Compositions and methods for producing myrcene

Abstract

The present invention provides compositions and methods for producing myrcene by culturing genetically modified microbial host cells that express a myrcene synthase and, optionally, a geranyl pyrophosphate synthase. The present invention also provides isolated nucleic acid molecules encoding myrcene synthase variants derived from the myrcene synthase of the Lamiaceae genus, which comprise one or more amino acid substitutions that improve the in vivo performance of the myrcene synthase in a genetically modified microbial host cell. The present invention also provides isolated myrcene synthase variants that exhibit improved activity in converting geranyl diphosphate to myrcene.

Description

[0001] 1. Cross-references to related applications

[0002] This application claims and enjoys priority to U.S. Provisional Application No. 62 / 248,240, filed on October 29, 2015, which is incorporated herein by reference.

[0003] 2. Field of Invention

[0004] This invention relates to fermentation compositions, genetically modified microbial host cells, and isolated nucleic acid molecules for generating myrcene from said genetically modified microbial host cells. 3. Background of the Invention

[0006] Among terpenoids, monoterpenes, C10 members of the terpenoid family, are the main components of essential oils naturally found in leaves, flowers, and fruits. These essential oils have various functions among plants and between plants and predators. For example, some monoterpenes participate in plant wound healing. Examples of monoterpenes found in plants include limonene, myrcene, 3-carene, ocimene, and pinene.

[0007] Monoterpenes are commercially important raw materials for many industries. Specifically, myrcene is an important intermediate used in the fragrance industry. Myrcene can be derivatized to produce a variety of end products, including flavorings and fragrances. Although myrcene exists in nature, it is present in very small quantities. Furthermore, while some monoterpenes, such as camphor, exist in near-pure forms, myrcene generally exists in complex mixtures with other monoterpenes. Therefore, myrcene is difficult to isolate in large quantities from these complex mixtures.

[0008] Therefore, there is a need for an efficient and economical method for the large-scale production of myrcene.

[0009] 4. Summary of the Invention

[0010] This invention provides compositions and methods comprising genetically modified microbial host cells containing heterologous nucleic acid molecules encoding myrcene synthase. The inventors have discovered that myrcene synthases derived from basil species produce myrcene in relatively high quantities when expressed in genetically modified microbial host cells. Targeted mutagenesis techniques and screening combinatorial libraries containing various mutations have also been used to generate variants of wild-type basil myrcene synthases. The myrcene synthase variants provided by this invention exhibit improved in vivo performance in terms of myrcene production and / or enzyme activity in genetically modified microbial host cells compared to their parent myrcene synthases. Therefore, the fermentation compositions and methods provided by this invention can be used to produce myrcene in large quantities in an economical and reliable manner.

[0011] The distribution characteristics of monoterpenoid products generated by genetically modified microbial host cells containing the myrcene synthase provided in this invention are unique and distinguishable from the distribution characteristics of monoterpenoid products generated by other known myrcene synthases. Therefore, the fermentation composition can be used to generate end products with unique properties, such as flavorings and fragrances, which can be distinguished from monoterpenoid compounds generated by other myrcene synthases.

[0012] On one hand, the present invention provides a fermentation composition comprising: (a) a genetically modified microbial host cell cultured in a culture medium, wherein the genetically modified microbial host cell contains a heterologous nucleic acid molecule encoding myrcene synthase; and (b) a monoterpene compound generated from the genetically modified microbial host cell, wherein the monoterpene compound comprises myrcene as a major component and one or more byproducts as minor components, wherein the one or more byproducts comprise α-terpinene and / or γ-terpinene. In some embodiments, the one or more monoterpene byproducts in the fermentation composition further comprise 4-terpineol. In some embodiments, the one or more monoterpene byproducts in the fermentation composition further comprise juniperene, limonene, β-ocimene, or β-linalool. In some embodiments, the one or more monoterpene byproducts in the fermentation composition further comprise α-thujone, (E)-hydrated juniperene, and / or (Z)-hydrated juniperene.

[0013] In some embodiments, based on the relative area % of the monoterpenoids in the GC-MS chromatogram, the monoterpenoids in the fermentation composition comprise at least about 85% myrcene and less than about 15% of one or more byproducts, compared to the total amount of the monoterpenoids. In some embodiments, based on the relative area % of the monoterpenoids in the GC-MS chromatogram, the monoterpenoids in the fermentation composition comprise between about 88% and about 93% myrcene, compared to the total amount of the monoterpenoids. In some embodiments, based on the relative area percentage of the monoterpenoids in the GC-MS chromatogram, and based on the total amount of the monoterpenoids, the monoterpenoids comprise: about 89.09% to about 92.01% myrcene, about 0.80% to about 0.98% juniperene, about 0.67% to about 0.90% α-terpinene, about 0.54% to about 1.01% limonene, about 0.91% to about 1.21% β-ocimene, about 1.00% to about 1.06% γ-terpinene, about 0.76% to about 1.17% β-linalool, and about 2.32% to about 2.42% 4-terpineol. In some embodiments, based on the relative area percentage of the monoterpenoids in the GC-MS chromatogram, and based on the total amount of the monoterpenoids, the monoterpenoids further comprise: about 0% to about 0.51% α-thujone, about 0% to about 0.54% (E)-hydrated juniperene, and about 0.98% to about 1.13% (Z)-hydrated juniperene. In some embodiments, the fermentation composition comprises at least 50 mg, at least 100 mg, at least 500 mg, at least 1 g, at least 5 g, at least 10 g, at least 50 g, at least 100 g, or at least 150 g of myrcene per liter of culture medium.

