A set of polynucleotides, methods and kits for the detection of transgenic crops
By designing plasmid standard molecules containing specific gene sequences and their primer probes, the problem of lack of positive standards in real-time fluorescent PCR detection of transgenic crops has been solved, achieving high sensitivity and specificity in detection, and is suitable for quantitative detection of multi-component and multi-line transgenic products.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SHANGHAI METROLOGY & TESTING TECHNOLOGY RESEARCH INSTITUTE CO LTD
- Filing Date
- 2016-06-22
- Publication Date
- 2026-04-14
AI Technical Summary
The lack of positive standards and positive standard configuration in current real-time fluorescent PCR detection of genetically modified crops leads to uncertainty and complexity in the detection results, especially in the detection of multi-component and multi-strain genetically modified products, which poses a risk of missed detection.
A standard plasmid molecule containing the CaMV35S promoter of cauliflower mosaic virus, the NOS terminator, the neomycin phosphotransferase gene NPTII, the FMV35S promoter of Scrophularia mosaic virus, and the 18S rRNA coding sequence of a standard plant gene is provided. Combined with specific primers and probes, it can be used for real-time fluorescent PCR detection.
It improves the sensitivity and specificity of detection, simplifies the detection process for multi-component and multi-line genetically modified products, reduces the risk of missed detection, and ensures the reliability and comparability of test results.
Smart Images

Figure BDA0001025192580000061 
Figure BDA0001025192580000062 
Figure BDA0001025192580000063
Abstract
Description
Technical Field
[0001] This invention relates to a set of plasmid molecules in the field of bioengineering technology, specifically to a set of polynucleotides, methods, and kits for the detection of transgenic crops. Background Technology
[0002] Genetic engineering technology involves transferring genes between different species, modifying the genetic material of organisms to achieve desired traits, nutritional quality, and consumer appeal, thus meeting various human needs, such as increased yield, expression of specific nutrients, and even resistance to herbicides, viruses, or pests. However, with the widespread cultivation of genetically modified crops globally, their food safety and environmental safety have become a major concern for consumers, governments, and relevant agencies worldwide. Labeling of genetically modified products has become a crucial part of the regulation of genetically modified products in various countries. Many countries and regions, including the EU, Japan, South Korea, Australia, and New Zealand, have implemented mandatory labeling systems for genetically modified organisms (GMOs), specifying minimum labeling limits for GMO components in food. my country promulgated the "Administrative Measures for the Labeling of Agricultural Genetically Modified Organisms" on January 5, 2002. These measures explicitly state that the labeling management of GMOs aims to regulate the sale of agricultural GMOs, guide their production and consumption, and protect consumers' right to know. Therefore, it is necessary to establish corresponding quantitative detection methods for the increasingly commercialized genetically modified products, conduct rigorous metrological investigations of the detection process, improve the traceability level of genetically modified detection values, establish complete traceability standards for genetically modified detection values, and ensure the reliability, comparability, and universality of genetically modified detection results.
[0003] Genetically modified organism (GMO) detection methods often involve detecting nucleic acids, with real-time quantitative PCR (qPCR) being the primary method. As a relatively quantitative method, qPCR requires accurate positive standard materials to construct a standard curve, which is then used to assign values to the analytes. The accuracy and reliability of the positive standard materials are crucial for quantitative analysis. Furthermore, in qualitative PCR testing, positive standard materials are also necessary for method quality control and result confirmation. Therefore, developing GMO plasmid DNA standard materials will contribute to improving the detection and testing capabilities for GMO products.
