Glucosylamylase variants and the polynucleotides encoding them

Abstract

This invention relates to glucose amylase variants. It also relates to polynucleotides encoding these variants; nucleic acid constructs, vectors, and host cells containing these polynucleotides; and methods of using these variants.

Description

[0001] References to sequence lists

[0002] This application contains a sequence list in a computer-readable form, which is incorporated herein by reference. Background of the Invention Invention Field

[0003] This invention relates to glucosylamylase variants, polynucleotides encoding these variants, methods for producing these variants, and methods for using these variants. The use of the glucosylamylase of the present invention for starch conversion to produce fermentation products, such as ethanol, and syrups (e.g., glucose) is also described. The invention further relates to a composition comprising the glucosylamylase of the present invention.

[0004] Related technical specifications

[0005] Glucoamylase (1,4-α-D-glucan glucosylhydrolase, EC 3.2.1.3) is an enzyme that catalyzes the release of D-glucose from the non-reducing ends of starch or related oligosaccharide and polysaccharide molecules. Glucoamylases are produced by several filamentous fungi and yeasts, among which those from the genus *Aspergillus* are the most commercially important.

[0006] Commercially, glucosylamylase is used to convert starch-containing materials that have been partially hydrolyzed by α-amylase into glucose. The glucose can then be converted directly or indirectly into fermentation products using a fermenting organism. Examples of commercial fermentation products include alcohols (e.g., ethanol, methanol, butanol, 1,3-propanediol); organic acids (e.g., citric acid, acetic acid, itaconic acid, lactic acid, gluconic acid, gluconate, lactic acid, succinic acid, 2,5-diketo-D-gluconic acid); ketones (e.g., acetone); amino acids (e.g., glutamic acid); gases (e.g., H2 and CO2); and more complex compounds, including, for example, antibiotics (e.g., penicillin and tetracycline); enzymes; vitamins (e.g., riboflavin, B vitamins). 12 Fermentation processes also produce edible alcohols (e.g., beer and wine) and dairy products (e.g., in the production of yogurt and cheese).

[0007] The final product can also be a syrup. For example, the final product can be glucose, but it can also be converted into fructose or a mixture of nearly equal amounts of glucose and fructose by glucose isomerase. Such a mixture, or a mixture further enriched with fructose, is the most commonly used commercially available high-fructose corn syrup (HFCS) worldwide.

[0008] One object of the present invention is to provide polypeptides having glucosylamylase activity and polynucleotides encoding these polypeptides, and these polypeptides and polynucleotides provide high yields in the production of fermentation products, such as ethanol production processes, including a one-step ethanol fermentation process of raw starch that has never been gelled (or cooked starch).

[0009] WO 2011 / 068803 discloses the isolation of glucosylamylase from fungi of the genus *Entoloma*. Specifically, it was isolated from *Entoloma viviparum* and *Entoloma densiflorum*.

[0010] This invention provides a glucose amylase variant with improved properties compared to its parent. Invention Overview

[0012] The present invention relates to a glucosylamylase variant comprising substitutions at one or more positions corresponding to positions 95, 59, 119, 121, 18, 426, and 316 of the polypeptide of SEQ ID NO: 3, wherein the variant has glucosylamylase activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity with the polypeptide of SEQ ID NO: 3.

[0013] The present invention also relates to isolated polynucleotides encoding these variants; nucleic acid constructs, vectors, and host cells containing these polynucleotides; and methods for generating these variants.

[0014] The present invention further relates to compositions comprising the variant glucosylamylase of the present invention.

[0015] In another aspect, the present invention relates to the use of this variant of glucosylamylase in the production of syrups or fermentation products.

[0016] In another aspect, the present invention relates to a method for producing fermentation products from starch-containing materials, comprising the following steps:

[0017] (a) Liquefying starch-containing materials in the presence of an α-amylase;

[0018] (b) to saccharify the liquefied material; and

[0019] (c) Fermentation is carried out using a fermenting organism;

[0020] Steps (a) and / or (b) are performed using at least one variant of the glucosyl amylase of the present invention.

[0021] In another aspect, the present invention relates to a method for producing fermentation products from starch-containing materials, comprising the following steps:

[0022] (a) Saccharifying the starch-containing material at a temperature below the initial gelation temperature of the starch-containing material; and

[0023] (b) Fermentation is carried out using a fermenting organism.

[0024] Step (a) is performed using at least one variant of the glucosyl amylase of the present invention.

[0025] definition

[0026] Glucoamylase: The term glucosylamylase (1,4-α-D-glucan glucosylhydrolase, EC 3.2.1.3) is defined as an enzyme that catalyzes the release of D-glucose from the non-reducing ends of starch or related oligosaccharide and polysaccharide molecules. For the purposes of this invention, glucosylamylase activity was determined according to the procedure described in the examples. Glucoamylase units (AGU) are defined as the amount of enzyme that hydrolyzes 1 micromole of maltose per minute under standard conditions (37°C, pH 4.3, substrate: 23.2 mM maltose, buffer: 0.1 M acetate, reaction time: 5 min).

[0027] The polypeptide of the present invention has at least 20%, preferably at least 40%, preferably at least 45%, more preferably at least 50%, more preferably at least 55%, more preferably at least 60%, more preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, even more preferably at least 90%, most preferably at least 95%, and even most preferably at least 100% glucosylamylase activity of the mature polypeptide of SEQ ID NO: 2.

[0028] In another embodiment, the polypeptide of the present invention has at least 20%, preferably at least 40%, preferably at least 45%, more preferably at least 50%, more preferably at least 55%, more preferably at least 60%, more preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, even more preferably at least 90%, most preferably at least 95%, and even most preferably at least 100% glucosylamylase activity of the polypeptide of SEQ ID NO: 3.

[0029] Allelic variants: The term "allelic variant" refers to any of two or more alternative forms of a gene occupying the same chromosomal locus. Allelic variations arise naturally from mutations and can lead to polymorphism within a population. Gene mutations can be silent (without alteration in the encoded polypeptide) or can encode a polypeptide with a modified amino acid sequence. Allelic variants of a polypeptide are polypeptides encoded by allelic variants of a gene.

[0030] cDNA: The term "cDNA" refers to a DNA molecule that can be prepared by reverse transcription from mature, spliced ​​mRNA molecules derived from eukaryotic or prokaryotic cells. cDNA lacks the intron sequences that can be present in the corresponding genomic DNA. Early initial RNA transcripts are precursors to mRNA, undergoing a series of processing steps, including splicing, before becoming mature, spliced ​​mRNA.

[0031] Coding sequence: The term "coding sequence" refers to a polynucleotide that directly identifies the amino acid sequence of a variant. The boundaries of a coding sequence are generally determined by an open reading frame that begins with a start codon (such as ATG, GTG, or TTG) and ends with a stop codon (such as TAA, TAG, or TGA). A coding sequence can be genomic DNA, cDNA, synthetic DNA, or a combination thereof.

[0032] Control Sequences: The term "control sequence" refers to the nucleic acid sequence necessary for the expression of a polynucleotide encoding a variant of the present invention. Each control sequence may be native (i.e., from the same gene) or exogenous (i.e., from a different gene) for the polynucleotide encoding that variant, or native or exogenous relative to each other. Such control sequences include, but are not limited to, pre-progenitors, polyadenylated sequences, propeptide sequences, promoters, signal peptide sequences, and transcription terminators. At a minimum, control sequences include promoters, as well as transcription and translation termination signals. These control sequences may be provided with multiple linkers for the purpose of introducing specific restriction enzyme sites that facilitate the linking of these control sequences to the coding region encoding a polynucleotide of a variant.

[0033] Expression: The term “expression” includes any step involved in variant generation, including but not limited to transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0034] Expression vector: The term “expression vector” refers to a linear or circular DNA molecule that includes a polynucleotide encoding a variant and that the polynucleotide is operatively linked to a control sequence provided for its expression.

[0035] Fragment: The term "fragment" refers to a polypeptide in which one or more (e.g., several) amino acids are missing from the amino and / or carboxyl termini of a mature polypeptide. The fragment possesses glucosylamylase activity. In one aspect, a fragment comprises at least 454 amino acid residues (e.g., amino acids 18 to 471 of SEQ ID NO: 2 or amino acids 1 to 454 of SEQ ID NO: 3), includes a catalytic domain, and has one or more substitutions according to the invention.

[0036] Highly stringent conditions: The term "highly stringent conditions" refers to pre-hybridization and hybridization for probes of at least 100 nucleotides in length, following standard DNA blotting procedures at 42°C in 5X SSPE, 0.3% SDS, 200 μg / ml cleaved and denatured salmon sperm DNA, and 50% formamide for 12 to 24 hours. Vector material is finally washed three times at 65°C for 15 minutes each time with 2X SSC and 0.2% SDS.

[0037] Host cell: The term "host cell" refers to any cell type that is readily transformed, transfected, transduced, etc., using nucleic acid constructs or expression vectors containing the polynucleotides of the present invention. The term "host cell" also encompasses any offspring of a parent cell that differs from the parent cell due to mutations occurring during replication.

[0038] Improved properties: The term "improved properties" refers to characteristics associated with variants that are improved compared to the parent. Such improved properties include, but are not limited to, specific activity, glucose tolerance, and thermal stability.

[0039] Isolated: The term “isolated” means a substance in a form or environment not present in nature. Non-limiting examples of isolated substances include (1) any non-naturally occurring substance, (2) any substance, including but not limited to any enzyme, variant, nucleic acid, protein, peptide, or cofactor, which is at least partially removed from one or all of the naturally occurring components associated with it; (3) any substance artificially modified relative to a naturally found substance; or (4) any substance modified by increasing the amount of the substance relative to other components associated with it (e.g., multiple copies of the gene encoding the substance; using a promoter stronger than the promoter associated with the gene encoding the substance). An isolated substance may be present in a fermentation broth sample.

[0040] Low stringency conditions: The term "low stringency conditions" refers to pre-hybridization and hybridization for probes of at least 100 nucleotides in length, following a standard DNA blotting procedure at 42°C in 5X SSPE, 0.3% SDS, 200 μg / ml cleaved and denatured salmon sperm DNA, and 25% formamide for 12 to 24 hours. Vector material is finally washed three times at 50°C for 15 minutes each time with 2X SSC and 0.2% SDS.

[0041] Mature polypeptide: The term "mature polypeptide" refers to a polypeptide in its final form after translation and any post-translational modifications such as N-terminal processing, C-terminal truncation, glycosylation, phosphorylation, etc. In one aspect, a mature polypeptide is amino acids 18 to 576 of SEQ ID NO: 2. Amino acids 1 to 17 of SEQ ID NO: 2 are signal peptides. It is known in the art that a host cell can produce a mixture of two or more different mature polypeptides (i.e., with different C-terminal and / or N-terminal amino acids) expressed by the same polynucleotide. A mature polypeptide is disclosed herein as SEQ ID NO: 3.

[0042] Mature polypeptide coding sequence: The term "mature polypeptide coding sequence" refers to a polynucleotide encoding a mature polypeptide with glucosylamylase activity. In one aspect, the mature polypeptide coding sequence is nucleotides 52 to 1728 (or 1731, including the stop codon) of SEQ ID NO: 1. Nucleotides 1 to 51 of SEQ ID NO: 1 encode a signal peptide.

[0043] Medium-tough conditions: The term "medium-tough conditions" refers to pre-hybridization and hybridization at 42°C for 12 to 24 hours in 5X SSPE, 0.3% SDS, 200 μg / ml cleaved and denatured salmon sperm DNA, and 35% formamide, following a standard DNA blotting procedure. Vector material is finally washed three times at 55°C for 15 minutes each time with 2X SSC and 0.2% SDS.

[0044] Medium-tough conditions: The term "medium-tough conditions" refers to pre-hybridization and hybridization at 42°C for 12 to 24 hours in 5X SSPE, 0.3% SDS, 200 μg / ml cleaved and denatured salmon sperm DNA, and 35% formamide, following a standard DNA blotting procedure. Vector material is finally washed three times at 60°C for 15 minutes each time with 2X SSC and 0.2% SDS.

[0045] Nucleic acid construct: The term “nucleic acid construct” refers to a single-stranded or double-stranded nucleic acid molecule that is isolated from a naturally occurring gene, modified in a way that does not normally exist in nature to contain a segment of nucleic acid, or synthesized, and that the nucleic acid molecule includes one or more control sequences.

[0046] Operable ligation: The term “operable ligation” refers to a construction in which a control sequence is positioned relative to the coding sequence of a polynucleotide so that the control sequence directs the expression of the coding sequence.

[0047] Parent or parental glucosylamylase: The term "parent" or "parental glucosylamylase" refers to a glucosylamylase that has been modified to produce the enzyme variant of the present invention. The parent can be a naturally occurring (wild-type) polypeptide or a variant or fragment thereof.

[0048] Sequence consistency: The degree of association between two amino acid sequences or two nucleotide sequences is described by the parameter "sequence consistency".

[0049] For the purposes of this invention, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J.Mol.Biol. 48:443-453) implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16:276-277) (preferably version 5.0.0 or later) was used to determine sequence consistency between two amino acid sequences. The parameters used were a vacancy opening penalty of 10, a vacancy extension penalty of 0.5, and an EBLOSUM62 substitution matrix (the EMBOSS version of BLOSUM62). The output of the "longest consistency" annotated by Needle (obtained using the -non-simplification option) was used as the percentage consistency and calculated as follows:

[0050] (Consistent residues x 100) / (Alignment length - Total number of vacancies in the alignment)

[0051] For the purposes of this invention, the Niederman-Wunsch algorithm (Needleman and Wunsch, 1970, see above) implemented in the Nieder program of the EMBOSS package (EMBOSS: European Molecular Biology Open Software Suite, Rice et al., 2000, see above) (preferably version 5.0.0 or later) is used to determine sequence consistency between two deoxyribonucleotide sequences. The parameters used are a vacancy opening penalty of 10, a vacancy expansion penalty of 0.5, and an EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix. The Nieder-annotated "longest consistency" output (obtained using the -non-simplified option) is used as the percentage consistency and calculated as follows:

[0052] (Consistent DNA nucleotides x 100) / (Alignment length - Total number of gaps in the alignment)

[0053] Subsequence: The term "subsequence" refers to a polynucleotide in which one or more (e.g., several) nucleotides are deleted from the 5′ and / or 3′ end of the mature polypeptide coding sequence; wherein the subsequence encodes a fragment having glucosylamylase activity. In one aspect, a subsequence encodes at least the catalytic domain of the variant according to the invention. For example, it comprises at least 1362 nucleotides (e.g., nucleotides 52 to 1413 of SEQ ID NO: 1).

[0054] Variants: The term "variant" means a polypeptide having glucosylamylase activity that includes alterations (i.e., substitutions, insertions, and / or deletions) at one or more (e.g., several) positions. Substitution means replacing an amino acid occupying a position with a different amino acid; deletion means removing an amino acid occupying a position; and insertion means adding an amino acid adjacent to and immediately following an amino acid occupying a position. Variants of the present invention have at least 20%, for example at least 40%, at least 45%, more preferably at least 50%, more preferably at least 55%, more preferably at least 60%, more preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, even more preferably at least 90%, most preferably at least 95%, and even most preferably at least 100% glucosylamylase activity of the mature polypeptide of SEQ ID NO: 3 of SEQ ID NO: 2.

[0055] Very High Tough Conditions: The term "very high tough conditions" refers to pre-hybridization and hybridization for probes of at least 100 nucleotides in length, following standard DNA blotting procedures at 42°C in 5X SSPE, 0.3% SDS, 200 μg / ml cleaved and denatured salmon sperm DNA, and 50% formamide for 12 to 24 hours. Vector material is finally washed three times at 70°C for 15 minutes each time with 2X SSC and 0.2% SDS.

[0056] Very low stringency conditions: The term "very low stringency conditions" refers to pre-hybridization and hybridization for probes of at least 100 nucleotides in length, following standard DNA blotting procedures, at 42°C in 5X SSPE, 0.3% SDS, 200 μg / ml cleaved and denatured salmon sperm DNA, and 25% formamide for 12 to 24 hours. Vector material is finally washed three times at 45°C for 15 minutes each time with 2X SSC and 0.2% SDS.

[0057] Wild-type glucosylamylase: The term "wild-type" glucosylamylase refers to a type of glucosylamylase expressed by naturally occurring microorganisms (such as bacteria, yeast, or filamentous fungi found in nature).

[0058] Variant Naming Conventions

[0059] For the purposes of this invention, the mature polypeptide disclosed in SEQ ID NO:3 is used to determine the corresponding amino acid residues in another glucosylamylase. The amino acid sequence of the other glucosylamylase is compared with the mature polypeptide disclosed in SEQ ID NO:3, and based on this comparison, the Niederman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) implemented in the Nieder program of the EMBOSS package (EMBOSS: European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (preferably version 5.0.0 or later) is used to determine the amino acid position number corresponding to any amino acid residue in the mature polypeptide disclosed in SEQ ID NO:3. The parameters used are an open space penalty of 10, an open space extension penalty of 0.5, and an EBLOSUM62 (the EMBOSS version of BLOSUM62) replacement matrix.

[0060] The identification of corresponding amino acid residues in another glucosylamylase can be determined by using several computer programs that compare multiple polypeptide sequences with their corresponding default parameters. These computer programs include, but are not limited to, MUSCLE (multiple sequence comparisons by logarithmic prediction; version 3.5 or later; Edgar, 2004, Nucleic Acids Research 32: 1792-1797), MAFFT (version 6.857 or later; Katoh and Kuma, 2002, Nucleic Acids Research 30: 3059-3066; Kato et al., 2005, Nucleic Acids Research 33: 511-518; Kato, 2007, Bioinformatics 23: 372-374; Kato et al., 2009, Methods in Molecular Biology). Biology 537:39-64; Kato Kazuto, 2010, Bioinformatics 26:1899-1900) and EMBOSS EMMA using ClustalW (1.83 or later; Thompson et al., 1994, Nucleic Acid Research 22:4673-4680).

