Method for detecting microorganisms in a sample using a fluorescence-based detection method using SOMAmer

Abstract

The present invention relates to detecting microorganisms, especially Staphylococcus aureus ( Staphylococcus aureus ), comprising the steps of: a) incubating the sample with a modified slow off-rate aptamer (SOMAmer) comprising a fluorescent marker; b) optionally washing the sample; c) analyzing the sample by a fluorescence-based detection method. The present invention also relates to a modified slow off-rate aptamer comprising a fluorescent marker, wherein the SOMAmer comprises a nucleotide sequence specific for Staphylococcus aureus, which is used to detect Staphylococcus aureus cells in a sample, and to a microarray or biosensor and a kit comprising at least one such SOMAmer comprising a fluorescent marker.

Description

[0001] The present invention relates to detecting microorganisms, especially Staphylococcus aureus ( Staphylococcus aureus ), comprising the steps of: a) incubating the sample with a modified slow off-rate aptamer (SOMAmer) comprising a fluorescent label; b) optionally washing the sample; and c) analyzing the sample by a fluorescence-based detection method.

[0002] The present invention also relates to a SOMAmer comprising a fluorescent marker, wherein the SOMAmer comprises a nucleotide sequence specific for Staphylococcus aureus, which is used to detect Staphylococcus aureus cells in a sample, and to a microarray or biosensor and a kit comprising at least one such SOMAmer comprising a fluorescent marker.

[0003] Monitoring of microbial contamination for food, water, non-sterile products or environment is usually based on traditional microbiological methods, such as culture methods. For detecting specific microorganisms, selectivity or differential culture media can be used, which respectively allow only selected microbial growth or distinguish a type of microorganism from another type of microorganism grown on the same culture medium. These methods need several days to obtain results because they rely on the ability of microbial growth to produce visible bacterium colonies. Even if it is time-consuming, it is always a standard detection method.

[0004] Over the past two decades, many technologies and detection systems have emerged in the field of rapid microbiology, such as nucleic acid amplification techniques (NAAT) and immunoassays. These alternative technologies reduce the detection time compared to traditional culture-based methods.

[0005] NAAT is known to provide contamination results within hours. However, this technology has several disadvantages, such as the complexity of the protocol (requiring high technical expertise) or the problem of false positives, and is still limited by the sample preparation method.

[0006] Immunoassays rely on the use of specific monoclonal or polyclonal antibodies to capture and / or detect target microorganisms. The efficiency and success of immunoassays depend on the quality of the antibodies used in the test. Due to the way they are produced (in animals or through cell culture), one disadvantage of using antibodies is the problem of reproducibility between batches.

[0007] To overcome some of the shortcomings of antibodies and improve assay quality, new affinity binders, such as aptamers, have been developed.

[0008] Aptamers are synthetic, short DNA or RNA strands that can fold into a variety of structures and can bind specifically to their targets (like antibodies).

[0009] DNA aptamers have been used to detect microorganisms including Staphylococcus aureus. In addition, fluorescently labeled DNA aptamers have also been reported for the detection of whole bacterial cells using fluorescence-based methods:

[0010] US 2012 / 0071639 A1 discloses specific DNA sequences for binding to a variety of food-borne and water-borne pathogens and biotoxins.

[0011] WO 2013 / 064818 A1 discloses fluorescently labeled aptamers for detecting pathogenic bacteria in a sample.

[0012] Cao et al. (2009, Nucleic Acids Res 37, 4621-4628) disclosed a set of ssDNA aptamers specific for Staphylococcus aureus obtained by the whole-bacteria SELEX procedure. A combination of five of these aptamers achieved good results in recognizing different strains of Staphylococcus aureus.

[0013] Dwivedi et al. (2013, Appl Microbiol Biotechnol 97, 3677-3686) described the use of Salmonella Typhimurium in Salmonella enterica serova Typhimurium)-specific DNA aptamers and their use in the detection of Salmonella by flow cytometry.

[0014] Gold et al. (2010, PLoS One 5, e15004) and Vaught et al. (2010, J Am Chem Soc 132, 4141-4151) described the development of new aptamer-based reagents called SOMAmers (modified slow off-rate aptamers). SOMAmers are made from single-stranded DNA (ssDNA) containing pyrimidine residues modified with amino acid side chain mimetics at their 5' position and have a relatively long (> 30 min) off-rate. These features result in SOMAmers with better affinity and better kinetic properties than standard RNA or DNA aptamers.

[0015] US 7947447 B2 discloses an improved SELEX method for producing SOMAmers that can bind to target molecules with slower dissociation rate constants than can be obtained using previous SELEX methods.

[0016] Ochsner et al. (2013, Diagn Microbiol Infect Dis. 76, 278-285) described a method for the treatment of Clostridium difficile ( Clostridium difficile) Characterization of toxin (i.e., microbial protein)-specific SOMAmers.

[0017] The use of SOMAmers for the detection of whole bacterial cells has not been described in the prior art.

[0018] The object of the present invention is to provide suitable reagents for detecting microorganisms in complex samples.

[0019] Surprisingly, it was discovered that highly specific fluorescently labeled SOMAmers are very effective tools for detecting microorganisms in complex samples by fluorescence-based methods.

[0020] Therefore, the present invention relates to a method for detecting microorganisms in a sample, comprising the steps of: a) incubating the sample with a modified slow off-rate aptamer (SOMAmer) comprising a fluorescent label; b) optionally washing the sample; c) analyzing the sample by a fluorescence-based detection method.

[0021] SOMAmers (modified slow off-rate aptamers) are made from single-stranded DNA (ssDNA) containing pyrimidine residues modified with amino acid side chain mimics at their 5' position and have a relatively long (> 30 min) off-rate. These features lead to better affinity and better kinetic properties of SOMAmers than standard RNA or DNA aptamers (Gold et al., 2010, PLoS One 5, e15004; Vaught et al., 2010, J Am Chem Soc 132, 4141-4151).

[0022] As used herein, "slow off-rate" refers to the time it takes for the aptamer / target complex to begin to dissociate. This can be expressed as a half-life or the point at which 50% of the aptamer / target complex has dissociated. The dissociation rate or dissociation velocity of a SOMAmer, expressed as a half-life (t 1 / 2 ) value, which may be greater than 30 min, greater than 60 min, greater than 90 min, or greater than 120 min. The dissociation time may be measured by a dynamic system (e.g., surface plasmon resonance) that monitors the binding and dissociation of the complex, which is well known in the art.

[0023] SOMAmer reagents can be generated by SELEX methods using natural or purified recombinant proteins with multiple modified DNA libraries for cell surface binding proteins of microorganisms. Suitable SELEX methods for generating such SOMAmers are disclosed in US 7947447 B2, which is incorporated by reference into the disclosure of this patent application.

[0024] Conventional methods of chemistry, microbiology and molecular biology required to practice the present invention are known to those skilled in the art and can also be found in the standard literature.