[0004] Currently, there is a severe shortage of standard materials for the detection of genetically modified organisms (GMOs), especially plasmid DNA standard materials. The variety of GMO crop standard materials available in China is limited, and traditional GMO matrix standard materials use mass percentage values as the key metric. Differences in genome size and DNA extraction efficiency can affect the copy number results obtained by quantitative real-time PCR, often resulting in significant uncertainty. For example, in maize seeds, the embryo is diploid, while the endosperm is triploid. Even within maize, different varieties exhibit significant differences in genome size, with haploid genomes ranging from 2.45 pg (2364 Mb) to 3.35 pg (3233 Mb), making it difficult to accurately calculate copy numbers based on mass. In contrast, plasmid DNA standard materials can be artificially constructed to achieve a 1:1 copy number ratio between the transgenic sequence and the internal control gene. This simplifies calculations and enhances traceability and reliability in the measurement process. Plasmid molecules can be cultured in large quantities using microorganisms, and DNA is easily amplified, thus providing an unlimited and stable supply of standard materials with high purity; furthermore, they are easy to handle and highly stable. Furthermore, the detection of genetically modified (GM) products containing multiple components in processed foods and feeds, such as corn, soybeans, and potatoes, or where a single component comprises multiple different strains, is extremely complex. For such multi-component, multi-strain GM products, using a single GM standard substance not only requires large quantities and involves complex preparation methods, resulting in a heavy workload and a high risk of missed detections. Developing universal plasmid DNA standard molecules containing multiple common GM targets is essential to meet the quantitative detection needs of GM testing laboratories for multi-component, multi-strain GM components in samples. Summary of the Invention
[0005] The purpose of this invention is to provide a set of plasmid standard molecules suitable for the detection of transgenic crops and their applications.
[0006] A first aspect of the present invention provides an isolated polynucleotide comprising:
[0007] The gene sequences of the cauliflower mosaic virus CaMV35S promoter, NOS terminator, neomycin phosphotransferase gene NPTⅡ, and Scrophularia mosaic virus FMV35S promoter were obtained.
[0008] In another preferred embodiment, the isolated polynucleotide also includes the coding sequence of the plant standard gene 18S rRNA.
[0009] In another preferred embodiment, the cauliflower mosaic virus CaMV35S promoter gene sequence is shown in SEQ ID NO.1.
[0010] In another preferred embodiment, the NOS terminator gene sequence is shown in SEQ ID NO.2.
[0011] In another preferred embodiment, the neomycin phosphotransferase gene NPTⅡ gene sequence is shown in SEQ ID NO.3.
[0012] In another preferred embodiment, the FMV 35S promoter gene sequence of the Scrophularia mosaic virus is shown in SEQ ID NO.4.
[0013] In another preferred embodiment, the 18S rRNA coding sequence of the plant standard gene is shown in SEQ ID NO.5.
[0014] A second aspect of the invention provides an isolated DNA construct comprising the polynucleotides described in the first aspect of the invention, and optionally a tag sequence, an enzyme digestion sequence, and / or a vector sequence.
[0015] In another preferred embodiment, the DNA construct is a linear DNA construct or a circular DNA construct.
[0016] In another preferred embodiment, the DNA construct is a plasmid.
[0017] In another preferred embodiment, the plasmid or expression vector is used as a standard molecule for the detection of transgenic crops (plasmid standard molecule).
[0018] In another preferred embodiment, the backbone plasmid of the plasmid or expression vector is selected from the group consisting of pcDNA3.1(+), pUC19, pUC18, pUC118, pUC119, pBlueScript II SK, and pGEM.
[0019] In another preferred embodiment, the isolated DNA construct is as shown in SEQ ID NO. 6.
[0020] In a third aspect, the present invention provides a kit comprising the polynucleotides described in the first aspect of the present invention or the DNA constructs described in the second aspect of the present invention.
[0021] In another preferred embodiment, the kit further includes a first primer pair that specifically amplifies the cauliflower mosaic virus CaMV35S promoter gene sequence.
[0022] In another preferred embodiment, the first primer pair sequence is shown in SEQ ID NO.7 and SEQ ID NO.8.
[0023] In another preferred embodiment, the kit further includes a second primer pair that specifically amplifies the NOS terminator gene sequence.
[0024] In another preferred embodiment, the second primer pair sequence is shown in SEQ ID NO.9 and SEQ ID NO.10.