[0014] On the other hand, the fermentation composition comprises a microbial host cell that is genetically modified to contain a heterologous nucleic acid molecule encoding myrcene synthase of the basil species or a variant thereof. In some embodiments, the myrcene synthase comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with the myrcene synthase of the basil species. In some embodiments, the myrcene synthase comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with SEQ ID NO: 2. In some embodiments, the myrcene synthase comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with SEQ ID NO: 2, and comprises at least one variant amino acid residue at one or more positions selected from the group consisting of positions 27, 28, 207, 213, 222, 342, 347, 381, 382, ​​389, 390, 401, 404, 428, 439, 466, 482, 484, 505, 514, 517, 524, 527, 528, 543, 544, and 552, compared with SEQ ID NO: 2, wherein said positions are numbered with reference to SEQ ID NO: 2.In some embodiments, the myrcene synthase comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with SEQ ID NO: 2, and comprising an amino acid sequence selected from H27I, H27C, S28H, I207V, K213C, K213H, K213R, K213V, R222N, C342L, Y347R, F381L, V382L, D389G, D389S, G390D, N401I, N401V, I404V, V428 At least one variant amino acid residue from the group consisting of L, Y439L, A466C, A466S, R482C, R482D, R482H, R482I, R482L, R482N, R482V, H484Y, C505I, C505L, C505V, G514L, G514V, S517G, F524L, F524V, V527C, V527F, V527H, V527L, V527N, V527S, V527Y, E528D, M543I, A544S, and Q552R, wherein the position is numbered with reference to SEQ ID NO: 2. In some embodiments, the myrcene synthase comprises the amino acid sequence of SEQ ID NO: 2, in addition to the amino acid sequence as described in this invention comprising one or more variant amino acid residues relative to SEQ ID NO: 2.

[0015] In some embodiments, the genetically modified microbial host cell in the fermentation composition contains a heterologous nucleic acid molecule encoding myrcene synthase, said myrcene synthase comprising the same as SEQ ID NO. NO:2 refers to at least one set of variant amino acid residues, and said at least one set of variant amino acid residues is selected from the group consisting of the following variant amino acid residues: (a) F381L, I404V, E528D, and M543I; (b) I404V and E528D; (c) F381L, D389G, I404V, Y439L, and E528D; (d) F381L, E528D, and M543I; (e) F381L, I404V, and E528D; (f) F381L, I404V, E528D, and A544S; and (g) F381L, I404V, E528D, and Q552R, wherein said positions are numbered with reference to SEQ ID NO:2. In some embodiments, the heterologous nucleic acid molecule encoding the myrcene synthase comprises a nucleotide sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with SEQ ID NO: 1, SEQ ID NO: 3, or SEQ ID NO: 4. In some embodiments, the heterologous nucleic acid molecule encodes a myrcene synthase comprising one or more of the above-described amino acid variants.

[0016] On the other hand, the fermentation composition comprises a genetically modified microbial host cell, which further comprises a heterologous nucleic acid molecule encoding geranyl pyrophosphate synthase. The geranyl pyrophosphate synthase catalyzes the formation of geranyl pyrophosphate, which is a substrate of myrcene synthase. In some embodiments, the geranyl pyrophosphate synthase is derived from bacteria. In some embodiments, the geranyl pyrophosphate synthase is derived from a Streptomycete species, particularly Streptomyces aculeolatus. In some embodiments, the heterologous nucleic acid molecule encoding the geranyl pyrophosphate synthase comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity with SEQ ID NO: 7. In some embodiments, the heterologous nucleic acid molecule encoding the myrcene synthase and the heterologous nucleic acid molecule encoding the gerany pyrophosphate synthase are both chromosomally integrated into the genome of the genetically modified microbial host cell.

[0017] In some embodiments, the genetically modified microbial host cell in the fermentation composition further comprises at least one heterologous mevalonate pathway gene encoding an enzyme selected from the group consisting of: (a) an enzyme that condenses two molecules of acetyl-CoA to form acetoacetyl-CoA; (b) an enzyme that condenses acetoacetyl-CoA with another molecule of acetyl-CoA to form 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA); (c) an enzyme that converts HMG-CoA to mevalonate; (d) an enzyme that converts mevalonate to mevalonate 5-phosphate; (e) an enzyme that converts mevalonate 5-phosphate to mevalonate 5-pyrophosphate; (f) an enzyme that converts mevalonate 5-pyrophosphate to IPP; and (g) an enzyme that converts IPP to DMAPP. In some embodiments, the genetically modified microbial host cell comprises endogenous farnesol pyrophosphate, which is functionally destroyed to direct carbon flow to generate geraniol pyrophosphate.

[0018] On the other hand, the present invention provides genetically modified microbial host cells. In some embodiments, the genetically modified microbial host cell comprises: (a) a heterologous nucleic acid molecule encoding basil species myrcene synthase, said basil species myrcene synthase comprising (i) the amino acid sequence of SEQ ID NO: 2; or (ii) an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with SEQ ID NO: 2; and (b) a heterologous nucleic acid molecule encoding geranyyl pyrophosphate synthase. In some embodiments, said heterologous nucleic acid molecule encoding geranyyl pyrophosphate synthase is derived from bacteria. In some embodiments, said geranyyl pyrophosphate synthase is derived from Streptomyces aculeolatus geranyyl pyrophosphate synthase. In some embodiments, the heterologous nucleic acid molecule encodes gerany pyrophosphate synthase, the gerany pyrophosphate synthase comprising: (i) the amino acid sequence of SEQ ID NO: 7; or (ii) an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with SEQ ID NO: 7. In some embodiments, the myrcene synthase in the microbial host cell comprises at least one variant amino acid residue located at one or more positions selected from the group consisting of positions 27, 28, 207, 213, 222, 342, 347, 381, 382, ​​389, 390, 401, 404, 428, 439, 466, 482, 484, 505, 514, 517, 524, 527, 528, 543, 544, and 552, compared to SEQ ID NO: 2, wherein said positions are numbered with reference to SEQ ID NO: 2. In some embodiments, the myrcene synthase in the microbial host cell may comprise one or more of the aforementioned variant amino acid residues.