[0025] According to the present invention, the term microorganism relates to bacteria, yeast or fungi. In a preferred embodiment, the microorganism is a bacterium, preferably a pathogenic bacterium.

[0026] It can, for example, be selected from the group consisting of Salmonella (such as Salmonella typhimurium, Salmonella Enteritidis), Escherichia coli ( Escherichia coli ), Listeria spp. Listeria spp ), Listeria monocytogenes ( Listeria monocytogenes ), Staphylococcus aureus, Pseudomonas ( Pseudomonas )、Campylobacter( Campylobacter ), Shigella ( Shigella , Streptococcus ( Streptococcus ), Mycobacterium ( Mycobacterium )、Burkshire Hathaway( Burkholderia )、Legionella( Legionella )、Yersinia ( Yersinia ), Clostridium difficile ( Clostridium ), Corynebacterium ( Corynebacterium ) and Vibrio ( Vibrio ).

[0027] In a preferred embodiment of the present invention, the microorganism is Staphylococcus aureus.

[0028] Examples of surface-bound proteins of S. aureus for which SOMAmers can be prepared include: SpA, ClfA, ClfB, FnbA, FnbB, SasD, IsdA, IsdB, IsdC, and IsdH. All of these proteins are attached to the cell wall by transpeptidase-mediated cleavage between threonine and glycine of the LPXTG transpeptidase motif and become amide-linked to the penta-glycine cross-bridge of the peptidoglycan (Marraffini et al., 2006, Microbiol Mol Biol Rev 70:192-221). Staphylococcus aureus protein A (SpA) is present on the bacterial surface and is secreted into the extracellular environment. ClfA and ClfB are structurally related fibrinogen binding proteins (McDevitt et al., 1997, Eur J Biochem 247: 416-424; Ni Eidhin et al., 1998, Mol Microbiol30: 245-257). ClfB is one of the key factors responsible for adhesion to desquamated anterior narial epithelial cells and is normally produced during the early exponential growth phase (Ni Eidhin et al., 1998, supra). FnbA and FnbB attach to components of the extracellular matrix (both fibronectin and elastin) and are important for colonization of host tissues during infection (Roche et al., 2004, supra). J Biol Chem SasD is a putative adhesion protein with unknown physiological role (Roche et al., 2003, Microbiology 149: 643-654; Ythier et al., 2012, Mol Cell Proteomics 11: 1123-1139). Four of these proteins belong to the iron-responsive surface determinant (Isd) system, which is induced under iron-limited conditions in S. aureus and is important for capturing heme from hemoglobin (IsdB, IsdH) and its transcellular wall transporter (IsdA, IsdC) (Grigg et al., 2010, J Inorg Biochem 104: 341-348;Mazmanian et al., 2003, Science 299: 906-909).

[0029] Typically, the sample to be analyzed is a complex sample, such as a clinical sample, a food or feed sample, a beverage sample, a pharmaceutical sample (including water for injection), a personal care and / or cosmetic sample. The sample may be a raw material, a finished product, or may be taken from a production or storage environment. Preferably, the sample is a clinical sample, a food sample, a pharmaceutical sample and / or a personal care product.

[0030] "Complex sample" means a sample comprising more than one component. For example, when it is food or feed - it can be meat or meat products (e.g., raw or cooked meat products), dairy products or compositions for dairy production (e.g., cheese or yogurt), plant-based food products, ready-to-eat foods or food ingredients, salad products, infant formula. In one embodiment, the sample can be a personal care or cosmetic product such as an eye care product, such as a contact lens care solution. If the sample is a beverage, it can be, for example, beer or a sample taken during beer brewing, drinking water. Pharmaceutical samples cover both human and animal (i.e., veterinary) medicines. Clinical samples can, for example, be body fluids (particularly blood, plasma or serum) or tissue samples.

[0031] Exemplary samples include, but are not limited to, foods (e.g., cow's milk, sheep's milk, goat's milk, horse's milk, donkey's milk, camel's milk, yak's milk, buffalo's milk, and reindeer's milk, dairy products, beef, goat's meat, lamb's meat, mutton's meat, pork's meat, frog's legs, veal, rodent's meat, horse's meat, kangaroo's meat, poultry's meat (including chicken, turkey, duck's meat, goose's meat, wild pigeon's meat or pigeon's meat, ostrich's meat, emu's meat), seafood (including finfish such as salmon and tilapia, and shellfish such as mollusks and crustaceans, and snails), meat products, plant products, seeds, grains from herbaceous plants (including corn, wheat, rice, barley, sorghum, and millet), grains from non-herbaceous plants (including beans, peanuts, peas and lentils), nuts (including almonds, walnuts and pine nuts), oil seeds (including sunflower, rapeseed and sesame), vegetables such as root vegetables (including potatoes, cassava and turnips), leafy vegetables (including amaranth, spinach and cabbage), marine vegetables (including palmate dulse, kelp and winged vegetables), stem vegetables (including bamboo shoots, cactus and asparagus), flower vegetables (including artichokes, cauliflower and day lily) and fruit vegetables (including pumpkin, okra and eggplant), fruits, herbs and spices), whole blood, urine, sputum, saliva, amniotic fluid, plasma, serum, lung lavage fluid and tissue (including but not limited to liver, spleen, kidney, lung, intestine, brain, heart, muscle, pancreas, etc.). The skilled person will recognize that cell lysates, extracts or (homogenized) materials obtained from any of the above exemplary samples or mixtures of the exemplary samples or compositions comprising one or more of the exemplary samples are also samples within the scope of the present invention.

[0032] In one embodiment of the invention, the SOMAmer comprises a nucleotide sequence that is specific for S. aureus.

[0033] The term "nucleotide sequence" as used herein refers to an oligonucleotide sequence or a polynucleotide sequence and variants, homologues, fragments and derivatives (such as parts thereof) thereof. The nucleotide sequence may be synthetic or recombinant in origin, it may be single-stranded, representing a sense or antisense strand.

[0034] The term "nucleotide sequence" in relation to the present invention includes synthetic DNA and RNA. Preferably, the nucleotide sequence of a SOMAmer according to the present invention can be synthesized in whole or in part using chemical methods well known in the art.

[0035] As used herein, the term "specific" means that the SOMAmer reacts selectively with S. aureus compared to other microorganisms.

[0036] SOMAmers according to the present invention can be used in a similar manner to antibodies. Similar to antibodies, SOMAmers provide target binding specificity.

[0037] In one aspect of the invention, the SOMAmer comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 15 and SEQ ID NO: 16 or a fragment thereof or a sequence having at least 80% identity thereto, or a sequence that hybridizes thereto under stringent conditions.

[0038] Preferably, the SOMAmer comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 and SEQ ID NO: 12 or a fragment thereof, or a sequence having at least 80% identity thereto, or a sequence that hybridizes thereto under stringent conditions.

