Specific expression promoters for rice root improvement and use thereof
By cloning the rice-specific expression promoter POsRo5, the energy waste problem caused by constitutive promoters was solved, and root-specific expression and transgenic effects in rice were improved.
Patent Information
- Application Number
- CN201810719642.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2018-07-03
- Publication Date
- 2026-01-27
- Estimated Expiration
- 2038-07-03
AI Technical Summary
In existing technologies, constitutive promoters lead to high-intensity expression of exogenous genes, which disrupts the plant's growth and metabolic balance, resulting in energy waste and growth obstacles. Furthermore, there are few reusable root-specific promoters in cereal crops such as rice, and the effects are not ideal.
By cloning and utilizing the rice-specific expression promoter POsRo5, exogenous genes were specifically expressed in rice roots through transgenic technology, avoiding unnecessary waste of materials and energy and improving root characteristics.
This method achieves root-specific expression in rice, avoids energy waste, cultivates ideal transgenic rice varieties, and improves the transgenic effect.
Smart Images

Figure CN108753785B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of biotechnology and plant genetic engineering. Specifically, this invention relates to the isolation, identification, and application of a rice-specific expression promoter. Background Technology
[0002] The growth and development of higher organisms is a process of orderly expression and coordinated action of different genes in time and space. A promoter is a nucleotide sequence upstream of a gene that, through its interaction with transcription factors, determines the expression pattern and intensity of downstream genes. Therefore, the promoter is a crucial element in gene expression regulation, often referred to as the "switch" of gene expression. Gene promoters are mainly classified into three types: constitutive promoters, tissue-specific promoters, and inducible promoters.
[0003] In recent years, plant genetic engineering research has made rapid progress and has become an important method and tool in crop genetic improvement and gene function research. Constitutive expression promoters are frequently used to drive the expression of target genes. While constitutive promoters can drive high-intensity expression of exogenous genes, this overexpression lacks temporal and spatial limitations, often disrupting the plant's original growth and metabolic balance, leading to the accumulation of large amounts of foreign proteins, wasting energy during plant growth, hindering normal plant growth, and even causing sterility and death. Tissue-specific promoters can drive the expression and accumulation of exogenous genes in specific tissues, avoiding unnecessary nutrient waste in the plant, reducing side effects on plant growth, and increasing transgenic effects, thus possessing certain application value. The development and utilization of tissue-specific promoters has therefore become a hot topic in genetic engineering research.
[0004] Based on the classification of plant tissues, tissue-specific promoters can be correspondingly divided into root, stem, leaf, and flower-specific promoters. Roots are the tissues in plants that absorb water and nutrients, and their function and shape play a crucial role in plant growth and development. Currently, a small number of root-specific promoters have been cloned and applied to gene function research, but their number remains limited. Furthermore, repeatedly using the same promoter in a vector can easily lead to transgene silencing, and promoter application is often affected by species differences, resulting in unsatisfactory results. Therefore, it is necessary to develop more endogenous root-specific promoters for cereal crops such as rice to provide a promoter reserve for crop genetic improvement applications. Summary of the Invention
[0005] This invention provides a rice-specific expression promoter, characterized in that the rice-specific expression promoter is extracted from plants of the genus *Oryza*.
[0006] Preferably, the rice-specific expression promoter comprises:
[0007] 1) The DNA sequence shown in SEQ ID No: 1 or 2 in the sequence listing; or
[0008] 2) A DNA sequence that, under stringent conditions, hybridizes with a DNA sequence containing the sequence in 1) and possesses promoter function; or
[0009] 3) A DNA sequence that shares 70%-75% homology with the DNA sequence defined in 1) or 2) and has promoter function; or
[0010] 4) A DNA sequence that has 75%-80% homology to the DNA sequence defined in 1) or 2) and has promoter function; or
[0011] 5) A DNA sequence that has 80%-85% homology to the DNA sequence defined in 1) or 2) and has promoter function; or
[0012] 6) A DNA sequence that has 85%-90% homology to the DNA sequence defined in 1) or 2) and has promoter function; or
[0013] 7) A DNA sequence that has 90%-95% homology to the DNA sequence defined in 1) or 2) and has promoter function; or
[0014] 8) A DNA sequence that has more than 95% homology to the DNA sequence defined in 1) or 2) and has promoter function; or
[0015] 9) A nucleotide sequence with promoter function obtained by adding one or more nucleotides to the nucleotide sequence shown in SEQ ID NO:1 or 2; or
[0016] 10) A nucleotide sequence with promoter function obtained by removing one or more nucleotides from the nucleotide sequence shown in SEQ ID NO:1 or 2; or
[0017] 11) A nucleotide sequence having promoter function obtained by substituting one or more nucleotides in the nucleotide sequence shown in SEQ ID NO:1 or 2.