[0019] On the other hand, the present invention provides isolated nucleic acid molecules encoding myrcene synthase variants. In some embodiments, the isolated nucleic acid molecule encodes myrcene synthase, the myrcene synthase comprising: (a) an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with SEQ ID NO: 2; and (b) at least one variant amino acid residue located at one or more positions 27, 28, 207, 213, 222, 342, 347, 381, 382, ​​389, 390, 401, 404, 428, 439, 466, 482, 484, 505, 514, 517, 524, 527, 528, 543, 544, and 552 compared to SEQ ID NO: 2, wherein said positions are numbered with reference to SEQ ID NO: 2. In some embodiments, at least one variant amino acid residue encoded by the isolated nucleic acid molecule is selected from H27I, H27C, S28H, I207V, K213C, K213H, K213R, K213V, R222N, C342L, Y347R, F381L, V382L, D389G, D389S, G390D, N401I, N401V, I404V, V428L, Y439L, A466C, A466S, R48 The group consisting of 2C, R482D, R482H, R482I, R482L, R482N, R482V, H484Y, C505I, C505L, C505V, G514L, G514V, S517G, F524L, F524V, V527C, V527F, V527H, V527L, V527N, V527S, V527Y, E528D, M543I, A544S, and Q552R, wherein the positions are numbered according to SEQ ID NO: 2.

[0020] In some embodiments, the isolated nucleic acid molecule encodes myrcene synthase, the myrcene synthase comprising at least one set of variant amino acid residues compared to SEQ ID NO: 2, and wherein the at least one set of variant amino acid residues is selected from the group consisting of the following variant amino acid residue groups: (a) F381L, I404V, E528D, and M543I; (b) I404V and E528D; (c) F381L, D389G, I404V, Y439L, and E528D; (d) F381L, E528D, and M543I; (e) F381L, I404V, and E528D; (f) F381L, I404V, E528D, and A544S; and (g) F381L, I404V, E528D, and Q552R, wherein the positions are numbered with reference to SEQ ID NO: 2.

[0021] In some embodiments, the isolated nucleic acid molecule comprises a nucleotide sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with SEQ ID NO: 1, SEQ ID NO: 3, or SEQ ID NO: 4. In some embodiments, one or more codons in the isolated nucleic acid molecule encode at least one variant amino acid residue selected from H27I, H27C, S28H, I207V, K213C, K213H, K213R, K213V, R222N, C342L, Y347R, F381L, V382L, D389G, D389S, G390D, N401I, N401V, I404V, V428L, Y439L, and A466. The group consisting of C, A466S, R482C, R482D, R482H, R482I, R482L, R482N, R482V, H484Y, C505I, C505L, C505V, G514L, G514V, S517G, F524L, F524V, V527C, V527F, V527H, V527L, V527N, V527S, V527Y, E528D, M543I, A544S, and Q552R, wherein the positions are numbered with reference to SEQ ID NO: 2.

[0022] On the other hand, the present invention provides an isolated mutant myrcene synthase. In some embodiments, the isolated mutant myrcene synthase has at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% amino acid sequence identity with SEQ ID NO: 2, and exhibits improved activity in converting geraniol diphosphate to myrcene compared to the activity of the myrcene synthase of SEQ ID NO: 2 under the same reaction conditions. In some embodiments, the mutant myrcene synthase comprises variant amino acid residues located at one or more of positions 27, 28, 207, 213, 222, 342, 347, 381, 382, ​​389, 390, 401, 404, 428, 439, 466, 482, 484, 505, 514, 517, 524, 527, 528, 543, 544, and 552, wherein said positions are numbered with reference to SEQ ID NO: 2. In some embodiments, the mutant myrcene synthase comprises at least one variant amino acid residue selected from the group consisting of: H27I, H27C, S28H, I207V, K213C, K213H, K213R, K213V, R222N, C342L, Y347R, F381L, V382L, D389G, D389S, G390D, N401I, N401V, I404V, V428L, Y439L, A466C, A466 S, R482C, R482D, R482H, R482I, R482L, R482N, R482V, H484Y, C505I, C505L, C505V, G514L, G514V, S517G, F524L, F524V, V527C, V527F, V527H, V527L, V527N, V527S, V527Y, E528D, M543I, A544S, and Q552R, wherein the positions are numbered with reference to SEQ ID NO: 2.

[0023] On the other hand, the present invention provides a vector containing the isolated nucleic acid molecules described in the present invention.

[0024] On the other hand, the present invention provides a method for generating myrcene. The method comprises culturing genetically modified microbial host cells of the present invention in a culture medium under culture conditions suitable for myrcene generation. In some embodiments, the method for generating myrcene comprises: (a) culturing a population of genetically modified microbial host cells in a first culture medium under non-inducing conditions, wherein the genetically modified microbial host cells contain heterologous nucleic acid molecules encoding myrcene synthase and heterologous nucleic acid molecules encoding geranyyl pyrophosphate synthase; and (b) culturing the population of microbial host cells or a subpopulation thereof in a second culture medium under inducing conditions, the inducing conditions increasing myrcene generation compared to the non-inducing conditions in step (a), wherein the second culture medium contains monoterpenoid compounds generated by the genetically modified microbial host cell population or subpopulation. In some embodiments, the monoterpenoid compounds comprise myrcene as a major component and one or more byproducts as minor components. In some embodiments, one or more byproducts comprise α-terpinene and γ-terpinene. In some embodiments, the method for generating myrcene further comprises recovering myrcene from the culture medium. In some embodiments, the genetically modified microbial host cells are cultured in a culture medium with a covering layer. In some embodiments, the genetically modified microbial host cells are cultured in a sealed container.

[0025] 5. Brief description of the attached drawings

[0026] Figure 1 illustrates an overview of myrcene production in a microbial host cell. In the schematic diagram shown in Figure 1, the microbial host cell converts feedstocks (e.g., sugars or other carbohydrates) via the mevalonate pathway to produce myrcene. To produce myrcene, gerany pyrophosphate synthase (GPPS) and myrcene synthase (MyrS) can be incorporated into the microbial host cell to transfer carbon flux from the C5-isoprenyl diphosphate metabolites isopentenyl diphosphate (IPP) and dimethyl allyl diphosphate (DMAPP) to gerany phosphate (GPP). In some embodiments, the FPP synthase (FPPS, e.g., encoded by ERG20 in *Saccharomyces cerevisiae*) can be modulated, for example, functionally disrupted, to achieve maximum myrcene production.

