An enzyme with heat stability and carrageenan degradation activity

Abstract

The present invention provides an enzyme with thermal stability and carrageenan degradation activity, the amino acid sequence of the carrageenase is SEQ ID NO: 1; the gene encoding the enzyme, one of the nucleotide sequences is SEQ ID NO: 2. The carrageenase provided by the present invention is used to degrade carrageenan. The present invention cloned an enzyme with thermal stability and carrageenan degradation activity from a hot spring strain, cloned its encoding gene into a host to achieve heterologous expression, and finally achieved industrial production of carrageenase, the enzyme has strong high temperature tolerance, and lays a foundation for subsequent industrial applications.

Description

Technical Field

[0001] The invention belongs to the technical field of functional gene screening, and in particular relates to an enzyme with thermal stability and carrageenan degradation activity. Background Art

[0002] Carrageenan is a structural polysaccharide in marine red algae, composed of D-galactose or its derivatives connected by α-1,3 and β-1,4 glycosidic bonds. It is a hydrophilic colloid, mainly found in the cell wall of seaweed. According to the number and position of sulfate groups and internal ether bonds contained in the disaccharide structural unit of carrageenan, it is divided into several types, among which κ-, λ-, ι-carrageenan are more common, and there are also α-, β-, θ-, μ-, ν-, γ-, δ-, ξ-, π-, ω-carrageenan and other types. At present, carrageenan is mainly used in food and food-related industries. Existing research results show that carrageenan oligosaccharides have a variety of biological activities, such as antiviral, antioxidant, anticoagulant, immunomodulatory, etc., so they have great application value in the field of medicine.

[0003] Although carrageenan has many advantages, its disadvantages such as large molecular weight, poor solubility, poor absorption by the body, and low utilization rate restrict the application of carrageenan in the medical field. How to use carrageenase to efficiently prepare carrageenan oligosaccharides and improve the application value of carrageenan has become a technology that needs to be overcome in current carrageenan research. Most of the carrageenase discovered so far are heat-labile enzymes, which will be rapidly inactivated when the temperature is higher than 60°C, which seriously limits the application of carrageenan degrading enzymes. Mou Haijin's research shows that the κ-carrageenase secreted by carrageenan-degrading bacteria M-2 loses all enzyme activity when placed at 55°C for 30 minutes; Potin et al.'s research shows that the κ-carrageenase secreted by Cytophaga strains is completely lost when placed at 40°C for 1 hour. The high-temperature enzymes derived from thermophilic microorganisms are enzyme resources with development prospects in the field of bioengineering due to their high action temperature and good heat resistance.

[0004] Thermophilic microorganisms have become a hot topic of scientific research in recent years because they can synthesize a variety of thermostable enzymes with application value. Microbiologists generally believe that microorganisms that can grow in a high temperature environment above 55°C are thermophilic microorganisms, including the lowest archaea and some bacteria, and those that can grow in an environment above 80°C are extreme thermophiles, most of which are archaea. Thermophilic enzymes are a type of thermostable enzymes produced by thermophilic microorganisms. The most notable feature of this enzyme protein is that it can still maintain a high catalytic efficiency at high temperatures. Since the solubility of substrates and products can be improved under high temperature conditions, the adhesion effect of substances and reactors can be reduced, the risk of contamination can be reduced, and the difficulty of product collection can be reduced, the high temperature enzyme is expected to replace the traditional room temperature catalysis and be widely used in many production fields such as food, leather processing, biopharmaceuticals, and wastewater treatment. The present invention isolates and obtains thermostable carrageenase from a strain of thermophilic bacteria, obtains its encoding gene by cloning, and realizes heterologous efficient expression by genetic engineering means, thereby obtaining a technology for industrial production of thermostable carrageenase. Summary of the invention

[0005] The present invention provides an enzyme with thermal stability and carrageenan degradation activity (referred to as carrageenase for short) and application thereof, thereby making up for the deficiencies of the prior art.

[0006] The carrageenase provided by the present invention comprises:

[0007] 1) a protease having an amino acid sequence of SEQ ID NO: 1;

[0008] 2) A protease having 90% or more homology with the amino acid sequence in 1).

[0009] A gene encoding the above enzyme, a nucleotide sequence of which is SEQ ID NO: 2

[0010] In another aspect, the present invention provides a recombinant expression vector for recombinantly expressing the above enzyme;

[0011] The present invention also provides a recombinant host cell into which the nucleotide sequence shown in SEQ ID NO.1 or the recombinant vector is transferred.

