Genetically-engineered cells
The PiggyBac™ transposon system with CBX3-UCOE ensures sustained transgene expression in iPSC-derived microglia, addressing the challenge of silencing and enabling time-controlled gene function studies during differentiation.
Patent Information
- Application Number
- PCT/EP2025/080891
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-10-24
- Filing Date
- 2025-10-24
- Publication Date
- 2026-04-30
AI Technical Summary
Current methods for genetically modifying human induced Pluripotent Stem Cells (iPSCs) to produce microglia face challenges in maintaining transgene expression during differentiation, leading to silencing and repression, which limits the ability to study gene function in a time-controlled manner and at different stages of microglia development.
The use of a PiggyBac™ transposon system flanked by a Ubiquitous Chromatin Opening Element (UCOE) nucleic acid sequence, specifically the CBX3-UCOE, to integrate and maintain expression of genes of interest in iPSC-derived microglia, allowing for controlled activation or repression of gene function during differentiation.
Enables sustained and controlled transgene expression in iPSC-derived microglia, facilitating the study of gene function at various stages of differentiation and providing a robust, rapid, and safe method for producing genetically engineered microglia.
Smart Images

Figure EP2025080891_30042026_PF_FP_ABST
Abstract
Description
[0001] Genetically-engineered Cells
[0002] Technical Field
[0003] The invention relates to methods for genetic manipulation and differentiation of iPSC cells to produce microglia comprising transposons containing a Ubiquitous Chromatin Opening Element (UCOE) nucleic acid sequence and a nucleic acid sequence encoding a gene of interest under control of a promoter, flanked by Piggybac™ transposon-specific inverted terminal repeat sequences PB 5’ ITR and PB 3’ ITR. The invention further relates to partially or fully mature microglia obtained by differentiation of iPSC cells comprising transposons comprising a Ubiquitous Chromatin Opening Element (UCOE) nucleic acid sequence and a nucleic acid sequence encoding a gene of interest under control of a promoter, flanked by Piggybac™ transposon-specific inverted terminal repeat sequences PB 5’ ITR and PB 3’ ITR and to uses of such cells.
[0004] Background to the Invention
[0005] US20200157567A1 describes a viral vector comprising a transposon and a nucleic acid encoding a transposase. The transposon comprises a transgene, or insertion site for a transgene, for integration into the genome of a target cell. The expression of the transposase is controlled such that the transposase is not expressed during production or packaging of the viral vector. Furthermore, the transposon comprises a packaging signal for the virus genome, thus preventing the packaging of any viral genome from which the transposon has been removed. Also disclosed are processes for producing a modified mammalian cell and for producing a mammalian cell with a modified genome, using a viral vector of the invention.
[0006] US 20220033845 A1 describes expression vectors for expressing recombinant proteins (e.g., biologies) in mammalian cells, host cells comprising the expression vectors, methods of producing the recombinant proteins, and methods of propagating the expression vectors.
[0007] AU2019250224B2 describes constructs and methods for expressing DNAs of interest in particular in non-primate eukaryotic host cells that display advantages with regard quantity and quality of expression including high stability of expression and transport of the expression product out of the cell.
[0008] WO2022104155A1 describes cells, tissues, organs, and / or animals having one or more modified genes for enhanced xenograft survival and / or tolerance. Also disclosed are methods of making and using the cells, tissues, organs, and / or animals having one or more of the modified genes.
[0009] EP2417263B1 describes compositions for the in vitro or in vivo production of specific proteins that comprise components of vectors, such as a vector backbone, a promoter, and a gene of interest that encodes for the protein of interest, and the transposon-based vectors comprising these components. Also described are methods of making these compositions and methods of using these compositions for the production of desired proteins in vivo or in transfected cells in vitro.
[0010] KR20210143897A describes matrix attachment regions (MARs), recombinant vector comprising the MAR, transformants transformed with the recombinant vector, and methods of culturing the transformant to produce a target protein.
[0011] W02020164702A1 describes a polypeptide comprising a transposase and at least one heterologous chromatin reader element (CRE), polynucleotide encoding the polypeptide and vector comprising the polynucleotide. An artificial transposable element comprising the polynucleotide can be targeted to active chromatin via a transposase coupled with a heterologous chromatin reader element.
[0012] Ackermann, M. et al. (2017) used genetically modified iPSC lines to address transgene stability during hematopoietic differentiation towards macrophages, using lentiviral vectors equipped with a CBX3-UCOE or ZFN-mediated targeting of an expression cassette into the human AAVS1 safe harbor to provide a tool for stable transgene expression in iPSCs and differentiated macrophages. Using different iPSC lines which expressed reporter genes either from randomly integrated lentiviral vector expression systems or the safe harbor AAVS1 allowed for the expression of reporter genes in pluripotent cells, as well as in macrophages derived therefrom, indicating their suitability to efficiently express therapeutic transgenes in iPSCs.
[0013] Muller-Kuller, U. et al. (2015) introduced a functional, 0.7 kb minimal CBX3-UCOE and constitutive or tissue-specific promoters to counteract epigenetic silencing of transgene expression in multipotent and pluripotent stem cells. In addition to preventing promoter silencing, the chromatin opening function of the CBX3-UCOE element was able to spread to adjacent heterologous DNA regions. This feature of the CBX3-UCOE was potentially of concern, as integrated CBX3-UCOE containing vectors could alter the chromatin status and therefore the expression pattern of cellular genes located nearby the integration site. The chromatin opening function of the endogenous CBX3 gene appeared to be centered at the promoter region and spanned a DNA region of approximately 1.5 kb, as defined by the transition from unmethylated to methylated DNA and the presence of active histone markers. Within the lentiviral vectors used, the distance of the CBX3-UCOE to the left border of the 5'-LTR was 1.7 kb, so in theory the minimal distance of cellular sequences to the CBX3-UCOE was beyond the distance covered by the chromatin opening effect of the element.
[0014] Skipper KA et al. (2019) used a core-fragment of the HNRPA2B1-CBX3 IICOE in a sleeping beauty transposon vector to modify CHO Cells and compared four different protective strategies in CHO-K1 cells, finding robust protection from silencing of transgene cassettes mediated by the ubiquitous chromatin-opening element (IICOE) derived from the HNRPA2B1-CBX3 locus. Using a bioinformatic approach, a shorter HNRPA2B1-CBX3 UCOE core fragment was defined and demonstrated to maintain transgene expression after extended passaging of CHO-K1 cells carrying DNA transposon vectors equipped with the shorter HNRPA2B1-CBX3-UCOE core fragment.
[0015] Microglia are the primary resident immune cells of the central nervous system (CNS) (Ramaswami et al., 2024). Microglia are myeloid cells that act as the first line of immune defence and constantly survey their environment and interact with other cells (neurons, astrocytes, oligodendrocytes and infiltrating immune cells) (Gao et al., 2023). During homeostasis, microglia regularly phagocytose cells and misfolded proteins. Furthermore, studies have shown that microglia have important functions in maintaining neuronal homeostasis by regulating synaptogenesis and synaptic pruning (Schafer & Stevens, 2015). Microglia also respond to CNS injury and disease with complex reactions, commonly called ‘activation’.
[0016] Dysregulation of microglial functions is heavily implicated on several neurodegenerative disorders, such as Parkinson’s disease (PD), Alzheimer’s disease, Amyotrophic Lateral Sclerosis (ALS), Multiple Sclerosis (MS), etc. Studying the role of microglia in health and disease is essential for the development of new and effective neurodegenerative disorder-related therapies.
[0017] Microglia research has undergone rapid exponential growth in the past 25 years. The advance in cellular models and genome editing has contributed to a more in-depth understanding of the roles of human microglia in health and disease (Gao et al., 2023). The use of human induced Pluripotent Stem Cells (h-iPSCs) and the development of microglia differentiation protocols have been particularly valuable in circumventing the issue of not being able to purify sufficient amounts of ex vivo human microglia from brain tissue to perform multifaceted experiments. iPSCs have provided an ‘unlimited’ source to produce biologically relevant human microglia. Moreover, since iPSCs are amenable to genetic manipulation, it has been possible to interrogate gene to microglial function processes.
[0018] Studies involving human microglia have been hampered by technical difficulties related to their isolation / derivation in sufficient quantities, the inability to expand their numbers in vitro, and the difficulty of genetically modifying the cells. IPSCs can be easily genetically modified via viral and non-viral vectors, and then used to produce differentiated cells in large quantities. However, upon differentiation from iPSC to partially or fully mature cells, transgene expression from currently-used vectors often undergoes strong or complete transcriptional silencing / repression. Thus, there is a need for vectors that permit the controlled or persistent expression of the transgenes from the iPSC through to the mature microglia stages.
[0019] Most genetic manipulation approaches to study microglial function using iPSCs as a source are carried out at the ‘iPSC / Stem cell stage’. This means, that gene knock outs are produced in the iPSC cells; and then these cells are differentiated into microglia. Multiple studies have looked at the effect of the gene / protein receptor Triggering receptor expressed on myeloid cells 2 (TREM2) by using this approach (McQuade et al., 2020; Reich et al., 2021). These studies have shown that TREM2 ablation during the differentiation of iPSC-cells to microglia leads to a decrease in microglia survival, as well as a decrease in the phagocytic capacity of microglia when it comes to amyloid beta-related substrates. While this approach has shed a light on the role of TREM2 in microglia, it does not permit the interrogation of TREM2’s role in a time and I or dose-dependent manner, for example, hitherto it has is not possible to investigate what happens when TREM2 is lost in fully differentiated microglia or to emulate or predict the effect of using a TREM2 blocking antibody as a therapeutic agent.
[0020] The purpose of this invention is to allow for the interrogation of gene function (either by activation or repression) in a time-controlled manner. The invention allows for the study of a gene’s role at the iPSC level (role of the gene during the microglia differentiation process), as well as the gene’s role at a later stage (when microglia are fully differentiated). Statements of Invention
[0021] The invention provides:
[0022] 1. A partially or fully differentiated iPSC-derived microglia cell comprising a transposon comprising a Ubiquitous Chromatin Opening Element (UCOE) nucleic acid sequence, a nucleic acid sequence of a gene of interest or a fragment thereof and optionally a 3’ polyadenylation sequence under control of a promoter, wherein the transposon is flanked by transposon-specific inverted terminal repeat sequences 5’ ITR and 3’ ITR, preferably the transposon is flanked by PiggyBac™ transposon-specific inverted terminal repeat sequences PB 5’ ITR and PB 3’ ITR.
[0023] 2. A partially or fully differentiated iPSC-derived microglia cell of clause 1, wherein the UCOE is a CBX3-UCOE nucleic acid sequence that precedes CBX3.
[0024] 3. A partially or fully differentiated iPSC-derived microglia cell of clause 1 or clause 2, wherein the UCOE is a nucleic acid sequence of SEQ ID NO: 1.
[0025] 4. A partially or fully differentiated iPSC-derived microglia cell, wherein the transposon-specific inverted terminal repeat sequences are PB 5’ ITR (SEQ ID NO: 2) and PB 3’ ITR (SEQ ID NO: 3).
[0026] In the transposon nucleic acid sequence, the nucleic acid sequence of the gene of interest is preceded by a promoter sequence for expression of the gene of interest and the promoter sequence is preceded by a UCOE nucleic acid sequence. In some embodiments the nucleic acid sequence of the gene of interest is operably linked to a nucleic acid sequence encoding a fluorescent protein gene for selection and I or detection of expression of the gene of interest, and I or, the nucleic acid sequence of the gene of interest is operably linked to a nucleic acid sequence encoding a selectable marker gene (such as an antibiotic resistance gene) for selection of a cell expressing the gene of interest. In some embodiments the gene of interest is operably linked to a nucleic acid sequence encoding a fluorescent protein gene, such as a nucleic acid sequence encoding eGFP (enhanced green fluorescent protein) for selection and I or detection of expression of the gene of interest. In some embodiments the nucleic acid sequence of the gene of interest is followed by nucleotide sequence that encodes a peptide that mediates ribosome skipping (e.g., the T2A self-cleaving peptide sequence that mediates ribosome skipping to produce multiple proteins from a single mRNA transcript) and then followed by a nucleic acid sequence encoding a fluorescent protein gene, such as a nucleic acid sequence encoding eGFP (enhanced green fluorescent protein) and I or nucleic acid sequence encoding a selectable marker; in some embodiments this is further followed by a nucleic acid sequence encoding a polyadenylation signal. In some embodiments the nucleic acid sequence of the gene of interest is followed by nucleic acid sequence that encodes a peptide that mediates ribosome skipping (e.g., the T2A self-cleaving peptide sequence) and then by a nucleic acid sequence encoding a fluorescent protein gene (e.g., eGFP) and then further by a nucleic acid sequence encoding a polyadenylation signal. In preferred embodiments, the transposon comprises nucleic acid sequences (in order) for: IICOE, promoter, gene of interest, peptide that mediates ribosome skipping (e.g., the T2A selfcleaving peptide sequence), fluorescent protein gene (e.g., eGFP) and polyadenylation signal. In some embodiments, such as those described above and elsewhere herein, a preferred gene of interest is a dCas9-KRAB nucleic acid sequence (e.g., a dCas9-KRAB nucleic acid sequence of SEQ ID NO: 4).
[0027] 5. A partially or fully differentiated iPSC-derived microglia cell of any preceding clause wherein the promoter, gene of interest or fragment thereof and optionally 3’ polyadenylation sequence are comprised within an expression cassette.
[0028] An expression cassette is a DNA construct that includes a gene and its regulatory sequences, enabling a cell to express the gene and produce a protein encoded thereby. An expression cassette typically comprises nucleic acid sequence for a promoter, the gene of interest, and a terminator or polyadenylation signal.
[0029] 6. A partially or fully differentiated iPSC-derived microglia cell of any preceding clause wherein the expression cassette comprises:
[0030] i. (a) a promoter,
[0031] (b) at least one cloning site (restriction enzyme cleavage site) or a multiple cloning site downstream of the promoter,
[0032] (c) a gene of interest downstream of and operably linked to the promoter,
[0033] (d) a polyadenylation sequence positioned downstream of and operably linked to the gene of interest,
[0034] (e) optionally an internal ribosome entry site,
[0035] (f) optionally a second promoter sequence positioned downstream of the gene of interest and polyadenylation sequence,
[0036] (g) optionally a fluorescent protein sequence positioned downstream of the second promoter, (h) a self-cleaving peptide sequence,
[0037] (i) optionally a gene for selection, e.g., for antibiotic selection,
[0038] (j) optionally a fluorescent protein gene, and
[0039] (k) optionally a second polyadenylation sequence; or,
[0040] ii (a) a promoter,
[0041] (b) optionally, at least one cloning site (restriction enzyme cleavage site) or a multiple cloning site downstream of the promoter,
[0042] (c) a gene of interest downstream of and operably linked to the promoter,
[0043] (d) a polyadenylation sequence positioned downstream of and operably linked to the gene of interest,
[0044] (e) optionally an internal ribosome entry site,
[0045] (f) optionally a second promoter sequence positioned downstream of the gene of interest and polyadenylation sequence,
[0046] (g) optionally a fluorescent protein sequence positioned downstream of the second promoter, (h) a self-cleaving peptide sequence,
[0047] (i) optionally a gene for selection, e.g., for antibiotic selection,
[0048] (j) optionally a fluorescent protein gene, and
[0049] (k) optionally a second polyadenylation sequence.
[0050] 7. A partially or fully differentiated iPSC-derived microglia cell of clause 6 wherein the expression cassette comprises:
[0051] i. (a) a CAG promoter,
[0052] (b) a multiple cloning site downstream of the promoter,
[0053] (c) a gene of interest downstream of and operably linked to the promoter, optionally wherein the gene of interest is a dCas9-KRAB sequence of SEQ ID NO: 4 (a dead / deactivated Cas9 with the repression domains and a nuclear localisation signal sequence),
[0054] (d) a T2A self-cleaving peptide sequence (SEQ ID NO: 5) positioned downstream of the gene of interest, e.g., dCas9-KRAB sequence of SEQ ID NO: 4, and
[0055] (e) a fluorescent protein gene sequence encoding eGFP (enhanced green fluorescent protein) positioned downstream of the T2A self-cleaving peptide sequence (SEQ ID NO: 5),
[0056] (f) an rBG polyadenylation sequence; or,
[0057] ii. (a) a CAG promoter,
[0058] (b) optionally a multiple cloning site downstream of the promoter, (c) a gene of interest downstream of and operably linked to the promoter, optionally wherein the gene of interest is a dCas9-KRAB sequence of SEQ ID NO: 4 (a dead / deactivated Cas9 with the repression domains and a nuclear localisation signal sequence),
[0059] (d) a T2A self-cleaving peptide sequence (SEQ ID NO: 5) positioned downstream of the gene of interest, e.g., dCas9-KRAB sequence of SEQ ID NO: 4, and
[0060] (e) a fluorescent protein gene sequence encoding eGFP (enhanced green fluorescent protein) positioned downstream of the T2A self-cleaving peptide sequence (SEQ ID NO: 5),
[0061] (f) an rBG polyadenylation sequence.
[0062] In some embodiments the gene of interest is inserted into the single cloning site or into a site within the multiple cloning site. In some embodiments the single cloning site or multiple cloning site is present in addition to the gene of interest.
[0063] 8. A partially or fully differentiated iPSC-derived microglia cell of any preceding clause comprising a vector comprising the transposon, preferably wherein the vector is a PiggyBac™ vector, such as a plasmid vector of SEQ ID NO: 6.
[0064] 9. A partially or fully differentiated iPSC-derived microglia cell of any one of clauses 1 to 8, optionally comprising a second vector capable of expressing a transposase, preferably wherein the transposase is a PiggyBac™ transposase, (e.g., Super PiggyBac™ transposase plasmid vector of SEQ ID NO: 7).
[0065] 10. A partially or fully differentiated iPSC-derived microglia cell of any one of clauses 1 to 9, wherein the transposon (comprising the expression construct optionally comprising the transgene) is integrated into the cell genome.
[0066] 11. A partially-differentiated iPSC-derived microglia cell according to any one of clauses 1 to 10.
[0067] 12. A fully differentiated iPSC-derived microglia cell according to any one of clauses 1 to 10.