[0061] When other enzymes deviate from the mature polypeptide of SEQ ID NO: 2, making traditional sequence-based comparison methods unable to detect their relationship (Lindahl and Elofsson, 2000, Journal of Molecular Biology 295: 613-615), other pairwise sequence comparison algorithms can be applied. Greater sensitivity in sequence-based searches can be achieved using search programs that utilize probabilistic representations (profiles) of polypeptide families to search a database. For example, the PSI-BLAST program generates multiple profiles through an iterative database search process and is capable of detecting distant homologs (Atschul et al., 1997, Nucleic Acids Res. 25: 3389-3402). Even greater sensitivity can be achieved if the polypeptide family or superfamily has one or more representatives in a protein structure database. Procedures such as GenTHREADER (Jones, 1999, J.Mol.Biol. 287: 797-815; McGuffin and Jones, 2003, Bioinformatics 19: 874-881) utilize information from various sources (PSI-BLAST, secondary structure prediction, structural alignment spectra, and solvation potential) as input to neural networks that predict the structural folding of query sequences. Similarly, the method of Gough et al., 2000, J.Mol.Biol. 313: 903-919 can be used to align sequences of unknown structures with superfamily models existing in the SCOP database. These alignments can then be used to generate homology models of peptides, and the accuracy of such models can be evaluated using various tools developed for this purpose.

[0062] For proteins with known structures, several tools and resources are available for retrieving and generating structure alignments. For example, the SCOP superfamily of proteins has already been structurally aligned, and those alignments are accessible and downloadable. Various algorithms, such as distance alignment matrices (Holm and Sander, 1998, Proteins 33: 88-96) or combined extensions (Shindyalov and Bourne, 1998, Protein Engineering 11: 739-747), can be used to align two or more protein structures, and implementations of these algorithms can also be used to query structure databases with structures of interest to discover possible structural homologs (e.g., Holm and Park, 2000, Bioinformatics 16: 566-567).

[0063] In the description of variations of the invention, the following nomenclature is provided for ease of reference. The recognized IUPAC single-letter or three-letter amino acid abbreviations are used.

[0064] replace. For amino acid substitutions, the following nomenclature is used: initial amino acid, position, substituted amino acid. Therefore, the substitution of threonine at position 226 with alanine is represented as "Thr226Ala" or "T226A". Multiple mutations are separated by plus signs ("+"), for example, "Gly205Arg+Ser411Phe" or "G205R+S411F" represent the substitution of glycine (G) with arginine (R) at positions 205 and 411, respectively, and the substitution of serine (S) with phenylalanine (F).

[0065] Missing. For amino acid deletions, use the following nomenclature: initial amino acid, position, * Therefore, a glycine deletion at position 195 is represented as "Gly195*" or "G195*". Multiple deletions are separated by a plus sign ("+"), for example, "Gly195". * +Ser411 * "or "G195 * +S411 * ".

[0066] insert.For amino acid insertions, the following nomenclature is used: initial amino acid, position, initial amino acid, inserted amino acid. Therefore, the insertion of lysine after glycine at position 195 is represented as "Gly195GlyLys" or "G195GK". Insertions of multiple amino acids are represented as [original amino acid, position, original amino acid, inserted amino acid #1, inserted amino acid #2; etc.]. For example, the insertion of lysine and alanine after glycine at position 195 is represented as "Gly195GlyLysAla" or "G195GKA".

[0067] <![CDATA[ Parents: ]]> <![CDATA[ Variants: ]]> 195 195 195a 195b G GKA

[0068] Multiple changes. Variants containing multiple changes are separated by a plus sign ("+"), such as "Arg170Tyr+Gly195Glu" or "R170Y+G195E", which represent that arginine and glycine at positions 170 and 195 are replaced by tyrosine and glutamic acid, respectively.

[0069] Different changes. When different changes can be introduced at a single position, these changes are separated by a comma, for example, "Arg170Tyr,Glu" means that arginine at position 170 is replaced by either tyrosine or glutamic acid. Therefore, "Tyr167Gly,Ala+Arg170Gly,Ala" represents the following variant:

[0070] “Tyr167Gly+Arg170Gly”, “Tyr167Gly+Arg170Ala”, “Tyr167Ala+Arg170Gly”, and “Tyr167Ala+Arg170Ala”.

[0071] Detailed Description of the Invention

[0072] This invention relates to glucosylamylase variants comprising substitutions at one or more (e.g., several) positions corresponding to positions 59, 95, 119, 121, 18, 426, and 316 of the polypeptide of SEQ ID NO: 3, wherein the variant possesses glucosylamylase activity. Specifically, these variants have improved properties compared to the glucosylamylase disclosed as SEQ ID NO: 3. In particular, these improved properties are improved thermostability, increased glucose tolerance, and / or increased specific activity. The variants according to the invention have at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity with the polypeptide of SEQ ID NO: 3.

[0073] The mature polypeptide of SEQ ID NO:2 corresponds to SEQ ID NO:3. Therefore, the position number referenced here corresponds to the position number of SEQ ID NO:3.

[0074] variants

[0075] The present invention provides a variety of glucosylamylase variants that contain changes, specifically substitutions, at one or more (e.g., several) positions corresponding to positions 59, 95, 119, 121, 18, 426, and 316.

[0076] In one embodiment, these variants are separated.

[0077] In one embodiment, the variant has at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity with the parental glucosylamylase.

[0078] In another embodiment, the variant has at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, for example at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity with the mature polypeptide of SEQ ID NO: 2. In one embodiment, the mature polypeptide of SEQ ID NO: 2 is SEQ ID NO: 3.

[0079] Therefore, in one embodiment, the present invention relates to a glucosylamylase variant comprising substitutions at one or more positions corresponding to positions 95, 59, 119, 121, 18, 426, and 316 of the polypeptide of SEQ ID NO: 3, wherein the variant has glucosylamylase activity, and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity with the polypeptide of SEQ ID NO: 3.

[0080] In another aspect, the variant includes substitutions at one or more positions corresponding to positions 59, 95, 119, 121, 18, 426, and 316. In another aspect, the variant includes substitutions at two positions corresponding to any one of positions 59, 95, 119, 121, 18, 426, and 316. In another aspect, the variant includes substitutions at three positions corresponding to any one of positions 59, 95, 119, 121, 18, 426, and 316. In another aspect, the variant includes substitutions at four positions corresponding to any one of positions 59, 95, 119, 121, 18, 426, and 316. In another aspect, the variant includes substitutions at five positions corresponding to any one of positions 59, 95, 119, 121, 18, 426, and 316. In another aspect, the variant includes substitutions at six positions corresponding to any one of positions 59, 95, 119, 121, 18, 426, and 316. On the other hand, the variants include substitutions at each position corresponding to positions 59, 95, 119, 121, 18, 426, and 316.

[0081] In another aspect, the variant change includes substitution or being constituted at the position corresponding to position 18. In another aspect, the amino acid at the position corresponding to position 18 is substituted with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, or Tyr, preferably substituted with Phe. In another aspect, the variant change includes substitution V18F of the polypeptide of SEQ ID NO: 3 or is constituted by such substitution.

[0082] In another aspect, the variant change includes substitution or being constituted at the position corresponding to position 59. In another aspect, the amino acid at the position corresponding to position 59 is substituted with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, or Tyr, preferably substituted with Ala, Cys, Gly, or Ile. In another aspect, the variant change includes substitution of the polypeptide of SEQ ID NO: 3 with V59A, V59C, V59G, or V59I, or being constituted by these substitutions.

[0083] In another aspect, the variant change includes substitution or being constituted at the position corresponding to position 95. In another aspect, the amino acid at the position corresponding to position 95 is substituted with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Thr, Trp, Tyr, or Val, preferably Pro. In another aspect, the variant change includes substitution S95P of the polypeptide of SEQ ID NO: 3 or being constituted by such substitution.

[0084] In another aspect, the variant change includes substitution or being constituted at the position corresponding to position 119. In another aspect, the amino acid at the position corresponding to position 119 is substituted with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Trp, Tyr, or Val, preferably substituted with Trp. In another aspect, the variant change includes substitution T119W of the polypeptide of SEQ ID NO: 3 or being constituted by such substitution.

[0085] In another aspect, the variant change includes substitution or being constituted at the position corresponding to position 121. In another aspect, the amino acid at the position corresponding to position 121 is substituted with Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably substituted with Pro. In another aspect, the variant change includes substitution A121P for the polypeptide of SEQ ID NO: 3 or being constituted by such substitution.

[0086] In another aspect, the variant change includes substitution or being constituted at the position corresponding to position 316. In another aspect, the amino acid at the position corresponding to position 316 is substituted with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Thr, Trp, Tyr, or Val, preferably substituted with Trp. In another aspect, the variant change includes substitution S316W of the polypeptide of SEQ ID NO: 3 or is constituted by such substitution.

[0087] In another aspect, the variant change includes substitution or being constituted at the position corresponding to position 426. In another aspect, the amino acid at position 426 is substituted with Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably substituted with Gly. In another aspect, the variant change includes substitution A426G of the polypeptide of SEQ ID NO: 3 or being constituted by such substitution.

[0088] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 18 and 59, such as those described above.

[0089] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 18 and 95, such as those described above.

[0090] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 18 and 119, such as those described above.

[0091] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 18 and 121, such as those described above.

[0092] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 18 and 316, such as those described above.

[0093] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 18 and 426, such as those described above.

[0094] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 59 and 95, such as those described above.

[0095] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 59 and 119, such as those described above.

[0096] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 59 and 121, such as those described above.

[0097] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 59 and 316, such as those described above.

[0098] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 59 and 426, such as those described above.

[0099] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 95 and 119, such as those described above.

[0100] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 95 and 121, such as those described above.

[0101] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 95 and 316, such as those described above.

[0102] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 95 and 426, such as those described above.

[0103] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 119 and 121, such as those described above.

[0104] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 119 and 316, such as those described above.

[0105] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 119 and 426, such as those described above.

[0106] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 121 and 316, such as those described above.

[0107] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 121 and 426, such as those described above.

[0108] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 316 and 426, such as those described above.

[0109] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 59, 95, and 119, such as those described above.

[0110] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 59, 95, and 121, such as those described above.

[0111] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 59, 95, and 316, such as those described above.

[0112] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 59, 119, and 121, such as those described above.

[0113] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 59, 119, and 316, such as those described above.

[0114] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 95, 119, and 121, such as those described above.

[0115] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 95, 119, and 316, such as those described above.

[0116] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 119, 121, and 316, such as those described above.

[0117] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 59, 95, and 18, such as those described above.

[0118] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 59, 95, and 426, such as those described above.

[0119] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 59, 119, and 18, such as those described above.

[0120] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 59, 119, and 426, such as those described above.

[0121] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 59, 121, and 18, such as those described above.

[0122] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 59, 121, and 426, such as those described above.

[0123] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 59, 121, and 316, such as those described above.

[0124] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 59, 18, and 426, such as those described above.

[0125] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 59, 18, and 316, such as those described above.

[0126] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 59, 426, and 316, such as those described above.

[0127] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 95, 119, and 18, such as those described above.

[0128] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 95, 119, and 426, such as those described above.

[0129] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 95, 121, and 18, such as those described above.

[0130] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 95, 121, and 426, such as those described above.

[0131] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 95, 121, and 316, such as those described above.

[0132] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 95, 18, and 426, such as those described above.

[0133] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 95, 18, and 316, such as those described above.

[0134] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 95, 426, and 316, such as those described above.

[0135] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 119, 121, and 18, such as those described above.

[0136] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 119, 121, and 426, such as those described above.

[0137] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 119, 18, and 426, such as those described above.

[0138] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 119, 18, and 316, such as those described above.

[0139] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 119, 426, and 316, such as those described above.

[0140] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 121, 18, and 426, such as those described above.

[0141] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 121, 18, and 316, such as those described above.

[0142] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 121, 426, and 316, such as those described above.

[0143] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 18, 426, and 316, such as those described above.

[0144] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 59, 95, 119, and 121, such as those described above.

[0145] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 59, 95, 119, and 18, such as those described above.

[0146] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 59, 95, 119, and 426, such as those described above.

[0147] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 59, 95, 119, and 316, such as those described above.

[0148] In another aspect, the variant changes include substitutions or composition thereof at positions corresponding to positions 59, 95, 121, and 18, such as those described above.

[0149] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 59, 95, 121, and 426, such as those described above.

[0150] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 59, 95, 121, and 316, such as those described above.

[0151] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 59, 95, 18, and 426, such as those described above.

[0152] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 59, 95, 18, and 316, such as those described above.

[0153] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 59, 95, 426, and 316, such as those described above.

[0154] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 59, 119, 121, and 18, such as those described above.

[0155] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 59, 119, 121, and 426, such as those described above.

[0156] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 59, 119, 121, and 316, such as those described above.

[0157] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 59, 119, 18, and 426, such as those described above.

[0158] In another aspect, the variant changes include substitutions or composition thereof at positions corresponding to positions 59, 119, 18, and 316, such as those described above.

[0159] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 59, 119, 426, and 316, such as those described above.

[0160] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 59, 121, 18, and 426, such as those described above.

[0161] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 59, 121, 18, and 316, such as those described above.

[0162] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 59, 121, 426, and 316, such as those described above.

[0163] In another aspect, the variant changes include substitutions or composition thereof at positions corresponding to positions 59, 18, 426, and 316, such as those described above.

[0164] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 95, 119, 121, and 18, such as those described above.

[0165] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 95, 119, 121, and 426, such as those described above.

[0166] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 95, 119, 121, and 316, such as those described above.

[0167] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 95, 119, 18, and 426, such as those described above.

[0168] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 95, 119, 18, and 316, such as those described above.

[0169] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 95, 119, 426, and 316, such as those described above.

[0170] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 95, 121, 18, and 426, such as those described above.

[0171] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 95, 121, 18, and 316, such as those described above.

[0172] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 95, 121, 426, and 316, such as those described above.

[0173] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 95, 18, 426, and 316, such as those described above.

[0174] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 119, 121, 18, and 426, such as those described above.

[0175] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 119, 121, 18, and 316, such as those described above.

[0176] In another aspect, the variant changes include substitutions or composition thereof at positions corresponding to positions 119, 121, 426, and 316, such as those described above.

[0177] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 119, 18, 426, and 316, such as those described above.

[0178] In another aspect, the variant changes include substitutions or components thereof at positions corresponding to positions 121, 18, 426, and 316, such as those described above.

[0179] In another aspect, the variant includes or consists of a combination of specific substitutions listed below or specific substitutions of the polypeptide of SEQ ID NO: 3:

[0180] V18F; or

[0181] V59A; or

[0182] V59C; or

[0183] V59G; or

[0184] V59I; or

[0185] S95P; or

[0186] T119W; or

[0187] A121P; or

[0188] A426G; or

[0189] S316W; or

[0190] S95P+A121P; or

[0191] V59A+S95P; or

[0192] S95P+T119W; or

[0193] V59A+S95P+A121P; or

[0194] S95P+T119W+A121P; or

[0195] V59C+A426G; or

[0196] V59G+A426G; or

[0197] V18F+V59I; or

[0198] V59C+S95P+T119W+A426G; or

[0199] V59C+S95P+T119W+A121P+A426G; or

[0200] V59C+S95P+A121P+A426G; or

[0201] V18F+V59I+S95P+A121P; or

[0202] V18F+V59I+S95P+T119W+A121P; or

[0203] S95P+A121P+S316W; and wherein the variant has glucosylamylase activity, and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity with the polypeptide of SEQ ID NO: 3.

[0204] In another embodiment, the variant comprises or consists of a combination of specific substitutions listed below or specific substitutions of the polypeptide of SEQ ID NO: 3:

[0205] V59A; or

[0206] S95P; or

[0207] T119W; or

[0208] A121P; or

[0209] S95P+A121P; or

[0210] V59A+S95P; or

[0211] S95P+T119W; or

[0212] V59A+S95P+A121P; or

[0213] S95P+T119W+A121P; wherein the variant has glucosylamylase activity, and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity with the polypeptide of SEQ ID NO: 3.

[0214] Compared to the glucosylamylase of SEQ ID NO: 3, these specific substitutions and combinations of substitutions have been shown here to increase the thermal stability of the variant glucosylamylase.

[0215] In another embodiment, the variant comprises or consists of a combination of specific substitutions listed below or specific substitutions of the polypeptide of SEQ ID NO: 3:

[0216] V59C+S95P+T119W+A426G; or

[0217] V59C+S95P+T119W+A121P+A426G; or

[0218] V59C+S95P+A121P+A426G; or

[0219] V18F+V59I+S95P+A121P; or

[0220] V18F+V59I+S95P+T119W+A121P; and wherein the variant has glucosylamylase activity, and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity with the polypeptide of SEQ ID NO: 3.

[0221] These specific substitutions and combinations of substitutions have been shown herein to increase the thermostability of the variant glucosylamylase according to the invention, along with reducing its glucose inhibition.

[0222] In another embodiment, the variant comprises or consists of a combination of specific substitutions listed below or specific substitutions of the polypeptide of SEQ ID NO: 3:

[0223] S95P+A121P+S316W; and wherein the variant has glucosylamylase activity, and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity with the polypeptide of SEQ ID NO: 3.

[0224] This particular combination of alternatives has been shown here to increase the thermostability of the variant glucosylamylase according to the invention, along with its specific activity.

[0225] In one embodiment, improved thermostability of the glucosylamylase variant according to the invention is provided by introducing one or more substitutions selected from the group consisting of 59A, 95P, 119W, and 121P, and specifically, the glucosylamylase variant includes substitutions of 95P+121P, more specifically S95P+A121P, and wherein the variant has glucosylamylase activity, and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity with the polypeptide of SEQ ID NO: 3.