[0039] More preferably, the SOMAmer comprises a nucleotide sequence selected from the group consisting of: SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11 and SEQ ID NO:12.

[0040] In a very preferred embodiment of the invention the SOMAmer comprises a nucleotide sequence according to SEQ ID NO:1 or SEQ ID NO:3.

[0041] As used herein, the term "fragment" means a portion of an aptamer sequence taught herein that has the same or better affinity, specificity or functional activity for a target of interest than the entire sequence. A fragment may consist of about 35 nucleotides (e.g., 33-37 nucleotides). Preferably, a fragment has a similar secondary structure to the original full-length aptamer in the region represented by the fragment.

[0042] The present invention also encompasses sequences having at least 80% sequence identity with the nucleic acid sequences of the present invention. In this context, similar sequences are taken to include nucleotide sequences that may have at least 80%, preferably at least 90%, more preferably at least 95 or 98% identity with the subject sequence. Typically, similar sequences will contain the same or similar secondary structure as the subject SOMAmer.

[0043] In one embodiment, the similar sequences adopted include nucleotide sequences having one or several additions, deletions and / or substitutions compared to the target sequence.

[0044] Sequence identity comparisons can be performed by eye, or more usually, with the aid of readily available sequence comparison programs. These commercially available computer programs can calculate the % identity between two or more sequences.

[0045] The present invention also encompasses sequences that are complementary to the nucleic acid sequences of the present invention or sequences that are capable of hybridizing to the sequences of the present invention or to sequences that are complementary thereto.

[0046] As used herein, the term "hybridization" shall include "the process by which a nucleic acid strand joins with a complementary strand through base pairing." Hybridization is performed under stringent conditions (eg, 50°C and 0.2xSSC {1xSSC = 0.15 M NaCl, 0.015 M sodium citrate pH 7.0}).

[0047] According to the present invention, the SOMAmer comprises a fluorescent label.

[0048] The label can be attached to the 5' or 3' end of the SOMAmer. In a preferred embodiment, the label is attached to the 5' end of the SOMAmer. The skilled artisan is well aware of techniques for attaching fluorescent labels to nucleic acid strands. Any of these methods can be used in the present invention to attach fluorescent labels to SOMAmers, for example, as described in Schubert et al., 1990, Nucleic Acids Research 18, 3427.

[0049] In theory, fluorescent labels can be attached during or after oligonucleotide synthesis.

[0050] The fluorescent label can be directly or indirectly attached to the SOMAmer. For indirect attachment, any mechanism known to those skilled in the art can be used, such as the use of biotin and streptavidin or digoxigenin (DIG) and anti-digoxigenin.

[0051] Suitable fluorescent labels are selected by those skilled in the art according to various parameters, such as the size and / or optical properties of the label (such as color, fluorescence excitation wavelength, fluorescence emission wavelength and intensity). A large variety of fluorescent labels are commercially available. Examples of suitable fluorescent labels are: fluorescein dyes (such as fluorescein, 6-FAM (6-carboxyfluorescein), JOE, TET, HEX), rhodamine dyes (such as 5'-tetramethylrhodamine, ROX, TRITC, X-rhodamine, lissamine rhodamine B), cyanine dyes (such as Cy2, Cy3, Cy3B, Cy3.5, Cy5, Cy5.5, Cy7, IRD700, IRD800, allophycocyanin (APC)), dinoflagellate chlorophyll (PerCP), R-phycoerythrin (R-PE), coumarin dyes (such as hydroxycoumarin, aminocoumarin, methoxycoumarin) and quantum dots. Additional examples are: Alexa Fluor® 350, Alexa Fluor® 405, Alexa Fluor® 430, Alexa Fluor® 488, Alexa Fluor® 500, Alexa Fluor® 514, Alexa Fluor® 532, Alexa Fluor® 546, Alexa Fluor® 555, Alexa Fluor® 568, Alexa Fluor® 594, Alexa Fluor® 610, Alexa Fluor® 633, Alexa Fluor® 647, Alexa Fluor® 660, Alexa Fluor® 680, Alexa Fluor® 700, Alexa Fluor® 750, Alexa Fluor® 790, DyLight 350, DyLight 408, DyLight 488, DyLight 549, DyLight 594, DyLight 633, DyLight 649, DyLight 680, DyLight 759, DyLight 800, eFluor® 660, Cascade Blue, Pacific Blue, Pacific Orange, Lucifer Yellow, NBD, Red 613, TruRed, FluorX, BODIPY-FL, Texas Red. Preferably, fluorescein is used.

[0052] The method according to the invention involves step a) incubating the sample with a modified slow off-rate aptamer (SOMAmer) comprising a fluorescent marker. This means that the SOMAmer comprising a fluorescent marker is mixed with the sample and incubated for a period of time.

[0053] Typically, the sample is inoculated directly into a buffer or growth medium (optionally incubated) prior to further analysis by fluorescence-based detection methods using SOMAmers. If the sample is a solid sample, it may be necessary to perform a homogenization (stomaching) after or during the addition of the buffer or growth medium. In a further optional embodiment, the solid sample is rinsed with a liquid and the liquid is then collected for further optional incubation in a growth medium and further analysis with SOMAmers.

[0054] Alternatively, the SOMAmer is mixed with a suitable buffer or with a growth medium and subsequently mixed with the sample. If the sample is a solid sample, homogenization may be necessary after or during the addition of the buffer / growth medium containing the SOMAmer.

[0055] Suitable buffer can be selected by those skilled in the art. It usually has a pH value greater than 5 and less than 9, preferably greater than 6 and less than 8, more preferably between 6.5 and 7.5. The buffer that can be used in the method of the present invention is preferably selected from phosphate buffer, phosphate buffered saline buffer (PBS), 2-amino-2-hydroxymethyl-1,3-propanediol (TRIS) buffer, TRIS buffered saline buffer (TBS) and TRIS / EDTA (TE). In one embodiment of the present invention, the buffer further comprises MgCl 2 MgCl 2 - if present - is typically present in a concentration of between 0.005 and 3 M, preferably between 0.01 and 1 M, more preferably between 0.01 and 0.5 M, for example 25 mM.

[0056] Typically, approximately 0.07 µmol / L of SOMAmer will be sufficient to detect 10 7 In a preferred embodiment, a SOMAmer concentration of 0.01 to 10 µmol / l buffer is used.

[0057] The incubation is generally carried out at a temperature of 16°C to 30°C, preferably at a temperature of 18°C ​​to 28°C, more preferably at room temperature.

[0058] Typically, the incubation time period is between 1 and 60 minutes, preferably between 5 and 30 minutes.

[0059] The concentration of SOMAmers used according to the present invention can be determined by one skilled in the art.