[0025] In another preferred embodiment, the kit further includes a third primer pair that specifically amplifies the neomycin phosphotransferase gene NPTⅡ gene sequence.
[0026] In another preferred embodiment, the third primer pair sequence is shown in SEQ ID NO.11 and SEQ ID NO.12.
[0027] In another preferred embodiment, the kit further includes a fourth primer pair that specifically amplifies the FMV 35S promoter gene sequence of the Scrophularia mosaic virus.
[0028] In another preferred embodiment, the fourth primer pair sequence is shown in SEQ ID NO.13 and SEQ ID NO.14.
[0029] In another preferred embodiment, the kit further includes a fifth primer pair that specifically amplifies the 18S rRNA coding sequence of the plant standard gene.
[0030] In another preferred embodiment, the fifth primer pair sequence is shown in SEQ ID NO.15 and SEQ ID NO.16.
[0031] In another preferred embodiment, the kit further includes one or more probe sequences selected from the group consisting of:
[0032] The first probe sequence is shown in SEQ ID NO.:17;
[0033] The second probe sequence is shown in SEQ ID NO.:18;
[0034] The third probe sequence, and the second probe sequence are shown in SEQ ID NO.:19;
[0035] The fourth probe sequence is shown in SEQ ID NO.:20;
[0036] The fifth probe sequence is shown in SEQ ID NO.:21.
[0037] A fourth aspect of the invention provides the use of the polynucleotide as described in the first aspect of the invention, the DNA construct as described in the second aspect of the invention, or the kit as described in the third aspect of the invention, characterized in that it is used for the detection of transgenic plants.
[0038] In another preferred embodiment, the detection is a real-time quantitative PCR detection.
[0039] In a fifth aspect, the present invention provides a real-time quantitative PCR detection method for transgenic crops, wherein the standard substance used is a polynucleotide as described in the first aspect of the present invention or a DNA construct as described in the second aspect of the present invention.
[0040] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description
[0041] Figure 1 This is the standard curve for 18S rRNA amplification.
[0042] Figure 2 This is the standard curve for CaMV35S gene amplification.
[0043] Figure 3 This is the standard curve for NOS gene amplification.
[0044] Figure 4 This is the standard curve for NPTII gene amplification.
[0045] Figure 5 This is the standard curve for FMV gene amplification.
[0046] Figure 6 A schematic diagram of the structure of the plasmid molecule of this invention. Detailed Implementation
[0047] Through extensive and in-depth research, the inventors have obtained a polynucleotide sequence that can be used for real-time fluorescent PCR detection of transgenic crops, as well as a primer pair that works with it. Experimental results show that when the polynucleotide sequence is prepared into a standard plasmid molecule using a suitable backbone plasmid and then used in conjunction with the primer pair of this invention for real-time fluorescent PCR detection, it exhibits excellent specificity and sensitivity, and good stability.
[0048] The technical problem to be solved by this invention is to overcome the lack of positive standards and the preparation of positive standards in existing real-time fluorescence PCR detection methods for transgenic crops. This invention provides a set of plasmid standard molecules suitable for real-time fluorescence PCR detection of transgenic crops, as well as the construction method, quantification method and application of the plasmid standard molecules.
[0049] The principle of real-time fluorescence PCR detection of genetically modified crops
[0050] Real-time fluorescence PCR (PCR) technology can specifically amplify exogenous gene sequences in transgenic crops. Primers targeting the exogenous gene and probes labeled with fluorescence at both ends are designed to amplify the DNA in the test sample. PCR products can be monitored in real time by detecting an increase in fluorescence signal. Simultaneously, a known concentration of positive standard material (or positive standard molecule) is amplified using the same primers, probes, and conditions. In PCR, the positive standard material (or positive standard molecule) can serve as a positive control; in real-time fluorescence PCR, a stable standard curve can be constructed using the positive standard material (or positive standard molecule), and the absolute content (copy number or concentration) of the corresponding gene in the sample can be calculated based on the standard curve.