[0226] In another embodiment, reduced glucose inhibition of the glucosylamylase variant according to the invention is provided by introducing one or more of a combination of substitutions selected from the group consisting of: 59C+426G, 59G+426G, and 18F+59I, more specifically, V59C+A426G, or V59G+A426G, or V18F+V59I, and wherein the variant has glucosylamylase activity, and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity with the polypeptide of SEQ ID NO: 3.

[0227] In another embodiment, by introducing a 316W substitution, specifically S316W, an increased specific activity of the glucosylamylase variant according to the invention is provided, wherein the variant has glucosylamylase activity, and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity with the polypeptide of SEQ ID NO: 3.

[0228] In one specific embodiment, the specific activity of the variant glucosylamylase can be improved by removing the starch-binding domain (SBD), thereby resulting in the G2 form of the variant. In a more specific embodiment, in the G2 form, amino acids 455-559 of SEQ ID NO: 3 are removed. As illustrated in the examples, this has been observed for the G2 forms of variants including S95P+A121P+S316W or S95P+A121P.

[0229] Therefore, in a specific embodiment, by removing the SBD, specifically 455-559 of SEQ ID NO: 3, more specifically including the SBD in variants of S95P+A121P+S316W or S95P+A121P, an increased specific activity of the glucosylamylase variant according to the invention is provided, wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity with the polypeptide of SEQ ID NO: 3.

[0230] Variations may further include one or more additional substitutions at one or more (e.g., several) other locations.

[0231] It should be noted that for all the specific variants disclosed, such another change can be introduced without significantly affecting the properties of these glucosylamylase variants. In one respect, apart from the specific substitutions discussed herein, the number of substitutions in the variants of the invention is 1-20, for example 1-10 and 1-5, for example 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 substitutions.

[0232] Therefore, the percentage of sequence identity of the variant peptide compared to the parent peptide of SEQ ID NO:3 can be at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, for example at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity with the peptide of SEQ ID NO:3.

[0233] In one specific embodiment, the above variant has glucosylamylase activity and the variant has at least 85% but less than 100% sequence identity with the polypeptide of SEQ ID NO: 3.

[0234] In one specific embodiment, the above variant has glucosylamylase activity and the variant has at least 90% but less than 100% sequence identity with the polypeptide of SEQ ID NO: 3.

[0235] In one specific embodiment, the above variant has glucosylamylase activity and the variant has at least 91% but less than 100% sequence identity with the polypeptide of SEQ ID NO: 3.

[0236] In one specific embodiment, the above variant has glucosylamylase activity and the variant has at least 92% but less than 100% sequence identity with the polypeptide of SEQ ID NO: 3.

[0237] In one specific embodiment, the above variant has glucosylamylase activity and the variant has at least 93% but less than 100% sequence identity with the polypeptide of SEQ ID NO: 3.

[0238] In one specific embodiment, the above variant has glucosylamylase activity and the variant has at least 94%, but less than 100%, sequence identity with the polypeptide of SEQ ID NO: 3.

[0239] In one specific embodiment, the above variant has glucosylamylase activity and the variant has at least 95% but less than 100% sequence identity with the polypeptide of SEQ ID NO: 3.

[0240] In one specific embodiment, the above variant has glucosylamylase activity and the variant has at least 96%, but less than 100%, sequence identity with the polypeptide of SEQ ID NO: 3.

[0241] In one specific embodiment, the above variant has glucosylamylase activity and the variant has at least 97%, but less than 100%, sequence identity with the polypeptide of SEQ ID NO: 3.

[0242] In one specific embodiment, the above variant has glucosylamylase activity and the variant has at least 98%, but less than 100%, sequence identity with the polypeptide of SEQ ID NO: 3.

[0243] In one specific embodiment, the above variant has glucosylamylase activity and the variant has at least 99%, but less than 100%, sequence identity with the polypeptide of SEQ ID NO: 3.

[0244] In addition to the specific substitutions described herein, these amino acid changes can be minor, i.e., conserved amino acid substitutions or insertions that do not significantly affect protein folding and / or activity; small deletions typically of 1–30 amino acids; small amino or carboxyl-terminal extensions, such as methionine residues at the amino terminus; small linker peptides of up to 20–25 residues; or small extensions that are easily purified by altering net charge or another function, such as polyhistidine tracts, antigenic epitopes, or binding domains.

[0245] Examples of conserved substitutions are found in the following group: basic amino acids (arginine, lysine, and histidine), acidic amino acids (glutamic acid and aspartic acid), polar amino acids (glutamine and asparagine), hydrophobic amino acids (leucine, isoleucine, and valine), aromatic amino acids (phenylalanine, tryptophan, and tyrosine), and small amino acids (glycine, alanine, serine, threonine, and methionine). Amino acid substitutions that generally do not alter specific reactivity are known in the art and are described, for example, by H. Neurath and RL Hill, 1979, in *The Proteins*, Academic Press, New York. Common substitutes are Ala / Ser, Val / Ile, Asp / Glu, Thr / Ser, Ala / Gly, Ala / Thr, Ser / Asn, Ala / Val, Ser / Gly, Tyr / Phe, Ala / Pro, Lys / Arg, Asp / Asn, Leu / Ile, Leu / Val, Ala / Glu, and Asp / Gly.

[0246] Alternatively, amino acid alterations have the property of changing the physicochemical properties of peptides. For example, amino acid alterations can improve the thermal stability of peptides, change substrate specificity, change the optimal pH, and so on.

[0247] Essential amino acids in peptides can be identified using procedures known in the art, such as site-directed mutagenesis or alanine scanning mutagenesis (Cunningham and Wells, 1989, Science 244: 1081-1085). In the latter technique, a single alanine mutation is introduced at each residue in the molecule, and the glucosidase activity of the resulting mutant molecule is tested to identify amino acid residues essential to the molecule's activity. See also Hilton et al., 1996, Journal of Biochemistry 271: 4699-4708. The active site of the enzyme or other biological interactions can also be determined by combining mutations of amino acids at hypothetical contact sites with physical analysis of the structure, such as by techniques like nuclear magnetic resonance, crystallography, electron diffraction, or photoaffinity labeling. See, for example, de Vos et al., 1992, Science 255: 306-312; Smith et al., 1992, Journal of Molecular Biology 224: 899-904; Wlodaver et al., 1992, FEBS Lett. 309: 59-64. Essential amino acids can also be identified by comparison with related peptides.

[0248] In one embodiment, this variant exhibits improved specific activity compared to the parent enzyme. Specific activity was determined using an AGU assay.

[0249] In one embodiment, the variant exhibits improved glucose tolerance (or reduced glucose inhibition) compared to the parent. Glucose inhibition is defined as the ratio of glucosylamylase activity with and without 30% glucose relative to the parental enzyme disclosed in SEQ ID NO: 3. For details, see the Materials and Methods section included herein.

[0250] In one embodiment, this variant exhibits improved thermal stability compared to the parent enzyme. Thermal stability was measured as residual activity at 32°C using a Kikkoman assay kit. For details, see Materials and Methods herein.

[0251] Parental glucosidase

[0252] The parental glucosylamylase can be (a) a polypeptide having at least 85% sequence identity with the mature polypeptide of SEQ ID NO: 2; (b) a polypeptide encoded by a polynucleotide hybridized to the coding sequence of (i) the mature polypeptide of SEQ ID NO: 1 or (ii) the full-length complement of (i) under medium- to high stringency conditions; or (c) a polypeptide encoded by a polynucleotide having at least 70% sequence identity with the coding sequence of the mature polypeptide of SEQ ID NO: 1.

[0253] In one aspect, the parent has at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with the mature polypeptide of SEQ ID NO: 2, said mature polypeptide having glucosylamylase activity. In another aspect, the amino acid sequence of the parent differs from that of the mature polypeptide of SEQ ID NO: 2 by up to 10 amino acids, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.

[0254] In another aspect, the parent comprises or consists of the amino acid sequence of SEQ ID NO: 2. In another aspect, the parent comprises or consists of the mature polypeptide of SEQ ID NO: 2. In another aspect, the parent comprises or consists of SEQ ID NO: 3.

[0255] In another embodiment, the parent is an allelic variant of the mature polypeptide of SEQ ID NO: 2.

[0256] On the other hand, the parent is encoded by a polynucleotide that hybridizes under high-strict or very high-strict conditions with (i) the mature polypeptide coding sequence of SEQ ID NO: 1, or (ii) the full-length complement of (i) (Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual, 2nd edition, Cold Spring Harbor, New York).

[0257] Nucleic acid probes can be designed using the polynucleotide or a subsequence of SEQ ID NO: 1, together with the polypeptide or fragment of SEQ ID NO: 2, to identify and clone parental DNA encoding strains from different genera or species according to methods well known in the art. Specifically, such probes can be hybridized with the genomic DNA or cDNA of the cells of interest according to standard DNA blotting procedures to identify and isolate the corresponding gene therein. These probes can be significantly shorter than the complete sequence, but should be at least 15 nucleotides long, for example, at least 25, at least 35, or at least 70 nucleotides. Preferably, the nucleic acid probe is at least 100 nucleotides long, for example, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, or at least 900 nucleotides. Both DNA and RNA probes can be used. Typically, the probes are labeled (e.g., with...). 32 P, 3 H, 35 This invention covers probes containing biotin (or avidin) to detect corresponding genes.

[0258] Genomic DNA or cDNA libraries prepared from other strains of this type can be screened for DNA that hybridizes to the probes described above and encodes a parent. Genomic DNA or other DNA from these other strains can be separated by agarose or polyacrylamide gel electrophoresis, or other separation techniques. DNA from the library or separated DNA can be transferred and immobilized on nitrocellulose or other suitable vector materials. To identify clones or DNA that hybridize to SEQ ID NO: 1 or its subsequences, the vector material is used for DNA blotting.

[0259] For the purposes of this invention, hybridization refers to the hybridization of a polynucleotide with a nucleic acid probe labeled with the following: (i) SEQ ID NO: 1; (ii) the mature polypeptide coding sequence of SEQ ID NO: 1; (iii) their full-length complements; or (iv) their subsequences; the hybridization is performed under very low to very high stringent conditions. Molecules hybridized with nucleic acid probes under these conditions can be detected using, for example, X-ray film or any other detection method known in the art.

[0260] In one respect, the nucleic acid probe is the coding sequence of the mature polypeptide of SEQ ID NO: 1. In another respect, the nucleic acid probe is nucleotides 52 to 1728 of SEQ ID NO: 1. In yet another respect, the nucleic acid probe is a polynucleotide encoding: the polypeptide of SEQ ID NO: 2; its mature polypeptide; or a fragment thereof. In yet another respect, the nucleic acid probe is SEQ ID NO: 1.

[0261] In another embodiment, the parent is encoded by a polynucleotide having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with the mature polypeptide encoding sequence of SEQ ID NO: 1.

[0262] The polypeptide can be a hybrid polypeptide in which a region of one polypeptide is fused to the N-terminus or C-terminus of a region of another polypeptide.

[0263] The parent peptide can be a fusion peptide or a cleavable fusion peptide, wherein another peptide is fused at the N-terminus or C-terminus of the peptide of the present invention. Fusion peptides are generated by fusing a polynucleotide encoding another peptide into the polynucleotide of the present invention. Techniques for generating fusion peptides are known in the art and include linking coding sequences of the peptides such that they are in a frame and that the expression of the fusion peptide is under the control of one or more promoters and terminators. Fusion peptides can also be constructed using integrin technology, wherein the fusion peptide is generated post-translational (Cooper et al., 1993, EMBO J. 12: 2575-2583; Dawson et al., 1994, Science 266: 776-779).

[0264] Fusion peptides may further include a cleavage site between the two peptides. This site is cleaved upon secretion of the fusion protein, thereby releasing both peptides. Examples of cleavage sites include, but are not limited to, those disclosed in the following literature: Martin et al., 2003, *Journal of Industrial Microbiology and Biotechnology* 3: 568-576; Svetina et al., 2000, *Journal of Biotechnology* 76: 245-251; Rasmussen-Wilson et al., 1997, *Applied and Environmental Microbiology* 63: 3488-3493; Ward et al. d) et al., 1995, Biotechnology 13: 498-503; and Contreras et al., 1991, Biotechnology 9: 378-381; Eaton et al., 1986, Biochemistry 25: 505-512; Collins-Racie et al., 1995, Biotechnology 13: 982-987; Carter et al., 1989, Proteins: Structure, Function, and Genetics 6: 240-248; and Stevens, 2003, Drug Discovery World 4: 35-48.

[0265] The parent can be obtained from any genus of microorganisms. For the purposes of this invention, the term "obtained from" as used herein in conjunction with a given source should mean that the parent encoded by the polynucleotide is produced by that source or by a strain in which a polynucleotide from that source has been inserted. In one aspect, the parent is extracellularly secreted.

[0266] The parent can be a fungal glucosylamylase. For example, the parent can be a glucosylamylase from the genus Myxobolus or Myxobolus.

[0267] In another aspect, the parent is *Entoloma filamentosa*, *Entoloma septum*, or *Entoloma valvulpis* glucosylase.

[0268] On the other hand, the parent is *Cladophora micrantha* glucosylamylase, such as the glucosylamylase of SEQ ID NO: 2 or its mature polypeptide.

[0269] It will be understood that, for the species mentioned above, this invention covers both perfect and imperfect states, as well as other taxonomic equivalents, such as asexual forms, regardless of their known species names. Those skilled in the art will readily identify the appropriate equivalents.

[0270] Strains of these species are readily available to the public at many culture collections, such as the American Type Culture Collection (ATCC), the German Microbial Culture Collection (DSMZ), the Dutch Culture Collection (Centraalbureau Voor Schimmelcultures, CBS), and the Northern Research Center (NRRL) of the Agricultural Research Culture Collection (ARC).

[0271] The parent can be identified and obtained from other sources, including microorganisms isolated from nature (e.g., soil, compost, water, etc.) or DNA samples obtained directly from natural materials (e.g., soil, compost, water, etc.), using the probes mentioned above. Techniques for directly isolating microorganisms and DNA from their natural environment are well known in the art. The polynucleotide encoding the parent can then be obtained by similarly screening a library of genomic DNA or cDNA from another microorganism or a mixed DNA sample. Once the polynucleotide encoding the parent is detected with one or more probes, it can be isolated or cloned using techniques known to those skilled in the art (see, for example, Sambrook et al., 1989, above).

[0272] Preparation of variants

[0273] These variants can be prepared using any mutagenesis procedure known in the art, such as site-directed mutagenesis, synthetic gene construction, semi-synthetic gene construction, random mutagenesis, shuffling, etc.

[0274] Site-directed mutagenesis is a technique that introduces one or more (e.g., several) mutations at one or more designated sites in a polynucleotide encoding the parent.

[0275] Site-directed mutagenesis can be achieved in vitro using PCR involving primers containing oligonucleotides with the desired mutation. Site-directed mutagenesis can also be performed in vitro via cassette mutagenesis, which involves cleavage by a restriction enzyme at a site in a plasmid containing a polynucleotide encoding the parent and subsequent ligation of the mutated oligonucleotide into the polynucleotide. Typically, the restriction enzyme used to digest the plasmid is the same as that used for the oligonucleotide to allow the sticky ends of the plasmid and the insert to ligate to each other. See, for example, Scherer and Davis, 1979, Proceedings of the National Academy of Sciences (Proc. Natl. Acad. Sci. USA) 76: 4949-4955; and Barton et al., 1990, Nucleic Acids Res. 18: 7349-4966.

[0276] Site-directed mutagenesis can also be achieved in vivo using methods known in the art. See, for example, U.S. Patent Application Publication No. 2004 / 0171154; Storici et al., 2001, Nature Biotechnol. 19: 773-776; Kren et al., 1998, Nat. Med. 4: 285-290; and Calissano and Macino, 1996, Fungal Genet. Newslett. 43: 15-16.

[0277] Any site-directed mutagenesis procedure can be used in this invention. Many commercially available kits are available for preparing variants.

[0278] Synthetic gene construction requires the in vitro synthesis of a designed polynucleotide molecule to encode a polypeptide of interest. Gene synthesis can be performed using a variety of techniques, such as the multi-channel microchip-based technique described by Tian et al. (2004, Nature 432: 1050-1054), and similar techniques involving the synthesis and assembly of oligonucleotides on optically programmable microfluidic chips.

[0279] Single or multiple amino acid substitutions, deletions, and / or insertions can be made and tested using known methods of mutagenesis, recombination, and / or truncation, followed by relevant screening procedures, such as those disclosed by Reidhaar-Olson and Sauer, 1988, Science 241: 53-57; Bowie and Sauer, 1989, Proceedings of the National Academy of Sciences of the United States of America (Proc. Natl. Acad. Sci. USA) 86: 2152-2156; WO 95 / 17413; or WO 95 / 22625. Other methods that can be used include error-prone PCR, phage display (e.g., Lowman et al., 1991, Biochemistry 30: 10832-10837; US Patent No. 5,223,409; WO 92 / 06204), and region-directed mutagenesis (Derbyshire et al., 1986, Gene 46: 145; Ner et al., 1988, DNA 7: 127).

[0280] The activity of cloned, mutagenic peptides expressed by host cells can be detected by combining mutagenesis / reorganization methods with high-throughput automated screening methods (Ness et al., 1999, Nature Biotechnology 17: 893-896). The mutagenic DNA molecules encoding the active peptides can be recovered from the host cells and rapidly sequenced using standard methods in the art. These methods allow for the rapid determination of the importance of individual amino acid residues within the peptide.

[0281] Semi-synthetic gene construction is achieved through a combination of various methods, including synthetic gene construction, and / or site-directed mutagenesis, and / or random mutagenesis, and / or shuffling. Semi-synthetic construction typically involves combining a process of synthesizing polynucleotide fragments with PCR technology. Therefore, defined regions of the gene can be synthesized de novo, while other regions can be amplified using site-specific mutagenesis primers, and still others can undergo error-prone or non-error-prone PCR amplification. The polynucleotide subsequence can then be shuffled.