[0027] Figure 2A is a schematic diagram of the mevalonic acid pathway.

[0028] Figure 2B is a schematic diagram of the 1-deoxy-D-xylitol-5-bisphosphate (DXP) pathway.

[0029] Figure 3A shows chromatograms from GC-FID: the top trace represents myrcene and byproducts generated by genetically modified microbial host cells expressing basil (Ocimum basilicum) myrcene synthase (ObMS); the bottom trace represents myrcene and byproducts generated by genetically modified microbial host cells expressing holly (Quercus ilex, QiMS). The monoterpene generation distribution characteristics of various myrcene synthases were tested using GC-MS and GC-FID. GC-MS was specifically used to identify byproducts including basilene, phenethyl alcohol, linalool, and geraniol. Phenethyl alcohol and geraniol were excluded from the myrcene area % purity calculation because phenethyl alcohol is not a terpene, and geraniol may not be generated by the action of myrcene synthase but by yeast-derived pyrophosphatase. Monoterpenoids alone were identified by considering the presence of molecular ion 136 (C10 terpene) and molecular ion 154 (C10 terpene alcohol) on the GC-MS chromatogram in the purity calculation. Subsequently, a GC-FID detector was used to obtain more accurate data on the distribution characteristics of monoterpene formation per area.

[0030] Figure 3B shows an enlarged GC-MS chromatogram of the range of C10 terpenoids produced by yeast host cells containing myrcene synthase from basil (Ocimum basilicum). The structures of the specified compounds are listed in Figure 4.

[0031] Figure 3C shows the linear relationship between the myrcene signal response (area) and sample concentration. For material purity assessment, the highest sample concentration (where the maximum peak value remains within the linear range of the detector response) is used for data accuracy. Based on this data, a 3 μl 0.5 g / L sample was selected as the appropriate analysis in Example 7.7.

[0032] Figure 4 shows the chemical structures of compounds identified in monoterpenoids produced by yeast host cells heterologously expressing myrcene synthase from basil (Ocimum basilicum).

[0033] Figure 5 shows a comparison of myrcene production in strains containing the *Streptomyces aculeolatus* geranyl pyrophosphate synthase (SaGPPS) gene and strains containing the *Abies grandis* (AgGPPS) gene, both codon-optimized for expression in *Saccharomyces cerevisiae*. Each GPPS gene was integrated as a single copy and expressed on the high-copy plasmid 2 μ / Leu2d. Samples were taken from each flask at 72 hours, and myrcene titer was determined by GC. Error bars represent the standard deviation of three replicates.

[0034] Figure 6 shows a comparison of the improved in vivo performance of the ObMS variant when integrated as a single copy into strain X100. The 1xObMS is encoded by the wild-type myrcene synthase nucleic acid of *Ocimum basilicum* containing SEQ ID NO: 1. 1xObMS was selected as the basal enzyme (parent) for engineering. The 5xObMn nucleic acid was generated by codon optimization of the 1xObMS nucleic acid for optimized expression in *Saccharomyces cerevisiae*. The 5xObMS nucleic acid contains the nucleotide sequence of SEQ ID NO: 3. The 14xObMS nucleic acid was derived from directed evolution using 5xObMS as the parent. The 14xObMS nucleic acid contains the nucleotide sequence of SEQ ID NO: 4. The Y-axis represents the myrcene production level at 72 hours, as determined using limonene as an internal standard.

[0035] Figure 7 shows two confirmed ObMS variants that, based on a competitive assay, exhibited improved myrcene production relative to their parent 14xObMS. The ObMS variant with a mutation at residue 552 has an amino acid substitution from glutamine to arginine. The ObMS variant with a mutation at residue 544 has an amino acid substitution from alanine to serine. The Y-axis provides the percentage improvement compared to the parent enzyme. Five replicates (for the parent) and twelve replicates (for both variants) were performed in this experiment.

[0036] 6. Specific Implementation Plan

[0037] This invention provides compositions and methods for the efficient biosynthesis of myrcene, particularly through the genetic engineering of myrcene synthases. In one embodiment, the production of myrcene is provided in large quantities in microorganisms that do not normally produce myrcene. In another embodiment, this invention provides compositions and methods for producing myrcene by culturing genetically modified microbial host cells expressing a myrcene synthase derived from the genus *Ocimum basilicum*. In some embodiments, this invention provides isolated nucleic acid molecules encoding myrcene synthase variants derived from wild-type *Ocimum basilicum* myrcene synthase, wherein said variants contain one or more amino acid substitutions that improve the in vivo performance of the enzyme in genetically modified microbial host cells. In some embodiments, this invention provides isolated myrcene synthase variants that exhibit improved activity in converting geraniol diphosphate to myrcene compared to wild-type myrcene synthase.

[0038] 6.1 Definition

[0039] Unless otherwise defined, all technical and scientific terms used in this invention shall have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Some terms mentioned in this invention shall be defined as having the following meanings.

[0040] The term "monoterpenoid" refers to a class of terpenoid compounds consisting of two isoprene units. As used in this invention, the term "monoterpenoid" is also intended to include "monoterpenoid-like compounds," which are compounds in which the C10 skeleton of the parent monoterpenoid has been modified, for example by oxidation or carbon skeleton rearrangement, and which may be linear or cyclic.

[0041] The term "byproduct" refers to monoterpenes produced together with myrcene via a genetically modified microbial host cell containing myrcene synthase through a catalytic reaction catalyzed by the myrcene synthase. As used in this invention, myrcene and its byproducts constitute the total amount of monoterpenoid compounds produced by the genetically modified microbial host cell.