[0051] Standard materials
[0052] A standard reference is a material or substance that has one or more sufficiently homogeneous and quantitatively defined characteristic values, used to calibrate equipment, evaluate measurement methods, or assign values to materials.
[0053] plasmid standard molecules
[0054] This invention relates to the detection of specific sequences of exogenous genes in transgenic crops and the design of a plasmid standard molecule based on these sequences, preferably plasmid pLW10.
[0055] In a preferred embodiment of the present invention, the plasmid standard fraction includes:
[0056] The gene sequences of the cauliflower mosaic virus CaMV35S promoter, NOS terminator, neomycin phosphotransferase gene NPTⅡ, and Scrophularia mosaic virus FMV35S promoter were obtained.
[0057] In another preferred embodiment, the isolated polynucleotide further includes the coding sequence of the plant standard gene 18S rRNA.
[0058] In another preferred embodiment, the cauliflower mosaic virus CaMV35S promoter gene sequence is shown in SEQ ID NO.1:
[0059]
[0060] In another preferred embodiment, the NOS terminator gene sequence is shown in SEQ ID NO.2:
[0061]
[0062] In another preferred embodiment, the neomycin phosphotransferase gene NPTⅡ gene sequence is shown in SEQ ID NO.3:
[0063]
[0064] In another preferred embodiment, the FMV 35S promoter gene sequence of the Scrophularia mosaic virus is shown in SEQ ID NO.4:
[0065]
[0066]
[0067] In another preferred embodiment, the 18S rRNA coding sequence of the plant standard gene is shown in SEQ ID NO. 5:
[0068]
[0069] In another preferred embodiment, the sequence of the plasmid standard molecule is shown in SEQ ID NO. 6:
[0070]
[0071]
[0072]
[0073] In a preferred embodiment of the present invention, the present invention also provides a primer pair for specifically amplifying the CaMV35S promoter gene sequence of the cauliflower mosaic virus:
[0074] Forward primer: GGCTCCTACAAATGCCATCATT (SEQ ID NO.7); and
[0075] Reverse primer: GGCAGAGGCATCTTCAACGA (SEQ ID NO.8).
[0076] In a preferred embodiment of the present invention, the present invention also provides a primer pair for specifically amplifying the NOS terminator gene sequence:
[0077] Forward primer: GATTAGAGTCCCGCAATTATACATTTAA (SEQ ID NO. 9); and
[0078] Reverse primer: TTATCCTAGTTTGCGCGCTATATTT (SEQ ID NO.10).
[0079] In a preferred embodiment of the present invention, the present invention also provides a specifically amplified neomycin phosphotransferase gene NPTII gene sequence:
[0080] Forward primer: TGCCGAATATCATGGTGGAA (SEQ ID NO.11); and
[0081] Reverse primer: CGGCCACAGTCGATGAATC (SEQ ID NO.12).
[0082] In a preferred embodiment of the present invention, the present invention also provides a specific amplification of the FMV 35S promoter gene sequence of the Scrophularia mosaic virus:
[0083] Forward primer: TCGAGCTGGCTTGTG (SEQ ID NO.13); and
[0084] Reverse primer: CGCCTAACAATTCTGCACCAT (SEQ ID NO.14).
[0085] In a preferred embodiment of the present invention, the present invention also provides a specific amplification of the 18S rRNA coding sequence of the standard gene in the plant:
[0086] Forward primer: TGACGGAGAATTAGGGTTCGA (SEQ ID NO.15); and
[0087] Reverse primer: GGATGTGGTAGCCGTTTCTCA (SEQ ID NO.16).