[0282] Polynucleotides

[0283] The present invention also relates to isolated polynucleotides encoding variants of the invention.

[0284] Nucleic acid constructs

[0285] The present invention also relates to a nucleic acid construct comprising a polynucleotide operatively linked to one or more control sequences encoding a variant of the invention, the one or more control sequences guiding the expression of the coding sequence in a suitable host cell under conditions compatible with the control sequences.

[0286] The polynucleotide can be manipulated in a variety of ways to provide the expression of a variant. Depending on the expression vector, manipulation of the polynucleotide prior to its insertion into the vector may be desired or necessary. Techniques for modifying polynucleotides using recombinant DNA methods are well known in the art.

[0287] The control sequence can be a promoter, which is a polynucleotide recognized by a host cell for the expression of that polynucleotide. The promoter contains a transcriptional control sequence that mediates the expression of that variant. The promoter can be any polynucleotide that exhibits transcriptional activity in the host cell, including mutant, truncated, and heterozygous promoters, and can be derived from a gene encoding an extracellular or intracellular polypeptide that is homologous or heterologous to that of the host cell.

[0288] Examples of suitable promoters for directing the transcription of the nucleic acid constructs of this invention in bacterial host cells are promoters obtained from the following genes: Bacillus amyloliquefaciens α-amylase gene (amyQ), Bacillus licheniformis α-amylase gene (amyL), Bacillus licheniformis penicillinase gene (penP), Bacillus thermophilus maltose amylase gene (amyM), Bacillus subtilis fructan sucrase gene (sacB), Bacillus subtilis xylA and xylB genes, Bacillus thuringiensis cryIIIA gene (Agaisse and Lereclus, 1994, Molecular Microbiology). Microbiology 13:97-107), Escherichia coli lac operon, Escherichia coli trc promoter (Egon et al., 1988, Gene 69:301-315), Streptomyces agar hydrolase gene (dagA), and prokaryotic β-lactamase gene (Villa-Kamaroff et al., 1978, Proc. Natl. Acad. Sci. USA 75:3727-3731), and tac promoter (DeBoer et al., 1983, Proc. Natl. Acad. Sci. USA 80:21-25). Other promoters are described in Gilbert et al., 1980, Scientific American 242:74-94, “Useful proteins from recombinant bacteria”. bacteria); and in Sambrook et al., 1989, see above. Examples of tandem promoters are disclosed in WO 99 / 43835.

[0289] Examples of suitable promoters for guiding the transcription of the nucleic acid constructs of the present invention in filamentous fungal host cells are promoters obtained from the genes of: Aspergillus nidulans acetamase, Aspergillus niger neutral α-amylase, Aspergillus niger acid-stable α-amylase, Aspergillus niger or Aspergillus awamori glucosylamylase (glaA), Aspergillus oryzae TAKA amylase, Aspergillus oryzae alkaline protease, Aspergillus oryzae triose phosphate isomerase, Fusarium oxysporum trypsin-like protease (WO 96 / 00787), Fusarium venenatum amyloglucosidase (WO 00 / 56900), Fusarium venenatum Daria (WO 00 / 56900), Fusarium venenatum Quinn (WO 96 / 00787). 00 / 56900), Rhizomucormiehei lipase, Rhizomucormiehei aspartic protease, Trichoderma reesei β-glucosidase, Trichoderma reesei cellobiose hydrolase I, Trichoderma reesei cellobiose hydrolase II, Trichoderma reesei endodextranase I, Trichoderma reesei endodextranase II, Trichoderma reesei endodextranase III, Trichoderma reesei endodextranase IV, Trichoderma reesei endodextranase V, Trichoderma reesei xylanase I, Trichoderma reesei xylanase II, Trichoderma reesei Trichoderma β-xylosidase, and the NA2-tpi promoter (a modified promoter derived from the Aspergillus neutral α-amylase gene, wherein the untranslated leader sequence is replaced by the untranslated leader sequence of the Aspergillus triose phosphate isomerase gene; non-restrictive examples include modified promoters derived from the Aspergillus niger neutral α-amylase gene, wherein the untranslated leader sequence is replaced by the untranslated leader sequence of the Aspergillus nidulans or Aspergillus oryzae triose phosphate isomerase gene); and its mutant promoters, truncated promoters, and heterozygous promoters.

[0290] In yeast hosts, useful promoters are derived from the following genes: *Saccharomyces cerevisiae* enolase (ENO-1), *Saccharomyces cerevisiae* galactokinase (GAL1), *Saccharomyces cerevisiae* alcohol dehydrogenase / glyceraldehyde-3-phosphate dehydrogenase (ADH1, ADH2 / GAP), *Saccharomyces cerevisiae* triose phosphate isomerase (TPI), *Saccharomyces cerevisiae* metallothionein (CUP1), and *Saccharomyces cerevisiae* 3-phosphate glycerate kinase. Romanos et al., 1992, *Yeast* 8:423-488, describe other useful promoters in yeast host cells.

[0291] The control sequence can also be a transcription terminator recognized by the host cell to terminate transcription. This terminator sequence is operatively linked to the 3' end of the polynucleotide encoding that variant. Any terminator that is functional in the host cell can be used.

[0292] Preferred terminators for bacterial host cells were obtained from the genes of Bacillus clausti alkaline protease (aprH), Bacillus licheniformis α-amylase (amyL), and Escherichia coli ribosomal RNA (rrnB).

[0293] The preferred terminator for filamentous fungal host cells is derived from the genes of Aspergillus nidulans anthranilate synthase, Aspergillus niger glucosidase, Aspergillus niger α-glucosidase, Aspergillus oryzae TAKA amylase, and Fusarium oxysporum trypsin-like protease.

[0294] Preferred terminators for yeast host cells are derived from the genes of *Saccharomyces cerevisiae* enolase, *Saccharomyces cerevisiae* cytochrome C (CYC1), and *Saccharomyces cerevisiae* glyceraldehyde-3-phosphate dehydrogenase. Other useful terminators for yeast host cells are described above by Romanus et al., 1992.

[0295] Control sequences can also be mRNA stabilizing regions downstream of the promoter and upstream of the gene's coding sequence, which increase the expression of the gene.

[0296] Examples of suitable mRNA stable regions were obtained from the following: Bacillus thuringiensis cryIIIA gene (WO 94 / 25612) and Bacillus subtilis SP82 gene (Hue et al., 1995, Journal of Bacteriology 177: 3465-3471).

[0297] The control sequence can also be a leader sequence, a non-translated mRNA region that is important for translation in the host cell. The leader sequence is operatively linked to the 5' end of the polynucleotide encoding that variant. Any leader sequence that is functional in the host cell can be used.

[0298] The preferred leader sequence for use in filamentous fungal host cells was obtained from the genes of Aspergillus oryzae TAKA amylase and Aspergillus nidulans triose phosphate isomerase.

[0299] The leader sequence suitable for yeast host cells is obtained from the following genes: Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae 3-phosphoglycerate kinase, Saccharomyces cerevisiae α factor, and Saccharomyces cerevisiae alcohol dehydrogenase / glyceraldehyde-3-phosphate dehydrogenase (ADH2 / GAP).

[0300] The control sequence can also be a polyadenylation sequence, i.e., a sequence operatively linked to the 3' end of the variant's coding sequence and recognized by the host cell during transcription as a signal to add polyadenylate residues to the transcribed mRNA. Any polyadenylation sequence that functions in the host cell can be used.

[0301] Preferred polyadenylated sequences for use in filamentous fungal host cells are derived from the genes of Aspergillus nidulans anthranilate synthase, Aspergillus niger glucosidase, Aspergillus niger α-glucosidase, Aspergillus oryzae TAKA amylase, and Fusarium oxysporum trypsin-like protease.

[0302] The polyadenylation sequence useful for yeast host cells is described in Guo and Sherman, 1995, Molecular Cellular Biology, 15: 5983-5990.

[0303] The control sequence can also be a signal peptide coding region, encoding a signal peptide linked to the N-terminus of the variant and guiding the variant into the cell's secretory pathway. The 5' end of the polynucleotide coding sequence may inherently contain a signal peptide coding sequence naturally linked within the translation reading frame to a segment encoding the variant's coding sequence. Alternatively, the 5' end of the coding sequence may include a signal peptide coding sequence that is exogenous to the coding sequence. In cases where the coding sequence does not naturally contain a signal peptide coding sequence, an exogenous signal peptide coding sequence may be required. Alternatively, an exogenous signal peptide coding sequence may simply replace the native signal peptide coding sequence to increase the variant's secretion. However, any signal peptide coding sequence that guides the expressed variant into the host cell's secretory pathway can be used.

[0304] Effective signal peptide coding sequences for bacterial host cells are obtained from the following genes: maltose amylase produced by Bacillus NCIB 11837, subtilisin protease from Bacillus licheniformis, β-lactamase from Bacillus licheniformis, α-amylase from Bacillus thermophilus, neutral proteases (nprT, nprS, nprM) from Bacillus thermophilus, and prsA from Bacillus subtilis. Additional signal peptides are described in Simonen and Palva, 1993, Microbiological Reviews 57:109-137.

[0305] The effective signal peptide coding sequences for filamentous fungal host cells are signal peptide coding sequences obtained from the following genes: Aspergillus niger neutral amylase, Aspergillus niger glucosylase, Aspergillus oryzae TAKA amylase, Aspergillus oryzae cellulase, Aspergillus oryzae endoglucanase V, Aspergillus pubescens lipase, and Rhizopus oryzae aspartic protease.

[0306] Signal peptides useful to yeast host cells are obtained from genes of *Saccharomyces cerevisiae* α-factor and *Saccharomyces cerevisiae* invertase. See above; Romanos et al. (1992) described other useful signal peptide coding sequences.

[0307] The control sequence can also be a propeptide-coding sequence encoding a propeptide located at the N-terminus of the variant. The resulting polypeptide is called a proenzyme or propeptide progenitor (or, in some cases, a zymogen). The propeptide progenitor is usually inactive and can be converted into an active polypeptide by catalytic or autocatalytic cleavage of the propeptide from the propeptide progenitor. The propeptide-coding sequence can be obtained from the genes of Bacillus subtilis alkaline protease (aprE), Bacillus subtilis neutral protease (nprT), Thermophilus laccase (WO 95 / 33836), Rhizopus oryzae aspartic protease, and Saccharomyces cerevisiae α-factor.

[0308] In the presence of both the signal peptide sequence and the propeptide sequence, the propeptide sequence is positioned immediately adjacent to the N-terminus of the variant, and the signal peptide sequence is positioned immediately adjacent to the N-terminus of the propeptide sequence.

[0309] It is also desirable to add regulatory sequences that modulate the expression of the variant relative to the growth of the host cell. Examples of regulatory systems are those that cause gene expression to turn on or off in response to chemical or physical stimuli, including the presence of regulatory compounds. Regulatory sequences in prokaryotic systems include the lac, tac, and trp operon systems. In yeast, the ADH2 or GAL1 system can be used. In filamentous fungi, the *Aspergillus niger* glucosylamylase promoter, the *Aspergillus oryzae* TAKA α-amylase promoter, and the *Aspergillus oryzae* glucosylamylase promoter can be used. Other examples of regulatory sequences are those that allow gene amplification. In eukaryotic systems, these regulatory sequences include dihydrofolate reductase genes amplified in the presence of methotrexate and metallothionein genes amplified with heavy metals. In these cases, the polynucleotide encoding the variant will be operatively linked to the regulatory sequence.

[0310] expression carrier

[0311] The present invention also relates to recombinant expression vectors comprising a polynucleotide encoding a variant of the invention, a promoter, and transcription and translation termination signals. Different nucleotides and control sequences can be linked together to produce a recombinant expression vector, which may include one or more convenient restriction enzyme sites to allow insertion or substitution of the polynucleotide encoding the variant at these sites. Alternatively, the polynucleotide can be expressed by inserting the polynucleotide or a nucleic acid construct containing the polynucleotide into a suitable vector for expression. In producing the expression vector, the coding sequence is located within the vector, such that the coding sequence is operatively linked to the suitable control sequence for expression.

[0312] Recombinant expression vectors can be any vector (e.g., plasmids or viruses) that facilitates recombinant DNA procedures and induces the expression of polynucleotides. The choice of vector will typically depend on its compatibility with the host cell to which it will be introduced. The vector can be a linear or closed circular plasmid.

[0313] The vector can be a self-replicating vector, that is, a vector existing as an extrachromosomal entity whose replication is independent of chromosome replication, such as a plasmid, extrachromosomal element, microchromosome, or artificial chromosome. The vector can contain any means to ensure self-replication. Alternatively, the vector can be one that, when introduced into the host cell, is integrated into the genome and replicates along with one or more chromosomes in which it has been integrated. Furthermore, a single vector or plasmid, or two or more vectors or plasmids (which together contain the total DNA of the genome to be introduced into the host cell), or transposons can be used.

[0314] The vector preferably contains one or more selective markers that allow easy selection of transformed, transfected, transduced, or similar cells. A selective marker is a gene whose product provides resistance to biocides or viruses, heavy metals, or auxotrophic prototrophs, etc.

[0315] Examples of bacterial selective markers include the dal gene in *Bacillus licheniformis* or *Bacillus subtilis*, or markers that confer antibiotic resistance (e.g., resistance to ampicillin, chloramphenicol, kanamycin, neomycin, spectinomycin, or tetracycline). Suitable markers for yeast host cells include, but are not limited to, ADE2, HIS3, LEU2, LYS2, MET3, TRP1, and URA3. Selective markers for use in filamentous fungal host cells include, but are not limited to, amdS (acetamipase), argB (ornithine carbamoyltransferase), bar (glufosinate-amyltransferase), hph (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5'-phosphate decarboxylase), sC (adenosyl sulfate transferase), and trpC (o-aminobenzoic acid synthase), along with their equivalents. Preferred markers for use in *Aspergillus* cells are the amdS and pyrG genes from *Aspergillus nidus* or *Aspergillus oryzae*, and the bar gene from *Streptomyces hygroscopicus*.

[0316] The vector preferably contains one or more elements that allow the vector to integrate into the host cell's genome or to replicate autonomously in the cell independently of the genome.

[0317] For integration into the host cell genome, the vector can rely on a polynucleotide sequence encoding the variant or any other element of the vector for integration into the genome via homologous or non-homologous recombination. Alternatively, the vector can contain additional polynucleotides to guide integration into one or more precise locations on one or more chromosomes within the host cell genome via homologous recombination. To increase the likelihood of integration at precise locations, these integrating elements should contain a sufficient number of nucleic acids, such as 100 to 10,000 base pairs, 400 to 10,000 base pairs, and 800 to 10,000 base pairs, that have high sequence identity with the corresponding target sequence to enhance the likelihood of homologous recombination. These integrating elements can be any sequence homologous to the target sequence within the host cell genome. Furthermore, these integrating elements can be non-coding or coding polynucleotides. On the other hand, the vector can integrate into the host cell genome via non-homologous recombination.

[0318] For autonomous replication, the vector may further include an origin of replication that enables the vector to replicate autonomously in the host cell in question. The origin of replication can be any plasmid replicon that mediates autonomous replication and functions within the cell. The terms "origin of replication" or "plasmid replicon" refer to the polynucleotide that enables a plasmid or vector to replicate in vivo.

[0319] Examples of bacterial origins of replication are the origins of replication of plasmids pBR322, pUC19, pACYC177, and pACYC184, which allow replication in Escherichia coli, and the origins of replication of plasmids pUB110, pE194, pTA1060, and pAMβ1, which allow replication in Bacillus.

[0320] Examples of replication origins used in yeast host cells are 2-micron replication origins ARS1, ARS4, combinations of ARS1 and CEN3, and combinations of ARS4 and CEN6.

[0321] Examples of useful origins of replication within filamentous fungal cells are AMA1 and ANS1 (Gems et al., 1991, Gene 98: 61-67; Cullen et al., 1987, Nucleic Acids Res. 15: 9163-9175; WO 00 / 24883). The isolation of the AMA1 gene and the construction of plasmids or vectors containing this gene can be performed according to the methods disclosed in WO00 / 24883.

[0322] More than one copy of the polynucleotide of the present invention can be inserted into a host cell to increase the generation of variants. An increased copy number of the polynucleotide can be obtained by integrating at least one additional copy of the sequence into the host cell genome or by including an amplifiable selectable marker gene along with the polynucleotide, wherein cells containing the amplified copy of the selectable marker gene, and thus additional copies of the polynucleotide, can be selected by culturing cells in the presence of a suitable selectivity reagent.

[0323] The procedures for connecting the elements described above to construct the recombinant expression vector of the present invention are well known to those skilled in the art (see, for example, Sambrook et al., 1989, above).

[0324] host cells

[0325] This invention also relates to recombinant host cells comprising a polynucleotide operably linked to one or more control sequences encoding a variant of the invention, the one or more control sequences directing the generation of the variant. A construct or vector containing the polynucleotide is introduced into the host cell such that the construct or vector is maintained as a chromosomal integrase or as an autonomously replicating extrachromosomal vector, as previously described. The term "host cell" encompasses any offspring of a parent cell that differs from the parent cell due to mutations occurring during replication. The selection of the host cell will depend largely on the gene encoding the variant and its origin.

[0326] The host cell can be any cell that is useful in the recombination to produce a variant, such as a prokaryotic cell or a eukaryotic cell.

[0327] Prokaryotic host cells can be any Gram-positive or Gram-negative bacteria. Gram-positive bacteria include, but are not limited to: Bacillus, Clostridium, Enterococcus, Bacillus aeruginosa, Lactobacillus, Lactococcus, Marine Bacillus, Staphylococcus, Streptococcus, and Streptomyces. Gram-negative bacteria include, but are not limited to: Campylobacter, Escherichia coli, Flavobacterium, Fusobacterium, Helicobacter, Coliform, Neisseria, Pseudomonas, Salmonella, and Ureaplasma.