[0018] Preferably, the rice-specific expression promoter is the rice-specific expression promoter POsRo5.
[0019] On the other hand, the present invention provides an application of the rice-specific promoter described above in regulating the root-specific expression of genes in rice.
[0020] On the other hand, the present invention provides a method for obtaining a host bacterium for the cultivation of transgenic plants, characterized in that the method includes transferring a rice-specific expression promoter as described in claim 3 into Agrobacterium tumefaciens.
[0021] On the other hand, the present invention provides a method for obtaining transformants for transgenic plant cultivation, characterized in that the method includes transferring the rice-specific expression promoter POsRo5 as described in claim 3 into Escherichia coli XL-Blue competent cells, obtaining positive clones by colony PCR screening, constructing a plant expression vector with the obtained positive clones and a plant vector, then transferring the plant expression vector into Agrobacterium tumefaciens, and using Agrobacterium tumefaciens to obtain transgenic plant cells, tissues, organs or plants through a mediating method.
[0022] On the other hand, the present invention provides an application of the rice-specific expression promoter POsRo5 described in claim 3 in the cultivation of transgenic plants, characterized in that the application includes: linking the rice-specific expression promoter POsRo5 described in claim 3 upstream of the gene sequence to be expressed in a vector, thereby constructing a recombinant expression vector; transforming the recombinant expression vector into rice cells, tissues or organs for cultivation, preferably, the gene to be expressed is one that improves rice root traits.
[0023] On the other hand, the present invention provides a set of primer pairs for amplifying all or any fragment of the rice root-specific strong expression promoter POsRo5, characterized in that the primer pair includes a forward primer and a reverse primer, the nucleotide sequence of the forward primer is as shown in SEQ ID NO: 3, and the nucleotide sequence of the reverse primer is as shown in SEQ ID NO: 4.
[0024] One embodiment of the present invention provides a rice root-specific expression promoter POsRo5, which is derived from the transcriptional regulatory region of the HKT2:1 gene (NCBI accession number: Os06g0701700) in the genome of the japonica rice variety Nipponbare. It is a DNA segment located 1485 bp upstream of the transcription start site, and its sequence is shown in SEQ ID No:1.
[0025] This invention also provides a recombinant expression vector, characterized by being a recombinant plasmid obtained by inserting the rice root expression promoter sequence into the multiple cloning site of a plant expression vector, wherein the nucleotide sequence is linked upstream of the gene sequence to be expressed in the vector. In one implementation, the gene to be expressed is the GUS gene. The recombinant expression vector is a recombinant expression vector obtained by constructing the sequence shown in SEQ ID No:1, i.e., POsRo5 or the promoter POsRo5, into pCAMBIA1381, referred to herein as pCAMBIA1381-POsRo5. Alternatively, the gene to be expressed can be any gene that improves rice root tissue. In this invention, the expression status of the GUS gene is used to identify the function of the promoter.
[0026] Preferably, the gene to be expressed is a gene that has the ability to improve the root tissue traits of rice.
[0027] On the other hand, the present invention provides an application of the rice root expression promoter in the cultivation of transgenic plants, characterized in that the application includes: linking the rice root expression promoter to the upstream of the gene sequence to be expressed in a vector to construct a recombinant expression vector; and transforming the recombinant expression vector into rice cells, tissues or organs for cultivation.