[0042] As used in this invention, when calculating the total amount of monoterpenoids or the purity of myrcene produced by the microbial host cells, the term "total amount of monoterpenoids" produced by the genetically modified microbial host cells does not include geraniol. This is because geraniol is likely produced by the enzyme-independent hydrolysis of myrcene synthase from geraniol pyrophosphate in the genetically modified microbial host cells.

[0043] As used in this invention, unless otherwise specifically indicated, % refers to a percentage determined by GC-MS or GC-FID as a relative area percentage. Relative area percentage is the ratio of the target peak area to the sum of the areas of all peaks in the chromatogram multiplied by 100%. Therefore, as used in this invention, the percentage of monoterpenes in a mixture of monoterpenes is based on peak area normalization from gas chromatography-mass spectrometry (GC-MS) or gas chromatography-flame ionization detector (GC-FID) chromatography. As described above, peaks associated with geraniol are excluded from the sum of all peak areas associated with monoterpenes. In some embodiments, the percentage of each monoterpene generated by genetically modified microbial host cells is determined under the GC-MS conditions described in Example 7.7, and the relative area percentage is calculated using a 3 μl sample at a concentration of 0.5 g / L myrcene.

[0044] The term "GC chromatogram" as used in this invention refers to an electronic and / or graphical record representing absolute or relative quantitative detection data of multiple isolated chemical substances obtained or derived from a group of molecules, wherein the separation has been performed by GC-MS or GC-FID.

[0045] As used in this invention, the term "major component" in a compound mixture refers to a quantity relative to the total amount of compounds, comprising at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% of the compounds. Regarding monoterpenoids generated from genetically modified microbial host cells, myrcene is the major component relative to the total amount of monoterpenoids generated from microbial host cells, based on the relative area percentage of the monoterpenoid peaks in the GC chromatogram described in Example 7.7.

[0046] As used in this invention, the term "minor component" in a compound mixture refers to one or more compounds, individually or collectively comprising less than about 50%, less than about 45%, less than about 40%, less than about 35%, less than about 30%, less than about 25%, less than about 20%, less than about 15%, less than about 10%, less than about 5%, less than about 4%, less than about 3%, less than about 2%, or less than about 1% of the total amount of the compounds. Regarding monoterpenoids generated from genetically modified microbial host cells, based on the relative area percentage of the monoterpene peaks in the GC chromatogram described in Example 7.7, the byproduct is a minor component compared to the total amount of monoterpenoids generated from the genetically modified microbial host cells.

[0047] The term "substantially free of" compounds in a mixture of compounds, as used in this invention, refers to compounds having less than 0.1% of the total amount of said compounds, based on the relative area percentage of the compound peaks in a GC chromatogram.

[0048] In the following description, whether the words "approximately" or "approximately" are used in conjunction with them, all numerical values ​​disclosed in this invention are approximate values. The numerical values ​​may vary by 1%, 2%, 5%, or 10% to 20%. Whenever a lower limit R is disclosed, it is always included. L and upper limit R U The numerical ranges for all values ​​are explicitly disclosed, including any value falling within those ranges. In particular, the following values ​​R within the range are also specified. k Specifically disclosed: R k =R L +k*(R U -R L ), where k is a variable between 0.01 and 1, with an increment of 0.01, i.e., k is 0.01, 0.02, 0.03, 0.04, 0.05, ..., 0.5, 0.51, 0.52, ..., 0.95, 0.96, 0.97, 0.98, 0.99, or 1. Furthermore, this invention specifically discloses any two numerical values ​​R defined above. k Any range of values ​​defined.

[0049] The term "myrcene" or "β-myrcene," also known as 7-methyl-3-methylene-1,6-octadiene, is a compound with the molecular formula C1. 10 H 16 Monoterpenes, and have the following molecular structures:

[0050]

[0051] The term "juniperene," also known as 4-methylene-1-(1-methylethyl)bicyclo[3.1.0]hexane, is a compound with the molecular formula C1. 10 H 16 Monoterpenes, having the following structures or their stereoisomers:

[0052]

[0053] The term "α-terpinene," also known as 1-isopropyl-4-methyl-1,3-cyclohexadiene, is a compound with the molecular formula C2. 10 H 16 Monoterpenes, and have the following structure:

[0054]

[0055] The term "limonene," also known as 1-methyl-4-(1-methylvinyl)-cyclohexene, is a compound with the molecular formula Ci. 10 H 16 Monoterpenes, having the following structures or their stereoisomers:

[0056]

[0057] The term "β-ocimene," also known as cis-3,7-dimethyl-1,3,7-octtriene, is a compound with the molecular formula C 10 H 16 Monoterpenes, having the following structures or their stereoisomers:

[0058]

[0059] The term "γ-terpinene," also known as 4-methyl-1-(1-methylethyl)-1,4-cyclohexadiene, is a compound with the molecular formula C2. 10 H 16 Monoterpenes, and have the following structure:

[0060]

[0061] The term "β-linalool," also known as 3,7-dimethyloctyl-1,6-dien-3-ol, is a compound with the molecular formula C 10 H 18 Monoterpenoid products of O, having the following structures or their stereoisomers:

[0062]

[0063] The term "α-thujone," also known as 1-isopropyl-4-methylbicyclo[3.1.0]hex-3-ene, is a compound with the molecular formula C 10 H 16 Monoterpenes, having the following structures or their stereoisomers:

[0064]

[0065] The term "(E)-hydrated juniperene," also known as (1S,4R,5R)-4-methyl-1-propane-2-ylbicyclo[3.1.0]hex-4-ol, is a compound with the molecular formula C 10 H 18 O monoterpenes, having the following structures or stereoisomers thereof:

[0066]

[0067] The term "(Z)-hydrated juniperene," also known as 4-methyl-1-propane-2-ylbicyclo[3.1.0]hexane-4-ol, is a compound with the molecular formula C 10 H 18 O monoterpenes, having the following structures or stereoisomers thereof:

[0068]

[0069] As used in this invention, "functionally disrupting" or "functionally destroying" a target gene (such as a gene encoding FPP synthase) means that the target gene is altered in such a way that the activity of the protein encoded by the target gene in the host cell is reduced. Similarly, "functionally disrupting" or "functionally destroying" a target protein (such as FPP synthase) means that the target protein is altered in such a way that the activity of the protein in the host cell is reduced. In some embodiments, the activity of the target protein encoded by the target gene is eliminated in the host cell. In other embodiments, the activity of the target protein encoded by the target gene is reduced in the host cell. Functional disruption of the target gene can be achieved by deleting or mutating all or part of the gene, thereby eliminating or reducing gene expression, or eliminating or reducing the activity of the gene product. Functional disruption of the target gene can also be achieved by deleting or mutating the regulatory elements of the gene (such as the promoter of the gene) to eliminate or reduce expression, or by deleting or mutating the coding sequence of the gene to eliminate or reduce the activity of the gene product. In some embodiments, functional disruption of the target gene results in the removal of the entire open reading frame of the target gene.

[0070] The term "fermentation" is used to refer to the cultivation of microorganisms that use carbon sources (such as sugar) as an energy source to produce desired products.

[0071] The term "culture medium" refers to a medium that enables the growth of biomass and the production of microbial metabolites. It contains a carbon source and may further contain nitrogen, phosphorus, vitamins, minerals, etc.

[0072] The term "fermentation medium" as used in this invention may be used synonymously with "culture medium." Generally, the term "fermentation medium" can be used to refer to a culture medium suitable for long-term cultivation of microorganisms to generate desired compounds from said microorganisms.

[0073] The term "culture medium / medium" refers to a culture medium and / or a fermentation medium. The "culture medium / medium" can be liquid or semi-solid. A given culture medium / medium can be both a culture medium and a fermentation medium.

[0074] The term "whole-cell fluid" refers to the entire contents of a container (e.g., flask, plate, fermenter, etc.), including cells, an aqueous phase, compounds generated in a hydrocarbon phase and / or emulsion. Therefore, the whole-cell fluid includes water, a carbon source (e.g., sugar), minerals, vitamins, other dissolved or suspended substances, microorganisms, metabolites and compounds produced by the microorganisms, and all other components of the material held in the container in which monoterpenoid compounds, including myrcene, are produced by the microorganisms.

[0075] The term "fermentation composition" may be used interchangeably with "whole-cell fluid". If the fermentation composition is added to the fermentation vessel during fermentation, the fermentation composition may also include a covering layer.

[0076] The term "biosynthetic pathway" refers to a pathway involving a series of enzymes that lead to molecular biosynthesis.

[0077] The term "mevalerate pathway" or "MEV pathway" as used in this invention refers to a biosynthetic pathway that converts acetyl-CoA to IPP. One embodiment of the MEV pathway is shown in Figure 2A. The mevalerate pathway comprises an enzyme catalyzing the following steps: (a) condensing two molecules of acetyl-CoA to form acetoacetyl-CoA; (b) condensing acetoacetyl-CoA with acetyl-CoA to form 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA); (c) converting HMG-CoA to mevalerate; (d) phosphorylating mevalerate to mevalerate 5-phosphate; (e) converting mevalerate 5-phosphate to mevalerate 5-pyrophosphate; and (f) converting mevalerate 5-pyrophosphate to isopentenyl pyrophosphate (IPP). The "upper part" of the mevalerate pathway refers to the enzyme responsible for converting acetyl-CoA to mevalerate via an MEV pathway intermediate. In some implementations, the IPP isomerase that converts IPP to DMAPP is also called the MEV pathway enzyme.

[0078] The term "deoxyxylulose-5-phosphate pathway" or "DXP pathway" as used in this invention refers to the biosynthetic pathway that converts glyceraldehyde-3-phosphate and pyruvate into IPP and DMAPP via a series of enzymes (referred to as DXP pathway enzymes). One embodiment of the DXP pathway is schematically illustrated in Figure 2B.

[0079] The term "pyrophosphate / ester" is used interchangeably with "diphosphate / ester" in this invention.

[0080] The term "myrcene synthase" refers to an enzyme capable of catalyzing the formation of myrcene as a major product from geranyl pyrophosphate precursor (also known as geranyl diphosphate precursor). The catalytic reaction of myrcene synthase may simultaneously generate other byproducts as minor components besides myrcene. For example, myrcene synthase can generate at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% of myrcene, relative to the total amount of monoterpenoids generated by a genetically modified microbial host cell using said myrcene synthase, based on the relative area percentage of monoterpenoids in a GC chromatogram. As used in this invention, the term "myrcene synthase" may include bifunctional enzymes that use two different substrates to catalyze two different catalytic reactions.

[0081] The term "gerany-based pyrophosphate synthase" refers to a polypeptide capable of catalyzing the formation of gerany pyrophosphate by condensing a precursor, isopentenyl pyrophosphate (IPP), and dimethylallyl pyrophosphate (DMAPP). As used in this invention, the term "gerany-based pyrophosphate synthase" may include bifunctional enzymes that use two different substrates to catalyze two different catalytic reactions.

[0082] As used in this invention, the term "sequence identity" or "percentage identity" in the context of two or more nucleic acid or protein sequences refers to two or more sequences or subsequences that are identical or have a specific percentage of identical amino acid residues or nucleotides. For example, when comparing and aligning over a comparison window or designated region to obtain maximum correspondence, the sequence may have a percentage identity of at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or higher, with a reference sequence in the designated region, as determined by using sequence comparison algorithms or by manual alignment and visual inspection. For example, the percentage of identity is determined by calculating the ratio of the number of identical nucleotides (or amino acid residues) in the sequence to the total length of the nucleotides (or amino acid residues) minus the length of any vacancies.