[0012] The carrageenase provided by the present invention is used for degrading carrageenan.

[0013] The present invention clones an enzyme with thermal stability and carrageenan degradation activity from a hot spring strain, clones its encoding gene into a host to achieve heterologous expression, and finally realizes industrial production of carrageenase. The enzyme has strong high temperature tolerance, laying a foundation for subsequent industrial applications. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 : Electropherogram obtained by SDS-PAGE electrophoresis;

[0015] Figure 2 : Activity identification diagram of recombinase;

[0016] Figure 3 : Optimal reaction temperature diagram of the screened enzyme;

[0017] Figure 4 : Product analysis diagram of the screened enzyme-degraded carrageenan; Note: M is the standard oligosaccharide control; respectively are enzyme activity control, 15min, 30min, 60min, 90min, 120min, 150min, 180min, 360min, 720min, and 1440min. DETAILED DESCRIPTION

[0018] The technical solution of the present invention is further described below in conjunction with the accompanying drawings and embodiments of the specification, but the protection scope of the present invention is not limited thereto.

[0019] The composition of the culture medium used in the specific embodiments of the present invention is as follows:

[0020] The components of the separation medium (also known as Zobell 2216E seawater medium) are as follows: 5 g of peptone, 1 g of yeast powder, fixed to 1000 ml with filtered old sea water, and sterilized by high pressure wet heat at 121°C for 20 min.

[0021] The components of the separation plate culture medium are as follows: 5 g of peptone, 1 g of yeast powder, 15 g of agar, and the volume is made up to 1000 ml with filtered Chenhai water, and sterilized by high pressure wet heat at 121°C for 20 min.

[0022] The components of LB liquid culture medium are as follows: 10 g of peptone, 5 g of yeast powder, and 10 g of sodium chloride. The volume is made up to 1000 ml with deionized water and sterilized by high pressure wet heat at 121° C. for 20 min.

[0023] The components of LB plate culture medium are as follows: peptone 10g, yeast powder 5g, sodium chloride 10g, agar 15g, dilute to 1000ml with deionized water, and sterilize by high pressure wet heat at 121°C for 20min.

[0024] The microbial sample was collected from a hot spring sample on the east coast of Kalianda Island, Indonesia (5°44'46"N, 105°35'12"E). The 16S DNA identification confirmed that the bacteria belonged to the genus Bacillus; preliminary fermentation experiments showed that the strain had the ability to degrade carrageenan at high temperatures. The purified strain was added to a 30wt% glycerol solution and stored in a -80℃ ultra-low temperature refrigerator.

[0025] Embodiment 1:

[0026] Construction of a genomic library of Thermostable Carrageenase-producing Bacteria

[0027] (1) Preparation of target DNA fragment

[0028] The Bacillus seed solution was inoculated into Zobell 2216E seawater culture medium and cultured in a shaking incubator at 50°C and 150 rpm for 24 h. Chromosomal DNA was extracted using a bacterial genome extraction kit (purchased from Tiangen, DP302-02). The electrophoretic DNA concentration was tested and the DNA length was greater than 40 kb, which met the requirements for library construction.

[0029] (2) Partial digestion of genomic DNA

[0030] The chromosomal DNA of Bacillus was partially digested by Sau3AI endonuclease. After 60 minutes of digestion, the insert fragment was obtained. After 60 minutes of digestion, the chromosomal DNA was just completely digested, which is suitable for constructing a genomic library; when the digestion time exceeds 80 minutes, the digestion is excessive, and the fragments are not evenly distributed, but mostly small fragments, which is not conducive to library construction. Therefore, 60 minutes of digestion is selected as the incomplete digestion time of the chromosomal DNA of the strain.

[0031] (3) Construction of genomic library

[0032] The pUC118 vector (purchased from Takara) and the insert fragment were connected at a molar ratio of about 1:3. The reaction system was connected overnight at 16°C, and the connection product was concentrated to 3μl. 1μl was taken to transform competent cells E.coli DH5α. After culture, it was spread on LB plate culture medium containing ampicillin (50μg / ml), IPTG (20μg / ml) and X-Gal (40μg / ml). It was cultured at 37°C overnight until colonies were visible. Transformants were screened according to the blue-white reaction of the colonies. About 18,000 colonies were randomly selected as clones of the genomic library for preservation. 15 white single colonies were randomly selected from the plate, and the plasmid was extracted. The target fragment was amplified by PCR using BcaBEST Primer M13-47 and BcaBEST Primer RV-M. The primer sequences are as follows:

[0033] BcaBEST Primer M13-47: 5'-CGCCAGGGTTTTCCCAGTCACGAC-3'

[0034] BcaBEST Primer RV-M: 5'-GAGCGGATAACAATTTCACACAGG-3'

[0035] The PCR reaction conditions were as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 240 s, 30 cycles; and extension at 72°C for 10 min.