[0088] In a preferred embodiment of the present invention, the present invention also provides the following probe sequence:
[0089] The first probe sequence specifically targets the CaMV35S promoter gene sequence of cauliflower mosaic virus:
[0090] CGATAAAGGAAAGGCC(SEQ ID NO.:17);
[0091] The second probe sequence is specifically targeted at the NOS terminator gene sequence:
[0092] ACGCGATAGAAAAC (SEQ ID NO.:18);
[0093] The third probe sequence specifically targets the neomycin phosphotransferase gene NPTII sequence:
[0094] TGGCCGCTTTTCT(SEQ ID NO.:19);
[0095] The fourth probe sequence specifically targets the FMV 35S promoter gene sequence of the aforementioned Scrophularia mosaic virus:
[0096] ACCAGACAAAAAAG(SEQ ID NO.:20);
[0097] The fifth probe sequence specifically targets the 18S rRNA coding sequence of the standard gene in the plant:
[0098] TCCGGAGAGGGAGC (SEQ ID NO.:21).
[0099] The primer-probe pair designed in this study exhibits good compatibility with the template molecule. Compared to the primer-probe pair in SNT 1204-2003 "Real-time Fluorescent PCR Qualitative Detection Method for Transgenic Components in Plants and Their Processed Products," the PCR amplification efficiency can be increased by 10%-20%, resulting in a significant improvement in detection sensitivity and a 5-10 fold increase in the detection limit. For example, using the primer-probe pair for the CaMV35S gene in this invention can increase the detection limit for the copy number of the CaMV35S gene by 10 times, to 13 copies / μL.
[0100] This study overcomes the difficulties in the existing quantitative PCR detection of nucleic acids in transgenic crops, namely the lack of positive standards and the preparation of positive standards, and provides a universal plasmid standard molecule for transgenic crops, which can be used for the qualitative and quantitative detection of transgenic components in transgenic crops.
[0101] In one specific embodiment of the present invention, the present invention provides a universal plasmid molecule for detecting transgenic crops, comprising four universal transgenic elements: cauliflower mosaic virus CaMV35S promoter (269bp), NOS terminator (256bp), neomycin phosphotransferase gene NPTⅡ (831bp), Scrophularia mosaic virus FMV 35S promoter (523bp); and the highly conserved internal standard gene 18S rRNA in eukaryotic plants.
[0102] In a preferred embodiment, the copy number ratio of each transgenic universal element and the internal standard gene in the plasmid molecule is 1:1.
[0103] The plasmid DNA molecule of this invention contains four universal transgenic elements: the CaMV35S promoter (269 bp) of cauliflower mosaic virus, the NOS terminator (256 bp), the neomycin phosphotransferase gene NPTⅡ (831 bp), and the FMV35S promoter of Scrophularia mosaic virus (523 bp), covering the insertion element sequences of most existing transgenic crops. Therefore, it can be used for the qualitative detection of most transgenic products. The selected insertion element sequences cover the target gene sequences of existing transgenic detection PCR methods; therefore, this positive standard molecule can be used in conjunction with existing primers and probes or transgenic detection kits in transgenic detection laboratories, demonstrating broad applicability.
[0104] The copy number ratio of transgenic insertion element and internal standard gene in the plasmid molecule is fixed at 1:1. That is, according to the transgenic component content calculation method in GB19495.5-2004 "Detection of Transgenic Products by Nucleic Acid Quantitative PCR", the transgenic content in the plasmid molecule is 100%, which facilitates the calculation of the percentage of transgenic content in practical applications.
[0105] Table 1. Exogenous sequence information of plasmid DNA standard molecules
[0106]
[0107] Reagent test kit
[0108] This invention provides a kit for detecting genetically modified crops, the kit comprising:
[0109] The above plasmid standard molecules.
[0110] The kit provided by this invention contains primer pairs that specifically amplify each transgenic universal element in the standard molecule of the plasmid, enabling convenient PCR detection with high specificity, high sensitivity, and good linearity.
[0111] The main advantages of this invention are:
[0112] (1) The plasmid standard molecules containing the polynucleotide sequence of the present invention have the advantages of strong uniformity and high stability. At the same time, the present invention solves the problem of lack of standard materials in the detection of transgenic crops, ensures the comparability of transgenic crop detection results, and provides quality control for transgenic crop PCR detection.