[0068] 13. A partially or fully differentiated iPSC-derived microglia cell according to any one of clauses 1 to 12 wherein differentiation status is assessed by using a panel of flow cytometry markers.
[0069] 14. A method for:
[0070] (a) preventing silencing of a gene of interest (transgene), (b) promoting expression of a gene of interest,
[0071] (c) expressing a product of a gene of interest, and I or
[0072] (d) expressing a larger (> 7.0 Kb) expression cassette,
[0073] comprising culturing a cell according to any one of clauses 1 to 13.
[0074] 15. A method for:
[0075] (a) preventing silencing of a gene of interest (transgene) and I or
[0076] (b) maintaining expression of a gene of interest during differentiation,
[0077] comprising culturing a cell according to any one of clauses 1 to 13 in the presence of a differentiation stimulus.
[0078] 16. A method for knockdown (downregulation) of expression of a target gene comprising culturing a cell according to any one of clauses 1 to 13 comprising dCas9-KRAB (as the gene of interest) in the presence of the target gene-directed gRNA (e.g., delivered via lentiviral vector, such as a vector of SEQ ID NO: 8 into which the target gene-directed guide RNA (gRNA) of interest is cloned). For the avoidance of doubt, dCas9-KRAB is not the target gene.
[0079] 17. A composition comprising a cell of any one of clauses 1 to 13 and a carrier.
[0080] 18. A composition comprising a cell of any one of clauses 1 to 13 and a vector capable of expressing transposase.
[0081] 19. A gene transfer system comprising a cell of any one of clauses 1 to 13 and a transposase.
[0082] 20. A gene transfer system of clause 19, wherein the transposase is a Piggybac™ transposase.
[0083] 21. A method for modulating expression of a gene of interest in a cell, comprising
[0084] (a) providing a cell of any one of clauses 1 to 13,
[0085] (b) introducing a vector encoding a transposase, preferably a Piggybac™ transposase to the cell and
[0086] (c) introducing a vector containing a guide RNA capable of controlling the expression of the target gene to the cell. 22. A method for integrating a gene of interest into the genome of a microglial cell comprising contacting a cell with the gene transfer system of clause 19 or 20, thereby integrating the gene of interest into the cell.
[0087] 23. A method for knockdown (downregulation) of a target gene in a cell comprising contacting a cell with the gene transfer system of clause 19 or 20 thereby to introduce and integrate dCas9-KRAB and introducing a gRNA (preferably delivered via lentiviral vector) to the cell to knockdown expression of the target gene.
[0088] 24. A method of using or a use of cells, compositions, systems or methods of the invention according to any one of clauses 1 to 23:
[0089] (a) for interrogation of gene function (either by activation or repression) in a time-controlled manner,
[0090] (b) for the study of the role of a gene at the iPSC level (role of the gene during the microglia differentiation process),
[0091] (c) for the study of as the role of the gene at a later stage (when microglia cells are mature), (d) for the screening of a library of compounds on microglia cells edited to repress a target gene.
[0092] Detailed Description of the Invention
[0093] The invention permits the interrogation of gene function (either by activation or repression) in a time-controlled manner. The invention allows for the study of the role of a gene at the iPSC level (role of the gene during the microglia differentiation process), as well as the role of the gene at a later stage (once microglia cells are mature).
[0094] Most existing technology performs CRISPR / Cas9 knock out (KO) at iPSC level. TREM2 KO iPSC lines have been produced by nucleofecting human iPSC cells with ribonucleoprotein (RNP) complexes formed by HiFiCas9 Nuclease and TREM2 crRNA:tracRNA. Cells are then plated in single cell fashion to obtain clonal colonies. Genomic DNA is extracted for some of these clonal colonies to test by PCR and sequencing whether there could be a potential TREM2 KO. Clones are then differentiated to microglia and TREM2 KO is confirmed at the microglia level by cell surface staining and flow cytometry. These approaches have a TREM2 KO during the whole differentiation process: from iPSCs (stem cell level) to microglia. One research group has taken an approach in which they have generated dCas9-KRAB (CRISPR inhibition) and dCas9-VPR (CRISPR activation) containing iPSC lines. Then, they further modify the iPSC lines to enforce the expression of 6 transcription factors and direct differentiation of iPSCs to microglia this way (Drager et al., 2022). Single gRNAs targeting specific genes are delivered at the iPSC level. This approach also has the caveat of having a genetic knock down during the transcription factor enforced differentiation process. To circumvent this issue, the group developed an iPSC line that adds DHFR degron domains to make the CRISPRi and CRISPRa machinery inducible. The CRISPRi cassette is flanked on both the N and the C termini with dihydrofolate reductase (DHFR) degrons. In the absence of the small molecule trimethoprim (TMP), DHFR degrons cause proteasomal degradation of fused proteins. Addition of TMP stabilizes the degron-tagged CRISPRi machinery. (The same principle applies to their CRISPRa machinery). These systems enable flexible timing of the onset of gene perturbation in cells already expressing sgRNAs. This feature is particularly important for experiments in microglia: it enables lentiviral delivery of sgRNAs to occur in iPSCs, which are much more amenable to lentiviral infection than microglia, without prematurely affecting genes that may be relevant for differentiation. The drawbacks of the approaches used in this publication, however, are that the iPSC-differentiation process is enforced by transcription factors and has been deemed very artificial when compared to other longer small molecule differentiation protocols that aim to recapitulate microglia formation following the embryonic developmental waves of microglia emergence.
[0095] A clonal iPSC line was derived that expresses a deactivated Cas9 with a KRAB domain (Kruppel associated box repressor domain) and a reporter (eGFP: enhanced green fluorescent protein) to repress gene expression (CRISPRi / CRISPR inhibition system). We also derived a clonal iPSC line that expresses a deactivated Cas9 with a VPR domain (VP64, p65 and RTa activator domains). This system is a CRISPRa / CRISPR activation system. The approach to deliver gRNAs was different to previous approaches. In contrast to traditional approaches, a lentiviral vector (LV-UCOECBX3- U6gRNA-mTagBFP2) containing a CBX3 IICOE sequence upstream of a U6 promoter was used to drive the expression of the sgRNA. A separate promoter was used to drive the expression of an mTagBFP2 reporter and a puromycin resistance gene. This small cargo, containing the IICOE, was successfully delivered at the iPSC (stem cell level) and at the microglia level (fully- differentiated cell level). This feature allows gene activation or downmodulation to be introduced at the microglia level without prematurely affecting genes that may be relevant for differentiation. Microglial cells of the invention may be partially or fully differentiated microglia cells, markers for differentiation of microglia include at least expression of at least TMEM119, TREM2, P2RY12, MERTK, CX3CR1, CD45, CD115. Discriminating, or microglia-specific, markers are reported to include Tmeml 19, P2ry12, Hexb, Feris, SalH, C1q, Gpr34, Olfml3, Mertk, Prosl, Tyro3, and Tgfbrl. Tmeml 19 has been proposed to be a highly specific marker of mature microglia.
[0096] Microglia cells of the invention are useful in research, drug discovery and development, for example in methods of screening, such as CRISPR screening, to identify novel targets, or in screening for antibody or small molecule inhibitors of a target gene. Transposons, expression cassettes, vectors, cells, compositions, gene transfer systems and methods of the invention may be used in selection of lead candidate molecules, in target validation for large and small molecules, in biology, safety and toxicological studies.
[0097] Transposons, expression cassettes, vectors, cells, compositions, gene transfer systems and methods of the invention may be used in biomarker discovery.
[0098] Transposons, expression cassettes, vectors, cells, compositions, gene transfer systems and methods of the invention may be used in cell therapy, for example in CRISPR knock down of HLA of iPSC, to provide universal-HLA-silent knockdown cells.
[0099] Transposons, expression cassettes, vectors, cells, compositions, gene transfer systems and methods of the invention may be used in autologous iPSC gene editing to engineer a subject’s cells, prior to administration of engineered cells back to patient.
[0100] The invention provides a safe, robust, and rapid approach to produce genetically engineered iPSC-microglia via a modified transposon-based vector that ensures sustained transgene expression.
[0101] Sustained transgene expression in iPSC-differentiated cells can be achieved through a targeted gene engineering approach using Zinc Finger Nucleases, TALENs or CRISPR / Cas9 that allows for transgene integration into safe harbor loci, such as the AAVS1 locus23. Although this method is safe (it introduces transgene into one site in the genome that is known), and robust; there are three main disadvantages: 1) it is very time-consuming as the efficiency of introducing a transgene into one site means a lower efficiency of successful genetic engineering. 2) Introducing large transgenes / DNA fragments significantly reduces the efficiency of this approach. 3) There is a limit to how many transgenes can be inserted into the genome in one round of targeting (this approach does not allow for bigger, more sophisticated multi-transgene approaches, for example, inserting a library of sgRNAs for a genome wide-CRISPR Based screen).
[0102] One way to enable sustained transgene expression in a random integration fashion is the use of lentiviral vectors equipped with elements that are able to actively remodel the local chromatin environment and activate transcription such as ubiquitous chromatin opening elements (UCOEs). Viral vectors containing a 1.5 kb methylation-free CpG island from the human HNRPA2B1-CBX3 housekeeping genes (A2LICOE) or a minimal 0.7 kb sequence encompassing the CBX3 gene only, are able to prevent transgene silencing and variegation in cell lines, multipotent and pluripotent stem cells, and their differentiated progeny (macrophages included). This approach circumvents the disadvantage of not being able to insert several transgenes / DNA fragments / libraries in one round of targeting. It also decreases the time needed to generate genetically modified iPSC lines. However, the main disadvantages of this approach are twofold: lentiviral vectors have a genetic cargo limit, preventing the introduction of large transgenes / fusion gene sequences and laboratories need to have specialized biohazard containment procedures for viral packaging and viral-based gene delivery.
[0103] Vectors based on DNA transposons such as PiggyBac™ or Sleeping Beauty (SB) are effective non-viral tools for gene therapy and genetic engineering of cells. These vectors provide a safer, faster, and less costly approach to generate genetically modified iPSC lines, than their viral counterparts. This is because there is no need to package virus, nor the need of cumbersome quality-assurance procedures, such as titration of vectors and testing for replication-competent virus. This method only involves the manipulation of plasmids, so it can be easily performed in a biosafety level 1 / 2 laboratory with basic equipment, without requiring complex biohazard containment procedures. Moreover, it has been reported that PiggyBac™ and SB transposon-based gene transfer is considered a safer tool when compared with viral tools due to their integration pattern. Another advantage is that these vectors do not have a cargo limit, circumventing the problem of not being able to insert large transgenes into the host’s genome.
[0104] Promoter DNA methylation and a near-random integration profile of transposon based-systems often results in transgene integration into heterochromatin, which renders such vectors vulnerable to transcriptional repression / silencing (Skipper et al., 2019, ibid) . Therefore, we reasoned that to secure persistent transgene expression it may be necessary to protect transposon-embedded transgenes with anti-transcriptional silencing elements. We hypothesized that integrating the minimal 0.7 kb sequence encompassing the CBX3 gene in a PiggyBac™ vector could present a tool for the genome editing of iPSCs that would allow for sustained transgene expression in differentiated progeny, such as macrophages.
[0105] The PiggyBac™ Transposon System (System Biosciences (SBI), Palo Alto, California, USA; Hera BioLabs, Inc. Lexington, Kentucky, USA) consists of a PiggyBac Vector (a PiggyBac transposon plasmid that contains the DNA to be inserted) and a PiggyBac transposase helper plasmid that provides the transposase enzyme, Super PiggyBac Transposase which recognizes transposon-specific inverted terminal repeats (ITRs) and efficiently integrates the ITRs and intervening DNA into the genome at ttaa sites. The Super PiggyBac Transposase is delivered to the cell via the Super PiggyBac Transposase Expression Vector (SEQ ID NO: 7), which is co-transfected with one or more PiggyBac Vectors. The PiggyBac Transposon System uses a cut-and-paste mechanism to transfer DNA from the PiggyBac Vector into the genome.
[0106] The present invention uses the transposon machinery of the “ttaa” specific PiggyBac® transposons to insert a targeted functional heterologous DNA sequence (gene of interest) into the genome of the host cell and uses a CBX3 UCOE to prevent silencing of expression of the gene of interest. The resulting transformed cell or group of cells are stable transformants that will pass the introduced gene to all subsequent progeny. The targeted functional heterologous DNA “gene of interest” for purposes of this invention is any heterologous DNA capable of being expressed in a host cell.
[0107] The transformation system of the present invention includes a vector that includes the modified piggyback - CBX3 UCOE transposon (PB-UCOECBX3 transposon), the vector may include a marker construct, such as the enhanced green fluorescent protein gene (eGFP) operably linked to a suitable promoter. This vector can be used to transform and detect transgenic organisms based on expression of the marker, e.g., green fluorescent protein marker under ultraviolet light. After chromosomal integration and inheritance of the vector, expression of the marker will occur in all progeny cells. The transformation system of the present invention also includes a PiggyBac transposase vector. The creation of a transformed cell requires that the vector containing the functional heterologous DNA first be physically placed within the host cell. A variety of transformation techniques may be used to introduce the vector DNA into a cell. The DNA sequence flanked by the transposon inverted repeats will be inserted into the genome of the cells. This DNA will then be passed on to the progeny cells. Transformed cells can be selected from untransformed cells, for example by ultraviolet light when the transformation system includes an enhanced green fluorescent protein gene that produces an altered visible phenotype under ultraviolet light. Using standard techniques known to those familiar with the field, techniques such as, for example, Southern blotting and polymerase chain reaction, DNA can be isolated from transformed cells to confirm that the introduced DNA has been inserted.
[0108] To our knowledge, this invention represents the first time that genetically engineered human iPSC-derived microglia have been produced using a PiggyBac system containing a UCOE CBX3 sequence to produce genetically modified iPSC lines that are differentiated into microglia. The integration of the minimal 0.7 kb UCOE CBX3 sequence in a PiggyBac vector and use to transform iPSCs, allows production of human genetically-engineered microglia in a reduced-time frame when compared to prior art methods. The vectors employed in the invention prevent silencing of transgenes in differentiated cells from iPSCs (microglia).
[0109] List of Figures
[0110] Figure 1: dCas9-KRAB-eGFP Cassette. The dCas9-KRAB-eGFP plasmid PB-UCOE-dCas9KRAB-eGFP (PLASMID SEQ ID NO: 6) is a PiggyBack™ (PB) plasmid comprised of 2 flanking Inverse tandem repeats (PB 3’ ITR and PB 5’ ITR, respectively), a ubiquitous chromatin opening element (UCOE) upstream a CAG Promoter and the dead Cas9 sequence with the KRAB repressor domain sequence (dCas9-KRAB (NS)) (Hybrid construct consisting of the cytomegalovirus (CMV) enhancer fused to the chicken beta-actin promoter cytomegalovirus, dCas9 KRAB (ns): dead Cas9 with the Kruppel associated box (KRAB) domain and nuclear signalling sequence). There is a self-cleaving peptide (T2A) followed by the Enhanced green fluorescent protein (eGFP) sequence. The rabbit betaglobin polyadenylation (rBG Poly(A)) sequence is positioned following the eGFP sequence.
[0111] Figure 2: iPSC -derived microglia have a heterogeneous morphology and have a good viability. A. Brightfield Images of iPSC-derived microglia derived from the dCas9-KRAB-eGFP line (20X). B. Representative flow cytometry dot-plots for cell viability. PI staining is represented on the X-axis.
[0112] Figure 3: iPSC-derived microglia from dCas9 -KRAB-eGFP line are eGFP+. Flow cytometry histograms representative for eGFP expression of one experiment for microglia from the parental line (control), unmodified (light grey outline) and for microglia from the dCas9-KRAB-eGFP line (black, solid).
[0113] Figure 4: iPSC-derived microglia express pan microglia and pan macrophage cell surface markers. Summary of viability (% of live cells) and pan-microglia cell-surface marker expression for dCas9-KRAB-GFP iPSC-derived microglia (n=3).
[0114] Figure 5: iPSC-derived microglia phagocytose Zymosan, E.coli and amyloid beta coated beads. dCas9-KRAB-eGFP microglia phagocytic activity using different substrates. Microglia were incubated with increasing concentrations of E.coli pHrodo beads, Zymosan pHrodo beads and amyloid beta coated pHrodo beads. The phagocytic capacity is measured as the average red intensity in green objects (eGFP+ microglia). pHrodo beads are transparent at neutral pH but fluoresce red when ingested by macrophages.
[0115] Figure 6: gRNA plasmid SEQ ID NO: 8 PL-22.0050 LV-UCOECBx3-pU6-stuffer-pEF1a-mTagBFP2-T2A-Puro-dWPRE. The gRNA plasmid is a lentiviral plasmid comprised of 2 flanking long tandem repeats (5’ LTR and 3’ LTR). There is a Rev-responsive element (RRE) sequence, followed by a central polypurine tract sequence (Cppt), a ubiquitous chromatin opening element (UCOE) upstream the U6 promoter and a stuffer sequence (into which the 20 nucleotide CRISPR gRNA of interest is cloned). There is a sgRNA scaffold sequence, a second promoter (EF1 -alpha) that drives the expression of an mTagBFP2 sequence. There is a T2A self-cleaving peptide sequence, a Puromycin resistance sequence, the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE). After the 3’ LTR, there is a SV40 polyadenylation signal sequence (SV40 Poly(A)).