[0328] The bacterial host cell can be any Bacillus cell, including but not limited to: Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus croceus, Bacillus coagulans, Bacillus sturdier, Bacillus splendidus, Bacillus stagnation, Bacillus licheniformis, Bacillus megaterium, Bacillus brevis, Bacillus thermophilus, Bacillus subtilis, and Bacillus thuringiensis cells.

[0329] The bacterial host cell can also be any streptococcal cell, including but not limited to: Streptococcus equina, Streptococcus pyogenes, Streptococcus mammae, and Streptococcus equine subsp. veterinary.

[0330] The bacterial host cell can also be any Streptomyces cell, including but not limited to: non-chromogenic Streptomyces, insecticidal Streptomyces, sky blue Streptomyces, gray Streptomyces and light blue Streptomyces cells.

[0331] DNA can be introduced into Bacillus cells via the following methods: protoplast transformation (see, for example, Chang and Cohen, 1979, Molecular Genetics and Genomics, 168: 111-115), and competent cell transformation (see, for example, Young and Spizizen, 1961, Journal of Bacteriology, 81: 823-829; or Dubnau and David Dubnau). Davidoff-Abelson, 1971, Journal of Molecular Biology 56: 209-221, electroporation (see, e.g., Shigekawa and Dower, 1988, Biotechniques 6: 742-751), or conjugation (see, e.g., Koehler and Thorne, 1987, Journal of Bacteriology 169: 5271-5278). DNA can be introduced into E. coli cells via protoplast transformation (see, e.g., Hanahan, 1983, Journal of Molecular Biology 166: 557-580) or electroporation (see, e.g., Dower et al., 1988, Nucleic Acids Res. 16: 6127-6145). DNA can be introduced into Streptomyces cells through protoplast transformation, electroporation (see, for example, Gong et al., 2004, Folia Microbiol. (Praha) 49: 399-405), conjugation (see, for example, Mazodier et al., 1989, Journal of Bacteriol. 171: 3583-3585), or transduction (see, for example, Burke et al., 2001, Proceedings of the National Academy of Sciences of the United States of America 98: 6289-6294). DNA can be introduced into Pseudomonas cells by electroporation (see, for example, Choi et al., 2006, Journal of Microbiological Methods, 64: 391-397) or conjugation (see, for example, Pinedo and Smets, 2005, Appl. Environ. Microbiol., 71: 51-57).DNA can be introduced into Streptococcus cells via the following methods: native competent cells (see, for example, Perry and Kuramitsu, 1981, Infect. Immun. 32: 1295-1297), protoplast transformation (see, for example, Catt and Jollick, 1991, Microbios 68: 189-207), electroporation (see, for example, Buckley et al., 1999, Appl. Environ. Microbiol. 65: 3800-3804), or conjugation (see, for example, Clewell, 1981, Microbiol. Rev. 45: 409-436). However, any method known in the art for introducing DNA into host cells can be used.

[0332] The host cell can also be a eukaryotic cell, such as a mammalian, insect, plant, or fungal cell.

[0333] The host cell can be a fungal cell. As used herein, “fungus” includes Ascomycota, Basidiomycota, Chytridiomycota, Zygomycota, along with Oomycota and all mitotic fungi (as defined by Hawksworth et al. in Ainsworth and Bisby's Dictionary of The Fungi, 8th edition, 1995, CAB International, University Press, Cambridge, UK).

[0334] The host cell of this fungus can be a yeast cell. As used herein, "yeast" includes Ascomycota (Endosporales), Basidiomycota, and yeasts belonging to the Deuteromycetes (Bacillus). Since the classification of yeast may change in the future, for the purposes of this invention, yeast should be defined as described in *Biology and Activities of Yeast* (edited by Skinner, Passmore, and Davenport, Soc. App. Bacteriol. Symposium Series No. 9, 1980).

[0335] Yeast host cells can be cells from the genera *Candida*, *Hansenula*, *Kluyveromyces*, *Pichia pastoris*, *Saccharomyces*, *Schizosaccharomyces*, or *Yarrowia*, such as *Kluyveromyces lactis*, *Kluyveromyces*, *Saccharomyces cerevisiae*, *Saccharomyces sacchariformis*, *Saccharomyces davidiana*, *Saccharomyces douglas*, *Kluyveromyces klufernum*, *Nordic yeast*, *Ovoyces*, or *Yarrowia lipolytica*.

[0336] Fungal host cells can be filamentous fungal cells. "Filamentous fungi" includes all filamentous forms of the phylum Eumycota and subphyla of Oomycetes (as defined by Hawkesworth et al., 1995, see above). Filamentous fungi are typically characterized by a hyphal wall composed of chitosan, cellulose, glucan, mannan, and other complex polysaccharides. Vegetative growth occurs through hyphal elongation, and carbon metabolism is obligate aerobic. In contrast, yeast (such as Saccharomyces cerevisiae) grows vegetatively through budding of single-celled cells, and carbon metabolism can be fermentative.

[0337] The host cells of filamentous fungi can be cells from genera such as *Apertoire*, *Aspergillus*, *Bjerkandera*, *Pseudomonas*, *Aureospora*, *Coprinus*, *Coriolus*, *Cryptococcus*, *Filibasidium*, *Fusarium*, *Pyrophyllus*, *Pleurotus*, *Mucor*, *Pyrophyllus*, *Pleurotus ... or *Trichoderma*.

[0338] For example, the host cells of filamentous fungi can be *Aspergillus amblymorii*, *Aspergillus sulphureus*, *Aspergillus fumigatus*, *Aspergillus japonicus*, *Aspergillus nidus*, *Aspergillus oryzae*, *Bjerkandera adusta*, *Ceriporiopsis saneirina*, *Ceriporiopsis caregiea*, *Ceriporiopsis gilvescens*, *Ceriporiopsis pannocinta*, *Ceriporiopsis rivulosa*, *Ceriporiopsis subrufa*, *Ceriporiopsis subvermispora*, *Chrysosporium inops*, *Chrysosporium lucknowense*, and *Chrysosporium foetida*. merdarium, Chrysosporium queenslandicum, Chrysosporium zonatum, Coprinus cinereus, Coriolushirsutus, Fusarium moniliforme, Fusarium graminearum, Fusarium kuwaiense, Fusarium scabra, Fusarium graminearum, Fusarium graminearum, Fusarium graminearum, Fusarium moniliforme ... eryngii), terrestrial clostridium, Trametes villosa, Trametes versicolor, Trichoderma harzianum, Trichoderma corningensis, Trichoderma longibranchii, Trichoderma reesei, or green Trichoderma cells.

[0339] Fungal cells can be transformed in a manner known per se through methods involving protoplast formation, protoplast transformation, and cell wall regeneration. Suitable procedures for transforming Aspergillus and Trichoderma host cells are described in EP 238023 and Yelton et al., 1984, Proceedings of the National Academy of Sciences (Proc. Natl. Acad. Sci. USA) 81:1470-1474, and Christensen et al., 1988, Bio / Technology 6:1419-1422. Suitable methods for transforming Fusarium species are described by Malardier et al., 1989, Gene 78:147-156 and WO 96 / 00787. Yeast can be transformed using procedures described in the following literature: Becker and Guarente, in Abelson, JN and Simon, MI, eds., Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, Vol. 194, pp. 182-187, Academic Press, Inc., New York; Ito et al., 1983, Journal of Bacteriology 153:163; and Hinnen et al., 1978, Proceedings of the National Academy of Sciences 75:1920.

[0340] Generation method

[0341] The present invention also relates to methods for generating variants, the methods comprising: (a) culturing host cells of the present invention under conditions suitable for expressing the variant; and (b) recovering the variant.

[0342] These host cells are cultured in a nutrient medium suitable for producing the variant using methods known in the art. For example, the cells can be cultured by shake flask culture or by small-scale or large-scale fermentation (including continuous fermentation, batch fermentation, feed-feed fermentation, or solid-state fermentation) in a suitable medium and under conditions that allow for the expression and / or isolation of the variant in a laboratory or industrial fermenter. The culture occurs using procedures known in the art in a suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts. Suitable media are available from commercial suppliers or can be prepared according to publicly available compositions (e.g., in the catalogue of the U.S. Center for Type Culture Collection). If the variant is secreted into the nutrient medium, it can be recovered directly from the medium. If the variant is not secreted, it can be recovered from cell lysates.

[0343] The variant can be detected using methods known in the art that are specific to these variants. These detection methods include, but are not limited to, the use of specific antibodies, the formation of enzyme products, or the disappearance of enzyme substrates. For example, an enzyme assay can be used to determine the activity of the variant.

[0344] The variant can be recovered using methods known in the art. For example, the variant can be recovered from the nutrient medium through a variety of routine procedures, including but not limited to collection, centrifugation, filtration, extraction, spray drying, evaporation, or precipitation.

[0345] Variants can be purified to obtain substantially pure variants by a variety of procedures known in the art, including but not limited to: chromatography (e.g., ion exchange chromatography, affinity chromatography, hydrophobic interaction chromatography, chromatographic focusing, and size exclusion chromatography), electrophoresis procedures (e.g., preparative isoelectric point focusing), differential solubility (e.g., ammonium sulfate precipitation), SDS-PAGE, or extraction (see, for example, Protein Purification, edited by Janson and Ryden, VCH Publishers, New York, 1989).

[0346] In an alternative, instead of recycling the variant, the host cell of the present invention expressing the variant is used as a source of the variant.

[0347] Composition

[0348] The present invention also relates to compositions comprising a polypeptide of the present invention. Preferably, the composition further comprises a carrier and / or an excipient. More preferably, these compositions are enriched with such a polypeptide. The term "rich" indicates that the glucosylamylase activity of the composition has been increased, for example, by an enrichment factor of at least 1.1. Preferably, these compositions are formulated to provide desired properties, such as light color, low odor, and acceptable storage stability.

[0349] The composition may include the polypeptide of the present invention as the main enzyme component, for example, a single-component composition. Alternatively, the composition may include a variety of enzyme activities, such as aminopeptidase, α-amylase, isoamylase, carbohydrate enzyme, carboxypeptidase, catalase, cellulase, chitosanase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, esterase, α-galactosidase, β-galactosidase, glucosylamylase, α-glucosidase, β-glucosidase, halogen peroxidase, invertase, laccase, lipase, mannosidase, oxidase, pectinase, peptidase, peroxidase, phytase, polyphenol oxidase, amylopectinase, proteolytic enzyme, ribonuclease, transglutaminase, or xylanase.

[0350] In one specific embodiment, the composition comprises α-amylase and a variant glucosylase according to the invention. In another specific embodiment, the composition comprises isoamylase and a variant glucosylase according to the invention. In yet another specific embodiment, the composition comprises α-amylase, isoamylase, and a variant glucosylase according to the invention.

[0351] In another aspect, the composition comprises a variant glucosylamylase of the present invention in combination with amylopectin. In another aspect, the composition comprises a variant glucosylamylase of the present invention in combination with amylopectin and isoamylase. In yet another aspect, the composition comprises a variant glucosylamylase of the present invention in combination with amylopectin and α-amylase.

[0352] In one specific embodiment, the composition further comprises a protease.

[0353] Peptide compositions can be prepared according to methods known in the art, and these peptide compositions can be in the form of liquid or dry compositions. For example, peptide compositions can be in the form of particles or microparticles. The peptides included in the composition can be stabilized according to methods known in the art.

[0354] Examples of preferred uses of the polypeptides or polypeptide compositions of the present invention are given below. The dosage of the polypeptide compositions of the present invention and other conditions for using the compositions can be determined based on methods known in the art.

[0355] The above compositions are suitable for use in liquefaction, saccharification, and / or fermentation processes, preferably in starch conversion, and especially for the production of syrups and fermentation products, such as ethanol.

[0356] Examples of preferred uses of the polypeptide compositions of the present invention are given below. The dosage of the polypeptide compositions of the present invention and other conditions for using the compositions can be determined based on methods known in the art.

[0357] use

[0358] The present invention also relates to the use of one of the polypeptides of the invention in a liquefaction process, a saccharification process, and / or a fermentation process. The polypeptide can be used in a single process, such as a liquefaction process, a saccharification process, or a fermentation process. It can also be used in a combination of multiple processes, such as a liquefaction and saccharification process, a liquefaction and fermentation process, or a saccharification and fermentation process (preferably related to starch conversion).

[0359] In a preferred aspect of the invention, the liquefaction, saccharification, and / or fermentation process includes liquefaction and saccharification processes performed sequentially or simultaneously.

[0360] In conventional enzymatic liquefaction processes, a heat-stable α-amylase is added to degrade long-chain starch into branched and linear shorter units (maltodextrin), but no glucosylamylase is added. The glucosylamylase of this invention is highly heat-stable, making its addition during liquefaction advantageous. When combined with an α-amylase during liquefaction, the glucosylamylase of this invention exhibits a synergistic effect. In conventional saccharification processes, the dextrin produced during liquefaction is further hydrolyzed to produce low-molecular-weight sugars DP1-3 that can be metabolized by the fermenting organism. Hydrolysis is typically accomplished using glucosylamylase; alternatively, α-glucosidase and / or acidic α-amylase may be used in addition to glucosylamylase.

[0361] When the glucosylamylase of the present invention (possibly combined with α-amylase) is applied to liquefaction and / or saccharification processes, particularly a simultaneous liquefaction and saccharification process, the process can be carried out at higher temperatures. The variant glucosylase of the present invention is particularly useful for the saccharification of native starch (granular starch) at high temperatures, but below the gelation temperature, for example, in the range of 40°C to 65°C, more specifically from 50°C to 62°C, and even more specifically from 59°C to 62°C.

[0362] By performing this liquefaction and / or saccharification process at a higher temperature, the process can be carried out in a shorter time period, or alternatively, a lower enzyme dosage can be used. Furthermore, the risk of microbial contamination is reduced when the liquefaction and / or saccharification process is performed at a higher temperature.

[0363] Conversion of starch-containing materials

[0364] This invention provides the use of the glucosylamylase of the invention for the production of glucose and the like from starch. Generally, the method comprises the step of partially hydrolyzing precursor starch using a variant of the glucosylamylase of the invention, alone or in the presence of an α-amylase.

[0365] The variant glucosidase of the present invention can also be used in combination with an enzyme that hydrolyzes only α-(1,6)-glycosidic bonds in molecules comprising at least four glucose residues.

[0366] In another aspect, the present invention relates to the use of a glucosylamylase of the present invention in starch conversion. Furthermore, the glucosylamylase of the present invention can be used in a continuous starch conversion process comprising a continuous saccharification process.

[0367] Production of syrups, beverages and / or fermentation products

[0368] The glucosyl amylase of the present invention can be used to convert starch into, for example, syrupy beverages and / or a fermentation product (including ethanol).

[0369] The present invention also provides a method for producing syrups (such as glucose) from starch-containing materials using the glucosylase of the present invention. Suitable starting materials are illustrated in the "Starch-containing Materials" section. Generally, the process includes the following steps: partially or completely hydrolyzing (liquefying and / or saccharifying) the starch-containing material in the presence of the glucosylase of the present invention, alone or in combination with α-amylase, to release glucose from the non-reducing ends of starch or related oligosaccharide and polysaccharide molecules.

[0370] The glucoamylase of the present invention can also be used in a fixed form. This is suitable and often used in the production of specialty syrups (e.g., maltose syrup) along with residual streams of oligosaccharides associated with the production of fructose syrups (e.g., high fructose syrup (HFS)).

[0371] Fermentation products

[0372] The term "fermentation product" refers to the product produced by a process involving a fermentation process using a fermenting organism. Fermentation products contemplated according to the present invention include alcohols (e.g., arabinitol, butanol, ethanol, glycerol, methanol, ethylene glycol, 1,3-propanediol, butylene glycol, glycerin, sorbitol, and xylitol); organic acids (e.g., acetic acid, acetoic acid, adipic acid, ascorbic acid, citric acid, 2,5-diketo-D-gluconic acid, formic acid, fumaric acid, gluconic acid, glucuronic acid, glutaric acid, 3-hydroxypropionic acid, itaconic acid, lactic acid, malic acid, malonic acid, oxalic acid, oxaloacetic acid, propionic acid, succinic acid, and xylic acid); ketones. Classes of amino acids (e.g., acetone); amino acids (e.g., aspartic acid, glutamic acid, glycine, lysine, serine, and threonine); alkanes (e.g., pentane, hexane, heptane, octane, nonane, decane, undecane, and dodecane); cycloalkanes (e.g., cyclopentane, cyclohexane, cycloheptane, and cyclooctane); alkenes (e.g., pentene, hexene, heptene, and octene); gases (e.g., methane, hydrogen (H2), carbon dioxide (CO2), and carbon monoxide (CO)); antibiotics (e.g., penicillin and tetracycline); enzymes; vitamins (e.g., riboflavin, B vitamins). 12(β-carotene) and hormones. In a preferred aspect, the fermentation product is ethanol, for example, fuel ethanol; drinking ethanol, i.e., neutral spirits suitable for drinking; or industrial ethanol or products used in the edible alcohol industry (e.g., beer and spirits), the dairy industry (e.g., fermented dairy products), the leather industry, and the tobacco industry. Preferred beer types include ale, stout, porter, lager, bitters, malt liquor, happyhu, high-alcohol beer, low-alcohol beer, low-calorie beer, or light beer. Preferred fermentation processes include alcohol fermentation processes well known in the art. Preferred fermentation processes are anaerobic fermentation processes well known in the art.

[0373] brewing

[0374] The glucosylamylases of the present invention are highly thermally stable and therefore can be used in industries requiring starch hydrolysis at high temperatures. For example, the glucosylamylases of the present invention can be used in the brewing industry. The glucosylamylases of the present invention are added in an effective amount that can be readily determined by those skilled in the art.