[0028] Furthermore, the application is used to improve the growth characteristics of rice, especially the growth and improvement of the roots.
[0029] Technical effect
[0030] The purpose of this invention is to clone the root-specific promoter POsRo5 from rice and verify its function using transgenic technology, while simultaneously analyzing the tissue expression pattern of this gene in rice. By using the promoter sequence described in this invention to replace constitutive promoters, the target gene can be driven to specifically express in the roots of rice, increasing the effectiveness of transgenic technology, avoiding unnecessary waste of resources and energy, effectively improving the root characteristics of rice, and cultivating ideal transgenic rice varieties. Therefore, this promoter has significant value in practical applications. Attached Figure Description
[0031] The embodiments of the present invention will now be described in detail with reference to the accompanying drawings, wherein:
[0032] Figure 1 The expression vector pCAMBIA1381-POsRo5 was constructed.
[0033] In the figure, (A) is a schematic diagram of the results of enzyme digestion verification of the pCAMBIA1381-POsRo5 expression vector in this invention.
[0034] (B) Schematic diagram of the pCAMBIA1381-POsRo5 vector, where POsRo5 is located upstream of the GUS gene.
[0035] Figure 2 The results of GUS staining of the obtained POsRo5::GUS transgenic positive rice plants are shown. A, B and C represent the roots, leaves and stems of the seedlings, respectively.
[0036] Figure 3 This is a schematic diagram of the Psubs3 promoter constructed in the pCAMBIA1381 vector plasmid in Example 2;
[0037] Figure 4 This is a schematic diagram of the Gus staining results in Example 2;
[0038] Figure 5 This is a comparative diagram showing the process before and after the flooding treatment. Detailed Implementation
[0039] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.
[0040] Example 1
[0041] Obtaining root-specific expression promoters and constructing expression vectors
[0042] (1) Cloning of promoter POsRo5
[0043] Based on the whole genome sequence of the rice variety Nipponbare (Oryza sativa L cv. Nipponbare) provided in NCBI, amplification primers were designed using Primer5 primer design software according to the sequence shown in SEQ ID No. 1 of the sequence listing. Restriction sites were also designed based on the characteristics of the selected vector and target gene. The primer sequences are as follows:
[0044] FP: GGATCC ACCCCCTTAATCAAAAACAACA
[0045] RP: GTCGAC TTGATGCAAAGGAGCAACGAGC
[0046] The GGATCC base is the recognition site and protective base of the restriction endonuclease BamHI; the GTCGAC base is the recognition site and protective base of the restriction endonuclease SalI.
[0047] Rice genomic DNA was used as a template for PCR amplification using KOD high-fidelity polymerase. The reaction volume (50 μL) is as follows. The amplification products were subjected to 1% agarose gel electrophoresis.
[0048]
[0049] (2) Adding polyA and connecting T carrier
[0050] The PCR product was recovered, a polyA tail was added to it, and it was ligated into a T vector to obtain a cloning vector.
[0051] Addition of A system: 3.175 μL of the recovered product and 1.825 μL of the addition of A mixture (2 μL of 5×Taq buffer, 0.5 μL of 25 mM MgCl2, 0.5 μL of 100 mM dATP, and 0.25 μL of Taq polymerase) were placed at 72 °C and reacted for 30 min.
[0052] Ligation of T vector: 4 μL of product A and 1 μL of T vector were reacted at 25 °C for 30 min to obtain the target product, which was then transformed into competent E. coli cells.
[0053] (3) Transformation of E. coli competent cells
[0054] ① Transfer the ligation solution containing the A-linked T vector into a 1.5 mL Eppendorf tube containing 100 μL of competent cells and place on ice for 30 min;
[0055] ② After heat shock at 42℃ for 90 seconds, immediately place in an ice bath for 2 minutes;
[0056] ③ Add 500 μL of LB liquid medium and incubate at 37°C in a shaker for 1 h (120 r / min) to allow the bacteria to return to normal growth.