[0116] Figure 7: TREM2 KD at the iPSC and iPSC-derived microglia level. A Experimental timeline of TREM2 knock down at the iPSC / Stem Cell level and phagocytosis measurement (top) and flow cytometry histogram for TREM2 expression (detected in the R670 / 30-A channel) representative of one experiment for microglia from the non-targeting e (control) line (darkest solid colour) and for microglia from the TREM2 gRNA containing iPSC line (semidark solid colour). Isotype control is in light-grey colour. B Experimental timeline of TREM2 knock down at the microglia level and phagocytosis measurement (top) and flow cytometry histogram for TREM2 expression (detected in the R670 / 30-A channel) representative of one experiment for microglia transduced with the non-targeting (control) gRNA (darkest solid colour) and for microglia transduced with the TREM2 gRNA (semi-dark solid colour). Isotype control is shown with a light-grey outline colour. Figure 8. TREM2 KD at the iPSC level and iPSC-microglia level causes an increase in the phagocytosis of Zymosan and E. coli beads. A iPSC level-. Compilation of phagocytic capacity of microglia from the non-targeting e (control) line (circles) and for microglia from the TREM2 gRNA containing iPSC line (triangles). Microglia were incubated with one concentration of E.coli pHrodo beads or Zymosan pHrodo beads. The phagocytic capacity is measured across time and is the average red intensity in green objects (eGFP+ microglia). B Microglia level: Compilation of phagocytic capacity of microglia transduced with the nontargeting e (control) gRNA (circles) and for microglia transduced with the TREM2 gRNA (triangles). Microglia were incubated with one concentration of E.coli pHrodo beads or Zymosan pHrodo beads. The phagocytic capacity is measured across time and is the average red intensity in green objects (eGFP+ microglia).
[0117] Figure 9. TREM2 KD at the iPSC level causes a decrease in the phagocytosis of amyloid beta beads, but TREM2 KD at the iPSC-level causes an increase in the phagocytosis of amyloid beta beads. A iPSC level-. On the left, compilation of phagocytic capacity of microglia from the non-targeting e (control) line (circles) and for microglia from the TREM2 gRNA containing iPSC line (triangles). Microglia were incubated with one concentration of amyloid beta-coated pHrodo beads. The phagocytic capacity is measured across time and is the average red intensity in green objects (eGFP+ microglia). On the right, statistical analyses comparing the area under the curve calculated from the red intensity over time plots across control and TREM2 KD treatments n= 4 or more. B Microglia level: On the left, compilation of phagocytic capacity of microglia transduced with the non-targeting (control) gRNA (circles) and for microglia transduced with the TREM2 gRNA (triangles). Microglia were incubated with one concentration of amyloid beta-coated pHrodo beads. The phagocytic capacity is measured across time and is the average red intensity in green objects (eGFP+ microglia). On the right, statistical analyses comparing the area under the curve calculated from the red intensity over time plots across control and TREM2 KD treatments n= 4. [* P < 0.05, ** P < 0.01]
[0118] Figure 10. TREM2 KD at the iPSC-derived microglia level decreases cell viability. A Experimental timeline of TREM2 knock down at the microglia level cell viability measurement in full media and upon removal of cytokines. B. Brightfield Images of iPSC-derived microglia transduced with the non-targeting (control) gRNA and for microglia transduced with the TREM2 gRNA (TREM2 KD) under full media condition, and under no-cytokine addition treatment. (20X). C. Cell viability evaluation at 96h after cytokine removal / full media change of microglia transduced with the non-targeting (control) gRNA (squares) and for microglia transduced with the TREM2 gRNA (triangles) (n=3).
[0119] Examples
[0120] Materials and Methods
[0121] Cell Culture
[0122] Human iPSC Maintenance
[0123] The human induced pluripotent stem cell (iPSC) line SFCi55 (parental control) was generated as described in (Yang et al., 2017). In brief, the SFCi55 iPSC line was originally generated using fibroblasts obtained from blood group O Rhesus negative individuals by R Biomedical under REC 1 / AL / 0020 ethical approval and programmed to iPSCs using Yamanaka factors on episomal vectors. The line has been confirmed to be pluripotent and have normal karyotype.
[0124] Human induced pluripotent stem cells (hiPSCs) from SFCi55 and all derivatives were cultured in mTESR™ Plus medium (Stem Cell Technologies, Cat #100-0276) on 0.5 pg / cm2vitronectin (Invitrogen, Cat#A31804) coated tissue culture treated 6-well plates. The cells were passaged routinely every 5-7 days using ReLeSR™ (Stem Cell Technologies Cat# 05872) ata 1:10-1:20 split ratio.
[0125] Genome-edited iPSC line derivation (PiggyBac)
[0126] Reactions of DNA-lipid complex were prepared by diluting 10pl Lipofectamin STEM (Thermofisher Cat# STEM00008) in 100pl of Opti-MEM™ (Gibco Cat #31985062). In a separate reaction, 2.5ug total DNA (2ug expression plasmid + 0.5ug transposase plasmid) was added to 100ul of Opti-MEM™. Both reactions were mixed 1:1 and then incubated for 10 minutes.
[0127] SFCi55 wild-type iPSC cells were washed once with PBS (without magnesium and calcium), followed by incubation with Accutase (Gibco, Cat# A1110501) for 3 minutes. 1ml of mTESR media was added and the cells were detached, centrifuged and counted. The cells were seeded at 1 x 104cells / well in a 6-well plate containing 2ml cloning medium: [(mTESR Plus medium supplemented with CloneR™2 (1:10, Stem Cell Technologies Cat# 100-0691)]. DNA-lipid complex (180ul) was then added to each well in a drop-wise manner, leaving one well as an un-transfected control. After 2 days, the medium was replaced with fresh cloning medium. From day 4 onwards the medium was replaced with mTESR Plus medium according to normal iPSC culture procedures. To sort genome edited cells, once expanding cells had reached desired confluency, they were detached using Accutase and sorted for the main GFP population by flow cytometry. Sorted cells were seeded into 96-well plates (1 cell per well), or into 10cm dishes at a density of 600 cells / dish, pre-coated with vitronectin and containing cloning medium. After 2 days the medium was replaced with fresh cloning medium. From day 4 onwards the medium was replaced with mTESR Plus according to normal iPSC culture procedures. On day 7, the colonies were picked and transferred to 24-well plates pre-coated with vitronectin, and expanded for another ~7 days before being transferred to a 6-well plate using ReLeSR.
[0128] iPSC differentiation to microglia
[0129] Differentiation of microglia was carried out using as base protocols the ones reported in (Lopez-Yrigoyen et al., 2018, 2019, 2020). Maintenance media on one confluent well of iPSCs in a 6-well plate was replaced with 1 ml of Mix1, which consisted of mTESR Plus (Stem Cell Technologies Cat#100-0276) supplemented with 50ng / ml of BMP4 (R&D Cat# 314-BP-050) , 50ng / ml of VEGF (R&D Cat# 293-VE-050 and 20ng / ml of SCF (Invitrogen Cat# PHC2111). Colonies were cut using a StemPro™ EZPassage™ tool (Invitrogen Cat#23181010) and transferred into two wells containing 2.5 ml of Mix1 cultured in Ultralow Attachment 6-well plates (Greiner, Cat# 657970) to induce embryoid body (EB) formation. After 2 days the medium was topped up with 500pl concentrated fresh Mix1 cytokines [(BMP4 (300 ng / ml), VEGF (300 ng / ml) and SCF (120 ng / ml)]. A full media change was performed on the EBs on day 4 by first collecting the EBs, letting them settle by gravity in a 50ml falcon tube and resuspending them in fresh Mix1 medium (3 ml / well). On day 6, tissue culture treated 6-well plates were coated with 1 ml / well of EmbryoMax® 0.1% Gelatin Solution (Merck, Cat# ES-006-B) for 30 minutes. The gelatin was then replaced with 3ml of Mix2 [(X-VIVO15 (Lonza, Cat# BE02-060F media supplemented with 100ng / ml of CSF1 (Biolegend, Cat# 574808), 25ng / ml IL-3 (Peprotech, Cat# 200-03), 1% Penicillin-Streptomycin (Gibco, Cat# 15140122), 2nM Glutamax (Gibco, Cat# 35050061) and 0.55Mm p-mercaptoethanol (Gibco Cat# 31350010)].
[0130] EBs were collected into a 50ml tube, and once settled at the bottom by gravity, they were resuspended in a small amount of Mix2 medium. 10-15 EBs were added per well to the gelatin-coated 6-well plate. Non-adherent macrophage precursor cells were harvested starting from 2-3 weeks after EB plating every 3-4 days for up to 3 months: Media from EB plates was collected and filtered using a 40pm cell strainer. EB plate was re-fed with 3ml of Mix 2 and returned to the incubator. Macrophage precursors were plated at a density of 3-4 x 105 cells / well in a Nunc-Upcell 6-well plate in microglia medium [Advanced DMEM / F-12 (Gibco Cat# 12634010) media supplemented with 25ng / ml of CSF1, 2nM Glutamaxand 1% Penicillinstreptomycin, 10ng / ml GM-CSF (Gibco Cat# PHC2013), 50ng / ml TGFp (Peprotech Cat# 100-21C) and 100ng / ml IL-34 (Peprotech Cat# 200-34 )]. Macrophage precursors in microglia medium were left for at least 7 days and up-to 14 days to mature into fully differentiated microglia. Media changes were performed every % days.
[0131] Flow Cytometry of iPSC-derived microglia
[0132] iPSC derived microglia in Nunc-up cell plates were incubated 4 min at 4 degrees Celsius and then dislodged from the vessels by pipetting using a P1000 pipette. Cells were counted and then spun at 200g for 3 min. If cell count was <107, cells were resuspended in 80pl FACS buffer [2% BSA 5mM EDTA] and FcR Blocking Reagent (20pl) for 10min on ice. Volume was adjusted then, so cells were at a density of 2x106cells / ml. Cells were added to a Il-bottomed 96-well plate at a density of 2x105cells / specimen (100pl). Corresponding conjugated antibodies and isotype controls were added to the wells and mixed gently, followed by incubation at 4°C in the dark for 30 min. FACS buffer (1 OOpI) was then added to each well, the plate was spun down at 200g for 3 min, and the supernatant was removed. 2 FACS buffer washes were carried out: 200ul of FACS buffer was added and plate was spun at 200g for 3 min. Cells were then resuspended in FACS buffer, and a viability dye was added (Propidium Iodide at a 1:1000 dilution). Flow cytometry was performed using a 6 Laser Fortessa flow cytometer and FACS Diva software.
[0133] Table 1. Antibodies and isotype controls
[0134] Antibody Isotype Fluorophore Dilution Cat# Source TMEM 119 Mouse lgG1 , K AF-647 1:40 FAB10313R R and D Mouse lgG1 - AF-647 1:200 IC002R R and D TREM2 Rat lgG2b APC 1:25 FAB17291A R and D Rat lgG2b - APC 1:50 IC013A R and D CD115 Rat lgG1 APC 1:40 347306 Biolegend Rat lgG1 - APC 1:40 400412 Biolegend P2RY12 Mouse lgG2a APC 1:80 392113 Biolegend CD33 Mouse lgG1 , K APC 1:20 366606 Biolegend MERTK Mouse lgG1 , K APC 1:40 367612 Biolegend CD11c Mouse lgG1 , K APC 1:50 301614 Biolegend CD206 Mouse lgG1 , K APC 1:40 321110 Biolegend CX3CR1 Rat lgG2b APC 1:20 341610 Biolegend CD45 Mouse lgG1 , K APC 1 / 20 304012 Biolegend
[0135]
[0136] CD163 Mouse lgG1 , K APC 1 / 100 333610 Biolegend CD169 Mouse lgG1 , K APC 1 / 100 346008 Biolegend CD11b Mouse lgG1 , K APC 1 / 200 301310 Biolegend Mouse lgG1 - APC 1 / 200 400122 Biolegend CD14 Mouse lgG2a, APC 1 / 200 301808 Biolegend K
[0137] Mouse lgG2a - APC 1 / 200 400220 Biolegend Mouse lgG2b - APC 1 / 100 400322 Biolegend Mouse lgG1 - APC 1 / 100 400120 Biolegend Mouse lgG1 - APC 1 / 100 400122 Biolegend
[0138]
[0139] Microglia bead phagocytosis assays.
[0140] iPSC derived microglia from the dCas9-KRAB 1.8 were plated 2-3 days before live imaging, at a density of 2x104per well of an imaging TC Treated 96 well plate (CellCarrier-96 Ultra Microplates, Perkin Elmer Cat# 6055300) in 100ul of microglia media: [Advanced DMEM / F-12 (Gibco Cat# 12634010) media supplemented with 25ng / ml of CSF1, 2nM Glutamax and 1% Penicillin-Streptomycin, 10ng / ml GM-CSF (Gibco Cat# PHC2013), 50ng / ml TGFp (Peprotech Cat# 100-21C) and 100ng / ml IL-34 (Peprotech Cat# 200-34 )]. For zymosan bead phagocytosis, on the day of the assay (48h / 72h after seeding), a vial of pHrodo™ Red Zymosan Bioparticles (Invitrogen Cat# P35364) were re-suspended in 1ml of PBS and vortexed thoroughly. Then, 1 ml was further diluted with 19ml of PBS (vortex thoroughly again). This gave an assay stock concentration of 50ug / ml. Beads were added to the microglia at a final concentration ranging from 0 to 25ug / ml. For E.coli bead phagocytosis, on the day of the assay (48h / 72h after seeding), a vial of pHrodo™ Red E.coli BioParticles (Invitrogen Cat# P35361) was re-suspended in 2ml of PBS and vortexed thoroughly. Then, 1 ml was further diluted with 19ml of PBS (vortexed thoroughly again). This gave an assay stock concentration of 50ug / ml. Beads were added to the microglia at a final concentration ranging from 0 to 25ug / ml.
[0141] For Ap42 bead phagocytosis, one day prior to the assay, 1mg of Ap42 (Ana Spec Cat AS-20276) was re-suspended in 1ml of PBS. Then, 4mg of Amidine Latex Beads (Thermo Fisher Cat # A37322) were re-suspended in 1ml of PBS. Beads were pelleted by centrifugation at 16,000 g for 5 min. PBS was aspirated and beads were then re-suspended in 400ul of PBS containing 1 mg / ml Ap42. Beads were incubated at 37°C overnight. On the day of the assay, Ap42 coated beads were spun down at 16,000 g for 5 min. Beads were re-suspended in 2ml of PBS. 1ml of Beads was centrifuged at 16,000 g for 5 min and re-suspended in a 0.2mg / ml pHrodo™ Red, SE solution (Thermo Fisher Cat# P36600). Beads were incubated for 1 h at room temperature in the dark. After the incubation, the beads were washed with PBS once. All beads were re-suspended in 2ml of PBS. 1ml was taken and further diluted with 19ml of PBS. This gave an assay stock concentration of: 50ug / ml. Beads were added to the microglia at a final concentration ranging from 0 to 25ug / ml. After the addition of beads to microglia, plate was immediately placed into the Incucyte S3 Live imaging system. Acquisition of 3 fields per well was carried out every 30min for 24h, at 20X magnification. Image Analyses were carried out using the Cell-by-Cell pipeline from Incucyte. Briefly, microglia were segmented based on size and morphology. Total red fluorescence in the microglia population per timepoint was taken as a first output. Then, the area under the curve was calculated per treatment and plotted for further statistical analyses.
[0142] Microglia viability assay
[0143] Transduced microglia were given a full media change after transduction. 3 days after transduction, some cells were taken for a flow cytometry viability test (Oh timepoint test), where 200,000 cells were stained in a 2% BSA PBS solution containing propidium iodide (1:1000) for 5 min. The remaining cells received a full media change, or a media change without TGFB cytokine, or a media change without CSF1, IL34, GM-CSF and TGFB). Cells were left under those conditions either 48h, 72h or 96h. The flow cytometry viability test was carried out at each time point. Viability was quantified as % of PI positive cells in the mTagBFP2+ population (mTagBFP2 marks cells containing either non-targeting control orTREM2 gRNA).
[0144] HEK293 Culture
[0145] Lenti-X HEK293T cells were purchased from Takara Clontech (Cat# 632180) and were cultured in Iscove’s Modified Dulbecco’s Medium: IMDM (Sigma Cat# I3390) supplemented with Glutamax (1:100) (Gibco Cat# 35050-038) and FBS (Thermofisher Cat no: 10500064) to a final concentration of 10%. Cells were passaged every 2 to 3 days at a ratio of 1:8 or 1:10 by washing once with PBS and using trypsin (Gibco Cat# 15050065).
[0146] Lentivirus preparation / packaging
[0147] 2.3x105HEK293T cells were plated in 1 ml of IMDM in a well of a 12 well plate (about 30% confluency). At 24 hours after plating, a media change was performed, and cells were transfected with desired lentiviral plasmid (transfer plasmid). Transfection reactions were prepared by mixing 100 pl of Opti-MEM® I Reduced Serum Medium without serum (Gibco Cat# 31985070), 250 ng of transfer plasmid, 750ng of pC-Pack2 (Cellecta Cat# CPCP-K2A) and 3 pl of Transit293 (Mirus Cat# MIR 2704) and incubating at room temperature for 25 minutes. Transfection reactions were added dropwise to the wells. At 24 hours after transfection media was replaced. Media with lentiviral particles was collected and stored at -80 °C.
[0148] Vpx-Viral like particles (VLPs) preparation
[0149] Vpx-containing VLPs were produced by transfection of HEK293T cells as described in the previous section. In this case, transfer plasmid is pSIV3+ (VLP Vpx+) (Negre etal., 2000).
[0150] Lentivirus transduction
[0151] Human iPSCs
[0152] An 80% confluent well of iPSCs was washed with PBS, followed by an incubation with 0.5 ml of Stempro-Accutase (Gibco Cat#A1110501) at 37 °C to detach the cells and get a single cell suspension. 1 ml of mTSER plus media was added, and cells were collected and counted. A total of 30,000 cells were seeded per well in a 6-well plate previously coated with vitronectin and containing 2 ml cloning medium (mTESR Plus medium supplemented with CloneR™2 (1:10) Stemcell Technologies Cat# 100-0691). Lentiviral particles were added dropwise to desired wells. Lentiviral particle volume was added calculating for an MOI of 10. Cells were incubated at 37 °C and 5 % CO2 for 2 days. A full media change was performed with cloning medium 48 hours after infection. Cells were then grown and passaged as described in the maintenance section.
[0153] Human iPSC-derived microglia
[0154] iPSC-derived microglia were seeded at a density of 2.5x105cells / ml in 1ml (12-well plate) or at 1.33x105cells / ml in 3ml (6-well plate) of microglia medium: [Advanced DMEM / F-12 (Gibco Cat# 12634010) media supplemented with 25ng / ml of CSF1, 2nM Glutamaxand 1% Penicillinstreptomycin, 10ng / ml GM-CSF (Gibco Cat# PHC2013), 50ng / ml TGFp (Preprotech Cat# 100-21C) and 100ng / ml IL-34 (Preprotech Cat# 200-34 )] 72h after seeding, microglia were transduced by adding Vpx-VLP particles produced in house and lentiviral particles, aiming for an MOI of 3 to 5.