[0375] The generation of liquefaction, saccharification and / or fermentation products

[0376] In this respect, the present invention relates to a process for producing a liquefied, saccharified, and / or fermented product from a starch-containing material, the process comprising the steps of treating the starch-containing material with a polypeptide of the present invention. Various suitable starch-containing starting materials are listed in the “Starch-containing Materials” section below. Various enzymes under consideration are listed in the “Enzymes” section below. Preferably, the process of the present invention comprises treating the starch-containing material with a polypeptide of the present invention, alone or in combination with an α-amylase. The liquefied and / or saccharified product of the present invention is dextrin or a low molecular weight sugar (e.g., DP1-3). In this liquefaction process, the conversion of starch to glucose, dextrin, and / or low molecular weight sugars is enhanced by adding a glucosylamylase of the present invention. After fermentation, this fermentation product (e.g., ethanol) can optionally be recovered, for example, by distillation. Fermentation is preferably carried out in the presence of yeast (preferably a strain of the genus *Saccharomyces*). Various suitable fermentation organisms are listed in the “Fermentation Organisms” section below.

[0377] Method for producing fermentation products from materials containing gelled starch

[0378] In this respect, the present invention relates to a method for producing fermentation products, particularly ethanol, from starch-containing materials, the method comprising a liquefaction step and saccharification and fermentation steps performed sequentially or simultaneously.

[0379] This invention relates to a method for producing fermentation products from starch-containing materials, comprising the following steps:

[0380] (a) Using an α-amylase to liquefy starch-containing materials;

[0381] (b) Saccharifying the liquefied material obtained in step (a) using a glucosyl amylase; and

[0382] (c) Using a fermenting organism to ferment saccharified materials.

[0383] Preferably, step (a) further includes using the glucosylamylase variant of the present invention. In one embodiment, the glucosylamylase variant of the present invention is also present / added in step (b).

[0384] Fermentation products, such as ethanol in particular, can optionally be recovered after fermentation, for example, by distillation. A variety of suitable starch-containing starting materials are listed in the "Starch-containing Materials" section below. A variety of enzymes under consideration are listed in the "Enzymes" section below. Liquefaction is preferably carried out in the presence of an α-amylase. Fermentation is preferably carried out in the presence of yeast (preferably a strain of the genus *Saccharomyces*). A variety of suitable fermentation organisms are listed in the "Fermentation Organism" section below. In several preferred embodiments, steps (b) and (c) are performed sequentially or simultaneously (i.e., as an SSF process).

[0385] In one specific embodiment, the method of the present invention further includes the following steps prior to step (a):

[0386] x) Preferably, the particle size of the starch-containing material is reduced by grinding; and

[0387] y) to form a slurry containing the starch-containing material and water.

[0388] The aqueous slurry may contain 10 wt% to 40 wt%, preferably 25 wt% to 35 wt% of starch-containing material. The slurry is heated above its gelation temperature, and α-amylase, preferably bacterial and / or acidic fungal α-amylase, may be added to initiate liquefaction (thinning). In one embodiment, the slurry may be steam-cooked prior to exposure to α-amylase in step (a) of the invention to further gel the slurry.

[0389] More precisely, liquefaction can be carried out as a three-step hot slurry process. The slurry is heated to between 60°C and 95°C, preferably between 80°C and 85°C, and α-amylase is added to initiate liquefaction (dilution). The slurry is then spray-cooked at a temperature between 95°C and 140°C, preferably between 105°C and 125°C, for 1–15 minutes, preferably 3–10 minutes, especially about 5 minutes. The slurry is cooled to between 60°C and 95°C, and α-amylase is added again to conclude hydrolysis (secondary liquefaction). The liquefaction process is typically carried out at pH 4.5–6.5, particularly between pH 5–6. The whole, finely ground and liquefied particles are called a paste.

[0390] The saccharification in step (b) can be performed using conditions well known in the art. For example, the entire saccharification process can last from about 24 to about 72 hours; however, it is typically performed only at temperatures between 30°C and 65°C, typically about 60°C, for a typical 40–90 minutes, followed by complete saccharification during fermentation in a simultaneous saccharification and fermentation process (SSF process). Saccharification is typically performed at temperatures between 30°C and 65°C, typically about 60°C, and at a pH between 4 and 5, typically about pH 4.5.

[0391] The most widely used process in the production of fermentation products (especially ethanol) is simultaneous saccharification and fermentation (SSF), in which there is no holding stage of saccharification, meaning that the fermentation organism (e.g., yeast) and one or more enzymes can be added together. SSF can typically be carried out at temperatures between 25°C and 40°C, such as between 29°C and 35°C, between 30°C and 34°C, or around 32°C. According to the invention, this temperature can be adjusted up or down during fermentation.

[0392] According to the present invention, fermentation step (c) includes, but is not limited to, fermentation processes for producing: alcohols (e.g., ethanol, methanol, butanol); organic acids (e.g., citric acid, acetic acid, itaconic acid, lactic acid, gluconic acid); ketones (e.g., acetone); amino acids (e.g., glutamic acid); various gases (e.g., H2 and CO2); antibiotics (e.g., penicillin and tetracycline); enzymes; vitamins (e.g., riboflavin, B12, β-carotene); and hormones. Preferred fermentation processes include alcohol fermentation processes as well known in the art. Preferred fermentation methods are anaerobic fermentation methods, as well as those well known in the art.

[0393] The process of producing fermentation products from materials containing ungelatinized starch

[0394] In this respect, the present invention relates to a process for producing fermentation products from starch-containing materials, wherein the starch-containing material is not gelled (i.e., uncooked starch-containing material). According to the invention, desired fermentation products, such as ethanol, can be produced without liquefying an aqueous slurry containing the starch-containing material. In one embodiment, a process of the present invention includes saccharifying (milled) starch-containing material (e.g., granular starch) in the presence of an α-amylase at a temperature below gelation temperature to produce a variety of sugars that can be fermented into desired fermentation products by a suitable fermenting organism. In another embodiment, the glucosylamylase and an α-amylase of the present invention are used in the saccharification and fermentation process. In one aspect, the present invention relates to a process for producing fermentation products from starch-containing materials, the process comprising:

[0395] (a) Saccharifying a starch-containing material at a temperature below the initial gelation temperature of the starch-containing material using a mature glucose amylase variant according to the invention.

[0396] (b) Fermentation is carried out using a fermenting organism.

[0397] Steps (a) and (b) of the method of the present invention can be performed continuously or simultaneously. In one embodiment, a slurry comprising water and a starch-containing material is prepared prior to step (a).

[0398] In a preferred embodiment, step (a) includes adding an α-amylase.

[0399] The fermentation method can be carried out for a period of 1 to 250 hours, preferably from 25 to 190 hours, more preferably from 30 to 180 hours, even more preferably from 40 to 170 hours, even more preferably from 50 to 160 hours, even more preferably from 60 to 150 hours, even more preferably from 70 to 140 hours, and most preferably from 80 to 130 hours.

[0400] The term "initial gelation temperature" refers to the lowest temperature at which starch gelation begins. Starch heated in water begins to gel between 50°C and 75°C; the exact gelation temperature depends on the specific starch and can be readily determined by those skilled in the art. Therefore, the initial gelation temperature can vary depending on the plant species, the specific variety of the plant species, and the growing conditions. In the context of this invention, the initial gelation temperature of a given starch-containing material is based on the work of Gorinstein & Lii, 1992, Starch. The method described in 44(12):461-466 results in a loss of birefringence of 5% of starch granules at a certain temperature.

[0401] Prior to step (a), a slurry of a starch-containing material (e.g., granular starch) with 10 wt% to 55 wt% dry solids, preferably 25 wt% to 40 wt% dry solids, and more preferably 30 wt% to 35 wt% dry solids can be prepared. This slurry may contain water and / or process water, such as bottom distillate (backflow), scrubber water, evaporator condensate or distillate, side stripper water from distillation, or other process water from fermentation plant. Because the process of the present invention is carried out below the gelation temperature and therefore no significant increase in viscosity occurs, high levels of bottom distillate can be used if desired. In one embodiment, the aqueous slurry contains from about 1 vol% to about 70 vol% bottom distillate, preferably 15 vol% to 60 vol% bottom distillate, and especially from about 30 vol% to 50 vol% bottom distillate.

[0402] The starch-containing material can preferably be prepared by dry or wet milling to reduce the particle size to 0.05 to 3.0 mm, preferably 0.1 to 0.5 mm. After being subjected to one method of the present invention, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or preferably at least 99% of the dry solids of this starch-containing material can be converted into a soluble starch hydrolysate.

[0403] The process of the present invention is carried out at a temperature below the initial gelation temperature. Preferably, the temperature at which step (a) is performed is between 30°C and 75°C, and more preferably between 45°C and 60°C.

[0404] In a preferred embodiment, steps (a) and (b) are performed as a continuous or simultaneous saccharification and fermentation process. In this preferred embodiment, the process is typically carried out at a temperature between 25°C and 40°C, such as between 29°C and 35°C, such as between 30°C and 34°C, such as about 32°C. According to the invention, this temperature can be adjusted up or down during fermentation.

[0405] In one embodiment, saccharification and fermentation are performed simultaneously, thereby maintaining a sugar level (e.g., glucose level) at a low level, for example, below 6 wt%, preferably below about 3 wt%, preferably below about 2 wt%, more preferably below about 1 wt%, even more preferably below about 0.5 wt%, or even more preferably 0.25 wt%, for example below about 0.1 wt%. Such a low sugar level can be achieved simply by using adjusted amounts of enzymes and fermenting organisms. Those skilled in the art can readily determine the amounts of enzymes and fermenting organisms used. The amounts of enzymes and fermenting organisms used can also be selected to maintain a low maltose concentration in the fermentation broth. For example, the maltose level can be maintained below about 0.5 wt.% or below about 0.2 wt.%.

[0406] The process can be carried out at a pH range between pH 3 and pH 7, preferably from pH 3.5 to pH 6, or more preferably from pH 4 to pH 5.

[0407] The glucoamylase variant of the present invention is thermostable, so presaccharification and / or saccharification can be performed at temperatures higher than conventional presaccharification and / or saccharification temperatures. In one embodiment, a method of the present invention includes presaccharifying the starch-containing material prior to a simultaneous saccharification and fermentation (SSF) process. Presaccharification can be performed at high temperatures (e.g., 50°C-85°C, preferably 60°C-75°C) before transfer to the SSF.

[0408] Starch-containing materials

[0409] According to the present invention, any suitable starch-containing starting material, including granulated starch, can be used. The starting material is typically selected based on the desired fermentation product. Examples of suitable starch-containing starting materials for use in the methods of the present invention include tubers, roots, stems, whole grains, corn, cobs, wheat, barley, rye, sorghum, sago, wood ear mushrooms, wood ear mushroom flour, sorghum, rice, peas, legumes, or sweet potatoes, or mixtures thereof, or cereals, sugar-containing raw materials (e.g., molasses), fruit materials, sugarcane or beets, potato starch, and cellulose-containing materials (e.g., wood or plant residues), or mixtures thereof. Both glutinous and non-glutinous types of corn and barley are considered.

[0410] Fermented organisms

[0411] "Fermentation organism" refers to any organism suitable for use in fermentation processes and capable of producing the desired fermentation product, including bacterial and fungal organisms. Particularly suitable fermentation organisms are those that can directly or indirectly ferment sugars (such as glucose or maltose) into, or convert them into, the desired fermentation product. Examples of fermentation organisms include fungal organisms, such as yeast. Preferred yeasts include strains of the genus *Saccharomyces*, particularly *Saccharomyces cerevisiae*. Commercially available yeasts include, for example, RedStar yeast. TM Lesaffre Ethanol Red (available from Red Star / Lesaffre, USA), FALI (available from Fleischmann's Yeast, a subsidiary of Burns Philp Food Inc., USA), SUPERSTART (available from Alltech), GERTSTRAND (available from Gert Strand AB, Sweden), and FERMIOL (available from DSM Specialties).

[0412] enzymes

[0413] Glucoamylase

[0414] The glucosylamylase is preferably the glucosylamylase of the present invention. However, as mentioned above, the glucosylamylase of the present invention can also be combined with other glucosylamylases.

[0415] The amount of glucoamylase added can be from 0.001 to 10 AGU / g DS, preferably from 0.01 to 5 AGU / g DS, for example about 0.05, 0.1, 0.3, 0.5, 1 or 2 AGU / g DS, especially 0.05 to 0.5 AGU / g DS or 0.02-20 AGU / g DS, preferably 0.1-10 AGU / g DS.

[0416] α-Amylase

[0417] According to the present invention, α-amylase can be from any source. Preferably, it is α-amylase from fungal or bacterial sources.

[0418] In a preferred aspect, the α-amylase is an acidic α-amylase, such as fungal acidic α-amylase or bacterial acidic α-amylase. The term "acidic α-amylase" means an α-amylase that, when added in an effective amount, has optimal activity at a pH range of 3 to 7, preferably from 3.5 to 6, or more preferably from 4 to 5 (EC 3.2.1.1).

[0419] Bacterial α-amylase

[0420] According to the present invention, a bacterial α-amylase is preferably derived from Bacillus.

[0421] In a preferred aspect, the Bacillus α-amylase is derived from strains of Bacillus licheniformis, Bacillus amyloliquefaciens, Bacillus subtilis, or Bacillus thermophilus, but may also be derived from other Bacillus species. Specific examples of the α-amylases considered include Bacillus licheniformis α-amylase (BLA) shown in SEQ ID NO:4 of WO 99 / 19467, Bacillus amyloliquefaciens α-amylase (BAN) shown in SEQ ID NO:5 of WO 99 / 19467, and Bacillus thermophilus α-amylase (BSG) shown in SEQ ID NO:3 of WO 99 / 19467. In one embodiment of the invention, the α-amylase is an enzyme having a degree of consistency of at least 60%, preferably at least 70%, more preferably at least 80%, even more preferably at least 90%, such as at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% with any sequence shown in SEQ ID NO: 1, 2, 3, 4, or 5 in WO 99 / 19467.

[0422] Bacillus α-amylase can also be a variant and / or a heterozygote, especially one of the variants and / or heterozygotes described in any of the following: WO 96 / 23873, WO 96 / 23874, WO 97 / 41213, WO 99 / 19467, WO00 / 60059, and WO 02 / 10355 (all documents are incorporated herein by reference). Exactly considered α-amylase variants are disclosed in U.S. Patent Nos. 6,093,562, 6,297,038, or 6,187,576 (incorporated herein by reference), and include thermophilic Bacillus stearothermophilus α-amylase (BSG α-amylase) variants having a deletion of one or two amino acids at positions 179 to 182, preferably a double deletion (preferably corresponding to a double deletion of δ(181-182) compared to the wild-type BSG α-amylase amino acid sequence described in SEQ ID NO: 3 disclosed in WO 99 / 19467) in WO 99 / 19467, or a deletion of amino acids 179 and 180 using SEQ ID NO: 3 of WO 99 / 19467 (which is incorporated herein by reference). Even more preferred are Bacillus α-amylases, especially Bacillus stearothermophilus α-amylases, which have a double deletion corresponding to δ(181-182) and further include an N193F substitution (also represented as I181*+G182*+N193F) compared to the amino acid sequence of wild-type BSG α-amylase described in SEQ ID NO:3 disclosed in WO 99 / 19467.

[0423] α-Amylase can also be a maltose α-amylase. A maltose-producing α-amylase (glucan 1,4-α-maltose hydrolase, EC 3.2.1.133) is capable of hydrolyzing amylose and amylopectin into maltose in the α-configuration. A maltose α-amylase from the thermophilic Bacillus stearothermophilus strain NCIB 11837 is commercially available from Novozymes A / S, Denmark. This maltose α-amylase is described in U.S. Patent Nos. 4,598,048, 4,604,355, and 6,162,628, which are incorporated herein by reference.

[0424] Bacterial hybrid α-amylase

[0425] One particular heterozygous α-amylase under consideration comprises 445 C-terminal amino acid residues of Bacillus licheniformis α-amylase (shown as SEQ ID NO: 4 in WO 99 / 19467) and 37 N-terminal amino acid residues of α-amylase derived from Bacillus amyloliquefaciens (shown as SEQ ID NO: 3 in WO 99 / 194676), having one or more, and especially all, of the following substitutions:

[0426] G48A+T49I+G107A+H156Y+A181T+N190F+I201F+A209V+Q264S (using Bacillus licheniformis numbering). Also preferred are variants having one or more of the following mutations (or corresponding mutations in the backbone of other Bacillus α-amylases): H154Y, A181T, N190F, A209V, and Q264S; and / or the deletion of two residues between positions 176 and 179, preferably the deletion of E178 and G179 (using SEQ ID NO: 5 of WO 99 / 19467).

[0427] Fungal α-amylase

[0428] Fungal acidic α-amylases include acidic α-amylases derived from strains of the genus Aspergillus, such as Aspergillus oryzae, Aspergillus niger, or Aspergillus kawachii α-amylase.

[0429] The preferred acidic fungal α-amylase is a fungal amyl-like α-amylase, preferably derived from Aspergillus oryzae strains. In this disclosure, the term "fungal amyl-like α-amylase" indicates an acidic fungal α-amylase. WO 96 / 23874 The mature portion of the amino acid sequence shown in SEQ ID NO: 10 exhibits high consistency, i.e., more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, more than 95%, more than 96%, more than 97%, more than 98%, more than 99%, or even 100% consistency of an α-amylase.

[0430] Another preferred acidic α-amylase is derived from *Aspergillus niger* strains. In one preferred aspect, the acidic fungal α-amylase is an α-amylase from *Aspergillus niger* disclosed in the Swiss-prot / TeEMBL database under master accession number P56271 as “AMYA_ASPNG” and described in more detail in WO 89 / 01969 (Example 3). The acidic *Aspergillus niger* acidic α-amylase is also shown in WO 2004 / 080923 (Novison) as SEQ ID NO: 1, which is incorporated herein by reference. Various variants of the acidic fungal amylase having at least 70% similarity, e.g., at least 80% or even at least 90% similarity, e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% similarity, to SEQ ID NO: 1 in WO 2004 / 080923 are also considered.