[0057] ④ Take 100 μL of the above bacterial solution and spread it on an LB selection plate containing ampicillin. After the bacterial solution is completely absorbed by the culture medium, invert the culture dish and incubate at 37°C for 16–24 h.
[0058] ⑤ Select clones that have been verified by colony PCR and enzyme digestion and send them to Beijing Liuhe BGI Genomics Co., Ltd. for sequencing analysis to obtain the promoters of candidate genes.
[0059] (4) Construction of promoter expression vector
[0060] The promoter fragment and the linearized pCAMBIA1381 plasmid were recovered after double digestion with the corresponding enzymes. The recovered target fragment and the linearized vector (1 μL 10×T4 ligase buffer, 1 μL T4 ligase, 2 μL linearized vector, 6 μL target fragment) were ligated with T4 ligase. The colonies were verified by PCR and double digestion to obtain the expression vector of the corresponding promoter.
[0061] (5) Expression vector transformed Agrobacterium tumefaciens EHA105
[0062] ① Take 10 μL of expression vector plasmid DNA and add it to Agrobacterium competent cells taken from the ultra-low temperature freezer. Mix well and incubate on ice for 30 min.
[0063] ② Quick-freeze with liquid nitrogen for 1 minute;
[0064] ③ Add 1 mL of LB medium and incubate at 28℃ and 120 r / min for 4 h;
[0065] ④ Centrifuge at 4000 r / min for 1 min and discard the supernatant; resuspend in 150 μL LB medium and spread the bacterial culture onto LB solid plates containing 50 μg / mL Kan and 10 μg / mL LRif;
[0066] ⑤ Incubate at 28℃ for 2–3 days until single colonies grow, then perform colony PCR identification.
[0067] ⑥ Select positive clones and preserve them with 50% glycerol (1:1).
[0068] Agrobacterium-mediated rice genetic transformation
[0069] (1) After sterilization, the seeds were soaked in sterile water at 30°C in the dark overnight. The embryos were then removed with a scalpel and placed on the induction medium. Twelve embryos were evenly placed in each dish (a disposable plastic culture dish with a size of 100×25mm and containing 50ml of induction medium). The dishes were placed at 30°C in the dark for 2 to 3 weeks to induce callus formation until pale yellow granular callus grew.
[0070] (2) Pre-culture: Select granular callus tissue without lesions from the induction medium and place it on a new induction medium. Culture it in the dark at 30°C for 3-5 days.
[0071] (3) Infection and co-culture: Transfer the pre-cultured callus tissue to a 50ml sterile tube, add Agrobacterium tumefaciens bacterial suspension containing the expression vector and soak for 20min, pour out the bacterial suspension, and blot dry the remaining bacterial suspension with sterile filter paper. Then, evenly spread the callus on the co-culture medium and incubate at 23℃ in the dark for 2-3 days.
[0072] (4) Transfer the co-cultured callus to recovery medium (avoid overlap between callus as much as possible). Incubate in the dark at 23°C for 3-5 days.
[0073] (5) Screening: Select resistant embryogenic callus tissues that are bright yellow and granular without bacterial spots from the screening medium. Inoculate 30 tissues per dish into the screening medium and incubate in the dark at 30°C for 2 to 3 weeks until new resistant granular callus grows.
[0074] (6) Differentiation of each transformation event (all callus tissues produced by the proliferation of a single callus tissue during screening) Three independent embryogenic callus tissues were selected and placed in a certain area of the differentiation medium and cultured in a 30°C light culture room (16 h light / 8 h dark) for 3 to 4 weeks until seedlings emerged.
[0075] (7) Rooting: Two robust seedlings from each region were selected and transplanted to rooting medium. They were cultured in a tissue culture chamber at 30℃ for approximately three weeks under a photoperiod of 16 hours light / 8 hours darkness. After identification, they were transplanted to the field. Identification of promoter expression characteristics in transgenic rice seedlings.
[0076] GUS can react with the chromogenic substrate X-gluc to produce a blue color, thus allowing for qualitative studies of GUS expression levels and patterns through histochemical staining.