[0060] Optionally, the method according to the invention may involve a step of washing the sample. During this step, any unbound SOMAmer may be eluted before detecting the presence of bound SOMAmer. Typically, washing means centrifuging the sample and resuspending the pellet in a buffer. The washing step may be performed once or repeated several times, for example twice, 3 times or 4 times.

[0061] In step c) according to the present invention, the sample is analyzed by a fluorescence-based detection method. The fluorescence-based detection method is preferably selected from: flow cytometry, solid phase cytometry, fluorescence-based analysis methods and fluorescence imaging systems (such as fluorescence microscopy).

[0062] Flow cytometry is an analytical method that allows the measurement of light scattered and fluorescent emissions generated by luminescent individual cells. Typically, the cells or particles to be analyzed are suspended in a liquid and passed individually through a laser beam. The scattered light (related to particle size and complexity) and the fluorescent emissions (due to fluorescent labeling of the target particles / cells) of each particle are collected by a detector and sent to a computer. Since each particle or cell is investigated separately, the results represent the cumulative individual cell characteristics (Álvarez-Barrientos et al. 2000, Clin Microbiol Rev, 13(2): 167–195).

[0063] A sample that may contain a target analyte is mixed with a reagent specific for the target analyte (e.g., a SOMAmer according to the present invention) labeled with a suitable fluorescent molecule. After applying appropriate binding conditions and optional washing steps, the labeled sample is then processed by flow cytometry: cells are individually passed through a laser beam and the resulting scattered light and fluorescent signals are analyzed to collect information related to the target analyte (e.g., cells).

[0064] Fluorescence imaging systems provide images of the observed object (e.g., single cells, microcolonies) using light emitted by the phenomenon of fluorescence (Barrett and Myers 2003, Foundations of Image Science. In Wiley Series in pure and Applied Optics ed. Saleh BEAUSA, New Jersey, Hoboken: John Wiley & Sons, Inc.). Fluorescence microscopy is an example of a fluorescence imaging system, where the features imaged are small and obtained through optical magnification.

[0065] A sample that may contain a target analyte is mixed with a reagent specific for the target analyte (e.g., a SOMAmer) labeled with a suitable fluorescent molecule. After applying appropriate binding conditions and optional washing steps, the labeled sample is placed under the objective of a microscope. The parameters of the microscope are set to match the characteristics of the fluorescent label.

[0066] Solid phase cytometry is a method used to detect single particles / cells on a solid surface. Typically, solid phase cytometry is performed on a membrane. Image-based quantification systems will provide the number, size, and shape of any selected markers in combination with their localization on the membrane.

[0067] The sample that may contain the target analyte is filtered through a black membrane filter (e.g. polyester or polycarbonate) with an appropriate pore size (i.e. 0.4 μm for bacteria). The retained cells are then labeled with a reagent specific for the target analyte (e.g. SOMAmer) labeled with a suitable fluorescent molecule. The filter is then scanned with a laser that allows fluorescent events on the membrane (e.g. labeled microorganisms) to be detected by a series of detection units. This enables the detection and counting of the target analyte on the membrane (Reynolds and Fricker 1999, J Appl Microbiol 86, 785–795; Vanhee et al. 2009, Nat Protoc 4, 224-231).

[0068] Fluorescence-based analytical methods are methods that measure the total amount of fluorescent signals, which are used to detect and / or measure the amount of target analytes that have been labeled with suitable fluorescent tags (Skoog et al. 2007, Principles of Instrumental Analysis, Sixth Edition, USA, California, Belmont: Brooks / Cole). Such methods can be implemented on various carriers (e.g., microplates, tubes, microtubes, microfluidic devices).

[0069] A sample that may contain a target analyte is mixed with a reagent specific for the target analyte (e.g., a SOMAmer) labeled with a suitable fluorescent molecule. After applying appropriate binding conditions and optional washing steps, the container (e.g., a microplate, a small tube) containing the labeled sample is exposed to a specific wavelength to appropriately excite the fluorescent dye. The fluorescent emission (occurring as a result of the binding of the target analyte to the fluorescent reagent) is collected by an appropriate optical sensor. The amount of this fluorescence is quantified by the sensor and processed for correlation with reference data to provide a measure of the analyte.

[0070] Any fluorescent molecule can be used in any fluorescence-based detection method. For a given detection method, the key requirements are an excitation source suitable for the chosen fluorescent molecule and the availability of a fluorescence detector.

[0071] Examples of wavelength combinations for fluorescence detection (suitable fluorescent labels):

[0072] - Excitation: 488 nm (blue laser) + Emission: 530 nm (fluorescein, Alexa Fluor® 488), 585 nm (R-phycoerythrin – R-PE) and >670 nm (Dinoflagellate chlorophyll – PerCP)

[0073] - Excitation: 532 - 561 nm (green and yellow / green lasers) + Emission: 560 (Alexa Fluor® 532), 585 (R-PE - R-phycoerythrin)

[0074] - Excitation: 635 nm (red laser) + Emission: 660 nm (Allophycocyanin – APC / Cyanocyanine 5 –Cy5 / eFluor® 660 / Alexa Fluor® 647).

[0075] The method according to the invention offers several advantages over the use of antibodies:

[0076] - Excellent thermal stability in solution

[0077] - Lower molecular weight

[0078] - Higher multiplexing capability

[0079] - Chemical stability to heat, drying and solvents

[0080] - Reversible renaturation

[0081] - Easy reagent production

[0082] - Consistent batch-to-batch performance

[0083] - Lower costs.

[0084] The present invention also relates to a modified slow off-rate aptamer (SOMAmer) comprising a fluorescent label, wherein the SOMAmer comprises a nucleotide sequence specific for Staphylococcus aureus.

[0085] SOMAmers, fluorescent labels and preferred embodiments thereof are defined as described above.

[0086] Therefore, in another aspect, the present invention relates to a SOMAmer comprising a fluorescent label, characterized in that the SOMAmer comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 15 and SEQ ID NO: 16 or a fragment thereof or a sequence having at least 80% identity thereto, or a sequence that hybridizes thereto under stringent conditions.

[0087] In another aspect, the present invention relates to a SOMAmer comprising a fluorescent label, characterized in that the SOMAmer comprises a nucleotide sequence selected from the following: SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11 and SEQ ID NO:12 or a fragment thereof or a sequence having at least 80% identity therewith, or a sequence that hybridizes therewith under stringent conditions.

[0088] In a further aspect, the present invention relates to a SOMAmer comprising a fluorescent marker, characterized in that the SOMAmer comprises a nucleotide sequence according to SEQ ID NO:1 or SEQ ID NO:3.

[0089] In a further aspect, the present invention relates to the use of a SOMAmer comprising a fluorescent marker as defined above for detecting Staphylococcus aureus cells in a sample.

[0090] The SOMAmer according to the invention may be immobilized on (eg bound to or adhered to) a substrate or carrier (eg a microcarrier).