[0113] (2) When the product prepared by using the plasmid standard molecule of the present invention in combination with the primer pair of the present invention is used for real-time fluorescence PCR detection of transgenic crops, it has high specificity, high sensitivity and good linearity.
[0114] (3) The kit provided by this invention includes a plasmid standard molecule for detecting transgenic crops (pLW10 plasmid standard molecule). The transgenic content of this plasmid is 100%, and the calculation method is based on copy number ratio. Using this plasmid as a positive standard makes the calculation of transgenic content convenient. The four insertion element sequences selected in the plasmid standard molecule cover the target gene sequences of existing transgenic detection PCR methods. It can be used in conjunction with existing primers and probes or transgenic detection kits in transgenic detection laboratories, and has broad applicability.
[0115] (4) The probe and template molecules provided by the present invention have good compatibility and high detection sensitivity.
[0116] The present invention will be further described below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions as described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Percentages and parts are by weight unless otherwise stated. The biological materials and reagents used in the embodiments of the present invention, unless otherwise specified, are commercially available.
[0117] Example 1: Construction of plasmid standard molecules
[0118] The construction process of universal plasmid DNA standard material for transgenic crops according to the present invention is as follows:
[0119] a. Utilize databases (such as GenBank, Shanghai Genetically Modified Organism Safety Testing and Evaluation Sharing Service Platform) http: / / www.shgmo.org / welcome.htm Bioinformatics analysis was performed to select conserved sequence fragments of inserted element genes that cover existing transgenic element detection methods: cauliflower mosaic virus CaMV35S promoter (269bp), NOS terminator (256bp), neomycin phosphotransferase gene NPTⅡ (831bp), and Scrophularia mosaic virus FMV 35S promoter (523bp).
[0120] b. The processed sequences were linked together in a specific order. In this embodiment, the linking order was: CaMV35S promoter (269bp) - NOS terminator (256bp) - neomycin phosphotransferase gene NPTⅡ (831bp) - Scrophularia mosaic virus FMV 35S promoter (523bp). The artificially synthesized sequence was obtained from Takara Bio Engineering (Dalian) Co., Ltd. The obtained full-length gene was cloned into the plasmid vector pcDNA3.1(+) (purchased from Invitrogen (Shanghai) Trading Co., Ltd.) to construct the plasmid pLW09 containing the target gene sequence.
[0121] c. Search for the 18S rRNA coding sequence of standard genes in eukaryotes in genbank.
[0122] d. Primers were designed using Primer 5.0 software to amplify the 18S rRNA of the standard gene in eukaryotic plants. Enzyme restriction sites and protective bases required for molecular cloning were added to both ends of each primer. Specific primer sequences are shown in Table 2. The PCR reaction system is shown in Table 3, and the PCR reaction steps are shown in Table 4.
[0123] Table 2. PCR primer sequences for constructing standard plasmid DNA molecules
[0124]
[0125]
[0126] Table 3. PCR amplification system of 18SRNA sequence in plasmid standard molecules
[0127] Reaction reagents Dosage (μL) 10×buffer 2 dNTP (2.5mM) 1 Upstream primer (10 μM) 1 Downstream primer (10 μM) 1 Ex Taq enzyme (5 units / reaction) 0.5 DNA template 1 <![CDATA[ddH2O]]> Make up to 20 μL
[0128] Table 4. PCR amplification conditions for 18SRNA sequences in plasmid standard molecules
[0129]
[0130] e. The amplified fragment is inserted into the plasmid vector pLW09 using molecular cloning techniques to obtain the plasmid DNA standard molecule pLW10, which contains both the transgenic universal element sequence and the plant standard gene sequence. The copy number ratio of the transgenic universal element sequence to the plant standard gene sequence is 1:1.