[0036] Each clone was tested to have exogenous DNA, with the smallest inserted fragment being about 800 bp, the largest inserted fragment being about 6 kb, and the average inserted fragment size being about 4 kb.

[0037] A clone with obvious hydrolysis circles around it was screened from the genomic library. The recombinant plasmid was extracted and sequenced to obtain the complete ORF for producing thermostable carrageenase. The complete length of ORF was 1125bp, encoding a total of 374 amino acids, with a theoretical molecular weight of 42.5kDa.

[0038] Example 2: Construction of recombinant expression vector of heat-stable carrageenan

[0039] The thermostable carrageenan gene obtained by the present invention is cloned into an expression vector to construct a recombinant expression strain. First, based on the full-length sequence, primers for amplifying the full gene are designed:

[0040] Upstream primer F-GTCGTC GTCGAC CAGTAATTTTACCGGTATC;

[0041] Downstream primer R-CATAAA TCTAGA CACTCACGACTAAAGTATCT;

[0042] PCR amplification confirmed the full-length sequence of the gene. The expression plasmid was constructed by restriction cloning, that is, the PCR product of the thermostable carrageenase and the expression vector pET-30 (a) were double-digested with BamHI / XbaⅠ endonucleases, respectively, and recovered and purified; T4 DNA Ligase was used for ligation, and TOP10 competent cells were transformed. The plasmid of the positive clone was extracted using a plasmid extraction kit (purchased from Tiangen Company). After testing, the nucleotide sequence was shown in SEQ ID NO: 2. The gene encodes 400 amino acids, and the amino acid sequence is shown in SEQ ID NO: 1.

[0043] The plasmid of the positive clone obtained above was transformed into the E. coli BL21 (DE3) expression strain to construct the expression recombinant strain; the specific process is as follows:

[0044] Take BL21 stored at -80℃, melt it on ice, take 10μl of recombinant plasmid with a pre-cooled pipette tip, and add it to the melted BL21; shake gently to mix, place in an ice bath for 30 minutes, quickly transfer to a 42℃ water bath, and place it for exactly 90 seconds; quickly transfer to ice and cool for 2 minutes; then add 800μl LB liquid culture medium and incubate at 37℃, 150rpm, 45min; spread on LB plate culture medium containing 50μg / mL kanamycin and culture overnight.

[0045] Example 3: Expression of thermostable carrageenase using recombinant expression strains

[0046] The recombinant expression strain constructed above was transferred to 100 ml of LB liquid medium containing 50 μg / mL kanamycin and cultured at 37°C until the bacterial liquid OD reached 600 When the value reaches 0.6, cool at 15℃ for 30min, add isopropyl-β-D-thiogalactopyranoside (IPTG) to make the final concentration 1.0mmol / L, and culture at 15℃ on a shaker for 24h. Collect the supernatant by low-temperature centrifugation, concentrate and freeze-dry. Then, Ni 2+ Affinity chromatography: Since the expressed recombinant protein contains a 6×His tag at the N-terminus, it can be affinity adsorbed to the chromatography column. After gradient elution with different concentrations of imidazole solution, the eluate is collected and freeze-dried for later use. The induced expression of the recombinant protein and the purified protein are detected by SDS-PAGE electrophoresis, such as Figure 1 shown.

[0047] Example 4: Detection of thermostable carrageenase activity and analysis of enzyme properties

[0048] The activity of the thermostable carrageenase prepared above was determined using the DNS (3,5-dinitrosalicylic acid) method. The specific operation is as follows:

[0049] Take 1mL of inactivated and uninactivated heat-stable carrageenase solution and 2mL of substrate solution (containing 0.2wt% κ-carrageenan) respectively, react in a constant temperature water bath at 60°C for 30min, take 1mL of the reaction product and add it to 1.5mL DNS solution, and boil it in a water bath for 5min. Then quickly cool it to room temperature, add distilled water to 25mL, mix well, and measure the OD value at a wavelength of 520nm. The measured heat-stable carrageenase activity is 800U / ml.