[0091] The present invention also relates to a microarray or a biosensor comprising at least one SOMAmer as described above comprising a fluorescent marker.

[0092] Biosensors are analytical devices for detecting target analytes that convert biological responses into electrical signals. Biosensor applications use biological recognition elements (such as enzymes, antibodies and nucleic acids) to detect target molecules. Conventional biosensors contain three components: a biosensor element that can recognize or bind to the analyte, a transduction element that converts the detection event into a measurable signal, and a display that converts the signal into a digital format. The sensing element primarily defines the selectivity and sensitivity of the biosensor. Detection of analytes is typically based on sensing the analyte with an electronic readout or an optical readout. SOMAmers comprising fluorescent markers according to the present invention can be used as biological elements in biosensor applications.

[0093] In a further embodiment, the invention relates to a kit comprising at least one SOMAmer as defined above comprising a fluorescent marker.

[0094] The kit according to the present invention may be a rapid detection kit. The kit may, for example, comprise i) at least one (such as 2, 3 or 4) SOMAmers according to the present invention comprising a fluorescent marker and ii) instructions for how to use the SOMAmers. BRIEF DESCRIPTION OF THE DRAWINGS

[0095] Figure 1 : After staining with different concentrations of fluorescently labeled 4520-8 (SEQ ID NO: 3) and 4531-56 (SEQ ID NO: 1) SpA SOMAmer for 10 7 After 15 min of binding reaction, S. aureus was detected by flow cytometry.

[0096] (a) Graphical representation of the mean fluorescence intensity (bars) and the percentage of stained cells (lines) obtained at different SOMAmer concentrations (n=3). Grey bars: mean fluorescence intensity when 4520-8 (SEQ ID NO:3) was used, black bars: mean fluorescence intensity when 4531-56 (SEQ ID NO:1) was used. Black line: percentage of stained cells when 4520-8 (SEQ ID NO:3) or 4531-56 (SEQ ID NO:1) was used (same data).

[0097] (b) Example of flow cytometry results obtained using the 4531-56 (SEQ ID NO:1) SpA SOMAmer. Black area: unstained cell population; -1 (light grey), 0.7 µmol l -1 (dark grey) and 7 µmol l -1 (Black solid line) Stained cell population. The M1 and M2 intervals were set to include the fluorescence signal (autofluorescence) of the control unstained cells in M1. Therefore, the cell population located in the M2 interval was considered stained.

[0098] Figure 2 :When using 7 µmol l -1 Fluorescently labeled 4531-56 (SEQ ID NO: 1) SpA SOMAmer staining 10 7 After 3 cells were stained, Staphylococcus aureus was detected by flow cytometry. Different staining times were compared (n=3). The mean fluorescence intensity is shown as a bar and the percentage of stained cells is shown as a line graph.

[0099] Figure 3 : After staining with 0.7 μM of fluorescently labeled 4531-56 (SEQ ID NO: 1) SpA SOMAmer for 10 7 After 30 minutes of staining, the mean fluorescence intensity increased by 1.4 times compared to the intensity obtained after 5 minutes of staining incubation.

[0100] Example:

[0101] Example 1: Purification of Staphylococcus aureus Target

[0102] The relevant portion of the gene encoding the desired target or target domain was PCR amplified from genomic DNA of Staphylococcus aureus NRS384 (USA300) using the primers shown in Table 1 and cloned into pCR-Script SK+ (Stratgene). cF A Gene Bam HI- Sac The PCR product was transferred into the expression vector pET-51b (EMD-Novagen) in the form of an I cassette, which contains an amino-terminal Strep tag and a carboxyl-terminal His 10 Tags. The plasmids were sequenced to verify the identity of the gene and the correct genetic fusion of the cloned DNA fragment with the vector-encoded sequences of the His-tag and Strep-tag.

[0103] Table 1: Amplification and cloning of genes encoding Staphylococcus aureus cell surface proteins

[0104]

[0105] Recombinant proteins were overexpressed in E. coli BL21(DE3) or BL21(DE3) / pLysE (EMD / Novagen). The optimal expression conditions for soluble proteins were optimized with respect to growth temperature (25-37°C) and induction time (4-15 h). Cells from 0.1-0.8 L of culture were lysed with 10 mL BugBuster / Nuclease Reagent (EMD Millipore). ® Superflow ™ Agarose (EMD Millipore) affinity chromatography was used to separate the recombinant His 10 / Strep-tagged proteins were purified from the soluble fraction. Native Staphylococcal protein A was purchased from VWR and biotinylated with NHS-PEG4-biotin (Pierce Biotechnology). Protein concentrations were determined using the QuickStart Bradford Protein Assay Kit (BioRad).

[0106] Example 2: Selection of SOMAmers

[0107] Libraries using 5-benzylaminocarbonyl-dU (BndU), 5-naphthylmethylaminocarbonyl-dU (NapdU), and 5-tryptamine-dU (TrpdU) were used for SELEX using Staphylococcus aureus proteins. Each selection was performed from 1 nmol (10 14 -10 15 ) containing 40 consecutive randomized positions flanked by fixed sequences required for PCR amplification. SELEX is essentially as described in (Gold et al. 2010, PLoS One 5: e15004; Ochsner et al. 2013, Diagn Microbiol Infect Dis .; Vaught et al. 2010, J Am Chem Soc Buffer SB18T was used throughout SELEX and subsequent binding assays and consisted of 40 mM HEPES pH 7.5, 0.1 M NaCl, 5 mM KCl, 5 mM MgCl 2 and 0.05% Tween-20. Eight rounds of selection were performed, and starting from round 2, kinetic challenges were performed with 10 mM dextran sulfate to favor slow off-rates. ® Talon ® (Invitrogen) (it binds to His on the recombinant protein 10Dispensing of the SOMAmer–target complex was achieved with either 50 µl of 40 mM NaOH or with MyOne Streptavidin C1 beads (Life Technologies) (for biotinylated SpA). Selected sequences were eluted from the bead-bound targets with 80 µl of 40 mM NaOH, neutralized with 20 µl of 160 mM HCl and PCR amplified with KOD EX DNA polymerase (Invitrogen-Life Technologies). Modified DNA for the next round was prepared by primer extension from the antisense strand of the PCR product with KOD EX DNA polymerase and purified as described in (Gold et al. ,2010).

[0108] Analysis of DNA rebinding kinetics for selected DNA from rounds 3 to 8 (C 0 t) were used to assess sequence convergence during later rounds, indicating increased abundance of some sequences or sequence families. Clones showed good affinity (K) in the solution binding radioactivity assay (see below). d A pool of SOMAmers with a concentration of ≤10 nM was generated and the sequences of 48 clones / pool were determined. Individual SOMAmers were selected based on sequence pattern and diversity and enzymatically prepared for further characterization.