[0155] Plasmid synthesis / cloning
[0156] The PL-22.003 PB-UCOE-dCas9-KRAB-eGFP plasmid (SEQ ID NO: 6) was designed in house and then synthesized from scratch by Vector builder.
[0157] The PL-22.0050 LV-UCOECBx3-U6gRNA-mTagBFP2 (SEQ ID NO: 8) was produced in house by cloning in the mTagBFP2 sequence by Gibson Assembly into base vector PL-21.0067 LV- UCOEcBX3-pU6-stuffer-pEF1a-eGFP-T2A-Puro-WPRE (SEQ ID NO: 9) which was designed in house but synthesised from scratch by Vector builder. Full plasmid sequences are provided.
[0158] Single gRNA cloning into PL-22.0050 LV-UCOECBx3-U6gRNA-mTagBFP2 (SEQ ID NO: 8) was done by all-in one digestion-ligation. LV-UCOEcBX3-U6gRNA-mTagBFP2 has a stuffer region which can be cleaved by TypellS restriction enzymes Aarl or PaqCI, leaving 5'-GTTG and GTTT-3' overhangs with which to ligate in sgRNA oligos. TypellS restriction enzymes allow for digestion of stuffer containing vector and ligation of annealed sgRNA oligos into cut vector at the same time.
[0159] sgRNA sequences were taken from the Weissman Lab CRISPRi and CRISPRa annotated libraries
[0160]
[0161] (htps: / / elifesciences.Org / articles / 19760 / figures#SD3 ) and ordered as DNA oligos with the adapters for cloning with PaqCI restriction enzyme.
[0162] sgRNA sequences
[0163] CRISPRi
[0164] SEQ ID NO: 10 NTC#1a tgtcgtgatgcgtagacgg (CRISPRa. v2 Weissman library)
[0165] SEQ ID NO: 11 NTC#3i gtgtgcaacctccgccgttg (CRISPRi. v2 Weissman library)
[0166] SEQ ID NO: 12 TREM2#1 (CRISPRi.v2 Weissman library) GTAAGATGAGCAGCCGGAG SEQ ID NO: 13 TREM2#2(CRISPRi.v2 Weissman library) AGGAGGGTGTGAAGAATAT SEQ ID NO: 14 TREM2#3 (CRISPRi.v2 Weissman library) GAGAAGGCATCACAGGGCA SEQ ID NO: 15 TREM2#4 (CRISPRi.v2 Weissman library) GCCCTGGGGTGAATTATGA
[0167] Oligo annealing and phosphorylation were carried out by setting the following reaction: 6.5 pL H2O, 0.5 pL 10x T4 DNA ligase buffer, 1 pL forward oligo (100 pM), 1 pL Reverse oligo (100 pM) and 1 pL T4PNK enzyme. Tubes were placed in a PCR machine with the following program: 37 °C for 30 min, 95 °C for 5 min, and then a temperature ramp down 0.1°C / s to 4°C. Annealed oligos were diluted to 200 pL with H2O and kept at 4 °C. The digestion and ligation of plasmid and annealed sgRNA oligos was carried out by setting the following reaction: 1 pL 10x CutSmart buffer, 1 pL diluted annealed oligos (+ H2O negative control), 100 ng plasmid, 1 pL 10 mM DTT, 1 pL 10 mM ATP, 0.5 pL PaqCI, 0.25 pL PaqCI Activator, 0.25 pL T4 ligase and H2O up to 10 pL. Reaction was then placed in a PCR machine and the following protocol was run: 6 cycles of (37°C - 5 min, 16°C - 5 min), then 1 cycle of 60°C for 5 min.
[0168] Ligated plasmids were then transformed into E.coli and plated on LB-Ampicillin plates and incubated at 30°C overnight. gRNA cloning was confirmed by Sanger Sequencing. Statistical analyses
[0169] Data were expressed as mean ± standard deviation (SD. Statistical tests that were used are indicated in figure legends and were performed using Graph Pad software version 6.0c. P-values <0.05 were considered statistically significant (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 , ns non-significant).
[0170] Example 1: Differentiation of dCas9 KRAB (CRISPRi machinery) expressing iPSCs into bona-fide iPSC-derived microglia.
[0171] CRISPR / Cas9 technology has transformed our ability to elucidate mammalian cell biology and represents a valuable tool to interrogate gene function in different settings. Large CRISPR-Cas9 based genetic screens have been conducted in cancer cell lines, rather than in more biological relevant systems, like healthy, differentiated macrophages. Deriving a clonal iPSC line that expresses Cas9 can facilitate large genetic screens in different cell types. Recently developed screens have used Cas9 systems that avoid the double strand cut to bypass cell toxicity effects, or other on-target effects such as allele loss, chromosomal abnormalities and p53 activation due to DNA damage response. An example of such system is CRISPR interference (CRISPRi). This system uses a deactivated / dead Cas9 (dCas9) that binds to the target genomic region with the same efficiency as Cas9 but cannot generate a double strand break. The dCas9 is fused to repressor domains, and when it uses a guide RNA, it targets the promoter region of a specific gene and drives its transcriptional repression, or knockdown. To our knowledge, there is one approach that has been successful in iPSC-differentiated cells so far (neurons and microglia)9’10, whereby a dCas9-KRAB iPSC line (CRISPRi system) was derived by targeting a safe harbour locus: CYBL. After the long genome editing cell line derivation process, the cells are differentiated into neurons or microglia (6 and 8 days respectively) by the genetic enforcement of transcription factors (an artificial differentiation system). Biologically relevant iPSC macrophage differentiation systems take an average of 4 weeks. This CYBL genome editing approach needs to be tested for silencing in longer differentiation protocols.
[0172] We pursued a different strategy. We derived a clonal line that expressed a deactivated Cas9 with a KRAB domain (Kruppel associated box repressor domain) and a reporter (eGFP: enhanced green fluorescent protein), using our UCOE-plasmid approach. Of note, it would be very difficult to package the dCas9-KRAB cassette into a virus, as the cargo size exceeds the 7kb recommended cargo to allow for good viral titers. To solve this problem, it has been proposed in the art that dCas9 protein be split into different domains and integrated inside the cells. This approach would involve co-infection of two cassettes and more cumbersome cell selection processes, plus it would still need a ubiquitous chromatin opening element in both cassettes to ensure transgene expression at differentiated cell states. We reasoned that the IICOE Piggy Bac system of the invention would allow for a dCas9-KRAB transgene, as well as a reporter, such as eGFP to be delivered into iPSC cells without the need for splitting any sequence. To avoid silencing of the reporter, we used a T2A self-cleaving peptide downstream the dCas9-KRAB sequence, so dCas9 KRAB and eGFP would be in the same transcript. The main features of this plasmid are: the two transposon-specific inverted terminal repeat sequences (PB 5’ ITR (SEQ ID NO: 2) and PB 3’ITR (SEQ ID NO: 3)), the 0.7kb CBX3 sequence just upstream of a CAG Promoter, multiple cloning sites, dCas9-KRAB (SEQ ID NO: 4), a dead / deactivated Cas9 with the repression domains and a nuclear localisation signal sequence (gene of interest), a T2A (self-cleaving peptide) (SEQ ID NO: 5) and eGFP (enhanced green fluorescent protein).
[0173] Human iPSCs were co-transfected with PB-UCOEcBX3-dCas9KRAB-GFP ((SEQ ID NO: 6) PL-22.003 PB-UCOECBX3-pCAG-dCas9-KRAB-T2A-eGFP-pA (CRISPRi plasmid)) and the plasmid containing the sequence for the Super PiggyBac-Transposase (SEQ ID NO: 7). One week after transfection, the cells were sorted based on GFP expression and they were seeded at a clonal density.
[0174] Human iPSCs containing the UCOEcBX3-dCas9KRAB-T2A-eGFP sequence (CRISPRi machinery) (Figure 1) were differentiated into microglia. Microglia produced were heterogeneous in morphology and had good viability (Figure 2). The dCas9-KRAB-GFP-engineered microglia expressed eGFP (Figure 3), so no silencing of the transgene occurred at this differentiated cell state.
[0175] Cell-surface marker expression in the dCAS9 KRAB iPSC-derived microglia was tested. Microglia expressed pan-microglia markers at comparable levels to those published in several publications (Chen et al., 2021; Washer et al., 2022). dCas9-KRAB-eGFP microglia expressed TMEM119, TREM2, P2RY12, CD33, MERTK, CD11c, CX3CR1, CD45, CD14, CD11b, CD115, CD163, CD169, CD206. (Figure 4). Furthermore, microglia from the dCas9 KRAB Line, were able to phagocytose pHrodo Zymosan™ beads, pHrodo E.coli beads and Amyloid-Beta (AB42-peptide) coated beads in a titratable manner (Figure 5). This shows that the expression of the CRISPRi machinery does not interfere with microglia pan-marker expression or the hallmark function of phagocytosis. Example 2: Gene downmodulation by sgRNA transduction at the iPSC (Stem cell level). TREM2 as proof of concept.
[0176] To test the functionality of dCas9-KRAB-GFP iPSC line, delivery of a sgRNA was required. A lentiviral vector (LV-UCOECBX3-U6gRNA-mTagBFP2) (Figure 6) was designed with the CBX3 IICOE upstream of a U6 promoter to drive the expression of a sgRNA. A separate promoter was used to drive the expression of an mTagBFP2 reporter and a puromycin resistance gene. iPSCs were reverse-transduced with different versions of the LV-UCOECBX3-U6gRNA: a non-targeting gRNA (NTC) and (TREM2 gene sgRNA) (Figure 7). Transduced and puromycin selected cells were differentiated into microglia. Microglia cells were then tested for TREM2 expression. Cells carrying the non-targeting gRNA expressed TREM2, while cells carrying the TREM2 sgRNA expressed low levels of TREM2 (comparable to isotype staining). This showed that the system was functional and that knock-down of genes in iPSC-derived microglia with sgRNA transduction at the iPSC level could be achieved.
[0177] Some studies have looked at the effect of the gene / protein receptor Triggering receptor expressed on myeloid cells 2 (TREM2) by knocking out TREM2 at the iPSC level (McQuade et al., 2020; Reich et al., 2021). These studies have shown that TREM2 ablation during the differentiation of iPSC-cells to microglia leads to a decrease in microglia survival, as well, as a decrease in the phagocytic capacity of microglia when it comes to amyloid beta-related substrates. We tested whether TREM2 knock down at the microglia level decreases cell viability, just like it has been reported for TREM2 KO at the iPSC level by others (McQuade et al., 2020). In this case, we observed that inhibiting TREM2 expression at the microglia level cause a decrease in viability (Figure 10). This feature is observed when microglia are cultured in full media, and when microglia are cultured in media without TGFB. TREM2 KD microglia are particularly more susceptible to the removal of cytokines from the culture media (Figure 10). All these observations agree to what is reported in TREM2 ablation studies at the iPSC / Stem Cell level.
[0178] We tested the phagocytic capacity of TREM2 KD microglia. Microglia containing the TREM2 sgRNA can phagocytose more Zymosan and E.coli beads (Figure 8). However, when it comes to amyloid beta coated beads, TREM2 sgRNA containing microglia phagocytose less when compared to microglia containing non-targeting control sgRNAs (Figure 9). This result is in line with what others published knocking out TREM2 at the iPSC level.
[0179] 1 Example 3: Gene downmodulation by sgRNA transduction at the microglia level. TREM2 as proof of concept.
[0180] In this example, the dCas9-KRAB-GFP iPSC line was differentiated into microglia. Microglia were transduced with control or TREM2 sgRNAs at 3 days after macrophage precursor stage of the differentiation protocol (Figure 7B). Microglia cells were then tested for TREM2 expression. Cells carrying the non-targeting gRNA expressed TREM2, while cells carrying the TREM2 sgRNA expressed lower levels of TREM2. This showed that the system was functional and that knock-down of genes in iPSC-derived microglia with sgRNA transduction at the microglia stage could be achieved. We tested the phagocytic capacity of our TREM2 KD microglia. Microglia containing the TREM2 sgRNA are able to phagocytose more Zymosan and E.coli beads (Figure 8B). When it comes to amyloid beta coated beads, TREM2 sgRNA containing microglia phagocytosed more when compared to microglia containing nontargeting control sgRNAs (Figure 9B). This is the opposite result to what we observed when TREM2 expression was downmodulated from the iPSC-level. It is also the opposite result to what other research groups report when knocking out TREM2 at the iPSC level. Our approach of abrogating TREM2 expression at the microglia level allows us to evaluate what happens when TREM2 is lost in fully differentiated microglia and to emulate / predict the effect of using a TREM2 blocking antibody as a therapeutic agent.
[0181] The effect of TREM2 downmodulation in a time-controlled fashion (acutely vs chronic) was previously assessed in a murine system. They used antisense oligonucleotides (ASOs) to address this question, since ASOs potently but transiently lower Trem2 throughout the brain. Late-stage ASO-mediated Trem2 knockdown significantly increased phagocytosis, reduced plaque deposition and attenuated microglial association around plaque. Changes in microglial gene signatures after ASO administration and phagocytosis indicate that microglia may be activated with short-term Trem2 reduction. This suggests that there is a time- and / or dosedependent role for TREM2 in mediating plaque deposition, phagocytosis and microglial responses. Loss of TREM2 function may be beneficial for microglial activation and plaque removal in an acute context (Schoch etal., 2021).
[0182] References
[0183] 1. Luo, Y. et al. Stable Enhanced Green Fluorescent Protein Expression After Differentiation and Transplantation of Reporter Human Induced Pluripotent. Stem Cells Trans Med 3, 821-835 (2014).
[0184] 2. Lopez-Yrigoyen, M., Fidanza, A., Cassetta, L., Axton, R. A., Taylor, A. H., Meseguer-Ripolles, J., Tsakiridis, A., Wilson, V., Hay, D. C., Pollard, J. W., & Forrester, L. M. (2018). A human iPSC line capable of differentiating into functional macrophages expressing ZsGreen: a tool for the study and in vivo tracking of therapeutic cells. Philosophical Transactions of the Royal Society B: Biological Sciences, 373(1750). https: / / doi.org / 10.1098 / RSTB.2017.0219 3. Lopez-Yrigoyen, M., Yang, C. T., Fidanza, A., Cassetta, L., Taylor, A. H., McCahill, A., Sellink, E., von Lindern, M., van den Akker, E., Mountford, J. C., Pollard, J. W., & Forrester, L. M. (2019). Genetic programming of macrophages generates an in vitro model for the human erythroid island niche. Nature Communications 2019 10:1, 10(1), 1-11. https: / / doi.org / 10.1038 / s41467-019-08705-0
[0185] 4. Ackermann, M. et al. Ex vivo Generation of Genetically Modified Macrophages from Human Induced Pluripotent Stem Cells. Transfusion Medicine and Hemotherapy 44, 135-142 (2017).
[0186] 5. Muller-Kuller, II. etal. A minimal ubiquitous chromatin opening element (IICOE) effectively prevents silencing of juxtaposed heterologous promoters by epigenetic remodeling in multipotent and pluripotent stem cells. Nucleic Acids Research 43, 1577-1592 (2015).
[0187] 6. Yant, S. R. etal. High-Resolution Genome-Wide Mapping of Transposon Integration in Mammals. Molecular and Cellular Biology 25, 2085-2094 (2005).
[0188] 7. Lopez-Yrigoyen, M., May, A., Ventura, T., Taylor, H., Fidanza, A., Cassetta, L., Pollard, J. W., & Forrester, L. M. (2020). Production and characterization of human macrophages from pluripotent stem cells. Journal of Visualized Experiments, 2020( 58). https: / / doi.Org / 10.3791 / 61038
[0189] 8. Barkal, A. et al. CD24 signalling through macrophage Siglec-10 is a target for cancer immunotherapy. Nature, 572, 392-396 (2019)
[0190] 9. Tian R. etal. CRISPR Interference-Based Platform for Multimodal Genetic Screens in Human iPSC-Derived Neurons. Neuron, 104(2):239-255 (2019)
[0191] 10. Drager, Nina etal. A CRISPRi / a platform in iPSC-derived microglia uncovers regulators of disease states Biorxiv, preprint (2022)
[0192] 11. Huang, Xinbo et al. A Light-Inducible Split-dCas9 System for Inhibiting the Progression of Bladder Cancer Cells by Activating p53 and E-cadherin. Front. Mol. Biosci 7: (2021)
[0193] 12. Skipper KA, Hollensen AK, Antoniou MN, Mikkelsen JG. Sustained transgene expression from sleeping beauty DNA transposons containing a core fragment of the HNRPA2B1-CBX3 ubiquitous chromatin opening element (UCOE). BMC Biotechnol. (2019).
[0194] 13. Negre, D., Mangeot, P. E., Duisit, G., Blanchard, S., Vidalain, P. O., Leissner, P., Winter, A. J., Rabourdin-Combe, C., Mehtali, M., Moullier, P., Darlix, J. L., & Cosset, F. L. (2000). Characterization of novel safe lentiviral vectors derived from simian immunodeficiency virus (SIVmac251) that efficiently transduce mature human dendritic cells. Gene Therapy 2000 7:19, 7(19), 1613-1623. https: / / doi.org / 10.1038 / sj.gt.3301292
[0195] 14. Yang, C. T., Ma, R., Axton, R. A., Jackson, M., Taylor, A. H., Fidanza, A., Marenah, L., Frayne, J., Mountford, J. C., & Forrester, L. M. (2017). Activation of KLF1 Enhances the Differentiation and Maturation of Red Blood Cells from Human Pluripotent Stem Cells. Stem Cells (Dayton, Ohio), 35(4), 886-897.