[0083] For convenience, computer programs and mathematical algorithms known in the art can be used to determine the degree of identity between two sequences. Such algorithms for calculating the percentage sequence identity typically take into account sequence gaps and mismatches in the comparison region. Procedures for comparing and aligning sequences, such as Clustal W (Sequence Alignment) (Thompson et al., (1994) Nucleic Acids Res., 22:4673-4680), ALIGN (Myers et al., (1988) CABIOS, 4:11-17), FASTA (Pearson et al., (1988) PNAS, 85:2444-2448; Pearson (1990), Methods Enzymol., 183:63-98), and BLAST for gaps (Altschul et al., (1997) Nucleic Acids Res., 25:3389-3402), can all be used for this purpose. The BLAST or BLAST 2.0 (Altschul et al., J.Mol.Biol.215:403-10, 1990) is available from multiple sources, including the National Center for Biotechnology Information (NCBI) and the Internet, for link sequence analysis programs BLASTP, BLASTN, BLASTX, TBLASTN, and TBLASTX. More information is available on the NCBI website.

[0084] In some implementations, sequence alignment and percentage identity calculations can be determined using the BLAST program with its standard default parameters. For nucleotide sequence alignment and sequence identity calculations, the BLASTN program can be used with its default parameters (vacancy open penalty = 5, vacancy extension penalty = 2, nuclear match = 1, nuclear mismatch = -3, expected value = 10.0, word size = 11). For peptide sequence alignment and sequence identity calculations, the BLASTP program can be used with its default parameters (vacancy open = 11, vacancy extension penalty = 2; nuclear match = 1; nuclear mismatch = -3, expected value = 10.0; word size = 11; matrix Blosum62). Alternatively, the following program and parameters can be used: Clone Manager Suite version 5 (Sci-Ed software) Align Plus software; DNA comparison: Global comparison, Standard Linear Scoring matrix, mismatch penalty = 2, open vacancy penalty = 4, extension vacancy penalty = 1. Amino acid comparison: Global comparison, BLOSUM 62 score matrix.

[0085] The term "homology" as used in this invention refers to the similarity between two or more nucleic acid sequences or two or more amino acid sequences. Sequence identity can be measured as a percentage of identity (or similarity or homology); the higher the percentage, the closer the sequences are to being identical. When aligned using standard methods, homologs or orthologs of nucleic acid or amino acid sequences have a relatively high degree of sequence identity. For example, "homologies" of a reference protein or nucleic acid include those with at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, and at least about 99% sequence identity with the reference protein or nucleic acid. As mentioned above, various procedures for sequence alignment and analysis are well known and can be used to determine whether two sequences are homologs of each other.

[0086] The phrase "strict hybridization conditions" refers to conditions under which a probe typically hybridizes with its target sequence in a complex mixture of nucleic acids, but not with other sequences. Strict conditions are sequence-dependent and vary depending on the specific conditions. Longer sequences hybridize specifically at higher temperatures. For extensive guidelines on nucleic acid hybridization, see Tijssen, Techniques in Biochemistry and Molecular Biology—Hybridization with Nucleic Probes, "Overview of principles of hybridization and the strategy of nucleic acid assays" (1993). Typically, strict conditions are chosen as the melting point (T0) of the specific sequence at a pH value higher than a defined ionic strength. m The temperature is approximately 5-10°C lower. The T... m It is at equilibrium (because the target sequence is in excess, at T) m The stringent conditions are determined by the temperature at which 50% of the probe is used in equilibrium and the remaining 50% of the probe complementary to the target sequence hybridizes with the target sequence (under defined ionic strength, pH, and nucleic acid concentration). Strict conditions can also be achieved by adding a destabilizing agent such as formamide. For selective or specific hybridization, the positive signal is at least twice the background signal, preferably 10 times the background signal. Exemplary stringent hybridization conditions may be as follows: incubation at 42°C with 50% formamide, 5×SSC, and 1% SDS, or incubation at 65°C with 5×SSC and 1% SDS, followed by washing at 65°C in 0.2×SSC and 0.1% SDS.

[0087] If the peptides they encode are substantially the same, then nucleic acids that do not hybridize under stringent conditions are still substantially the same. This occurs, for example, when copies of nucleic acids are generated using the maximum codon degeneracy allowed by the genetic code. In this case, the nucleic acids are typically hybridized under moderately stringent hybridization conditions. An exemplary “moderately stringent hybridization condition” includes hybridization at 37°C in a buffer of 40% formamide, 1M NaCl, and 1% SDS, followed by washing at 45°C in 1×SSC. Positive hybridization is at least twice the background. Those skilled in the art will readily recognize that other hybridization and washing conditions can be used to provide similar stringent conditions. Additional guidelines for determining hybridization parameters are provided in numerous references, such as Current Protocols in Molecular Biology, ed. Ausubel et al.

[0088] "Conservative amino acid substitution" is a situation where an amino acid residue is replaced by another amino acid residue in a side chain (R group) with similar chemical properties (e.g., charge or hydrophobicity). Generally, conservative amino acid substitution does not substantially alter the functional properties of a protein. In cases where two or more amino acid sequences differ from each other due to conservative substitution, the percentage sequence identity or homology can be adjusted upwards to correct for the conservatism of the substitution. Methods for making such adjustments are well known to those skilled in the art (see, for example, Pearson WR, 1994, Methods in Mol. Biol 25:365-89).

[0089] The following six groups each contain amino acids that are conserved and substituted for each other: 1) serine (S), threonine (T); 2) aspartic acid (D), glutamic acid (E); 3) asparagine (N), glutamine (Q); 4) arginine (R), lysine (K); 5) isoleucine (I), leucine (L), alanine (A), valine (V); and 6) phenylalanine (F), tyrosine (Y), tryptophan (W).

[0090] As used in this invention, the term "variant amino acid residue" refers to an amino acid change or substitution in a variant form of the reference protein. For example, the variant amino acid residue "F381L" means that position 381 of the reference protein, which normally contains phenylalanine (F), is replaced by the amino acid residue leucine (L). In another embodiment, the variant amino acid residue "D389G" means that position 389 of the reference protein, which normally contains the amino acid residue aspartic acid (D), is replaced by the amino acid residue glycine (G).