[0109] Synthetic SOMAmers were prepared at a 1 µmol scale as 48-50mers by standard phosphoramidite chemistry and purified by HPLC. They contain either 5' biotin-dA or 5' fluorescein-biotin-dA and an inverted dT nucleotide at the 3' end (3'idT) to increase stability against 3' to 5' exonucleases.

[0110] Example 3: SOMAmer equilibrium and whole-cell radiolabeled binding assays

[0111] Prior to binding assays, SOMAmers were properly folded by heating at 95°C for 5 min, followed by cooling to room temperature over a 10-15 min period.

[0112] Affinity (K) was determined in equilibrium solution binding assays of radiolabeled SOMAmer (10-20 pM) with serially diluted protein (0.001-100 nM). d ) and Zorbax PSM-300A (Agilent Technologies) resin was used for distribution onto filter plates as described in (Gold et al. 2010).

[0113] Before cloning, Staphylococcus epidermidis ( S. epidermidis ), hemolytic streptococci (S. hemolyticus pyogenes ( S. pyogenes ), Enterococcus faecalis ( E. faecalis The SOMAmer pool was tested for specific binding to Staphylococcus aureus in a 2 h equilibrium binding assay with Escherichia coli and Pseudomonas aeruginosa as controls. 5 – 10 8 CFU / mL, and 0.1 mM dextran sulfate and 0.35 M NaCl were added to the binding buffer to reduce nonspecific background. In addition, individual aptamers were screened for binding to eight different Staphylococcus aureus belonging to different lineages, including: NRS382, NRS383, NRS384, NRS123, NRS385, NRS386, NRS103 (NARSA and ATCC 29213 (ATCC).

[0114] result:

[0115] Pool affinity assays confirmed successful selection of SOMAmers for a total of 22 pools obtained with ssDNA modified with BndU, NapdU, or TrpU, with pool affinities ranging from 0.13-8.90 nM. Specific binding was observed for S. aureus, but not for S. epidermidis, S. hemolyticus, S. pyogenes, E. faecalis, E. coli, or P. aeruginosa.

[0116] Alignment of the sequences determined for each of the 48 clones from each pool showed multi-copy clones and families sharing the same sequence pattern. Representative clones were screened in affinity assays and the K values ​​of the best SOMAmers were d in the range of 0.03–2.17 nM (Table 2).

[0117] Table 2: SOMAmer reagents for S. aureus surface proteins showing affinity (K) against the original full-length sequences obtained in SELEX. d )

[0118]

[0119] The binding affinities of the SOMAmers to purified S. aureus proteins correlated well with the binding observed to whole bacteria. One SpA-NapdU clone (4520-8; SEQ ID NO:3) and one tSpA-TrpdU clone (4531-56; SEQ ID NO:1) were able to bind to all whole cells of S. aureus tested with a detection limit of ~10 in the radiolabeled filter binding assay. 4 cells / well (10 5 – 10 6 No binding was observed for S. epidermidis or Group B Streptococcus, indicating good specificity of these SOMAmers. Similar binding characteristics were observed for the ClfA SOMAmer.

[0120] The sequences of SOMAmers are listed in Table 3.

[0121] Table 3: Sequences of SOMAmers:

[0122]

[0123] The "T" nucleotides of the sequences provided in Table 3 are C-5 modified pyrimidines. More specifically, the "T" nucleotides of the SOMAmers targeting the SpA protein are NapdUTP (or NapdU) nucleotides, while the "T" nucleotides of the SOMAmers targeting the ClfA protein are BndUTP (or BndU) nucleotides.

[0124] In addition, the aptamer sequence motif (4520) binding to the SpA protein is represented by the following sequence:

[0125] GGCWWCGGGWACCWAWWAWNNGGWWWAGCC(N) n GWC (SEQ ID NO: 15), wherein "W" in the sequence represents a position that may be occupied by a C-5 modified pyrimidine, and wherein "N" in the sequence represents a position that may be occupied by any unmodified or modified nucleotide, and n is 0 to 2 (or 0, 1 or 2). Preferably, the C-5 modified pyrimidine is NapdU or BndU. More preferably, the C-5 modified pyrimidine is NapdU.

[0126] The aptamer sequence motif (4503) that binds to the ClfA protein is represented by the following sequence:

[0127] AWCWGGWC(N) nAWCWGGWWWWWAAG (SEQ ID NO: 16), wherein "W" in the sequence indicates a position that may be occupied by a C-5 modified pyrimidine, and wherein "N" in the sequence indicates a position that may be occupied by any unmodified or modified nucleotide. In addition, n can be a number from 1 to 30 (or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30) or from 2 to 20 (or 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20) or from 5 to 18 (or 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 or 18) or from 10 to 16 (or 10, 11, 12, 13, 14, 15 or 16). Preferably, n is 16. Preferably, the C-5 modified pyrimidine is NapdU or BndU. More preferably, the C-5 modified pyrimidine is BndU.

[0128] Example 4: Detection of Staphylococcus aureus cells by flow cytometry

[0129] SOMAmers against protein A (SpA) were synthesized as described above as 48-mers containing 5'ABflT (biotin and fluorescein) and used in flow cytometry experiments. The following activities were confirmed: 4520-8 (SEQ ID NO:3) (K d =0.17 nM) and 4531-56 (SEQ ID NO:1) (K d =0.09 nM).

[0130] Trypcase Soy Broth (TSB; bioMérieux, Craponne, France) was inoculated with a cryopreserved culture of Staphylococcus aureus DSM 1104 (or ATCC 25923) and incubated with shaking at 32.5°C overnight. The overnight culture was then subcultured in fresh TSB at 32.5°C with shaking until the OD600 of the working culture reached 0.8 (approximately 10 8 Bacteria ml -1 ) and divided into approximately 10 7 The cells were aliquoted into 100 μL / tube. Bacteria were harvested by centrifugation at 10 000 g for 2 min. The pellet was resuspended in 5% paraformaldehyde containing SOMAmer (concentration range 0.07 – 7 μmol l -1 ) in 100 µl PBS / 25 mmol l -1 MgCl2 After incubation at room temperature for 5, 15 or 30 min, the bacteria were centrifuged at 10 000 g for 2 min and the pellet was washed with PBS / 25 mmol l -1 MgCl 2 Resuspend. This washing step was repeated twice. Unstained bacteria were prepared as controls following the same procedure (without addition of SOMAmer). Unstained and stained bacteria were then analyzed by flow cytometry. All experiments were performed using a FACSCalibur™ flow cytometer (Becton Dickinson Biosciences; Le Pont de Claix, France) equipped with an air-cooled 15 mW argon-ion laser emitting at 488 nm. Green fluorescence was collected as a logarithmic signal in the FL1 channel (530 ± 30 nm). The mean fluorescence intensity and the percentage of fluorescent cells (in a defined gate, n = 10 000) generated as a result of SOMAmer binding were determined in these assays. Data from the FACSCalibur™ were analyzed using BD CellQuest™ software (Becton Dickinson Biosciences).