[0196] 15. Chen, S. W., Hung, Y. S., Fuh, J. L., Chen, N. J., Chu, Y. S., Chen, S. C., Fann, M. J., & Wong, Y. H. (2021). Efficient conversion of human induced pluripotent stem cells into microglia by defined transcription factors. Stem Cell Reports, 16(5), 1363-1380. https: / / doi.Org / 10.1016 / j.stemcr.2021.03.010
[0197] 16. Drager, N. M., Sattler, S. M., Huang, C. T. L., Teter, O. M., Leng, K., Hashemi, S. H., Hong, J., Aviles, G., Clelland, C. D., Zhan, L., Udeochu, J. C., Kodama, L., Singleton, A. B., Nalls, M. A., Ichida, J., Ward, M. E., Faghri, F., Gan, L., & Kampmann, M. (2022). A CRISPRi / a platform in human iPSC-derived microglia uncovers regulators of disease states. Nature Neuroscience, 25(9), 1149-1162. https: / / doi.org / 10.1038 / s41593-022-01131-4
[0198] 17. Gao, C., Jiang, J., Tan, Y., & Chen, S. (2023). Microglia in neurodegenerative diseases: mechanism and potential therapeutic targets. In Signal Transduction and Targeted Therapy (Vol. 8, Issue 1). Springer Nature, https: / / doi.org / 10.1038 / s41392-023-01588-0 18. Lopez-Yrigoyen, M., Fidanza, A., Cassetta, L., Axton, R. A., Taylor, A. H., Meseguer-Ripolles, J., Tsakiridis, A., Wilson, V., Hay, D. C., Pollard, J. W., & Forrester, L. M. (2018). A human iPSC line capable of differentiating into functional macrophages expressing ZsGreen: a tool for the study and in vivo tracking of therapeutic cells. Philosophical Transactions of the Royal Society B: Biological Sciences, 373(1750). https: / / doi.org / 10.1098 / RSTB.2017.0219 19. Lopez-Yrigoyen, M., May, A., Ventura, T., Taylor, H., Fidanza, A., Cassetta, L., Pollard, J. W., & Forrester, L. M. (2020). Production and characterization of human macrophages from pluripotent stem cells. Journal of Visualized Experiments, 2020(158). https: / / doi.Org / 10.3791 / 61038
[0199] 20. Lopez-Yrigoyen, M., Yang, C. T., Fidanza, A., Cassetta, L., Taylor, A. H., McCahill, A., Sellink, E., von Lindern, M., van den Akker, E., Mountford, J. C., Pollard, J. W., & Forrester, L. M. (2019). Genetic programming of macrophages generates an in vitro model for the human erythroid island niche. Nature Communications 2019 10:1, 10(1), 1-11. https: / / doi.org / 10.1038 / s41467-019-08705-0
[0200] 21. McQuade, A., Kang, Y. J., Hasselmann, J., Jairaman, A., Sotelo, A., Coburn, M., Shabestari, S. K., Chadarevian, J. P., Fote, G., Tu, C. H., Danhash, E., Silva, J., Martinez, E., Cotman, C., Prieto, G. A., Thompson, L. M., Steffan, J. S., Smith, I., Davtyan, H., ... Blurton-Jones, M. (2020). Gene expression and functional deficits underlie TREM2-knockout microglia responses in human models of Alzheimer’s disease. Nature Communications 2020 11:1, 11(1), 1-17. https: / / doi.org / 10.1038 / s41467-020-19227-5
[0201] 22. Ramaswami, G., Yuva-Aydemir, Y., Akerberg, B., Matthews, B., Williams, J., Golczer, G., Huang, J., Al Abdullatif, A., Huh, D., Burkly, L. C., Engle, S. J., Sehgal, A., Sigova, A. A., Fremeau, R. T., Liu, Y., & Bumcrot, D. (2024). Transcriptional characterization of iPSC-derived microglia as a model for therapeutic development in neurodegeneration. Scientific Reports, 14(1). https: / / doi.Org / 10.1038 / S41598-024-52311 -0
[0202] 23. Reich, M., Paris, I., Ebeling, M., Dahm, N., Schweitzer, C., Reinhardt, D., Schmucki, R., Prasad, M., Kochi, F., Leist, M., Cowley, S. A., Zhang, J. D., Patsch, C., Gutbier, S., & Britschgi, M. (2021). Alzheimer’s Risk Gene TREM2 Determines Functional Properties of New Type of Human iPSC-Derived Microglia. Frontiers in Immunology, 11, 617860. https: / / doi.org / 10.3389 / FIMMU.2020.617860 / BIBTEX
[0203] 24. Schafer, D. P., & Stevens, B. (2015). Microglia Function in Central Nervous System Development and Plasticity. Cold Spring Harbor Perspectives in Biology, 7(10), a020545. https: / / doi.Org / 10.1101 / CSHPERSPECT.A020545
[0204] 25. Schoch, K. M., Ezerskiy, L. A., Morhaus, M. M., Bannon, R. N., Sauerbeck, A. D., Shabsovich, M., Jafar-nejad, P., Rigo, F., & Miller, T. M. (2021). Acute Trem2 reduction triggers increased microglial phagocytosis, slowing amyloid deposition in mice. 118, 2100356118. https: / / d0i.0rg / l 0.1073 / pnas.2100356118 / - / DCSupplemental
[0205] 26. Washer, S. J., Perez-Alcantara, M., Chen, Y., Steer, J., James, W. S., Trynka, G., Bassett, A. R., & Cowley, S. A. (2022). Single-cell transcriptomics defines an improved, validated monoculture protocol for differentiation of human iPSC to microglia. Scientific Reports, 12(1).
[0206] Sequence Listing Information
[0207] SEQ ID NO: 1 UCOE ctcgagcccgggaggtggtccctgcagttacgccaatgataacccccgccagaaaaatcttagtagccttccctttttgttttccgtg ccccaactcggcggattgactcggccccttccggaaacacccgaatcaacttctagtcaaattattgttcacgccgcaatgaccc acccctggcccgcgtctgtggaactgacccctggtgtacaggagagttcgctgctgaaagtggtcccaaaggggtactagttttta agctcccaactccccctcccccagcgtctggaggattccacaccctcgcaccgcaggggcgaggaagtgggcggagtccggtt ttggcgccagccgctgaggctgccaagcagaaaagccaccgctgaggagactccggtcactgtcctcgccccgcctccccctt ccctccccttggggaccaccgggcgccacgccgcgaacgttaagtgccgcggtcgtcggcgcctccgccctcccccttgggcc ccaattcccagcgggcgcggcgcgcggcccctccccccgccgggcgcgcgcccgctgccccgcccttcgtggccgcccggc gtgggcggtgccacccctccccccggcggccccgcgcgcagctcccggctccctcccccttcggatgtggcttgagctgtaggc gcggagggccggctagc
[0208] SEQ ID NO: 2 PB 5’ ITR ttaaccctagaaagatagtctgcgtaaaattgacgcatgcattcttgaaatattgctctctctttctaaatagcgcgaatccgtcgctgt gcatttaggacatctcagtcgccgcttggagctcccgtgaggcgtgcttgtcaatgcggtaagtgtcactgattttgaactataacga ccgcgtgagtcaaaatgacgcatgattatcttttacgtgacttttaagatttaactcatacgataattatattgttatttcatgttctacttac gtgataacttattatatatatattttcttgttatagatatc
[0209] SEQ ID NO: 3 PB 3’ ITR Tttgttactttatagaagaaattttgagtttttgtttttttttaataaataaataaacataaataaattgtttgttgaatttattattagtatgtaa gtgtaaatataataaaacttaatatctattcaaattaataaataaacctcgatatacagaccgataaaacacatgcgtcaattttacg catgattatctttaacgtacgtcacaatatgattatctttctagggttaa
[0210] SEQ ID NO: 4 dCas9-KRAB (a dead / deactivated Cas9 with the repression domains and a nuclear localisation signal sequence) atggacaagaagtacagcatcggcctggccatcggcaccaactctgtgggctgggccgtgatcaccgacgagtacaaggtgc ccagcaagaaattcaaggtgctgggcaacaccgaccggcacagcatcaagaagaacctgatcggcgccctgctgttcgaca gcggagaaacagccgaggccacccggctgaagagaaccgccagaagaagatacaccagacggaagaaccggatctgct atctgcaagagatcttcagcaacgagatggccaaggtggacgacagcttcttccacagactggaagagtccttcctggtggaag aggataagaagcacgagcggcaccccatcttcggcaacatcgtggacgaggtggcctaccacgagaagtaccccaccatct accacctgagaaagaaactggtggacagcaccgacaaggccgacctgcggctgatctatctggccctggcccacatgatcaa gttccggggccacttcctgatcgagggcgacctgaaccccgacaacagcgacgtggacaagctgttcatccagctggtgcaga cctacaaccagctgttcgaggaaaaccccatcaacgccagcggcgtggacgccaaggccatcctgtctgccagactgagcaa gagcagacggctggaaaatctgatcgcccagctgcccggcgagaagaagaatggcctgttcggcaacctgattgccctgagc ctgggcctgacccccaacttcaagagcaacttcgacctggccgaggatgccaaactgcagctgagcaaggacacctacgacg acgacctggacaacctgctggcccagatcggcgaccagtacgccgacctgtttctggccgccaagaacctgtccgacgccatc ctgctgagcgacatcctgagagtgaacaccgagatcaccaaggcccccctgagcgcctctatgatcaagagatacgacgagc accaccaggacctgaccctgctgaaagctctcgtgcggcagcagctgcctgagaagtacaaagagattttcttcgaccagagc aagaacggctacgccggctacatcgatggcggagccagccaggaagagttctacaagttcatcaagcccatcctggaaaaga tggacggcaccgaggaactgctcgtgaagctgaacagagaggacctgctgcggaagcagcggaccttcgacaacggcagc atcccccaccagatccacctgggagagctgcacgccattctgcggcggcaggaagatttttacccattcctgaaggacaaccgg gaaaagatcgagaagatcctgaccttccgcatcccctactacgtgggccctctggccaggggaaacagcagattcgcctggat gaccagaaagagcgaggaaaccatcaccccctggaacttcgaggaagtggtggacaagggcgccagcgcccagagcttca tcgagcggatgaccaacttcgataagaacctgcccaacgagaaggtgctgcccaagcacagcctgctgtacgagtacttcacc gtgtacaacgagctgaccaaagtgaaatacgtgaccgagggaatgagaaagcccgccttcctgagcggcgagcagaaaaa agccatcgtggacctgctgttcaagaccaaccggaaagtgaccgtgaagcagctgaaagaggactacttcaagaaaatcgag tgcttcgactccgtggaaatctccggcgtggaagatcggttcaacgcctccctgggcacataccacgatctgctgaaaattatcaa ggacaaggacttcctggacaatgaggaaaacgaggacattctggaagatatcgtgctgaccctgacactgtttgaggacagag agatgatcgaggaacggctgaaaacctatgcccacctgttcgacgacaaagtgatgaagcagctgaagcggcggagataca ccggctggggcaggctgagccggaagctgatcaacggcatccgggacaagcagtccggcaagacaatcctggatttcctgaa gtccgacggcttcgccaacagaaacttcatgcagctgatccacgacgacagcctgacctttaaagaggacatccagaaagccc aggtgtccggccagggcgatagcctgcacgagcacattgccaatctggccggcagccccgccattaagaagggcatcctgca gacagtgaaggtggtggacgagctcgtgaaagtgatgggccggcacaagcccgagaacatcgtgatcgaaatggccagag agaaccagaccacccagaagggacagaagaacagccgcgagagaatgaagcggatcgaagagggcatcaaagagctg ggcagccagatcctgaaagaacaccccgtggaaaacacccagctgcagaacgagaagctgtacctgtactacctgcagaat gggcgggatatgtacgtggaccaggaactggacatcaaccggctgtccgactacgatgtggacgctatcgtgcctcagagctttc tgaaggacgactccatcgataacaaagtgctgactcggagcgacaagaaccggggcaagagcgacaacgtgccctccgaa gaggtcgtgaagaagatgaagaactactggcgccagctgctgaatgccaagctgattacccagaggaagttcgacaatctgac caaggccgagagaggcggcctgagcgaactggataaggccggcttcatcaagagacagctggtggaaacccggcagatca caaagcacgtggcacagatcctggactcccggatgaacactaagtacgacgagaacgacaaactgatccgggaagtgaaa gtgatcaccctgaagtccaagctggtgtccgatttccggaaggatttccagttttacaaagtgcgcgagatcaacaactaccacca cgcccacgacgcctacctgaacgccgtcgtgggaaccgccctgatcaaaaagtaccctaagctggaaagcgagttcgtgtacg gcgactacaaggtgtacgacgtgcggaagatgatcgccaagagcgagcaggaaatcggcaaggctaccgccaagtacttctt ctacagcaacatcatgaactttttcaagaccgagattaccctggccaacggcgagatccggaagcggcctctgatcgagacaa acggcgaaacaggcgagatcgtgtgggataagggccgggactttgccaccgtgcggaaagtgctgtctatgccccaagtgaat atcgtgaaaaagaccgaggtgcagacaggcggcttcagcaaagagtctatcctgcccaagaggaacagcgacaagctgatc gccagaaagaaggactgggaccctaagaagtacggcggcttcgacagccccaccgtggcctattctgtgctggtggtggccaa agtggaaaagggcaagtccaagaaactgaagagtgtgaaagagctgctggggatcaccatcatggaaagaagcagcttcga gaagaatcccatcgactttctggaagccaagggctacaaagaagtgaaaaaggacctgatcatcaagctgcctaagtactccc tgttcgagctggaaaacggccggaagagaatgctggcctctgccggcgaactgcagaagggaaacgaactggccctgccctc caaatatgtgaacttcctgtacctggccagccactatgagaagctgaagggctcccccgaggataatgagcagaaacagctgtt tgtggaacagcacaaacactacctggacgagatcatcgagcagatcagcgagttctccaagagagtgatcctggccgacgcta atctggacaaggtgctgagcgcctacaacaagcacagagacaagcctatcagagagcaggccgagaatatcatccacctgttt accctgaccaatctgggagcccctgccgccttcaagtactttgacaccaccatcgaccggaagaggtacaccagcaccaaag aggtgctggacgccaccctgatccaccagagcatcaccggcctgtacgagacacggatcgacctgtctcagctgggaggcga cgcctatccctatgacgtgcccgattatgccagcctgggcagcggctcccccaagaaaaaacgcaaggtggaagatcctaag aaaaagcggaaagtggacggcggcggttccggcggagggtcggatgctaagtcactaactgcctggtcccggacactggtga ccttcaaggatgtatttgtggacttcaccagggaggagtggaagctgctggacactgctcagcagatcgtgtacagaaatgtgat gctggagaactataagaacctggtttccttgggttatcagcttactaagccagatgtgatcctccggttggagaagggagaagag ccc
[0211] SEQ ID NO: 5 T2A self-cleaving peptide sequence ggaagcggagagggcaggggaagtcttctaacatgcggggacgtggaggaaaatcccggcccc
[0212] Plasmid sequences
[0213] SEQ ID NO: 6 PL-22.003 PB-UCOECBx3-pCAG-dCas9-KRAB-T2A-eGFP-pA (CRISPRi plasmid)
[0214] PiggyBac expression vector containing UCOECBXS to protect expression of dCas9-KRAB on iPSC derived cells with eGFP reporter fused via T2A cleavable peptide linker. ttaaccctagaaagatagtctgcgtaaaattgacgcatgcattcttgaaatattgctctctctttctaaatagcgcgaatccgtcgctgt gcatttaggacatctcagtcgccgcttggagctcccgtgaggcgtgcttgtcaatgcggtaagtgtcactgattttgaactataacga ccgcgtgagtcaaaatgacgcatgattatcttttacgtgacttttaagatttaactcatacgataattatattgttatttcatgttctacttac gtgataacttattatatatatattttcttgttatagatatcatcaactttgtatagaaaagttgctcgagcccgggaggtggtccctgcagt tacgccaatgataacccccgccagaaaaatcttagtagccttccctttttgttttccgtgccccaactcggcggattgactcggcccc ttccggaaacacccgaatcaacttctagtcaaattattgttcacgccgcaatgacccacccctggcccgcgtctgtggaactgacc cctggtgtacaggagagttcgctgctgaaagtggtcccaaaggggtactagtttttaagctcccaactccccctcccccagcgtctg gaggattccacaccctcgcaccgcaggggcgaggaagtgggcggagtccggttttggcgccagccgctgaggctgccaagc agaaaagccaccgctgaggagactccggtcactgtcctcgccccgcctcccccttccctccccttggggaccaccgggcgcca cgccgcgaacgttaagtgccgcggtcgtcggcgcctccgccctcccccttgggccccaattcccagcgggcgcggcgcgcggc ccctccccccgccgggcgcgcgcccgctgccccgcccttcgtggccgcccggcgtgggcggtgccacccctccccccggcgg ccccgcgcgcagctcccggctccctcccccttcggatgtggcttgagctgtaggcgcggagggccggctagcctcgacattgatt attgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatgg cccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttc cattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctatt gacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtat tagtcatcgctattaccatggtcgaggtgagccccacgttctgcttcactctccccatctcccccccctccccacccccaattttgtattt atttattttttaattattttgtgcagcgatgggggcggggggggggggggggcgcgcgccaggcggggcggggcggggcgagg ggcggggcggggcgaggcggagaggtgcggcggcagccaatcagagcggcgcgctccgaaagtttccttttatggcgaggc ggcggcggcggcggccctataaaaagcgaagcgcgcggcgggcgggagtcgctgcgcgctgccttcgccccgtgccccgct ccgccgccgcctcgcgccgcccgccccggctctgactgaccgcgttactcccacaggtgagcgggcgggacggcccttctcct ccgggctgtaattagcgcttggtttaatgacggcttgtttcttttctgtggctgcgtgaaagccttgaggggctccgggagggccctttg tgcggggggagcggctcggggggtgcgtgcgtgtgtgtgtgcgtggggagcgccgcgtgcggctccgcgctgcccggcggctg tgagcgctgcgggcgcggcgcggggctttgtgcgctccgcagtgtgcgcgaggggagcgcggccgggggcggtgccccgcg gtgcggggggggctgcgaggggaacaaaggctgcgtgcggggtgtgtgcgtgggggggtgagcagggggtgtgggcgcgt cggtcgggctgcaaccccccctgcacccccctccccgagttgctgagcacggcccggcttcgggtgcggggctccgtacgggg cgtggcgcggggctcgccgtgccgggcggggggtggcggcaggtgggggtgccgggcggggcggggccgcctcgggccg gggagggctcgggggaggggcgcggcggcccccggagcgccggcggctgtcgaggcgcggcgagccgcagccattgcct tttatggtaatcgtgcgagagggcgcagggacttcctttgtcccaaatctgtgcggagccgaaatctgggaggcgccgccgcacc ccctctagcgggcgcggggcgaagcggtgcggcgccggcaggaaggaaatgggcggggagggccttcgtgcgtcgccgcg ccgccgtccccttctccctctccagcctcggggctgtccgcggggggacggctgccttcgggggggacggggcagggcggggt tcggcttctggcgtgtgaccggcggctctagagcctctgctaaccatgttcatgccttcttctttttcctacagctcctgggcaacgtgct ggttattgtgctgtctcatcattttggcaaagaattgcaagtttgtacaaaaaagcaggctcctagggccaccatggacaagaagt acagcatcggcctggccatcggcaccaactctgtgggctgggccgtgatcaccgacgagtacaaggtgcccagcaagaaatt caaggtgctgggcaacaccgaccggcacagcatcaagaagaacctgatcggcgccctgctgttcgacagcggagaaacag ccgaggccacccggctgaagagaaccgccagaagaagatacaccagacggaagaaccggatctgctatctgcaagagatc ttcagcaacgagatggccaaggtggacgacagcttcttccacagactggaagagtccttcctggtggaagaggataagaagca cgagcggcaccccatcttcggcaacatcgtggacgaggtggcctaccacgagaagtaccccaccatctaccacctgagaaag aaactggtggacagcaccgacaaggccgacctgcggctgatctatctggccctggcccacatgatcaagttccggggccacttc ctgatcgagggcgacctgaaccccgacaacagcgacgtggacaagctgttcatccagctggtgcagacctacaaccagctgtt cgaggaaaaccccatcaacgccagcggcgtggacgccaaggccatcctgtctgccagactgagcaagagcagacggctgg aaaatctgatcgcccagctgcccggcgagaagaagaatggcctgttcggcaacctgattgccctgagcctgggcctgaccccc aacttcaagagcaacttcgacctggccgaggatgccaaactgcagctgagcaaggacacctacgacgacgacctggacaac ctgctggcccagatcggcgaccagtacgccgacctgtttctggccgccaagaacctgtccgacgccatcctgctgagcgacatc ctgagagtgaacaccgagatcaccaaggcccccctgagcgcctctatgatcaagagatacgacgagcaccaccaggacctg accctgctgaaagctctcgtgcggcagcagctgcctgagaagtacaaagagattttcttcgaccagagcaagaacggctacgc cggctacatcgatggcggagccagccaggaagagttctacaagttcatcaagcccatcctggaaaagatggacggcaccgag gaactgctcgtgaagctgaacagagaggacctgctgcggaagcagcggaccttcgacaacggcagcatcccccaccagatc cacctgggagagctgcacgccattctgcggcggcaggaagatttttacccattcctgaaggacaaccgggaaaagatcgaga agatcctgaccttccgcatcccctactacgtgggccctctggccaggggaaacagcagattcgcctggatgaccagaaagagc gaggaaaccatcaccccctggaacttcgaggaagtggtggacaagggcgccagcgcccagagcttcatcgagcggatgacc