[0131] The specific steps for cloning the gene sequence are as follows: The eukaryotic 18S rRNA amplification fragment and plasmid pLW09 were obtained by digestion and amplification with restriction endonuclease Sam I. The PCR amplification sequence and linear plasmid pLW09 were recovered after enzyme digestion. They were ligated with T4 ligase. The ligation product was transformed into Escherichia coli DH5α to obtain the plasmid standard material pLW10.
[0132] Table 5 Enzyme digestion reaction system
[0133]
[0134]
[0135] Table 6 Target DNA Fragment Ligation Reaction System
[0136] Reaction reagents Dosage (μL) 10×T4 ligase buffer 2 T4 ligase 1 DNA fragments 6 plasmid vector 7 <![CDATA[ddH2O]]> Make up to 20 μL
[0137] Example 2: Application of universal detection plasmid standard molecules for transgenic crops
[0138] This embodiment provides a method for applying the universal detection plasmid standard molecule, matching primer pairs, and probes for transgenic crops in transgenic fluorescent PCR detection, including the following steps:
[0139] The primers, probes, PCR reaction system, and reaction time and temperature program in SNT 1204-2003 "Real-time Fluorescent PCR Qualitative Test Method for Transgenic Components in Plants and Their Processed Products" (China Entry-Exit Inspection and Quarantine Industry Standard), a method with high market acceptance, were selected as the standard method for transgenic detection. The Ct values obtained by simultaneously amplifying exogenous transgenic elements CaMV35S, FMV35S, NOS, and NPTII using real-time quantitative PCR were compared with those obtained by amplifying endogenous plant standard genes. When the specific concentration of plasmid DNA molecules is unknown, the plasmid DNA molecules can be serially diluted (at least 5 concentration gradients) to amplify the inserted element gene and the internal standard gene in the plasmid DNA molecules separately, and a standard curve can be constructed. The horizontal axis represents the nucleic acid copy number content of the serial dilution concentration, and the vertical axis represents the Ct value in fluorescent PCR. Simultaneously amplifying the inserted element gene and the internal standard gene in the transgenic sample to be tested, the concentration content (or dilution gradient) of both can be obtained. The ratio of the content of the inserted element gene to the content of the internal standard gene in the transgenic sample is the percentage of transgenic content.
[0140] The specific steps are as follows:
[0141] a. Serially dilute plasmid DNA standard molecules, from 10... 6 copies / μL~10 0 copies / μL;
[0142] b. The real-time fluorescence PCR reaction procedure in SNT 1204-2003 "Qualitative Detection Method of Transgenic Components in Plants and Their Processed Products by Real-Time Fluorescent PCR" was used, with serially diluted plasmid DNA standards as templates for real-time fluorescence PCR amplification. Each reaction was repeated three times, and a standard curve was established based on the relationship between the Ct value of amplified templates at different concentrations and their concentrations.
[0143] c. The real-time fluorescence PCR standard curves established using the DNA standards of each plasmid as templates are shown in [reference needed]. Figures 1-5 :
[0144] The correlation coefficients of the standard curves established using each plasmid DNA standard material all reached 0.99, indicating good linearity. The standard deviations of Ct values obtained between three parallel reactions and three different replicate experiments were all less than 0.2, demonstrating good repeatability and reproducibility of the quantitative PCR reaction. This indicates that plasmid DNA standard molecules are suitable for real-time fluorescence PCR detection and can be used as positive standard molecules for amplifying target gene sequences commonly used in the detection of transgenic crops by real-time fluorescence PCR.