[0131] result:

[0132] Fluorescently labeled SpA SOMAmers 4520-8 (SEQ ID NO:3) and 4531-56 (SEQ ID NO:1) were used to evaluate their efficiency in detecting S. aureus by flow cytometry. Both SOMAmers performed well in staining whole S. aureus cells.

[0133] Although 100% of the cells were -1 The chromatin was detected at low SpA SOMAmer concentrations, but not at 0.7 µmol l -1 and 7 µmol l -1 At higher reagent concentrations, the mean fluorescence intensity increased significantly ( Figure 1 a). This data is consistent with the expected increase when a highly abundant cell surface component is saturated with a fluorescently labeled SOMAmer. The lowest concentration of SpASOMAmer that ensures accurate discrimination of negative (unstained cells) and positive (stained cells) populations by flow cytometry can be set at 0.07 µmol l -1 ( Figure 1 b).

[0134] To determine the optimal binding time, a time course assay was performed. -1In the case of SpA SOMAmer, 100% of the cells were stained after only a 5-min binding reaction ( Figure 2 By increasing the binding time to 15 and 30 min, the fluorescence intensity increased by approximately 2-fold and 3-fold, respectively, leading to better discrimination between negative and positive populations. When a lower SpA SOMAmer concentration (0.7 µmol l -1 ) labeled cells, this increase in fluorescence intensity was less pronounced, likely due to limiting SOMAmer concentration ( Figure 3 ).

[0135] The developed SpA SOMAmer was shown to have high staining efficiency for S. aureus. Under the experimental conditions, the best detection of S. aureus by flow cytometry was achieved when low reagent concentrations (0.7 µmol l -1 ) and a short binding time (15 min) in a simple one-step procedure. DNA aptamers for flow cytometry-based detection of Staphylococcus aureus using single or groups of aptamers (Cao et al. 2009) or for detection of Salmonella typhimurium using aptamers generated by whole-cell SELEX (Dwivedi et al. 2013) have been reported. However, the percentage of aptamer-labeled cells obtained in these studies was not close to 100% and the fluorescence intensity was weaker than that obtained with the SOMAmers of the present invention.

[0136] Example 5: Comparison of SOMAmers according to the present invention with standard aptamers

[0137] Due to the unique slow off-rate characteristics of SOMAmers according to the invention, these agents should have better affinity and better kinetics than standard RNA or DNA aptamers. To demonstrate this assertion, SpASOMAmers according to the invention were compared with DNA aptamers specific for S. aureus (unknown target antigen).

[0138] The DNA aptamer was prepared by Integrated DNA Technologies.

[0139] The protocols for both the aptamers of the present invention and the standard aptamers were the same as described in Example 4 (differences for the standard aptamer: the aptamers were not heated before the assay; PBS was used as the binding buffer).

[0140] Flow cytometry results obtained with Staphylococcus aureus DSM 1104:

[0141] Binder concentration Combination time Percentage of stained cells Mean fluorescence intensity SOMAmer (4531-56; (SEQ ID NO:1)) <![CDATA[0.7 µmol l -1 ]]> 5 min 100% 331 Standard aptamer <![CDATA[159 µmol l -1 ]]> 60 min 90 % 265

[0142] After a 60-min binding time, 159 µmol l -1 The percentage of stained cells obtained with the standard aptamer did not reach 100%. -1 The SOMAmer of the present invention stained 100% of the cells after only 5 minutes. This result demonstrates that the SOMAmer of the present invention has better binding efficiency even when its concentration is 200 times lower than that of the standard DNA aptamer.

[0143] This experiment demonstrated the benefit of the slow off-rate characteristic of SOMAmers according to the present invention in flow cytometric detection of S. aureus: higher binding / detection efficiency can be achieved with lower reagent concentrations in a very short time frame.

[0144] Sequence Listing

[0145] <110> Merck Patent GmbH, SOMAlogic Inc

[0146] <120> Method for detecting microorganisms in a sample by fluorescence-based detection method

[0147] <130> I 14 / 041

[0148] <160> 16

[0149] <170> PatentIn Version 3.5

[0150] <210> 1

[0151] <211> 39

[0152] <212> DNA

[0153] <213> Artificial sequence

[0154] <220>

[0155] <223> SOMAmer: Target SpA

[0156] <220>

[0157] <221> t

[0158] <222> (1)

[0159] <223> C-5 modified pyrimidine

[0160] <400> 1

[0161] gctcgagtta attcggggatc gggctccggc ttttcgaat 39

[0162] <210> 2

[0163] <211> 40

[0164] <212> DNA

[0165] <213> Artificial sequence

[0166] <220>

[0167] <223> SOMAmer: Target SpA

[0168] <220>

[0169] <221> t

[0170] <222> (1)

[0171] <223> C-5 modified pyrimidine

[0172] <400> 2

[0173] ccggcttcgg gtacctatta tcggtttagc ccagtcataa 40

[0174] <210> 3

[0175] <211> 40

[0176] <212> DNA

[0177] <213> Artificial sequence

[0178] <220>

[0179] <223> SOMAmer: Target SpA

[0180] <220>

[0181] <221> t

[0182] <222> (1)

[0183] <223> C-5 modified pyrimidine

[0184] <400> 3

[0185] tcggcttcgg gtacctatta tcggtttagcccagtcagaa 40

[0186] <210> 4

[0187] <211> 40

[0188] <212> DNA

[0189] <213> Artificial sequence

[0190] <220>

[0191] <223> SOMAmer: Target SpA

[0192] <220>

[0193] <221> t

[0194] <222> (1)

[0195] <223> C-5 modified pyrimidine

[0196] <400> 4

[0197] gcggcttcgg gtacctatta tcggtttagc ccagtcaaaa 40

[0198] <210> 5

[0199] <211> 40

[0200] <212> DNA

[0201] <213> Artificial sequence

[0202] <220>

[0203] <223> SOMAmer: Target SpA

[0204] <220>

[0205] <221> t

[0206] <222> (1)

[0207] <223> C-5 modified pyrimidine

[0208] <400> 5

[0209] gtggcttcgg gtacctatta tcggtttagc ccagtcagaa 40

[0210] <210> 6

[0211] <211> 40

[0212] <212> DNA

[0213] <213> Artificial sequence

[0214] <220>

[0215] <223> SOMAmer: Target SpA

[0216] <220>

[0217] <221> t

[0218] <222> (1)

[0219] <223> C-5 modified pyrimidine

[0220] <400> 6

[0221] gcggcttcgg gtacctatta tcggtttagc cctgtcagga 40

[0222] <210> 7

[0223] <211> 48

[0224] <212> DNA

[0225] <213> Artificial sequence

[0226] <220>

[0227] <223> SOMAmer: Target: SpA

[0228] <220>

[0229] <221> t

[0230] <222> (1)