[0077] The reagents and procedures used for GUS staining were based on those proposed by Jefferson (Jefferson RA et al. GUS fusion: β-Glucuronidase as a sensitive and versatile gene fusion marker in higher plants[J]. EMBO J., 1987, 6:3901-3907), as detailed below:
[0078] ① Staining: Immerse the sample to be tested in GUS staining solution and place it in a 37℃ incubator for 24-36 hours.
[0079] ② Decolorization: Soak in 100% ethanol until completely decolorized. It can be stored in a solution containing 30% glycerol and 70% ethanol.
[0080] ③ Take photos and record them under a microscope.
[0081] GUS staining was performed using the method described above, and the results are as follows: Figure 3 As shown (scale bar = 0.2 cm), in transgenic rice plants containing POsRo5::GUS, during the seedling stage, this promoter is expressed only in the roots (A), and not in the leaves (B) or stems (C). This indicates that the POsRo5 promoter drives the GUS gene to be expressed only in the roots, thus demonstrating that the POsRo5 promoter is a root-specific promoter.
[0082] Example 2
[0083] This embodiment provides a promoter that is of great significance for rice root growth, which can be expressed in response to the external aquatic environment.
[0084] Step 1: Cloning the promoter Psubs3 and constructing the pCAMBIA1381-Psubs3 vector
[0085] Based on the whole genome sequence of the rice variety Nipponbare (Oryza sativa L cv. Nipponbare) provided in NCBI, amplification primers were designed according to the sequence of SEQ ID No. 2 in the sequence listing. Enzyme restriction sites of the primers were also designed based on the characteristics of the selected vector and the target gene. The primers used for amplification are:
[0086] Forward primer: EcoRI GAATTCTTTACTCACCGTGTCCTCTGTT
[0087] Reverse primer: HindIII AAGCTTTGTATCTCTCTCTGGTAGTTAG
[0088] Using DNA from the rice variety Nipponbare as a template, the promoter Psubs3 was amplified using forward and reverse primers, following the amplification procedure in a standard PCR system:
[0089] Pre-denaturation at 95℃ for 5 min; denaturation at 95℃ for 30 s, annealing at 58℃ for 30 s, extension at 72℃ for 2 min 30 s, 35 cycles from pre-denaturation at 95℃ to extension at 72℃; final extension at 72℃ for 10 min.
[0090] The target fragment amplified by PCR was recovered; the target fragment was 1939 bp in length. It was ligated into the PGEMM-T-Easy vector (purchased from Promega, mixed according to the instructions) and sent to Invitrogen for sequencing. The nucleic acid sequence is shown in SEQ ID No:2.
[0091] The PGEM-T-Easy vector containing Psubs3 was double-digested with HindIII and EcoRI to recover the promoter Psubs3 fragment. Simultaneously, pCAMBIA1381 was linearized using HindIII and EcoRI, and the aforementioned Psubs3 fragment was ligated into the pCAMBIA1381 vector to obtain the plant expression vector pCAMBIA1381-Psubs3, which fused the promoter Psubs3 with the GUS gene. (See schematic diagram). Figure 3 As shown, the plant expression vector pCAMBIA1381-Psubs3 was transformed into Agrobacterium tumefaciens EHA105 using the freeze-thaw method.
[0092] Step 2: Agrobacterium-mediated genetic transformation of rice
[0093] After removing the husks from mature seeds, soak them in 70% alcohol for 1 minute, then discard the alcohol. Soak the seeds in a 50% sodium hypochlorite solution (with an effective chlorine concentration greater than 4%) containing 1 drop of Tween 20 for 40 minutes (150 rpm). Discard the sodium hypochlorite and wash the seeds five times with sterile water until the solution is clear and free of sodium hypochlorite odor. Soak the seeds in sterile water overnight. Use a scalpel to peel the embryo off along the aleurone layer of the seed and inoculate the embryo onto callus induction medium. After culturing in the dark at 30°C for 11 days, separate the callus from the endosperm and plumule. Pre-culture the well-formed, vigorously dividing primary callus tissue for 3–5 days before using it for Agrobacterium transformation.