[0145] discuss:
[0146] The plasmid standard molecule of this invention contains four universal transgenic elements, providing broad coverage. Due to the limited capacity of plasmid vectors, the length of the universal transgenic elements needs to be selected, and potential interference between different universal transgenic elements during PCR must be avoided. Extensive experimental verification has shown that the specific universal transgenic elements selected in this invention have reasonable lengths, do not interfere with each other, can be amplified in large quantities using plasmids, are simple to prepare, and exhibit good reproducibility and repeatability in PCR detection, with good primer compatibility. Because the standard molecule of this invention contains multiple universal transgenic elements, for the detection of transgenic products containing multiple components or different strains in processed foods and feeds, only a single serially diluted standard solution is needed to detect the transgenic content, greatly reducing the workload in the detection process. For qualitative detection of transgenic products, the presence of just one inserted element from the plasmid molecule is sufficient to classify the product as transgenic; therefore, the plasmid molecule of this invention has a wide range of applications. The ratio of each transgenic insertion detection element to the plant standard gene in the plasmid molecule of this invention is 1:1, which is the same as the transgenic content expressed as a percentage of copy number in the national standard. Compared with the mass ratio of ordinary plant seed powder standard substances, the plasmid standard molecule of this invention does not require unit conversion and is simple to calculate when used as a positive standard.
[0147] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.
Claims
1. A reagent kit, characterized in that, The kit contains isolated polynucleotides, which comprise: The isolated polynucleotides include the CaMV35S promoter gene sequence of cauliflower mosaic virus, the NOS terminator gene sequence, the neomycin phosphotransferase gene NPTⅡ gene sequence, and the FMV35S promoter gene sequence of Scrophularia mosaic virus; the isolated polynucleotides also include the 18S rRNA coding sequence of the plant standard gene. The kit also includes a first primer pair, which specifically amplifies the CaMV35S promoter gene sequence of the cauliflower mosaic virus. The sequence of the first primer pair is shown in SEQ ID NO.7 and SEQ ID NO.
8. The cauliflower mosaic virus CaMV35S promoter gene sequence is shown in SEQ ID NO.1; The NOS terminator gene sequence is shown in SEQ ID NO.2; The neomycin phosphotransferase gene NPTⅡ gene sequence is shown in SEQ ID NO.3; The gene sequence of the Scrophularia mosaic virus FMV 35S promoter is shown in SEQ ID NO.4; The 18S rRNA coding sequence of the standard gene in the plant is shown in SEQ ID NO.5; The kit also includes a second primer pair, which specifically amplifies the NOS terminator gene sequence; and The kit also includes a third primer pair, which specifically amplifies the neomycin phosphotransferase gene NPTII gene sequence; and The kit also includes a fourth primer pair, which specifically amplifies the FMV35S promoter gene sequence of the Scrophularia mosaic virus; and The kit also includes a fifth primer pair, which specifically amplifies the 18S rRNA coding sequence of the standard gene in the plant; Furthermore, the isolated polynucleotide is an isolated DNA construct, which is a plasmid or expression vector; The isolated DNA construct has the nucleotide sequence shown in SEQ ID NO. 6; The kit also includes probe sequences selected from the following group: The first probe sequence is shown in SEQ ID NO.:17 and specifically targets the CaMV35S promoter gene sequence of cauliflower mosaic virus. The second probe sequence is shown in SEQ ID NO.:18 and is specifically targeted at the NOS terminator gene sequence; The third probe sequence is shown in SEQ ID NO.:19, and it specifically targets the neomycin phosphotransferase gene NPTⅡ gene sequence. The fourth probe sequence is shown in SEQ ID NO.:20 and specifically targets the Scrophularia mosaic virus FMV 35S promoter gene sequence; The fifth probe sequence is shown in SEQ ID NO.:21 and specifically targets the 18S rRNA coding sequence of the standard gene in the plant.
2. The kit according to claim 1, characterized in that, The plasmid or expression vector is used as a standard molecule for the detection of transgenic crops.
3. The kit according to claim 2, characterized in that, The backbone plasmid of the plasmid or expression vector is selected from the following group: pcDNA3.1(+), pUC19, pUC18, pUC118, pUC119, pBlueScript II SK, and pGEM.
4. The use of the kit as described in claim 1, characterized in that, Used for the detection of genetically modified plants.
5. The use as described in claim 4, characterized in that, The detection method is quantitative real-time PCR.
Citation Information
Patent Citations
Probe sequence for qualitatively detecting transgenic crop containing Npt II gene using fluorescence PCR and reagent case
CN1485438A