[0231] <223> C-5 modified pyrimidine

[0232] <400> 7

[0233] gtgatcgagc ggcttcgggt acctattatt ggtttagccc agtcagaa 48

[0234] <210> 8

[0235] <211> 40

[0236] <212> DNA

[0237] <213> Artificial sequence

[0238] <220>

[0239] <223> SOMAmer: Target SpA

[0240] <220>

[0241] <221> t

[0242] <222> (1)

[0243] <223> C-5 modified pyrimidine

[0244] <400> 8

[0245] tcggcttcgg gtacctatta tcggtttagcccagtctgaa 40

[0246] <210> 9

[0247] <211> 39

[0248] <212> DNA

[0249] <213> Artificial sequence

[0250] <220>

[0251] <223> SOMAmer: Target SpA

[0252] <220>

[0253] <221> t

[0254] <222> (1)

[0255] <223> C-5 modified pyrimidine

[0256] <400> 9

[0257] acggcttcgg gtacctatta tcggtttagc cagtcagaa 39

[0258] <210> 10

[0259] <211> 40

[0260] <212> DNA

[0261] <213> Artificial sequence

[0262] <220>

[0263] <223> SOMAmer: Targets ClfA

[0264] <220>

[0265] <221> t

[0266] <222> (1)

[0267] <223> C-5 modified pyrimidine

[0268] <400> 10

[0269] atctggttca aagtgacgat tgggcatctg gtttttaagt 40

[0270] <210> 11

[0271] <211> 40

[0272] <212> DNA

[0273] <213> Artificial sequence

[0274] <220>

[0275] <223> SOMAmer: Targets ClfA

[0276] <220>

[0277] <221> t

[0278] <222> (1)

[0279] <223> C-5 modified pyrimidine

[0280] <400> 11

[0281] atctggttct aagttatacttg gcgtaatctg gtttttaaga 40

[0282] <210> 12

[0283] <211> 40

[0284] <212> DNA

[0285] <213> Artificial sequence

[0286] <220>

[0287] <223> SOMAmer: Targets ClfA

[0288] <220>

[0289] <221> t

[0290] <222> (1)

[0291] <223> C-5 modified pyrimidine

[0292] <400> 12

[0293] atctggttca aagtggcgat tgggcatctg gtttttaagt 40

[0294] <210> 13

[0295] <211> 25

[0296] <212> DNA

[0297] <213> Artificial sequence

[0298] <220>

[0299] <223> Primer sequence clfA-3

[0300] <400> 13

[0301] cggatccagt agctgcagat gcacc 25

[0302] <210> 14

[0303] <211> 26

[0304] <212> DNA

[0305] <213> Artificial sequence

[0306] <220>

[0307] <223> Primer sequence clfA-4

[0308] <400> 14

[0309] cgagctcgct catcaggttg ttcagg 26

[0310] <210> 15

[0311] <211> 34

[0312] <212> DNA

[0313] <213> Artificial sequence

[0314] <220>

[0315] <223> SOMAmer binding to SpA

[0316] <220>

[0317] <221> n

[0318] <222> (1)

[0319] <223> No nucleotides or any unmodified or modified nucleotides

[0320] <220>

[0321] <221> W

[0322] <222> (1)

[0323] <223> C-5 modified pyrimidine

[0324] <220>

[0325] <221> misc_feature

[0326] <222> (20)..(20)

[0327] <223> n is a, c, g or t

[0328] <220>

[0329] <221> misc_feature

[0330] <222> (30)..(31)

[0331] <223> n is a, c, g or t

[0332] <400> 15

[0333] ggcwwcgggw accwawwawn ggwwwagccn ngwc 34

[0334] <210> 16

[0335] <211> twenty three

[0336] <212> DNA

[0337] <213> Artificial sequence

[0338] <220>

[0339] <223> SOMAmer binding to ClfA

[0340] <220>

[0341] <221> W

[0342] <222> (1)

[0343] <223> C-5 modified pyrimidine

[0344] <220>

[0345] <221> n

[0346] <222> (1)

[0347] <223> 1 to 30 unmodified or modified nucleotides

[0348] <220>

[0349] <221> misc_feature

[0350] <222> (9)..(9)

[0351] <223> n is a, c, g or t

[0352] <400> 16

[0353] awcwggwcna wcwggwwwww aag 23

Claims

1. Detection of Staphylococcus aureus in samples ( Staphylococcus aureus ), comprising the steps of: a) incubating the sample with a modified slow off-rate aptamer (SOMAmer) comprising a fluorescent label; b) optionally washing the sample; c) analyzing said sample by a fluorescence-based detection method, It is characterized in that The nucleotide sequence of the SOMAmer is shown in SEQ ID NO: 1, and the modification is C-5 modified pyrimidine: 5-tryptophanyl-dU (TrpdU); The method described herein is not intended for disease diagnosis.

2. The method according to claim 1, characterized in that The fluorescence-based detection method is a method selected from the group consisting of flow cytometry, solid phase cytometry, fluorescence-based analytical methods, and fluorescence imaging systems.

3. The method according to claim 1 or 2, characterized in that The sample is a food or feed sample, a beverage sample, a pharmaceutical sample, a personal care or cosmetic sample and / or a water sample.

4. The method according to one or more of claims 1 to 3, characterized in that The SOMAmer comprises a nucleotide sequence specific for Staphylococcus aureus.

5. The method according to one or more of claims 1 to 4, characterized in that The fluorescent label is selected from the group consisting of fluorescein dyes, rhodamine dyes, cyanine dyes, dinoflagellate chlorophyll (PerCP), R-phycoerythrin, coumarin dyes and quantum dots.

6. Use of a modified slow off-rate aptamer (SOMAmer) comprising a fluorescent marker in the preparation of a reagent for detecting Staphylococcus aureus in a sample by the following method, wherein the method comprises the steps of: a) incubating the sample with the SOMAmer; b) optionally washing the sample; c) analyzing said sample by a fluorescence-based detection method, It is characterized in that The nucleotide sequence of the SOMAmer is shown in SEQ ID NO: 1, and the modification is C-5 modified pyrimidine TrpdU.

7. The method according to claim 6, characterized in that The fluorescence-based detection method is a method selected from the group consisting of flow cytometry, solid phase cytometry, fluorescence-based analytical methods, and fluorescence imaging systems.

8. Use according to claim 6 or 7, characterized in that The sample is a clinical sample, a food or feed sample, a beverage sample, a pharmaceutical sample, a personal care or cosmetic sample and / or a water sample.

9. The method according to claim 6, characterized in that The SOMAmer comprises a nucleotide sequence specific for Staphylococcus aureus.

10. The method according to claim 6, characterized in that The fluorescent label is selected from the group consisting of fluorescein dyes, rhodamine dyes, cyanine dyes, dinoflagellate chlorophyll (PerCP), R-phycoerythrin, coumarin dyes and quantum dots.

Images