[0431] In a preferred aspect, the α-amylase is derived from Aspergillus kawachii and was disclosed by Kaneko et al., J. Ferment. Bioeng. 81: 292-298 (1996): "Molecular-cloning and determination of the nucleotide-sequence of a gene encoding an acid-stable α-amylase from Aspergillus kawachii"; and further disclosed as EMBL: #AB008370.

[0432] The fungal acid α-amylase can also be a wild-type enzyme or a variant thereof that includes a carbohydrate-binding module (CBM) and an α-amylase catalytic domain (i.e., a non-hybrid). In one embodiment, the wild-type acid α-amylase is derived from a strain of Aspergillus.

[0433] Fungal hybrid α-amylase

[0434] In a preferred aspect, the fungal acid α-amylase is a hybrid α-amylase. Preferred examples of fungal hybrid α-amylases include those disclosed in WO 2005 / 003311, U.S. Patent Publication No. 2005 / 0054071 (Novison), or U.S. Patent Application No. 2006 / 0148054 (Novison), which are incorporated herein by reference. A hybrid α-amylase may include an α-amylase catalytic domain (CD) and a carbohydrate-binding domain / module (CBM), as well as optional linkers.

[0435] Specific examples of the hybrid α-amylases considered include, but are not limited to, those disclosed in U.S. Patent Application No. 2006 / 0148054, including fungal α-amylase variants having the catalytic domain JAll 8 and Athelia rolfsii SBD (SEQ ID NO: 100 in U.S. Application No. 2006 / 0148054), Rhizomucor pusillus α-amylase having the AMG linker of Athelia rolfsii and SBD (SEQ ID NO: 101 in U.S. Application No. 2006 / 0148054), and Meripilus giganteus α-amylase having the Athelia rolfsii glucosylase linker and SBD (SEQ ID NO: 102 in U.S. Application No. 2006 / 0148054); and Rhizomucor pusillus α-amylase having the Aspergillus niger glucosylase linker and CBM (in International Publication WO). (SEQ ID NO 2 in 2007 / 144424).

[0436] Other specific examples of heterozygous α-amylases under consideration include, but are not limited to, those disclosed in U.S. Patent Publication No. 2005 / 0054071, including those disclosed in Table 3 on page 15, such as Aspergillus niger α-amylase having a white Aspergillus linker and a starch-binding domain.

[0437] Commercial α-amylase products

[0438] Preferred commercial compositions including α-amylase include: MYCOLASE, BAN from DSM (Gist Brocades Ltd.) TM TERMAMYL TM SC, FUNGAMYL TM LIQUOZYME TM SC, LIQUOZYME TM SC DS and SAN TM SUPER, SAN TM EXTRA L (Novozymes) and CLARASE TM L-40,000, DEX-LO TM SPEZYME TM FRED, SPEZYME TM AA, SPEZYME TM Ethyl and SPEZYME TM DELTA AA (Genencor International Ltd.)

[0439] The invention is further illustrated by the following numbered paragraphs:

[0440] Paragraph [1]. A glucosylamylase variant comprising substitutions at one or more of positions 95, 59, 119, 121, 18, 426, and 316 corresponding to the polypeptide of SEQ ID NO: 3, wherein the variant has glucosylamylase activity, and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity with the polypeptide of SEQ ID NO: 3.

[0441] Paragraph [2]. The variant described in paragraph 1 is a variant of a parental glucosyl amylase selected from the group consisting of the following:

[0442] a) A polypeptide having at least 85% sequence identity with the polypeptide of SEQ ID NO: 3;

[0443] b) A polypeptide encoded by a polynucleotide having at least 85% identity with the mature polypeptide coding sequence of SEQ ID NO: 1; and

[0444] c) A fragment of the polypeptide of SEQ ID NO: 3 that has glucosylamylase activity.

[0445] Paragraph [3]. The variant described in paragraph 2, wherein the parental glucosylamylase has at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with the polypeptide of SEQ ID NO: 3.

[0446] Paragraph [4]. A variant as described in any of paragraphs 2-3, wherein the parental glucosylamylase is encoded by a polynucleotide having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with the mature polypeptide encoding sequence of SEQ ID NO: 1.

[0447] Paragraph [5]. A variant as described in any one of paragraphs 2-4, wherein the parental glucosylamylase comprises or is composed of the polypeptide of SEQ ID NO: 3.

[0448] Paragraph [6]. A variant as described in any one of paragraphs 2-5, wherein the parental glucosylamylase is a fragment of the polypeptide of SEQ ID NO: 3, wherein the fragment has glucosylamylase activity.

[0449] Paragraph [8]. A variant as described in any one of paragraphs 1-7, wherein the variant has at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% but less than 100% sequence identity with the amino acid sequence of the parent glucosylamylase.

[0450] Paragraph [9]. A variant as described in any one of paragraphs 1-8, wherein the variant has at least 85%, such as at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity with the polypeptide of SEQ ID NO: 3.

[0451] Paragraph

[10] . Variations as described in any one of paragraphs 1-9, wherein the number of substitutions is 1-20, for example 1-10 and 1-5, such as 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 substitutions.

[0452] Paragraph

[11] . A variant as described in any one of paragraphs 1-10, which includes a substitution at the position corresponding to position 59.

[0453] Paragraph

[12] . Variations as described in paragraph 11, wherein the substitution is replaced by Ala, Cys, Gly, or Ile.

[0454] Paragraph

[13] . A variant as described in any one of paragraphs 1-12, which includes a substitution at the position corresponding to position 95.

[0455] Paragraph

[14] . A variant as described in paragraph 13, wherein the substitution is replaced with Pro.

[0456] Paragraph

[15] . A variant as described in any one of paragraphs 1-14, the variant comprising a substitution at the position corresponding to position 119.

[0457] Paragraph

[16] . A variant as described in paragraph 15, wherein the substitution is replaced with Trp.

[0458] Paragraph

[17] . A variant as described in any one of paragraphs 1-16, which includes a substitution at the position corresponding to position 121.

[0459] Paragraph

[18] . A variant as described in paragraph 17, wherein the substitution is replaced with Pro.

[0460] Paragraph

[19] . A variant as described in any one of paragraphs 1-18, which includes a substitution at the position corresponding to position 18.

[0461] Paragraph

[20] . A variant as described in paragraph 19, wherein the substitution is replaced with Phe.

[0462] Paragraph

[21] . A variant as described in any one of paragraphs 1-20, which includes a substitution at the position corresponding to position 426.

[0463] Paragraph

[22] . A variant as described in paragraph 21, wherein the substitution is replaced with Gly.

[0464] Paragraph

[23] . A variant as described in any one of paragraphs 1-22, the variant comprising a substitution at the position corresponding to position 316.

[0465] Paragraph

[24] . A variant as described in paragraph 23, wherein the substitution is replaced with Trp.

[0466] Paragraph

[25] . Variations as described in any one of paragraphs 1-24 include substitutions at the two positions corresponding to any of positions 59, 95, 119, 121, 18, 426, and 316.

[0467] Paragraph

[26] . Variations as described in any one of paragraphs 1 to 25 include substitutions at three positions corresponding to any of positions 59, 95, 119, 121, 18, 426, and 316.

[0468] Paragraph

[27] . Variations as described in any one of paragraphs 1-26 include substitutions at the four positions corresponding to any of positions 59, 95, 119, 121, 18, 426, and 316.

[0469] Paragraph

[28] . Variations as described in any one of paragraphs 1-27 include substitutions at five positions corresponding to any of positions 59, 95, 119, 121, 18, 426, and 316.

[0470] Paragraph

[29] . Variations as described in any one of paragraphs 1-28 include substitutions at the six positions corresponding to any of positions 59, 95, 119, 121, 18, 426, and 316.

[0471] Paragraph

[30] . Variations as described in any one of paragraphs 1-21 include substitutions at each position corresponding to positions 59, 95, 119, 121, 18, 426, and 316.

[0472] Paragraph

[31] . A variant as described in any one of paragraphs 1-24 includes one or more substitutions selected from the group consisting of 59A, 95P, 119W, and 121P, and specifically, is a glucosylamylase variant comprising substitution 95P+121P, more specifically S95P+A121P, and wherein the variant has glucosylamylase activity, and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity with the polypeptide of SEQ ID NO: 3.

[0473] Paragraph

[32] . A variant as described in any one of paragraphs 1-24 comprises one or more substitutions selected from the group consisting of: 59C+426G, 59G+426G, and 18F+59I, more specifically, V59C+A426G, or V59G+A426G, or V18F+V59I, and wherein the variant has glucosylamylase activity, and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity with the polypeptide of SEQ ID NO: 3.

[0474] Paragraph

[33] . A variant as described in any one of paragraphs 1-24 includes one or more substitutions selected from the following: 316W substitution, specifically S3 16W, and wherein the variant has glucosylamylase activity, and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity with the polypeptide of SEQ ID NO: 3.

[0475] Paragraph

[34] . A variant as described in any of the preceding paragraphs, wherein the variant comprises at least one of the following substitutions or combinations of substitutions:

[0476] V59A; or

[0477] S95P; or

[0478] A121P; or

[0479] T119W; or

[0480] S95P+A121P; or

[0481] V59A+S95P; or

[0482] S95P+T119W; or

[0483] V59A+S95P+A121P; or

[0484] S95P+T119W+A121P, wherein the variant has glucosylamylase activity, and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity with the polypeptide of SEQ ID NO: 3.

[0485] Paragraph

[35] . A variant as described in any of the preceding paragraphs, wherein the variant comprises at least one combination of the following substitutions:

[0486] V59C+A426G; or

[0487] V59G+A426G; or

[0488] V18F+V59I; or

[0489] V59C+S95P+T119W+A426G; or

[0490] V59C+S95P+T119W+A121P+A426G; or

[0491] V59C+S95P+A121P+A426G; or

[0492] V18F+V59I+S95P+A121P; or

[0493] V18F+V59I+S95P+T119W+A121P, wherein the variant has glucosylamylase activity, and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity with the polypeptide of SEQ ID NO: 3.

[0494] Paragraph

[36] . A variant as described in any of the preceding paragraphs, wherein the variant comprises at least one of the following substitutions or combinations of substitutions:

[0495] S316W; or

[0496] S95P+A121P+S316W, wherein the variant has glucosylamylase activity, and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity with the polypeptide of SEQ ID NO: 3.

[0497] Paragraph

[37] . A variant as described in any one of paragraphs 1-36, having improved properties relative to the parent, wherein the improved properties are selected from the group consisting of: specific activity, thermal stability, and glucose tolerance.

[0498] Paragraph

[38] . A variant as described in paragraphs 1-37, which has improved properties relative to the parent, wherein the improved properties are increased thermal stability.

[0499] Paragraph

[39] . A variant as described in paragraph 35, which has improved properties relative to the parent, wherein the improved properties are increased thermal stability and increased glucose tolerance.

[0500] Paragraph

[40] . A variant as described in paragraph 36, which has improved properties relative to the parent, wherein the improved properties are increased thermal stability and increased specific activity.

[0501] Paragraph

[41] . A composition comprising any one of paragraphs 1-40.

[0502] Paragraph

[42] . The composition according to paragraph 41 includes α-amylase and a polypeptide as described in any one of paragraphs 1-40.

[0503] Paragraph

[43] . The composition according to paragraph 41 includes isoamylase and a polypeptide as described in any one of paragraphs 1-40.

[0504] Paragraph

[44] . The composition according to paragraph 41 includes α-amylase, isoamylase, and a polypeptide as described in any one of paragraphs 1-40.

[0505] Paragraph

[45] . The composition according to paragraph 41 includes amylopectin and a polypeptide as described in any one of paragraphs 1-40.

[0506] Paragraph

[46] . Use of a polypeptide as described in any of paragraphs 1-40 for the production of syrup and / or a fermentation product.

[0507] Paragraph

[47] . According to the use described in paragraph 46, the starting material is a gelled or ungelled starch-containing material.

[0508] Paragraph

[48] . A process for producing fermentation products from starch-containing materials, the process comprising the following steps:

[0509] (a) Liquefying starch-containing materials in the presence of an α-amylase;

[0510] (b) to saccharify the liquefied material; and

[0511] (c) Fermentation is carried out using a fermenting organism;

[0512] Steps (a) and / or (b) are performed using at least one variant of glucosylamylase as described in any of paragraphs 1-40.

[0513] Paragraph

[49] . A process for producing fermentation products from starch-containing materials, the process comprising the following steps:

[0514] (a) Saccharifying the starch-containing material at a temperature below the initial gelation temperature of the starch-containing material; and

[0515] (b) Fermentation is carried out using a fermenting organism.

[0516] Step (a) is performed using at least one variant of glucosyl amylase as described in any of paragraphs 1-40.

[0517] Paragraph

[50] . A process for producing a syrup product from a starch-containing material, the process comprising the following steps:

[0518] The starch-containing material is saccharified at a temperature below the initial gelation temperature of the starch-containing material in the presence of a variant glucosidase as described in any one of paragraphs 1-40.

[0519] Paragraph

[51] . A process for producing a syrup product from a starch-containing material, the process comprising the following steps:

[0520] (a) Liquefying starch-containing materials in the presence of an α-amylase;

[0521] (b) Saccharifying the liquefied material in the presence of a variant of glucosylamylase as described in any one of paragraphs 1-40.

[0522] Paragraph

[52] . According to the process described in paragraph 51, step b) further includes the addition of an amylopectin.

[0523] Paragraph

[53] . The process described in paragraphs 51 and 52, wherein the saccharification temperature is in the range of 40°C to 65°C, more specifically from 50°C to 62°C, and more specifically from 59°C to 62°C.

[0524] Paragraph

[54] . An isolated polynucleotide that encodes a variant as described in any one of paragraphs 1-40.

[0525] Paragraph

[55] . A nucleic acid construct comprising the polynucleotides described in paragraph 54.

[0526] Paragraph

[56] . An expression vector comprising the polynucleotides described in paragraph 54.

[0527] Paragraph

[57] . A host cell containing polynucleotides as described in paragraph 54.

[0528] Paragraph

[58] . A method for producing a glucose amylase variant, the method comprising:

[0529] Host cells as described in paragraph 57 were cultured under conditions suitable for expression of the variant; and the variant glucosyl amylase was recovered.

[0530] The invention is further described by the following examples, which should not be construed as limiting the scope of the invention.

[0531] Example

[0532] Materials and Methods

[0533] Glucoamylase activity

[0534] Glucoamylase activity can be measured in AGU units.

[0535] Glucoamylase activity (AGU)

[0536] <![CDATA[ Glucoamylase incubation ]]> Substrate: 100mM maltose Buffer solution: Acetate 0.1M pH: 4.30±0.05 Incubation temperature: 37℃±1 Reaction time: 6 minutes Enzyme working range: 0.5 AGU / mL to 4.0 AGU / mL

[0537] The analytical principle is described through three reaction steps:

[0538] Step 1 is an enzymatic reaction:

[0539] Glucoamylase (AMG) EC 3.2.1.3 (exo-α-1,4-glucan-glucosaminidase) hydrolyzes maltose to form α-D-glucose. The reaction is stopped with NaOH after incubation.

[0540] Steps 2 and 3 lead to an endpoint reaction.

[0541] In a reaction catalyzed by hexokinase, glucose is phosphorylated by ATP. The resulting glucose-6-phosphate is oxidized to 6-phosphogluconic acid by glucose-6-phosphate dehydrogenase. In this same reaction, an equimolar amount of NAD+ is reduced to NADH, resulting in an increase in absorbance at 340 nm. An automated analyzer system such as the Konelab 30 analyzer (Thermo Fisher Scientific) can be used.

[0542]

[0543] Specific activity of glucosylamylase

[0544] Specific activity was determined by measuring the above AGU using a Konelab instrument.

[0545] Glucoamylase activity using Kikkoman kit

[0546] Glucoamylase activity assay (Kikkoman)

[0547] Product Code: 60211

[0548] Measurement principle:

[0549]

[0550] The substrate 4-nitrophenyl-β-maltodextrin (G2-β-pNP) was degraded to 4-nitrophenyl-β-glucosidase (G1-β-pNP) by glucosidase or α-glucosidase. G1-β-pNP was further degraded to 4-nitrophenol (pNP) by β-glucosidase in this kit. The reaction was carried out at room temperature at approximately pH 4. The reaction was stopped by adding sodium carbonate, and simultaneously, the solution was made alkaline to maximize the absorbance of pNP. The glucose-forming activity was measured by quantifying the pNP at 400 nm.

[0551] 1) The measured reactions showed the G2-β-pNP degradation activities of glucosylamylase and β-glucosidase in the sample. This is considered to be the glucose formation activity in the sample.

[0552] 2) This test can be used for undialyzed koji extract.

[0553] 3) This test is not affected by α-amylase in the sample.

[0554] reagents main components quantity substrate solution G2-β-pNP 60ml enzyme solution β-glucosidase 60ml Termination solution Sodium carbonate 120ml

[0555] 1) Mix the "substrate solution" and "enzyme solution" of this kit in a 1:1 ratio.

[0556] 2) Take 10 μl of purified glucosylamylase variant sample with approximately 0.1 AG U g / ml activity (or water as a blank) and transfer it to the well of a microtiter plate. (Two copies)

[0557] 3) Add 60 μl of the substrate-enzyme mixture to the well.

[0558] 4) Incubate at 32℃ for 20 minutes.

[0559] 5) Add 120 μl of the stop solution to the well.

[0560] 6) Read OD400 nm. #Net OD 400 =OD400 (sample)-OD 400 (blank)

[0561] 1. Blank: Typically, the absorbance of the blank is less than 0.200.

[0562] 2. Specificity: The reaction is not affected by glucose (up to 100 g / L) or α-amylase (725 U / ml).

[0563] 3. Reproducibility: When the same sample is analyzed 10 times, the CV of absorbance is less than 1%.