[0094] Agrobacterium tumefaciens transformed into the pCAMBIA1381-Psubs3 recombinant expression vector was subjected to Agrobacterium-mediated genetic transformation. The genetic transformation, transformant selection, and transgenic plant regeneration were carried out in accordance with the methods proposed by Yongbo Duan (Yongbo Duan, Chenguang Zhai, et al. An efficient and high-throughput protocol for Agrobacterium mediated transformation based on phosphomannose isomerase positive selection in Japonica rice (Oryza sativa L.)[J]. Plant Cell Report, 2012.DOI 10.1007 / s00299-012-1275-3.).
[0095] A total of 32 plants were obtained. DNA was extracted from these plants, and after PCR identification, 28 positive pCAMBIA1381-Psubs3 plants were obtained.
[0096] Step 3: Identification of Psubs3 promoter activity
[0097] Following the method proposed by Jefferson (Jefferson RA et al. GUS fusion: β-Glucuronidase as a sensitive and versatile gene fusion marker in higher plant[J]. EMBO J., 1987, 6:3901-3907), the tissues to be stained were vacuum-sealed and then immersed in the staining solution, stained at 37°C for 24 hours. For destaining, the tissues were treated with 95% ethanol at 37°C until the negative control material turned white.
[0098] Tissues from positive transgenic plants 21 days after seed germination were stained. In rice plants grown under normal conditions, no GUS activity was observed in roots (A), stems (B), and leaves (C) after 24 hours of staining. However, after 1 hour of water immersion treatment, strong GUS expression was observed in roots (A), stems (B), and leaves (C) after 24 hours of staining (scale bar = 5 mm). Results are shown below. Figure 4 .
[0099] RNA was extracted from seedlings 14 days before and after flooding, and converted into cDNA via reverse transcription. The expression level of the GUS gene was detected using real-time quantitative PCR, with the rice housekeeping gene ACTIN used as a control. Changes in GUS gene expression were used to reflect the flooding-induced activity of the Psubs3 promoter.
[0100] RT-qPCR was performed using the SuperReal real-time quantitative PCR kit (TIANGEN, SYBR Green, FP205) from Tiangen Biotech (Beijing). The amount of RNA template used was quantified using the rice ACTIN gene as an internal control. Two... –ΔΔCT (ΔCT = CT target gene – CT internal reference gene; ΔΔCT = ΔCT treated – ΔCT control) The obtained signals and data were processed. Each gene was performed in triplicate. The quantitative primers used in this experiment were: Actin-FP 5'-CCTGACGGAGCGTGGTTAC-3'; and Actin-RP, 5'-CCAGGGCGATGTAGGAAAGC-3' for ACTIN amplification; Gus-FP, 5'-TACGGCAAAGTGTGGGTCAATAATCA-3' and Gus-RP, 5'-CAGGTGTTCGGCGTGGTGTAGAG-3' for GUS amplification. Figure 5 The results showed that the expression level of the GUS gene in the transgenic plants after water flooding was 15.3 times that of the untreated transgenic plants, indicating that the Psubs3 promoter has strong water flooding induction activity.