[0050] In addition, the thermostable carrageenase solution prepared above was directly dropped onto a solid plate culture medium, and after staining with iodine solution, an obvious transparent circle could be seen ( Figure 2 ), indicating that the thermostable carrageenase has carrageenan degradation activity, providing a good material for subsequent research and application.

[0051] To determine the heat resistance of thermostable carrageenase, the enzymatic reaction was carried out at 30℃, 40℃, 50℃, 60℃, 70℃, 80℃, and 90℃ for 30min, and the activity of thermostable carrageenase was determined by DNS method. The relative enzyme activity was calculated with the highest value of enzyme activity as 100%.

[0052] It has been determined that the optimal reaction temperature of thermostable carrageenase is 60°C ( Figure 3 ), under the condition of temperature of 80°C, the enzyme still has about 50% enzyme activity, and has obvious high temperature tolerance characteristics compared with existing carrageenase.

[0053] Example 4: Analysis of enzymatic hydrolysis product composition

[0054] A certain amount of thermostable carrageenase solution and a substrate containing 0.2 wt% carrageenan were weighed and reacted in a constant temperature water bath at 60°C, and a certain amount of reaction products were taken at 30min, 60min, 90min, 120min, 150min, 180min, 240min, 360min, 720min and 1440min, respectively, and concentrated by centrifugation. The composition of the enzymatic hydrolysis products after different reaction times was analyzed by TLC chromatography technology ( Figure 4 ). The steps of the detection method of seaweed oligosaccharides are as follows:

[0055] A. Capillary spotting: Use a pencil to gently draw a straight line 2cm from the bottom of the silica gel plate. For easy spotting, make a mark every 2cm on the straight line before spotting. Use a 0.5mm glass spotting capillary to spot the carrageenan oligosaccharide standard and carrageenan oligosaccharide sample on the marked straight line of the silica gel plate. When spotting with a capillary, the capillary should be perpendicular to the direction of the silica gel plate, and the time the capillary contacts the silica gel plate should be as short as possible, otherwise the spot diameter is difficult to control. The spot diameter should be controlled to 2mm, and the spot is allowed to dry naturally.

[0056] B. Layer development in chromatography cylinder: Place the bottom end (spotting end) of the silica gel plate with samples into the chromatography cylinder filled with the developing agent. The chromatography plate must be placed flat, and the liquid level of the developing agent must not exceed the spotting point. During chromatography, the chromatography cylinder is closed and the layer is developed from bottom to top. When the leading edge of the layer development reaches 1 cm from the top of the thin plate, take out the silica gel plate and dry it in a 60°C oven.

[0057] C. Color development with color developer: Spray the color developer evenly on the dried chromatography silica gel plate and heat it in a 60°C oven until the chromatography spots appear.