aacttcgataagaacctgcccaacgagaaggtgctgcccaagcacagcctgctgtacgagtacttcaccgtgtacaacgagct gaccaaagtgaaatacgtgaccgagggaatgagaaagcccgccttcctgagcggcgagcagaaaaaagccatcgtggacc tgctgttcaagaccaaccggaaagtgaccgtgaagcagctgaaagaggactacttcaagaaaatcgagtgcttcgactccgtg gaaatctccggcgtggaagatcggttcaacgcctccctgggcacataccacgatctgctgaaaattatcaaggacaaggacttc ctggacaatgaggaaaacgaggacattctggaagatatcgtgctgaccctgacactgtttgaggacagagagatgatcgagga acggctgaaaacctatgcccacctgttcgacgacaaagtgatgaagcagctgaagcggcggagatacaccggctggggcag gctgagccggaagctgatcaacggcatccgggacaagcagtccggcaagacaatcctggatttcctgaagtccgacggcttcg ccaacagaaacttcatgcagctgatccacgacgacagcctgacctttaaagaggacatccagaaagcccaggtgtccggcca gggcgatagcctgcacgagcacattgccaatctggccggcagccccgccattaagaagggcatcctgcagacagtgaaggtg gtggacgagctcgtgaaagtgatgggccggcacaagcccgagaacatcgtgatcgaaatggccagagagaaccagaccac ccagaagggacagaagaacagccgcgagagaatgaagcggatcgaagagggcatcaaagagctgggcagccagatcct gaaagaacaccccgtggaaaacacccagctgcagaacgagaagctgtacctgtactacctgcagaatgggcgggatatgta cgtggaccaggaactggacatcaaccggctgtccgactacgatgtggacgctatcgtgcctcagagctttctgaaggacgactc catcgataacaaagtgctgactcggagcgacaagaaccggggcaagagcgacaacgtgccctccgaagaggtcgtgaaga agatgaagaactactggcgccagctgctgaatgccaagctgattacccagaggaagttcgacaatctgaccaaggccgagag aggcggcctgagcgaactggataaggccggcttcatcaagagacagctggtggaaacccggcagatcacaaagcacgtgg cacagatcctggactcccggatgaacactaagtacgacgagaacgacaaactgatccgggaagtgaaagtgatcaccctga agtccaagctggtgtccgatttccggaaggatttccagttttacaaagtgcgcgagatcaacaactaccaccacgcccacgacg cctacctgaacgccgtcgtgggaaccgccctgatcaaaaagtaccctaagctggaaagcgagttcgtgtacggcgactacaag gtgtacgacgtgcggaagatgatcgccaagagcgagcaggaaatcggcaaggctaccgccaagtacttcttctacagcaaca tcatgaactttttcaagaccgagattaccctggccaacggcgagatccggaagcggcctctgatcgagacaaacggcgaaaca ggcgagatcgtgtgggataagggccgggactttgccaccgtgcggaaagtgctgtctatgccccaagtgaatatcgtgaaaaag accgaggtgcagacaggcggcttcagcaaagagtctatcctgcccaagaggaacagcgacaagctgatcgccagaaagaa ggactgggaccctaagaagtacggcggcttcgacagccccaccgtggcctattctgtgctggtggtggccaaagtggaaaagg gcaagtccaagaaactgaagagtgtgaaagagctgctggggatcaccatcatggaaagaagcagcttcgagaagaatccca tcgactttctggaagccaagggctacaaagaagtgaaaaaggacctgatcatcaagctgcctaagtactccctgttcgagctgg aaaacggccggaagagaatgctggcctctgccggcgaactgcagaagggaaacgaactggccctgccctccaaatatgtga acttcctgtacctggccagccactatgagaagctgaagggctcccccgaggataatgagcagaaacagctgtttgtggaacagc acaaacactacctggacgagatcatcgagcagatcagcgagttctccaagagagtgatcctggccgacgctaatctggacaag gtgctgagcgcctacaacaagcacagagacaagcctatcagagagcaggccgagaatatcatccacctgtttaccctgacca atctgggagcccctgccgccttcaagtactttgacaccaccatcgaccggaagaggtacaccagcaccaaagaggtgctggac gccaccctgatccaccagagcatcaccggcctgtacgagacacggatcgacctgtctcagctgggaggcgacgcctatcccta tgacgtgcccgattatgccagcctgggcagcggctcccccaagaaaaaacgcaaggtggaagatcctaagaaaaagcgga aagtggacggcggcggttccggcggagggtcggatgctaagtcactaactgcctggtcccggacactggtgaccttcaaggat gtatttgtggacttcaccagggaggagtggaagctgctggacactgctcagcagatcgtgtacagaaatgtgatgctggagaact ataagaacctggtttccttgggttatcagcttactaagccagatgtgatcctccggttggagaagggagaagagcccaccggtgg aagcggagagggcaggggaagtcttctaacatgcggggacgtggaggaaaatcccggccccatggtgagcaagggcgag gagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgaggg cgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcg tgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgc ccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagg gcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagt acaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccaca acatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccg acaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgt gaccgccgccgggatcactctcggcatggacgagctgtacaagtaagcggccgcacccagctttcttgtacaaagtggtgatcc tcaggtgcaggctgcctatcagaaggtggtggctggtgtggccaatgccctggctcacaaataccactgagatctttttccctctgc caaaaattatggggacatcatgaagccccttgagcatctgacttctggctaataaaggaaatttattttcattgcaatagtgtgttgga attttttgtgtctctcactcggaaggacatatgggagggcaaatcatttaaaacatcagaatgagtatttggtttagagtttggcaacat atgcccatatgctggctgccatgaacaaaggttggctataaagaggtcatcagtatatgaaacagccccctgctgtccattccttatt ccatagaaaagccttgacttgaggttagattttttttatattttgttttgtgttatttttttctttaacatccctaaaattttccttacatgttttacta gccagatttttcctcctctcctgactactcccagtcatagctgtccctcttctcttatggagatccctcgacctgcagcccaagcttggat ccctcgagttaattaacgagagcataatattgatatgtgccaaagttgtttctgactgactaataagtataatttgtttctattatgtatag gttaagctaattacttattttataatacaacatgactgtttttaaagtacaaaataagtttatttttgtaaaagagagaatgtttaaaagttt tgttactttatagaagaaattttgagtttttgtttttttttaataaataaataaacataaataaattgtttgttgaatttattattagtatgtaagtg taaatataataaaacttaatatctattcaaattaataaataaacctcgatatacagaccgataaaacacatgcgtcaattttacgcat gattatctttaacgtacgtcacaatatgattatctttctagggttaaataatagtttctaatttttttattattcagcctgctgtcgtgaatacc gagctccaattcgccctatagtgagtcgtattacaattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacc caacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagt tgcgcagcctgaatggcgaatgggacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgacc gctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaa atcgggggctccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgg gccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacact caaccctatctcggtctattcttttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaattta acgcgaattttaacaaaatattaacgcttacaatttaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaa atacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaa catttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctga agatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgtt ttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcat acactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgca gtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttg cacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgaca ccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaata gactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagc cggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacgggg agtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaa gtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaa tcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaat ctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaa ctggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccg cctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgat agttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccg aactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagagagaaaggcggacaggtatccggtaagcg gcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccac ctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttc ctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgata ccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgc ctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgca attaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataa caatttcacacaggaaacagctatgaccatgattacgccaagctcgaaattaaccctcactaaagggaacaaaagctggtacct cgcgcgacttggtttgccattctttagcgcgcgtcgcgtcacacagcttggccacaatgtggtttttgtcaaacgaagattctatgacg tgtttaaagtttaggtcgagtaaagcgcaaatctttt
[0215] SEQ ID NO: 7 PL-20.004 Super PiggyBac Transposase
[0216] Purchased from Gentaur. Co-transfected to mediate genomic integration of PiggyBac expression vectors. gcggccgcgagctcacggggacagcccccccccaaagcccccagggatgtaattacgtccctcccccgctagggggcagca gcgagccgcccggggctccgctccggtccggcgctccccccgcatccccgagccggcagcgtgcggggacagcccgggca cggggaaggtggcacgggatcgctttcctctgaacgcttctcgctgctctttgagcctgcagacacctggggggatacggggaaa aagctttaggctgaaagagagatttagaatgacagaatcatagaacggcctgggttgcaaaggagcacagtgctcatccagat ccaaccccctgctatgtgcagggtcatcaaccagcagcccaggctgcccagagccacatccagcctggccttgaatgcctgca gggatggggcatccacagcctccttgggcaacctgttcagtgcgtcaccaccctctgggggaaaaactgcctcctcatatccaac ccaaacctcccctgtctcagtgtaaagccattcccccttgtcctatcaagggggagtttgctgtgacattgttggtctggggtgacac atgtttgccaattcagtgcatcacggagaggcagatcttggggataaggaagtgcaggacagcatggacgtgggacatgcagg tgttgagggctctgggacactctccaagtcacagcgttcagaacagccttaaggataagaagataggatagaaggacaaaga gcaagttaaaacccagcatggagaggagcacaaaaaggccacagacactgctggtccctgtgtctgagcctgcatgtttgatg gtgtctggatgcaagcagaaggggtggaagagcttgcctggagagatacagctgggtcagtaggactgggacaggcagctgg agaattgccatgtagatgttcatacaatcgtcaaatcatgaaggctggaaaagccctccaagatccccaagaccaaccccaac ccacccaccgtgcccactggccatgtccctcagtgccacatccccacagttcttcatcacctccagggacggtgacccccccacc tccgtgggcagctgtgccactgcagcaccgctctttggagaaggtaaatcttgctaaatccagcccgaccctcccctggcacaac gtaaggccattatctctcatccaactccaggacggagtcagtgagaatattgcctccctggcgagctcacggggacagcccccc cccaaagcccccagggatgtaattacgtccctcccccgctagggggcagcagcgagccgcccggggctccgctccggtccgg cgctccccccgcatccccgagccggcagcgtgcggggacagcccgggcacggggaaggtggcacgggatcgctttcctctg aacgcttctcgctgctctttgagcctgcagacacctggggggatacggggaaaaagctttaggctgaaagagagatttagaatg acagaatcatagaacggcctgggttgcaaaggagcacagtgctcatccagatccaaccccctgctatgtgcagggtcatcaac cagcagcccaggctgcccagagccacatccagcctggccttgaatgcctgcagggatggggcatccacagcctccttgggca acctgttcagtgcgtcaccaccctctgggggaaaaactgcctcctcatatccaacccaaacctcccctgtctcagtgtaaagccatt cccccttgtcctatcaagggggagtttgctgtgacattgttggtctggggtgacacatgtttgccaattcagtgcatcacggagaggc agatcttggggataaggaagtgcaggacagcatggacgtgggacatgcaggtgttgagggctctgggacactctccaagtcac agcgttcagaacagccttaaggataagaagataggatagaaggacaaagagcaagttaaaacccagcatggagaggagc acaaaaaggccacagacactgctggtccctgtgtctgagcctgcatgtttgatggtgtctggatgcaagcagaaggggtggaag agcttgcctggagagatacagctgggtcagtaggactgggacaggcagctggagaattgccatgtagatgttcatacaatcgtc aaatcatgaaggctggaaaagccctccaagatccccaagaccaaccccaacccacccaccgtgcccactggccatgtccctc agtgccacatccccacagttcttcatcacctccagggacggtgacccccccacctccgtgggcagctgtgccactgcagcaccg ctctttggagaaggtaaatcttgctaaatccagcccgaccctcccctggcacaacgtaaggccattatctctcatccaactccagg acggagtcagtgagaatattcggccgctctagaactagtggatcccccgggctgcaggaattcgatggccgcttgggcgggata tctagcgccaaggttccgtaaagctctctattagaggactggcggtgccccatcaccctgggaggcctctccacaaatatcggcta cttccaattgattggacgcgccatcttgtctgcttatgcatattcagaggatcctgaatattcatgagcgagggccgtgcggcccctc cctccaaccctcccccggaacaagctccggagaacccgacaggccccgccttctttaccgatgcgtagaacaaaccattttccg ggttggggggggaaattaatgagagactttagctgaaaatgagcatggacgccaaagctgagtaaagatggcttaactttatcct ccattctgtaatccgtcagcttgagtgtacgggaagtcggcgaggggggcggcaggctcagaaacattctcctcctcctgtcgcgt cagaaagaacacccaaccagggagccggagccctggcgtcaacatctctggcgcgcgcgctccatgtaggccggtgcgggc ggccccgtagcgcaagggagggcgggaaaggaaggggcgggacacaagggcgaatctataaagggcgtcattcagcca gttctctcctcagaagcgccgagagcgcgaccgggacggttggagaagaaggtggctcccggaagggggagagacaaact gccgtaacctctgccgttcaggatcccggccatcaagcttatcgatgctgccgcagcaaaagcaggagcagatgccgccgtcg caggcgaagatgtcgcagacggaggaggcgatgctgccggcggaggaggcgaagtaagtagagggctgggctgggctgtg gggggtgtggggtgcgggactgggcagtctgggagtccctctcaccacttttcttacctttctaggatgctgcctcgaggaactgaa aaaccagaaagttaactggtaagtttagtctttttgtcttttatttcaggtcccggatccggtggtggtgcaaatcaaagaactgctcct cagtggatgttgcctttacttctaggcctgtacggaagtgttacttctgctctaaaagctgcggaattgtacccaattcgttaaggcca aattggccaccatgggctctagcctggacgacgagcacatcctgagcgccctgctgcagagcgacgacgaactggtgggcga ggacagcgacagcgaggtcagcgaccacgtgtccgaggacgacgtgcagtccgacaccgaggaagccttcatcgacgagg tgcacgaagtgcagcctaccagcagcggctccgagatcctggacgagcagaacgtgatcgagcagcctggcagctccctggc cagcaacagaatcctgaccctgccccagagaaccatcagaggcaagaacaagcactgctggtccacctccaagagcacca ggcggagcagagtgtccgccctgaacatcgtgcggagccagaggggccccaccagaatgtgcagaaacatctacgaccccc tgctgtgcttcaagctgttcttcaccgacgagatcatcagcgagatcgtgaagtggaccaacgccgagatcagcctgaagaggc gggagagcatgaccagcgccaccttcagagacaccaacgaggacgagatctacgccttcttcggcatcctggtgatgaccgcc gtgagaaaggacaaccacatgagcaccgacgacctgttcgacagatccctgagcatggtgtacgtgtccgtgatgagcagag acagattcgacttcctgatcagatgcctgagaatggacgacaagagcatcagacccaccctgcgggagaacgacgtgttcacc cccgtgcggaagatctgggacctgttcatccaccagtgcatccagaactacacccctggcgcccacctgaccatcgatgagca gctgctgggcttcagaggcagatgccccttcagagtgtacatccccaacaagcccagcaagtacggcatcaagatcctgatgat gtgcgacagcggcaccaagtacatgatcaacggcatgccctacctgggcagaggcacccagacaaacggcgtgcccctggg cgagtactacgtgaaagaactgagcaagcctgtgcatggcagctgcaggaacatcacctgcgacaactggttcaccagcatcc ccctggccaagaacctgctgcaggaaccctacaagctgaccatcgtgggcaccgtgcggagcaacaagcgggagatcccag aggtgctgaagaacagcagatccagacctgtgggaacaagcatgttctgcttcgacggccccctgaccctggtgtcctacaagc ccaagcccgccaagatggtgtacctgctgtccagctgcgacgaggacgccagcatcaacgagagcaccggcaagccccag atggtgatgtactacaaccagaccaagggcggcgtggacaccctggaccagatgtgcagcgtgatgacctgcagcagaaag accaacagatggcccatggccctgctgtacggcatgatcaatatcgcctgcatcaacagcttcatcatctacagccacaacgtgt ccagcaagggcgagaaggtgcagagccggaagaaattcatgcggaacctgtacatgagcctgacctccagcttcatgagaa agagactggaagcccccaccctgaagagatacctgcgggacaacatcagcaacatcctgcccaaggaagtgccaggaaca agcgacgacagcaccgaggaacccgtgatgaagaagaggacctactgcacctactgtcccagcaagatcagaagaaaggc caacgccagctgcaagaaatgcaaaaaagtgatctgccgggagcacaacatcgacatgtgccagagctgtttctgaggccgt aacggccgccagaattggggatccagacatgataagatacattgatgagtttggacaaaccacaactagaatgcagtgaaaa aaatgctttatttgtgaaatttgtgatgctattgctttatttgtaaccattataagctgcaataaacaagttaacaacaacaattgcattca ttttatgtttcaggttcagggggaggtgtgggaggttttttcggatcctctagagtcgacctgcaggcatgcaagctcggtacccagct tttgttccctttagtgagggttaattgcgcgcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccac acaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcact gcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattggg cgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaata cggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaa aggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaa acccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccgga tacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctcca agctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaag acacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaa gtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttg gtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaagg atctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattat caaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagtt accaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataacta cgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaa taaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccggga agctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtat ggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcc tccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgt aagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtca atacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaagg atcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggt gagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttccttttt caatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttcc gcgcacatttccccgaaaagtgccacctgacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcg tgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaag ctctaaatcgggggctccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgt agtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaaca acactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaa atttaacgcgaattttaacaaaatattaacgcttacaatttccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgc gggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtc acgacgttgtaaaacgacggccagtgagcgcgcgtaatacgactcactatagggcgaattggagctccaccgcggtg SEQ ID NO: 8 PL-22.0050 LV-UCOECBx3-pU6-stuffer-pEF1a-mTagBFP2-T2A-Puro-dWPRE