[0101] The above description of specific embodiments of the present invention does not limit the present invention. Those skilled in the art can make various changes or modifications based on the present invention, and as long as they do not depart from the spirit of the present invention, they should all fall within the scope of the appended claims. sequence list <110> Rice Research Institute, Anhui Academy of Agricultural Sciences <120> Specific expression promoters for improving rice roots and their applications <160> 4 <170> SIPOSequenceListing 1.0 <210> 1 <211> 1485 <212> DNA <213> Promoter (rice) <400> 1 acccccttaa tcaaaaacaa caagtgttgg gacttcagtt cttttctgag aagatacctg 60 gctcgaaggc tcatcggttc gctcattggc accggccgta tacacggttg tccctgcccg 120 tttgagaaat cgccgtacgg tggctgaggc gcttcacgac agagggtgga ttaggaacat 180 caccgccgct cttggcgtcc aagctatcct ggagtatttc aaactctagg acatcctcag 240 atcagttcaa ctctcggatg agcctgactc tctgacttgg aggtgggagt cctcaaggga 300 gtattcttct cggtcagcat accgtgctaa caagagccca tcttaggcaa aagttatgtt 360 cggattaacc tttaggaacc gcggaggagc aacagcgatg aatgaaacca accagcgaga 420 gttgtctacg acctgccgtc tggcagaggt ctcggtaccg aacagcgtgg gacacgcaac 480 gcaagaaaca ctagtttcac tgctctgata gctagtggaa aaccatgcat gtccagagtc 540 ttggcagctg tggtggattg ctctcagagc aattgggctt tcgaaatgct tgccgatcaa 600 tgaaccttcc tttcatcatt ggctctgtga tagcaaaaag aagatgacca aggcgcatcg 660 tcggggattt gacaccatcg caaccctggt agcatggacg atctggaaag agaagaaacaa 720 tagagttttc aatcaggtca gcatacttg ggtggagatc gctcgggcca tgatagacga 780 agctgatctt tggaggctgg ctagggctgc catacacacc ttagtagtcc atgtatag 840 agagaggtcg cttggagatt aggctctaat gctcttgcac ctctcctgta tcctccccgt 900 cttgtttttc ttttgttatg tccacttgta cataaacttt attcttttt aatataaaga 960 tgcgctcctt gcgaattccc aaaaaaaaca acaagaagca agtcatcttc tttttttttt 1020 ttttttgacg ctgagcaggt aatcattaga acagttagaa cttttaaaaa gacaaataat 1080 gctgctgaaa atattccacg aagaataatc tcatccggcc aggttccaag cagccagaac 1140 ttacttatgc agaagctagt catccatggg tagtatcagt gtttacactt ctgagaatcc 1200 gtatagtaat tcttctcaga gtgtgggtgt ttctcgagct atgcatctga taaggaagca 1260 ttgcatctat caccaggaaa accaataat tgagctacag attagttata ccggtcttac 1320 tgtccaataa ttgatttttt taatggaatc atagtctcac agataccacc aaagccaata 1380 ctcctccatt gcctgcatat aaataacaca aaagcagacc ggtcttggca aaggacactc 1440 actttgcttt ctcatactcg ttggctcgtt gctcctttgc atcaa 1485 <210> 4 <211> 1939 <212> DNA <213> Promoter (rice) <400> 4 tttactcacc gtgtcctctg ttgatttttg tgatgcccaa attgtttgat ttcatgatgt 60 gcttagaact gttgccagtg caagttgatt tacatgtaaa cctattctat gatgcatttc 120 tttcatcctt catgtgtgaa tctgtgagat gaatgcaact acaactagca aaagaacatt 180 tttttcacag gtaaccagca gcattgatgg gccgcattgt gctactcgtc acatgtaact 240 cacttgtgac gggttgtgac gcgacaagtt aaaagggggt taacattacc tgtgacgggt 300 tgtcatttgt aatctgtcag aggtgattca tactagtgac gtgcctttag ccgtcaaaga 360 taagtttagt catcactaac cactcatctc ttaccaacgc cctacccgtt agaggtgaca 420 gtttgagcct gtcaccgatg acccaatcta gtgtaatgat tctcaatatc aaaattgtat 480 aactcgacga ggtcaaccat tctagatttg atgactattc ttttgatgtc actagcaaaa 540 tgcccatgcg ttgcaccggg taatgtcgcg ttggataaag tttaactgaa cgatttttta 600 agcggtatag tatgacaata atagtgatca agtaatcgtt cataattttc tagcaatttt 660 aaaatggctc aaaataatgc caagaaaatt ttgtaaacga ctaaataaat taaatcgatg 720 gaattaaata aaattctatt tcgacctatt acttttgtaa ctgacccaaa aaatcggatc 780 ggcccgttta gcgcgagccg attgcactac aagtggccca tctaccggcg acggcccgac 840 acgcggcaaa gggcacgcgg ctcagttgtc ttccatggcc caaagactgc acggcccaat 900 agcggtggcg gcccgatgcg gggccgatct gacccatccg atctgatgga cagcttggat 960 tggtcccgcg ccaatgaaat cgccggccgg aaggggaggg