[0058] Depend on Figure 4 It can be seen that the enzyme can directly degrade carrageenan into carrageenan biose by reacting with the carrageenan substrate at a temperature of 60°C for different time periods (15min-1440min) without producing any intermediates, thereby efficiently preparing high-purity carrageenan biose. SEQUENCE LISTING <110> First Institute of Oceanography, State Oceanic Administration <120> An enzyme with heat stability and carrageenan degradation activity <130> <160> 2 <170> PatentIn version 3.5 <210> 1 <211> 374 <212> PRT <213> 1 <400> 1 Met Ala Phe Ile Asn Ile Lys Pro Glu Leu Lys Gln Asn Met Glu Arg 1 5 10 15 Leu Ser Asp Ile Leu Asn Ile Pro Glu Pro Leu Leu Ile Ser Ala Asn 20 25 30 Ala Asn Ala Ser Ala Asp Glu Leu Tyr Phe Pro Gly Val Ser Phe His 35 40 45 Ala Gly Lys Asn Val Gln Ala Ala Glu Thr Tyr Glu Gln Leu Gln Leu 50 55 60 Leu Ala Asn Gln Tyr Thr Phe Glu Asp Glu Gln Trp Leu Thr Lys Thr 65 70 75 80 Ala Val Tyr Asp Ser Ala Glu Leu Lys Lys Glu Ile Gly Arg Leu Thr 85 90 95 Glu Cys Phe Pro Phe Val Thr Ser Arg Ile Ile Gly Arg Ser Ser Met 100 105 110 Gly Gln Pro Ile Tyr Glu Leu Leu Leu Gly Ala Glu Asn Ala Gly Lys 115 120 125 Arg Thr His Met Asn Ala Ser Phe His Ala Asn Glu Trp Ile Thr Thr 130 135 140 Ser Val Leu Met Lys Trp Leu Lys Glu Tyr Cys Tyr His Leu Cys Thr 145 150 155 160 Gly Gln Thr Ala Leu Gly Phe Ser Pro Leu Asp Ile Phe Ser Ser Thr 165 170 175 Lys Leu Ser Val Val Pro Ile Val Asn Pro Asp Gly Val Asp Leu Val 180 185 190 Leu Asn Gly Pro Gly His Leu Gly Ile Ala Arg Glu Ala Leu Asp Glu 195 200 205 Met Asn Glu His Gln Pro Asp Phe Arg Glu Trp Lys Ala Asn Ile Asn 210 215 220 Gly Val Asp Leu Asn Asn Gln Phe Pro Ser Phe Trp Glu Ile Glu Lys 225 230 235 240 Gln Arg Lys Pro Pro Lys Ser Pro Ser Tyr Arg Asp Tyr Pro Gly Asp 245 250 255 Glu Pro Leu Thr Glu Pro Glu Ala Ala Ala Met Arg Asp Leu Ile Ala 260 265 270 Asn Glu Pro Pro Asp Arg Leu Val Ala Leu His Thr Gln Gly Glu Glu 275 280 285 Ile Tyr Trp Gly Tyr Lys Gly Leu Glu Pro Pro Glu Ser Ala Asp Val 290,295,300 Ile Gln Thr Phe Glu Arg Leu Ser Gly Tyr Lys Gly Val Arg Tyr Ile 305 310 315 320 Asp Ser Tyr Ala Gly Phe Arg Asp Trp Phe Ile His Tyr Tyr Gly Arg 325 330 335 Glu Gly Tyr Thr Val Glu Leu Gly Lys Gly Lys Asn Pro Leu Pro Leu 340 345 350 Gln Phe Asp Asp with Tyr Cys Lys Ser Arg Gly with Leu Trp Ala 355 360 365 Ser Cys Phe Phe Glu Ser 370 <210> 2 <211> 1125 <212> DNA <213> 2 <400> 2 atggcattca tcacatca accggagtta aagcagaata tggaagact gtctgacatt 60 ctgaacatac ccgaacgct tttaatcagt gcaatgca atgcatccgc ggacgaactt 120 tattttccgg gagtatcttt tcatgcagga aaaaacgttc aagcagcaga aacatatgaa 180 cagctgcaat tattggcgaa tcaatacacg tttgaagatg aacagtggct gacaaaaaca 240 gccgtttacg attcagcaga actgaaaaag gaaattggca gattgacgga atgctttccg 300 tttgttactt cccgtatcat cggccgctca agcatgggcc agcctatata tgaactgctc 360 cttggagctg aaaatgccgg aaaaagaacg catatgaatg cctcttttca tgccaatgaa 420 tggatcacca cttctgtttt gatgaaatgg ctcaaagaat actgttatca tttatgtaca 480 ggccagaccg ctttaggttt ttcaccgctc gatattttt catcaacaaa gctttccgtc 540 gtgccgatcg ttaatcccga cggtgttgac cttgtactta acggccccgg tcatcttggg 600 atcgcgagag aagcgctgga tgagatgaac gagcatcagc cggatttccg ggaatggaaa 660 gccaatataa acggagtgga tttaaataat cagtttccgt ctttctggga gatcgaaaaa 720 caaagaaaac cgcctaaatc cccttcctac agagactacc ccggagatga accgctgaca 780 gaaccggaag cggcagcgat gagggattta atcgcaaacg agccgcctga ccggcttgtg 840 gcgcttcaca cacaggggga ggaaatttat tggggataca agggattgga gcctcctgaa tcagctgatg tgatccaaac atttgagcgc ctgagcggtt ataagggcgt cagatatata gacagctatg caggatttag agttggttt attcattatt acggagaga aggatatact gttgaacttg gcaaaggaa aaatccttta ccgctgaaac aatttgacga tatatattgt aaaagcagag gaatactttg ggcatcctgt ttttttgaaa gctga

Claims

1. Use of a protease having an amino acid sequence of SEQ ID NO: 1 in degrading carrageenan to prepare carbabiose.

Images