aatgtagtcttatgcaatactcttgtagtcttgcaacatggtaacgatgagttagcaacatgccttacaaggagagaaaaagcacc gtgcatgccgattggtggaagtaaggtggtacgatcgtgccttattaggaaggcaacagacgggtctgacatggattggacgaa ccactgaattgccgcattgcagagatattgtatttaagtgcctagctcgatacataaacgggtctctctggttagaccagatctgagc ctgggagctctctggctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctg ttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtggcgcccgaacagggacttga aagcgaaagggaaaccagaggagctctctcgacgcaggactcggcttgctgaagcgcgcacggcaagaggcgaggggcg gcgactggtgagtacgccaaaaattttgactagcggaggctagaaggagagagatgggtgcgagagcgtcagtattaagcgg gggagaattagatcgcgatgggaaaaaattcggttaaggccagggggaaagaaaaaatataaattaaaacatatagtatggg caagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactgggacagcta caaccatcccttcagacaggatcagaagaacttagatcattatataatacagtagcaaccctctattgtgtgcatcaaaggataga gataaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaccaccgcacagcaagcggc cgctgatcttcagacctggaggaggagatatgagggacaattggagaagtgaattatataaatataaagtagtaaaaattgaac cattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctttgttcc ttgggttcttgggagcagcaggaagcactatgggcgcagcgtcaatgacgctgacggtacaggccagacaattattgtctggtat agtgcagcagcagaacaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagct ccaggcaagaatcctggctgtggaaagatacctaaaggatcaacagctcctggggatttggggttgctctggaaaactcatttgc accactgctgtgccttggaatgctagttggagtaataaatctctggaacagatttggaatcacacgacctggatggagtgggaca gagaaattaacaattacacaagcttaatacactccttaattgaagaatcgcaaaaccagcaagaaaagaatgaacaagaatta ttggaattagataaatgggcaagtttgtggaattggtttaacataacaaattggctgtggtatataaaattattcataatgatagtagg aggcttggtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatattcaccattatcgtttcagacccac ctcccaaccccgaggggacccgacaggcccgaaggaatagaagaagaaggtggagagagagacagagacagatccatt cgattagtgaacggatctcgacggtatcgctagcttttaaaagaaaaggggggattggggggtacagtgcaggggaaagaata gtagacataatagcaacagacatacaaactaaagaattacaaaaacaaattacaaaaattcaaaattttactagtgattatcgg atcaactttgtatagaaaagttgctcgagcccgggaggtggtccctgcagttacgccaatgataacccccgccagaaaaatctta gtagccttccctttttgttttccgtgccccaactcggcggattgactcggccccttccggaaacacccgaatcaacttctagtcaaatt attgttcacgccgcaatgacccacccctggcccgcgtctgtggaactgacccctggtgtacaggagagttcgctgctgaaagtgg tcccaaaggggtactagtttttaagctcccaactccccctcccccagcgtctggaggattccacaccctcgcaccgcaggggcga ggaagtgggcggagtccggttttggcgccagccgctgaggctgccaagcagaaaagccaccgctgaggagactccggtcact gtcctcgccccgcctcccccttccctccccttggggaccaccgggcgccacgccgcgaacgttaagtgccgcggtcgtcggcgc ctccgccctcccccttgggccccaattcccagcgggcgcggcgcgcggcccctccccccgccgggcgcgcgcccgctgcccc gcccttcgtggccgcccggcgtgggcggtgccacccctccccccggcggccccgcgcgcagctcccggctccctcccccttcg gatgtggcttgagctgtaggcgcggagggccggctagcgagggcctatttcccatgattccttcatatttgcatatacgatacaagg ctgttagagagataattggaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgg gtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtg gaaaggacgaaacaccttcggcaggtggtgttgtaaatgagcacacaaaatacacatgctaaaatattatattctatgacctttat aaaatcaaccaaaatcttctttttaataactttagtatcaataattagaatttttatgttcctttttgcaaacttttaataaaaatgagcaaa ataaaaaaacgctagttttagtaactcgcgttgttttcttcacctttaataatagctactccaccacttgttcctaagcggtcagctcctg cttcaatcattttttgagcatcttcaaatgttctaactccaccagctgctttaactaaagcattgtctttaacaactgacttcattagtttaac atcttcaaatgttgcacctgattttgaaaatcctgttgatgttttaacaaattctaatccagcttcaacagctatttcacaagctttcatgat ttcttcttttgttaataaacaattttccataatacatttaacaacatgtgatccagctgctttttttacagctttcatgtcttctaaaactaattc ataatttttgtcttttaatgcaccaatatttaataccatatcaatttctgttgcaccatctttaattgcttcagaaacttcgaatgcttttgtagc tgttgtgcatgcacctagaggaaaacctacaacatttgttattcctacatttgtgccttttaataattctttacaatagcttgttcaatatga attaacacaaactgttgcaaaatcaaattcaattgcttcatcacataattgtttaatttcagctttcgtagcatcttgttttaataatgtgtg atctatatatttgtttagtttcattttttctcctatatattcatttttaattttaattctttaataatttcgtctactttaactttagcgttttgaacagatt caccaacacctataaaataaatttttagtttaggttcagttccacttgggcgaacagcaaatcatgacttatcttctaaataaaatttta gtaagtcttgtcctggcatattatacattccatcgatgtagtcttcaacattaacaactttaagtccagcaatttgagttaagggtgttgct ctcaatgatttcattaatggttcaatttttaatttcttttcttctggtttaaaattcaagtttaaagtgaaagtgtaatatgcacccatttctttaa ataaatcttctaaatagtctactaatgttttattttgttttttataaaatcaagcagcctctgctattaatatagaagcttgtattccatctttat ctctagctgagtcatcaattacatatccataactttcttcataagcaaaaacaaaatttaatccgttatcttcttctttagcaatttctctac ccattcatttaaatccagttaaagtttttacaatattaactccatatttttcatgagcgattctatcacccaaatcacttgttacaaaacttg aatatagagccggattttttggaatgctatttaagcgttttagatttgataattttcaatcaattaaaattggtcctgtttgatttccatctaat cttacaaaatgaccatcatgttttattgccattccaaatctgtcagcatctgggtcattcataataataatatctgcatcatgtttaatacc atattcaagcggtatttttcatgcaggatcaaattctggatttggatttacaacatttttaaatgtttcatcttcaaatgcatgctcttcaacc tcaataacgttatatcctgattcacgtaatatttttggggtaaatttagttcctgttccattaactgcgctaaaaataatttttaaatctttttta gcttcttgctcttttttgtacacctgcacCTGtttaagagctatgctGGAAACagcatagcaagtttaaataaggctagtccgttat caacttgaaaaagtggcaccgagtcggtgcTTTTTTTggctccggtgcccgtcagtgggcagagcgcacatcgcccacag tccccgagaagttggggggaggggtcggcaattgaaccggtgcctagagaaggtggcgcggggtaaactgggaaagtgatgt cgtgtactggctccgcctttttcccgagggtgggggagaaccgtatataagtgcagtagtcgccgtgaacgttctttttcgcaacgg gtttgccgccagaacacaggtaagtgccgtgtgtggttcccgcgggcctggcctctttacgggttatggcccttgcgtgccttgaatt acttccacctggctgcagtacgtgattcttgatcccgagcttcgggttggaagtgggtgggagagttcgaggccttgcgcttaagga gccccttcgcctcgtgcttgagttgaggcctggcctgggcgctggggccgccgcgtgcgaatctggtggcaccttcgcgcctgtct cgctgctttcgataagtctctagccatttaaaatttttgatgacctgctgcgacgctttttttctggcaagatagtcttgtaaatgcgggcc aagatctgcacactggtatttcggtttttggggccgcgggcggcgacggggcccgtgcgtcccagcgcacatgttcggcgaggc ggggcctgcgagcgcggccaccgagaatcggacgggggtagtctcaagctggccggcctgctctggtgcctggtctcgcgccg ccgtgtatcgccccgccctgggcggcaaggctggcccggtcggcaccagttgcgtgagcggaaagatggccgcttcccggcc ctgctgcagggagctcaaaatggaggacgcggcgctcgggagagcgggcgggtgagtcacccacacaaaggaaaagggc ctttccgtcctcagccgtcgcttcatgtgactccacggagtaccgggcgccgtccaggcacctcgattagttctcgagcttttggagt acgtcgtctttaggttggggggaggggttttatgcgatggagtttccccacactgagtgggtggagactgaagttaggccagcttgg cacttgatgtaattctccttggaatttgccctttttgagtttggatcttggttcattctcaagcctcagacagtggttcaaagtttttttcttcca tttcaggtgtcgtgacaagtttgtacaaaaaagcaggctggatccgccaccATGGTGTCCAAGGGCGAAGAACT GATCAAAGAAAACATGCACATGAAGCTGTACATGGAAGGCACCGTGGACAACCACCAC TTCAAGTGCACAAGCGAAGGCGAGGGCAAGCCTTACGAGGGCACCCAGACCATGAGA ATCAAGGTGGTGGAAGGCGGCCCTCTGCCTTTCGCCTTTGATATCCTGGCCACCAGCT TTCTGTACGGCAGCAAGACCTTCATCAATCACACCCAGGGCATCCCCGATTTCTTCAAG CAGAGCTTCCCCGAGGGCTTCACCTGGGAGAGAGTGACCACATACGAGGATGGCGGC GTGCTGACAGCCACACAGGATACAAGTCTGCAGGACGGCTGCCTGATCTACAACGTGA AGATCCGGGGCGTGAACTTCACCAGCAACGGCCCCGTGATGCAGAAGAAAACCCTTG GCTGGGAAGCCTTCACCGAGACACTGTATCCTGCCGATGGCGGCCTGGAAGGCAGAA ACGATATGGCCCTGAAGCTCGTCGGCGGCTCTCACCTGATTGCCAATGCCAAGACCAC CTACAGAAGCAAGAAGCCCGCCAAGAACCTGAAGATGCCCGGCGTGTACTACGTGGAC TACCGGCTGGAAAGAATCAAAGAGGCCAACAACGAGACATACGTGGAACAGCACGAGG TGGCCGTGGCCAGATACTGTGATCTGCCTTCTAAGCTGGGCCACAAGCTGAACggtaccg gaagcggagagggcaggggaagtcttctaacatgcggggacgtggaggaaaatcccggccccatgaccgagtacaagccc acggtgcgcctcgccacccgcgacgacgtccccagggccgtacgcaccctcgccgccgcgttcgccgactaccccgccacgc gccacaccgtcgatccggaccgccacatcgagcgggtcaccgagctgcaagaactcttcctcacgcgcgtcgggctcgacatc ggcaaggtgtgggtcgcggacgacggcgccgcggtggcggtctggaccacgccggagagcgtcgaagcgggggcggtgtt cgccgagatcggcccgcgcatggccgagttgagcggttcccggctggccgcgcagcaacagatggaaggcctcctggcgcc gcaccggcccaaggagcccgcgtggttcctggccaccgtcggcgtctcgcccgaccaccagggcaagggtctgggcagcgc cgtcgtgctccccggagtggaggcggccgagcgcgccggggtgcccgccttcctggagacctccgcgccccgcaacctcccct tctacgagcggctcggcttcaccgtcaccgccgacgtcgaggtgcccgaaggaccgcgcacctggtgcatgacccgcaagcc cggtgcctgagtcgacacccagctttcttgtacaaagtggtgataatcgaattccgatAATCAACCTCTGGATTACAA AATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATA CGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTC CTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAAC GTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCAC CACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAA CTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGAC AATTCCGTGGTGTTGTCGGGGAAATCATCGTCCTTTCCTTGGCTGCTCGCCTGTGTTGC CACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCG GACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTC GCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCatcgggaattcccgcggttcgctt taagaccaatgacttacaaggcagctgtagatcttagccactttttaaaagaaaaggggggactggaagggctaattcactccca acgaagacaagatctgctttttgcttgtactgggtctctctggttagaccagatctgagcctgggagctctctggctaactagggaac ccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctc agacccttttagtcagtgtggaaaatctctagcagtagtagttcatgtcatcttattattcagtatttataacttgcaaagaaatgaatat cagagagtgagaggaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcattttt ttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctggctctagctatcccgcccctaactccgcccatccc gcccctaactccgcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctcggcct ctgagctattccagaagtagtgaggaggcttttttggaggcctagggacgtacccaattcgccctatagtgagtcgtattacgcgcg ctcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgcc agctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatgggacgcgccct gtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctccttt cgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgcttt acggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgac gttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataaggg attttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaatattaacgcttacaattt aggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaata accctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcatttt gccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaa ctggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtgg cgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcac cagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcgg ccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgat cgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgc gcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggacc acttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagca ctggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagaca gatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttca tttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcag accccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctac cagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatact gttcttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagt ggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctg aacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaa agcgccacgcttcccgaagagagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagg gagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtca ggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcc tgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgca gcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcag ctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcacccca ggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacaggaaacagctatgaccatgatt acgccaagcgcgcaattaaccctcactaaagggaacaaaagctggagctgcaagctt
[0217] SEQ ID NO: 9 PL-21.0067 LV-UCOECBx3-pU6-stuffer-pEF1a-eGFP-T2A-Puro-WPRE Lentiviral expression vector containing UCOECBXS, a human U6 promoter to drive sgRNA expression and EF1a promoter driving eGFP-T2A-PuroR expression. sgRNA are cloned into this base vector by restriction digest to remove stutter and ligation of sgRNA DNA sequences. aatgtagtcttatgcaatactcttgtagtcttgcaacatggtaacgatgagttagcaacatgccttacaaggagagaaaaagcacc gtgcatgccgattggtggaagtaaggtggtacgatcgtgccttattaggaaggcaacagacgggtctgacatggattggacgaa ccactgaattgccgcattgcagagatattgtatttaagtgcctagctcgatacataaacgggtctctctggttagaccagatctgagc ctgggagctctctggctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctg ttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtggcgcccgaacagggacttga aagcgaaagggaaaccagaggagctctctcgacgcaggactcggcttgctgaagcgcgcacggcaagaggcgaggggcg gcgactggtgagtacgccaaaaattttgactagcggaggctagaaggagagagatgggtgcgagagcgtcagtattaagcgg gggagaattagatcgcgatgggaaaaaattcggttaaggccagggggaaagaaaaaatataaattaaaacatatagtatggg caagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactgggacagcta caaccatcccttcagacaggatcagaagaacttagatcattatataatacagtagcaaccctctattgtgtgcatcaaaggataga gataaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaccaccgcacagcaagcggc cgctgatcttcagacctggaggaggagatatgagggacaattggagaagtgaattatataaatataaagtagtaaaaattgaac cattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctttgttcc ttgggttcttgggagcagcaggaagcactatgggcgcagcgtcaatgacgctgacggtacaggccagacaattattgtctggtat agtgcagcagcagaacaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagct ccaggcaagaatcctggctgtggaaagatacctaaaggatcaacagctcctggggatttggggttgctctggaaaactcatttgc accactgctgtgccttggaatgctagttggagtaataaatctctggaacagatttggaatcacacgacctggatggagtgggaca gagaaattaacaattacacaagcttaatacactccttaattgaagaatcgcaaaaccagcaagaaaagaatgaacaagaatta ttggaattagataaatgggcaagtttgtggaattggtttaacataacaaattggctgtggtatataaaattattcataatgatagtagg aggcttggtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatattcaccattatcgtttcagacccac ctcccaaccccgaggggacccgacaggcccgaaggaatagaagaagaaggtggagagagagacagagacagatccatt cgattagtgaacggatctcgacggtatcgctagcttttaaaagaaaaggggggattggggggtacagtgcaggggaaagaata gtagacataatagcaacagacatacaaactaaagaattacaaaaacaaattacaaaaattcaaaattttactagtgattatcgg atcaactttgtatagaaaagttgctcgagcccgggaggtggtccctgcagttacgccaatgataacccccgccagaaaaatctta gtagccttccctttttgttttccgtgccccaactcggcggattgactcggccccttccggaaacacccgaatcaacttctagtcaaatt attgttcacgccgcaatgacccacccctggcccgcgtctgtggaactgacccctggtgtacaggagagttcgctgctgaaagtgg tcccaaaggggtactagtttttaagctcccaactccccctcccccagcgtctggaggattccacaccctcgcaccgcaggggcga ggaagtgggcggagtccggttttggcgccagccgctgaggctgccaagcagaaaagccaccgctgaggagactccggtcact gtcctcgccccgcctcccccttccctccccttggggaccaccgggcgccacgccgcgaacgttaagtgccgcggtcgtcggcgc ctccgccctcccccttgggccccaattcccagcgggcgcggcgcgcggcccctccccccgccgggcgcgcgcccgctgcccc gcccttcgtggccgcccggcgtgggcggtgccacccctccccccggcggccccgcgcgcagctcccggctccctcccccttcg gatgtggcttgagctgtaggcgcggagggccggctagcgagggcctatttcccatgattccttcatatttgcatatacgatacaagg ctgttagagagataattggaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgg gtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtg gaaaggacgaaacaccttcggcaggtggtgttgtaaatgagcacacaaaatacacatgctaaaatattatattctatgacctttat aaaatcaaccaaaatcttctttttaataactttagtatcaataattagaatttttatgttcctttttgcaaacttttaataaaaatgagcaaa ataaaaaaacgctagttttagtaactcgcgttgttttcttcacctttaataatagctactccaccacttgttcctaagcggtcagctcctg cttcaatcattttttgagcatcttcaaatgttctaactccaccagctgctttaactaaagcattgtctttaacaactgacttcattagtttaac atcttcaaatgttgcacctgattttgaaaatcctgttgatgttttaacaaattctaatccagcttcaacagctatttcacaagctttcatgat ttcttcttttgttaataaacaattttccataatacatttaacaacatgtgatccagctgctttttttacagctttcatgtcttctaaaactaattc ataatttttgtcttttaatgcaccaatatttaataccatatcaatttctgttgcaccatctttaattgcttcagaaacttcgaatgcttttgtagc tgttgtgcatgcacctagaggaaaacctacaacatttgttattcctacatttgtgccttttaataattctttacaatagcttgttcaatatga attaacacaaactgttgcaaaatcaaattcaattgcttcatcacataattgtttaatttcagctttcgtagcatcttgttttaataatgtgtg atctatatatttgtttagtttcattttttctcctatatattcatttttaattttaattctttaataatttcgtctactttaactttagcgttttgaacagatt caccaacacctataaaataaatttttagtttaggttcagttccacttgggcgaacagcaaatcatgacttatcttctaaataaaatttta