tccgaaaacc ctaaccctaa 1020 ttgcctttct tccctactct ccctgatcca atctctggcg acgcgagaga gtggacggcg 1080 atgatctagt ctttctccgc gtctttccgt cttccacccg agttgtcgcc gactagatca 1140 tccaccggct ccaagccgtc attcatgctc gtgtggatcc gccgtcggcg cctagatccc 1200 atcgtctctc ggcgatagcc gcatggcagc tgcgatggcc aaggcgcgtg ggcagcagcg 1260 agactggtgg gcggcggatc tgccggctgg ggaggcttga gggcgcggag gtggctgagt 1320 tttggcagcc gcctcacaaa gttgccgcca ccgcctgctt cctcgacatc gccactagcg 1380 ggagatgtta aaaggctaa catgtaacgt atgagcccca aatttgaatc ctatatgcta 1440 catgtgtgaa aatttgtgtg tagatgtata gtaaaatgtg aacttttttt tatggttttt 1500 tcacctataa aaataaaat tggaaatta tttcttggt tggtttctta agagagccgt 1560 gtatgaaaat gagatcatca caagagtttt gttaagagga ccgccaaatg gttctctcct 1620 tgccgctcga tgcatgtgga aatagttgtt tttctacagg ttacagctta caagtgacat 1680 aacggtttga taaacgactg taggccaaaag tacttttcaa tcactttaat tttggtcagc 1740 tcccgtacat gtagttaact tgatctttgc acgcaagcaa ttattttct gtcaccacgc 1800 tcctcgacga cctctgcata cggctataaa atcacatgca acccctcaat aaccaaagca 1860 1920 actaccagag agataca 1939 <210> 3 <211> 28 <212> DNA <213> Primer (rice) <400> 3 ggatccacccccttaatcaaaaacaaca 28 <210> 2 <211> 28 <212> DNA <213> Primer (rice) <400> 2 gtcgacttga tgcaaaggag caacgagc 28
Claims
1. A rice-specific expression promoter that can be used to improve rice roots, characterized in that, The rice-specific expression promoter was extracted from rice plants, and its sequence is as follows: As shown in SEQ ID No:
1.
2. The application of the rice-specific expression promoter as described in claim 1 in regulating the root-specific expression of genes in rice.
3. A method for obtaining transformants for transgenic plant cultivation, characterized in that, The method includes transferring the rice-specific expression promoter POsRo5 of claim 1 into Escherichia coli XL-Blue competent cells, obtaining positive clones by colony PCR screening, constructing a plant expression vector with the obtained positive clones and a plant vector, transferring the plant expression vector into Agrobacterium tumefaciens, and obtaining transgenic plant cells, tissues, organs or plants by means of Agrobacterium tumefaciens through a mediating method.
4. The application of the rice-specific expression promoter POsRo5 according to claim 1 in the cultivation of transgenic plants, characterized in that, The application includes: linking the rice-specific expression promoter POsRo5 of claim 1 upstream of the gene sequence to be expressed in the vector to construct a recombinant expression vector; transforming the recombinant expression vector into rice cells, tissues or organs for cultivation, wherein the gene to be expressed is one that improves rice root traits.
5. A set of primer pairs for amplifying all of the rice root-specific strong expression promoter POsRo5 as described in claim 1, characterized in that, The primer pair includes a forward primer and a reverse primer, the nucleotide sequence of the forward primer is as shown in SEQ ID NO: 3, and the nucleotide sequence of the reverse primer is as shown in SEQ ID NO: 4.
Citation Information
Patent Citations
Rice-seed specific promoter expressed during specific period of plant growth
CN107099534A
Plants having enhanced yield-related traits and a method for making the same
US20140345002A1
Rice root specificity expression promoter POsRo1 and application thereof
CN103773766A
Specific expression promoter POsr1 of root of paddy rice, and application thereof
CN106047878A
Rice root specific expression promoter POsRO4 and corresponding rice cultivation method
CN107058324A