[0564] 4. Linear range: maximum net OD of 1.6 400 It should be proportional to the concentration of the enzyme.

[0565] 5. Color stability: The absorbance remains unchanged after 2 hours at 25℃.

[0566] Thermal stability determination

[0567] The thermal stability of the selected variants was determined using the Kikkoman glucoamylase kit after heating at 63°C or 67°C for 1 hour, as a measure of residual activity.

[0568] Glucose inhibition assay

[0569] Glucose inhibition was determined as the ratio of glucosylamylase (AMG) activity in the presence and absence of glucose. A Kikkoman assay kit was used for AMG determination. Ten μL of a 3-fold diluted sample was added to 190 μL of substrate (substrate solution in the kit: enzyme solution in the kit: 40% glucose or DW = 1:1:6), and the reaction mixture was incubated at 37°C. The reaction time depended on the substrate, being 30 min for glucose-free substrates and 2 hr for glucose-containing substrates. The reaction was then terminated by mixing 80 μL of the reaction mixture with 160 μL of 3% Na₂CO₃, and A400 was measured.

[0570] Calculate the glucose inhibition value using the following formula;

[0571] Glucose inhibition = (Vg / Vdw) / (WTg / WTdw) / 2*0.5*100

[0572] Vg; the variant δA400, derived from a substrate containing glucose.

[0573] Vdw; the variant δA400, derived from a substrate that does not contain glucose.

[0574] WTg; δA400 of Gt-AMG, derived from a substrate containing glucose.

[0575] Vdw; Gt-AMG's δA400, derived from a substrate that does not contain glucose.

[0576] DNA manipulation

[0577] All plasmids were constructed and amplified in *E. coli* Dh5α cells. Restriction endonucleases for DNA manipulation were available from New England Biolabs, Inc. and used according to the instructions. In-fusion (Clontech) was used for DNA ligation. Amplified plasmids were recovered using a Qiager plasmid kit. Polymerase chain reaction (PCR) was performed using Prime Star Max DNA polymerase (Takara Bio Inc.). A QIAquick gel extraction kit (Qiaager) was used to purify DNA fragments excised from agarose gels. All DNA manipulations were generally performed in accordance with the manufacturer's instructions and *Molecular Cloning: A Laboratory Manual* (2nd Edition), Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, described in Sambrook, Fritsch EF, and Maniatis T (1989).

[0578] Example 1: Cloning of the Gt-AMG glucosylamylase gene

[0579] Preparation of cDNA from *Cladosporium filamentosa* strains.

[0580] The cDNA was synthesized according to the following instructions from the Transciptor high Fidelity cDNA synthesis kit (Roche). Cloning of the Gt-AMG glucosylamylase gene.

[0581] The glucosyl amylase gene was re-cloned from cDNA into the Aspergillus expression vector using PCR with two cloning primers, pra102 and pra103, as shown below. These two cloning primers were designed based on known sequences and tagged for direct cloning via the IN-FUSION™ strategy.

[0582] Primer par102: 5'AGTCTTGATCGGATCCATGTACCGCTTCCTTGTCTGTGCT 3'

[0583] Primer pra103: 5'CGCACCACGTGGTTTAAACTTAACGCCAAGTGTCATTCTC 3'

[0584] PCR was performed using the PTC-200 DNA Engine under the conditions described below.

[0585]

[0586] The reaction products were separated by 1.0% agarose gel electrophoresis using 1x TAE buffer, from which approximately 1.7 bp PCR product bands were excised from the gel and purified using a Qiager gel extraction kit according to the manufacturer's instructions. 5X HD IN-FUSION was used. TM The kit (Klonda, Inc.) clones DNA corresponding to the glucosyl amylase gene of *Cladosporium globulus* into an Aspergillus expression vector linearized with BamHI and PmeI, according to the manufacturer's instructions.

[0587] 2 μl of ligation mixture was used to transform *E. coli* DH5α cells (TOYOBO). After heat shock at 42°C for 45 seconds and cooling on ice, 250 μl of SOC medium was added, and the cells were incubated at 37°C for 90 minutes at 225 rpm. They were then plated onto LB agar plates containing 250 μg ampicillin per ml and incubated overnight at 37°C. Selected colonies were inoculated into 3 ml of LB medium supplemented with 50 μg ampicillin per ml and incubated overnight at 37°C at 225 rpm. Plasmid DNA was purified from the selected colonies using the Qiager Plasmid Mini Kit (Qiager) according to the manufacturer's instructions. The *Cladophora globulus* glucosyl amylase gene sequence was validated by Sanger sequencing prior to heterologous expression. One of these plasmids was selected for further expression and named pNori140.

[0588] Protoplasts of the *Aspergillus niger* host were prepared as described in WO 95 / 02043. Preferably, the *Aspergillus niger* host lacked endogenous glucosylamylase activity. The *Aspergillus niger* glucosylamylase gene was integrated into the genome of the *Aspergillus niger* host using an FLP-based site-directed integration system as described in WO 2012 / 160093. One hundred μl of protoplast suspension was mixed with 2.5 μg of pNori140 plasmid, which possesses the *Aspergillus niger* glucosylamylase gene with the promoter, terminator, FLP gene, and integration site described in WO 2012 / 160093, and 250 μL of 60% PEG 4000 (Applichem) (polyethylene glycol, molecular weight 4,000), 10 mM CaCl2, and 10 mM Tris-HCl (pH 7.5) were added and gently mixed. The mixture was incubated at 37°C for 30 minutes. Protoplasts were mixed with 6% low-melting agarose (Biowhittaker Molecular Applications) and added as a top layer to COVE sucrose (1M) plates supplemented with 10 mM acetamide and 15 mM CsCl for transformant selection (4 ml top layer agar per plate). After incubation at 32°C for 6 days, spores from 5 transformants were isolated onto COVE II plates and cultured in flasks.

[0589] Culture. Transformants were inoculated into COVE Ngly plates at 30°C for 7 days, and the plate culture was then inoculated into 100 ml of MSS medium and cultured for 3 days at 30°C in 500 ml shake flasks on a rotary shaker. 10 ml of the culture was then inoculated into 100 ml of MU-1 medium and cultured at 30°C for 6 days. The culture was centrifuged, and the supernatant was filtered through a 0.2 μm membrane filter.

[0590] α-Cyclodextrin affinity gel. 10 g of epoxy-activated agarose 6B (GE Healthcare, Chalfont St. Giles, UK) powder was suspended in distilled water and washed with distilled water on a sintered glass filter. The gel was then suspended in coupling solution (100 ml of 12.5 mg / ml α-cyclodextrin, 0.5 M NaOH) and incubated at room temperature for one day with gentle agitation. The gel was washed with distilled water on a sintered glass filter and then suspended in 100 ml of 1 M ethanolamine at pH 10 and incubated at 50 °C for 4 hours for blocking. The gel was subsequently washed several times with 50 mM Tris-HCl at pH 8 and, alternatively, 50 mM NaOAc at pH 4.0. Finally, the gel was packed into 35–40 ml columns using equilibration buffer (50 mM NaOAc, 150 mM NaCl, pH 4.5).

[0591] Glucoamylase was purified from the culture medium. Fermentation medium from *Aspergillus niger* transformants carrying the glucosylase gene was filtered through a 0.22 μm PES filter and applied to an α-cyclodextrin affinity gel column previously equilibrated in 50 mM NaOAc, 150 mM NaCl, pH 4.5 buffer. Unbound material was eluted from the column using equilibration buffer, and glucosylase was eluted using more than 3 column volumes of the same buffer containing 10 mM β-cyclodextrin.

[0592] The glucosylamylase activity of the eluent was examined to determine if glucosylamylase had bound to the α-cyclodextrin affinity gel. The purified glucosylamylase sample was then dialyzed against 20 mM NaOAc at pH 5.0. Purity was finally checked by SDS-PAGE, and only one single band was observed.

[0593] Example 2: Construction and expression of a site-directed variant of glucosyl amylase from Cleopatra.

[0594] Using the plasmid pNori140 described in Example 1, primers V59A-F and V59A-R (designed to replace alanine (A) at position 59 of the mature sequence with valine (V)) and primers pra102 and pra102 (these two primers are designed based on known sequences and have tags added for use via IN-FUSION) were employed. TM The strategy involves direct cloning and two PCR reactions.

[0595] Primer par102: 5'agtcttgatcggatccatgtaccgcttccttgtctgtgct 3'

[0596] Primer pra103: 5'cgcaccacgtggtttaaacttaacgccaagtgtcattctc 3'

[0597] PCR was performed using the PTC-200 DNA Engine under the conditions described below.

[0598]

[0599] DNA fragments were recovered from agarose gel using the Qiager Gel Extraction Kit, following the manufacturer's instructions. IN-FUSION was used, following the manufacturer's instructions. TM BD Biosciences (Palo Alto, CA, USA) cloned the two purified fragments into the Aspergillus expression vector pNori140, which was linearized with BamHI and PmeI.

[0600] *E. coli* DH5α cells (TOYOBO) were transformed using a ligation mixture. Selected colonies were inoculated into 3 ml LB medium supplemented with 50 μg ampicillin per ml and incubated overnight at 37°C at 225 rpm. Plasmid DNA was purified from the selected colonies using the Qiager Plasmid Mini Kit (Qiager) according to the manufacturer's instructions. The sequence of the *Cladophora globulin* glucosyl amylase site-directed variant gene sequence was validated prior to heterologous expression, and one of these plasmids was selected for further expression.

[0601] As described in WO 95 / 02043, protoplasts of Aspergillus niger host cells lacking endogenous glucosylamylase activity were prepared. One hundred μl of protoplast suspension was mixed with 2.5 μg of pNori140 plasmid, which included a site-specific substitution of the Aspergillus niger AMG variant, and 250 μL of 60% PEG 4000 (Applichem) (polyethylene glycol, molecular weight 4,000), 10 mM CaCl2, and 10 mM Tris-HCl (pH 7.5) were added and gently mixed. The mixture was incubated at 37°C for 30 minutes. Protoplasts were mixed with 6% low-melting agarose (Biowhittaker Molecular Applications) and added as a top layer to COVE sucrose (1M) plates supplemented with 10 mM acetamide and 15 mM CsCl for transformant selection (4 ml top layer agar per plate). After incubation at 32°C for 6 days, spores from 5 transformants were isolated onto COVE II plates and cultured in flasks.

[0602] Use the forward and reverse primers shown in the table below to construct other variants.

[0603]

[0604]

[0605] Culture. The isolated transformants were inoculated into COVE Ngly plates at 30°C for 7 days, and the plate culture was then inoculated into 100 ml of MSS medium and cultured for 3 days at 30°C in 500 ml shake flasks on a rotary shaker. 10 ml of the culture was then inoculated into 100 ml of MU-1 medium and cultured at 30°C for 6 days. The culture was centrifuged, and the supernatant was filtered through a 0.2 μm membrane filter.

[0606] Example 3: Purification of site-directed Gt AMG variants

[0607] Selected transformants of the variant were cultured in the MU-1 described in Example 1, and the cultures were filtered through a 0.22 μm PES filter and applied to an α-cyclodextrin affinity gel column previously equilibrated in a 50 mM NaOAc, 150 mM NaCl, pH 4.5 buffer. Unbound material was eluted from the column using equilibration buffer, and glucosyl amylase was eluted using more than 3 column volumes of the same buffer containing 10 mM β-cyclodextrin.

[0608] The glucosylamylase activity of the eluent was examined to determine if glucosylamylase had bound to the α-cyclodextrin affinity gel. The purified glucosylamylase sample was then dialyzed against 20 mM NaOAc at pH 5.0.

[0609] Example 4: Characterization of a glucose amylase variant with improved thermostability

[0610] The thermostability of glucosylamylase variants with specific substitutions or combinations of substitutions was determined by measuring residual activity using a glucosylamylase assay kit from Kikkoman after heat treatment at 63°C and 67°C for 1 hour. The values ​​in the table are activities measured relative to control samples that did not undergo heat treatment.

[0611] The results are summarized in Table 1 below.

[0612] Table 1.

[0613]

[0614] The thermal stability of all tested combinations was improved, including those derived from monosubstituted (JGA064, 078, 083, and 122), disubstituted (JGA098, 099, and 123), and trisubstituted (JGA100 and 125), with JGA100 being the most thermally stable. On the other hand, JGA064, 099, and 100, with V59A, showed lower glucose inhibition, suggesting that position V59 is also important for glucose inhibition.

[0615] Glucose inhibition (GI) was determined as the ratio of AMG activity in the presence and absence of 30% glucose. These values ​​are relative to the wild type. Higher values ​​correspond to lower inhibition.

[0616] To finely tune the space around V59, four neighboring amino acids, V18, V37, T422, and A426, were selected based on structural analysis. Four double-saturated libraries containing V59 and the selected amino acids were constructed and screened.

[0617] Example 5: Characterization of a glucose amylase variant with improved glucose tolerance and improved thermostability

[0618] (V59X-V18X, V59X-V37X, V59X-T422X, and V-59X-A426X), JGA127, 128, and 129 from double-saturated libraries were selected as the best candidates for improving glucose inhibition. To improve the stability of JGA127 and 129, thermostable substitutions S95P, T119W, and A121P were introduced. The characterization results are summarized in Table 2.

[0619] Table 2. Characterization of variants with lower glucose inhibition

[0620]

[0621] All variants maintain a lower specific activity.

[0622] Example 6: Characterization of a glucosidase variant exhibiting improved glucose tolerance and improved thermal stability in combination with good specific activity.

[0623] JGA149 yielded a single-site saturated library of self-substituted S316X, providing a variant with lower glucose inhibition while maintaining the specific activity of the parental glucosylamylase. To improve its thermostability, S95P and A121P were introduced into JGA149, and the resulting variant JGA151 was characterized. Increased thermostability and specific activity were observed (Table 4).

[0624] G2 forms of JGA098 and JGA151 (without starch-binding domains) were constructed and named JGA148 and JGA203, respectively. JGA148 and JGA203 showed increased specific activity and no other characteristic changes (Table 3).

[0625] Table 3.

[0626]

[0627] The invention described and claimed herein is not limited to the specific aspects disclosed herein, as these aspects are intended to illustrate several aspects of the invention. Any equivalent aspects are contemplated to be within the scope of the invention. In fact, various modifications to the invention, other than those shown and described herein, will become apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims. In case of conflict, the disclosure including the definition shall prevail.

Claims

1. A glucosylamylase variant comprising substitutions at one or more positions of positions 95, 59, 119, and 121 corresponding to the polypeptide of SEQ ID NO:3, wherein the variant has glucosylamylase activity, and wherein the substitutions of the variant compared to the polypeptide of SEQ ID NO:3 are selected from: V59A; S95P; T119W; A121P; V59A+S95P; S95P+T119W; S95P+A121P; V59A+S95P+A121P; or S95P+T119W+A121P; and this variant has increased thermal stability relative to the peptide in SEQ ID NO:

3.

2. The glucosylamylase variant of claim 1, wherein the variant comprises a substitution of 59A.

3. The glucosylamylase variant of claim 1, wherein the variant comprises a 95P substitution.

4. The glucosylamylase variant of claim 1, wherein the variant comprises a substitution of 119W.

5. The glucosylamylase variant of claim 1, wherein the variant comprises a 121P substitution.

6. A composition comprising a glucose amylase variant as described in any one of claims 1-5.

7. The composition according to claim 6, comprising α-amylase and a glucose amylase variant as described in any one of claims 1-5.

8. The composition according to claim 6, comprising isoamylase and a glucose amylase variant as described in any one of claims 1-5.

9. The composition according to claim 6, comprising α-amylase, isoamylase, and a glucose amylase variant as described in any one of claims 1-5.

10. The composition according to claim 6, comprising amylopectin and a glucose amylase variant as described in any one of claims 1-5.

11. Use of a glucose amylase variant as described in any one of claims 1-5 for the production of syrup and / or a fermentation product.

12. The use according to claim 11, wherein the starting material is a gelled or ungelled starch-containing material.

13. A process for producing fermentation products from starch-containing materials, the process comprising the following steps: (a) Liquefying starch-containing materials in the presence of an α-amylase; (b) to saccharify the liquefied material; and (c) Fermentation is carried out using a fermenting organism; Steps (a) and / or (b) are performed using at least one glucose amylase variant as described in any one of claims 1-5.

14. A process for producing fermentation products from starch-containing materials, the process comprising the following steps: (a) Saccharifying the starch-containing material at a temperature below the initial gelation temperature of the starch-containing material; and (b) Fermentation is carried out using a fermenting organism. Step (a) is performed using at least one glucose amylase variant as described in any one of claims 1-5.

15. A process for producing a syrup product from a starch-containing material, the process comprising the following steps: In the presence of any one of the glucose amylase variants as described in claims 1-5, the starch-containing material is saccharified at a temperature below the initial gelation temperature of the starch-containing material.

16. A process for producing a syrup product from a starch-containing material, the process comprising the following steps: (a) Liquefying starch-containing materials in the presence of an α-amylase; (b) Saccharifying the liquefied material in the presence of any of the glucose amylase variants as described in any one of claims 1-5.

17. The process of claim 16, wherein step (b) further comprises adding an amylopectin.

18. The process according to claim 16 or 17, wherein the saccharification temperature is in the range of 40°C to 65°C.

19. The process according to claim 18, wherein the saccharification temperature is in the range of 50°C to 62°C.

20. The process according to claim 19, wherein the saccharification temperature is in the range of 59°C to 62°C.

21. An isolated polynucleotide encoding a glucose amylase variant as described in any one of claims 1-5.

22. A nucleic acid construct comprising the polynucleotide as described in claim 21.

23. An expression vector comprising the polynucleotide as described in claim 21.

24. A host cell comprising the polynucleotide as described in claim 21.

25. A method for producing a glucose amylase variant, the method comprising: The host cells according to claim 24 are cultured under conditions suitable for expressing the variant; And the glucose amylase variant was recycled.

Images