gtaagtcttgtcctggcatattatacattccatcgatgtagtcttcaacattaacaactttaagtccagcaatttgagttaagggtgttgct ctcaatgatttcattaatggttcaatttttaatttcttttcttctggtttaaaattcaagtttaaagtgaaagtgtaatatgcacccatttctttaa ataaatcttctaaatagtctactaatgttttattttgttttttataaaatcaagcagcctctgctattaatatagaagcttgtattccatctttat ctctagctgagtcatcaattacatatccataactttcttcataagcaaaaacaaaatttaatccgttatcttcttctttagcaatttctctac ccattcatttaaatccagttaaagtttttacaatattaactccatatttttcatgagcgattctatcacccaaatcacttgttacaaaacttg aatatagagccggattttttggaatgctatttaagcgttttagatttgataattttcaatcaattaaaattggtcctgtttgatttccatctaat cttacaaaatgaccatcatgttttattgccattccaaatctgtcagcatctgggtcattcataataataatatctgcatcatgtttaatacc atattcaagcggtatttttcatgcaggatcaaattctggatttggatttacaacatttttaaatgtttcatcttcaaatgcatgctcttcaacc tcaataacgttatatcctgattcacgtaatatttttggggtaaatttagttcctgttccattaactgcgctaaaaataatttttaaatctttttta gcttcttgctcttttttgtacacctgcacCTGtttaagagctatgctGGAAACagcatagcaagtttaaataaggctagtccgttat caacttgaaaaagtggcaccgagtcggtgcTTTTTTTggctccggtgcccgtcagtgggcagagcgcacatcgcccacag tccccgagaagttggggggaggggtcggcaattgaaccggtgcctagagaaggtggcgcggggtaaactgggaaagtgatgt cgtgtactggctccgcctttttcccgagggtgggggagaaccgtatataagtgcagtagtcgccgtgaacgttctttttcgcaacgg gtttgccgccagaacacaggtaagtgccgtgtgtggttcccgcgggcctggcctctttacgggttatggcccttgcgtgccttgaatt acttccacctggctgcagtacgtgattcttgatcccgagcttcgggttggaagtgggtgggagagttcgaggccttgcgcttaagga gccccttcgcctcgtgcttgagttgaggcctggcctgggcgctggggccgccgcgtgcgaatctggtggcaccttcgcgcctgtct cgctgctttcgataagtctctagccatttaaaatttttgatgacctgctgcgacgctttttttctggcaagatagtcttgtaaatgcgggcc aagatctgcacactggtatttcggtttttggggccgcgggcggcgacggggcccgtgcgtcccagcgcacatgttcggcgaggc ggggcctgcgagcgcggccaccgagaatcggacgggggtagtctcaagctggccggcctgctctggtgcctggtctcgcgccg ccgtgtatcgccccgccctgggcggcaaggctggcccggtcggcaccagttgcgtgagcggaaagatggccgcttcccggcc ctgctgcagggagctcaaaatggaggacgcggcgctcgggagagcgggcgggtgagtcacccacacaaaggaaaagggc ctttccgtcctcagccgtcgcttcatgtgactccacggagtaccgggcgccgtccaggcacctcgattagttctcgagcttttggagt acgtcgtctttaggttggggggaggggttttatgcgatggagtttccccacactgagtgggtggagactgaagttaggccagcttgg cacttgatgtaattctccttggaatttgccctttttgagtttggatcttggttcattctcaagcctcagacagtggttcaaagtttttttcttcca tttcaggtgtcgtgacaagtttgtacaaaaaagcaggctggatccgccaccatggtgagcaagggcgaggagctgttcaccggg gtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgcca cctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacct acggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtcc aggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtga accgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagcc acaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggca gcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctga gcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggat cactctcggcatggacgagctgtacaagggtaccggaagcggagagggcaggggaagtcttctaacatgcggggacgtgga ggaaaatcccggccccatgaccgagtacaagcccacggtgcgcctcgccacccgcgacgacgtccccagggccgtacgca ccctcgccgccgcgttcgccgactaccccgccacgcgccacaccgtcgatccggaccgccacatcgagcgggtcaccgagct gcaagaactcttcctcacgcgcgtcgggctcgacatcggcaaggtgtgggtcgcggacgacggcgccgcggtggcggtctgg accacgccggagagcgtcgaagcgggggcggtgttcgccgagatcggcccgcgcatggccgagttgagcggttcccggctg gccgcgcagcaacagatggaaggcctcctggcgccgcaccggcccaaggagcccgcgtggttcctggccaccgtcggcgtct cgcccgaccaccagggcaagggtctgggcagcgccgtcgtgctccccggagtggaggcggccgagcgcgccggggtgccc gccttcctggagacctccgcgccccgcaacctccccttctacgagcggctcggcttcaccgtcaccgccgacgtcgaggtgccc gaaggaccgcgcacctggtgcatgacccgcaagcccggtgcctgagtcgacacccagctttcttgtacaaagtggtgataatcg aattccgataatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgc tgctttaatgcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgt ggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcag ctcctttccgggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctc ggctgttgggcactgacaattccgtggtgttgtcggggaagctgacgtcctttccatggctgctcgcctgtgttgccacctggattctg cgcgggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggcctcttc cgcgtcttcgccttcgccctcagacgagtcggatctccctttgggccgcctccccgcatcgggaattcccgcggttcgctttaagac caatgacttacaaggcagctgtagatcttagccactttttaaaagaaaaggggggactggaagggctaattcactcccaacgaa gacaagatctgctttttgcttgtactgggtctctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactg cttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacc cttttagtcagtgtggaaaatctctagcagtagtagttcatgtcatcttattattcagtatttataacttgcaaagaaatgaatatcagag agtgagaggaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcact gcattctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctggctctagctatcccgcccctaactccgcccatcccgcccc taactccgcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctcggcctctgag ctattccagaagtagtgaggaggcttttttggaggcctagggacgtacccaattcgccctatagtgagtcgtattacgcgcgctcac tggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagct ggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatgggacgcgccctgtag cggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgct ttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgctttacg gcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttg gagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggatttt gccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaatattaacgcttacaatttagg tggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataacc ctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgcc ttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactg gatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcg cggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcacca gtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggcc aacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcg ttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgc aaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccac ttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactg gggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagat cgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcattttt aatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagac cccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctacca gcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtt cttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtgg ctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaa cggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaag cgccacgcttcccgaagagagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgaggga gcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcagg ggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctg cgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagc gagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagct ggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccag gctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacaggaaacagctatgaccatgatta cgccaagcgcgcaattaaccctcactaaagggaacaaaagctggagctgcaagctt
[0218] sgRNA sequences
[0219] CRISPRi
[0220] SEQ ID NO: 10 NTC#1a tgtcgtgatgcgtagacgg (CRISPRa.v2 Weissman library)
[0221] SEQ ID NO: 11 NTC#3i gtgtgcaacctccgccgttg (CRISPRi. v2 Weissman library)
[0222] SEQ ID NO: 12 TREM2#1 (CRISPRi.v2 Weissman library) GTAAGATGAGCAGCCGGAG SEQ ID NO: 13 TREM2#2(CRISPRi.v2 Weissman library) AGGAGGGTGTGAAGAATAT SEQ ID NO: 14 TREM2#3 (CRISPRi.v2 Weissman library) GAGAAGGCATCACAGGGCA SEQ ID NO: 15 TREM2#4 (CRISPRi.v2 Weissman library) GCCCTGGGGTGAATTATGA SEQ ID NO: 16 Rabbit beta-globin polyadenylation (rBG Poly(A)) signal sequence tcctcaggtgcaggctgcctatcagaaggtggtggctggtgtggccaatgccctggctcacaaataccactgagatctttttccctct gccaaaaattatggggacatcatgaagccccttgagcatctgacttctggctaataaaggaaatttattttcattgcaatagtgtgttg gaattttttgtgtctctcactcggaaggacatatgggagggcaaatcatttaaaacatcagaatgagtatttggtttagagtttggcaa catatgcccatatgctggctgccatgaacaaaggttggctataaagaggtcatcagtatatgaaacagccccctgctgtccattcct tattccatagaaaagccttgacttgaggttagattttttttatattttgttttgtgttatttttttctttaacatccctaaaattttccttacatgtttta ctag ccag atttttcctcctctcctg actactcccagtcatag ctgtccctcttctcttatgg ag ate
[0223] SEQ ID NO: 17 Bovine growth hormone polyadenylation signal (bGH poly(A) signal) ctgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttccta ataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaaggggga ggattgggaagacaatagcaggcatgctggggatgcggtgggctctatgg
Claims
Claims1. A partially or fully differentiated iPSC-derived microglia cell comprising a transposon comprising a Ubiquitous Chromatin Opening Element (UCOE) nucleic acid sequence, a nucleic acid sequence of a gene of interest or a fragment thereof and optionally a 3’ polyadenylation sequence under control of a promoter, flanked by transposon-specific inverted terminal repeat sequences 5’ ITR and 3’ ITR.
2. A partially or fully differentiated iPSC-derived microglia cell of claim 1, wherein the UCOE is a CBX3-UCOE nucleic acid sequence that precedes CBX3.
3. A partially or fully differentiated iPSC-derived microglia cell of claim 1 or claim 2, wherein the UCOE is a nucleic acid sequence of SEQ ID NO: 1.
4. A partially or fully differentiated iPSC-derived microglia cell, wherein the transposon-specific inverted terminal repeat sequences are PB 5’ ITR (SEQ ID NO: 2) and PB 3’ ITR (SEQ ID NO: 3).
5. A partially or fully differentiated iPSC-derived microglia cell of any preceding claim wherein the promoter, gene of interest or fragment thereof and optionally 3’ polyadenylation sequence are comprised within an expression cassette.
6. A partially or fully differentiated iPSC-derived microglia cell of any preceding claim wherein the expression cassette comprises:(a) a promoter,(b) at least one cloning site (restriction enzyme cleavage site) or a multiple cloning site downstream of the promoter,(c) a gene of interest downstream of and operably linked to the promoter,(d) a polyadenylation sequence positioned downstream of and operably linked to the gene of interest,(e) optionally an internal ribosome entry site,(f) optionally a second promoter sequence positioned downstream of the gene of interest and polyadenylation sequence,(g) optionally a fluorescent protein sequence positioned downstream of the second promoter, (h) a self-cleaving peptide sequence,(i) optionally a gene for selection, e.g., for antibiotic selection,(j) optionally a fluorescent protein gene, and(k) optionally a second polyadenylation sequence.
7. A partially or fully differentiated iPSC-derived microglia cell of claim 6 wherein the expression cassette comprises:(a) a CAG promoter,(b) a multiple cloning site downstream of the promoter,(c) a gene of interest downstream of and operably linked to the promoter, optionally wherein the gene of interest is a dCas9-KRAB sequence of SEQ ID NO: 4 (a dead / deactivated Cas9 with the repression domains and a nuclear localisation signal sequence),(d) a T2A self-cleaving peptide sequence (SEQ ID NO: 5) positioned downstream of the gene of interest, e.g., dCas9-KRAB sequence of SEQ ID NO: 4, and(e) a fluorescent protein gene sequence encoding eGFP (enhanced green fluorescent protein) positioned downstream of the T2A self-cleaving peptide sequence (SEQ ID NO: 5),(f) an rBG polyadenylation sequence.
8. A partially or fully differentiated iPSC-derived microglia cell of any preceding claim comprising a vector comprising the transposon, preferably wherein the vector is a PiggyBac™ vector, such as a plasmid vector of SEQ ID NO: 6.
9. A partially or fully differentiated iPSC-derived microglia cell of any one of claims 1 to 8, optionally comprising a second vector capable of expressing a transposase, preferably wherein the transposase is a PiggyBac™ transposase, (e.g., Super PiggyBac™ transposase plasmid vector of SEQ ID NO: 7).
10. A partially or fully differentiated iPSC-derived microglia cell of any one of claims 1 to 9, wherein the transposon (comprising the expression construct optionally comprising the transgene) is integrated into the cell genome.
11. A partially-differentiated iPSC-derived microglia cell according to any one of claims 1 to 10.
12. A fully differentiated iPSC-derived microglia cell according to any one of claims 1 to 10.
13. A partially or fully differentiated iPSC-derived microglia cell according to any one of claims 1 to 12 wherein differentiation status is assessed by using a panel of flow cytometry markers.
14. A method for:(a) preventing silencing of a gene of interest (transgene)(b) promoting expression of a gene of interest,(c) expressing a product of a gene of interest, and I or(d) expressing a larger (> 7.0 Kb) expression cassette,comprising culturing a cell according to any one of claims 1 to 13.
15. A method for:(a) preventing silencing of a gene of interest (transgene) and I or(b) maintaining expression of a gene of interest during differentiation,comprising culturing a cell according to any one of claims 1 to 13 in the presence of a differentiation stimulus.
16. A method for knockdown (downregulation) of expression of a target gene comprising culturing a cell according to any one of claims 1 to 13 comprising dCas9-KRAB in the presence of the target gene-directed gRNA (e.g., delivered via lentiviral vector).
17. A composition comprising a cell of any one of claims 1 to 13 and a carrier or excipient.
18. A composition comprising a cell of any one of claims 1 to 13 and a vector capable of expressing transposase.
19. A gene transfer system comprising a cell of any one of claims 1 to 13 and a transposase.
20. A gene transfer system of claim 19, wherein the transposase is a Piggybac™ transposase.
21. A method for modulating expression of a gene of interest in a cell, comprising(a) providing a cell of any one of claims 1 to 13,(b) introducing a vector encoding a transposase, preferably a Piggybac™ transposase to the cell and(c) introducing a vector containing a guide RNA capable of controlling the expression of the target gene to the cell.
22. A method for integrating a gene of interest into the genome of a microglial cell comprising contacting a cell with the gene transfer system of claim 19 or 20, thereby integrating the gene of interest into the cell.
23. A method for knockdown (downregulation) of a target gene in a cell comprising contacting a cell with the gene transfer system of claim 19 or 20 thereby to introduce and integrate dCas9-KRAB and introducing a gRNA (preferably delivered via lentiviral vector) to the cell to knockdown expression of the target gene.
24. A method of using or a use of cells, compositions, systems or methods of the invention according to any one of claims 1 to 23:(a) for interrogation of gene function (either by activation or repression) in a time-controlled manner,(b) for the study of the role of a gene at the iPSC level (role of the gene during the microglia differentiation process),(c) for the study of as the role of the gene at a later stage (when microglia cells are mature), or(d) for the screening of a library of compounds on microglia cells edited to repress a target gene.
Citation Information
Patent Citations
Production of proteins using transposon-based vectors
EP2417263B1
Clinical pathway design method using smart contract
KR1020230059577A
Viral Vector
US20200157567A1
Expression vectors for eukaryotic expression systems
US20220033845A1
Transposase with enhanced insertion site selection properties
WO2020164702A1