[0091] As used herein, the term "myrcene synthase variant" or "mutant myrcene synthase" relating to amino acid sequence refers to a myrcene synthase that has a different amino acid sequence compared to a reference myrcene synthase (e.g., wild-type myrcene synthase). Compared to its reference myrcene synthase, the myrcene synthase variant or mutant myrcene synthase may contain amino acid additions, deletions, substitutions, and / or insertions. The term "myrcene synthase variant" or "mutant myrcene synthase" nucleic acid molecule relating to nucleotide sequence refers to a myrcene synthase nucleic acid molecule that has a different nucleotide sequence compared to a reference myrcene synthase nucleic acid molecule. For example, compared to a wild-type myrcene synthase nucleic acid molecule, a myrcene synthase variant nucleic acid molecule or mutant myrcene synthase nucleic acid molecule may contain nucleotide additions, deletions, and / or substitutions, which may or may not result in changes to the corresponding amino acid sequence. In some embodiments where nucleotide changes do not result in changes to the amino acid sequence, the changes may, for example, improve the activity of the myrcene synthase through codon optimization.

[0092] The term "reference" or "parental" sequence (e.g., nucleic acid or protein) used in this invention refers to the sequence selected for sequence comparison, enzyme activity comparison, or comparison of myrcene generation with variant sequences (e.g., nucleic acid or protein).

[0093] The terms “natural” or “endogenous” as used in this invention refer to substances or processes / methods that can be naturally present in host cells.

[0094] The term "genetically modified" as used in this invention refers to a host cell containing a heterologous nucleotide sequence.

[0095] The term "heterogeneity" as used in this invention refers to something that is not normally found in nature. For example, when used in connection with nucleic acids (DNA or RNA) or proteins, the term "heterogeneity" refers to a nucleic acid or protein that is not naturally occurring as part of an organism, cell, genome, or DNA or RNA sequence present therein, or that is present on a cell or site within a genome or DNA or RNA sequence and is distinct from naturally occurring nucleic acids or proteins. The term "heterogeneous compound" refers to a compound generated by cells that do not normally produce the compound, or a compound generated at levels not normally produced by cells.

[0096] The term "naturally occurring" as used in this invention refers to something found in nature. For example, myrcene synthase, which exists in organisms, can be isolated from natural sources and is not intentionally modified in the laboratory; it is a naturally occurring myrcene synthase. Conversely, the term "not naturally occurring / non-naturally occurring" as used in this invention refers to something not found in nature but which can be generated through human intervention.

[0097] The term "in vivo performance" or "activity" of myrcene synthase as used in this invention refers to its ability to convert geranium pyrophosphate to myrcene when expressed in microbial host cells. Therefore, the terms "improved in vivo performance" or "improved activity" refer to an increased ability of myrcene synthase to convert geranium pyrophosphate to myrcene when expressed in microbial host cells.

[0098] The term "heterogeneous enzyme" as used in this invention refers to an enzyme that is not normally present in a given cell in nature. The term includes enzymes that are: (a) exogenous to a given cell (i.e., encoded by a nucleotide sequence that is not naturally present in the host cell or is not naturally present in the given context of the host cell); and (b) naturally present in the host cell (e.g., the enzyme is encoded by a nucleotide sequence that is endogenous to the cell), but are produced in the host cell in a non-natural amount (e.g., more or less than naturally present).

[0099] The terms “amino acid sequence,” “peptide,” “oligopeptide,” “polypeptide,” and “protein” are used interchangeably in this invention and refer to a polymeric form of amino acids of any length that may or may not be chemically or biochemically modified.

[0100] The terms “polynucleotide” and “nucleic acid” are used interchangeably in this invention and refer to the polymeric form of both ribonucleotides and deoxyribonucleotides of any length.

[0101] The term "isolated nucleic acid" or "isolated nucleic acid molecule," when applied to DNA, refers to a DNA molecule that has been isolated from a sequence immediately adjacent to the naturally occurring genome of the organism of its origin. "Isolated nucleic acid" or "isolated nucleic acid molecule" also includes non-genomic nucleic acids, such as cDNA or other non-naturally occurring nucleic acid molecules.

[0102] The term "cDNA" is defined in this invention as a DNA molecule that can be produced by reverse transcription from a mature, spliced ​​mRNA molecule obtained from a cell. cDNA lacks the intron sequences that are normally present in the corresponding genomic DNA.

[0103] The phrase "operably linked" as used in this invention refers to a functional link between nucleic acid sequences such that the promoters and / or regulatory regions of the link functionally control the expression of the coding sequence.

[0104] The term "productivity" as used in this invention refers to the amount of compound produced by the host cells, expressed as the amount of compound produced per unit volume of fermentation medium in which the host cells are cultured per hour (by volume). When applied to myrcene, the term "productivity" refers to the amount of myrcene produced by the host cells, expressed as the amount of myrcene produced per unit volume of fermentation medium in which the host cells are cultured per hour (by volume).

[0105] The term "yield / yield" refers to the amount of compound produced by the host cell, expressed as the amount (by weight) of said compound produced per unit of carbon source consumed by said host cell. More specifically, when applied to the production of myrcene, the term "yield / yield" refers to the amount of myrcene produced relative to the total reducing sugar added to the fermenter or flask (i.e., grams of myrcene produced divided by grams of total reducing sugar, expressed as a percentage). The total reducing sugar is a unit of measurement for sugars in grams. Reducing sugars are any sugars capable of being used as reducing agents because they possess a free aldehyde group or a free ketone group. All monosaccharides, such as galactose, glucose, and fructose, are reducing sugars. For example, if 10 grams of myrcene are produced by adding 100 grams of glucose (i.e., 100 grams of reducing sugar) to the host cell, the yield / yield of myrcene is 10%.

[0106] The terms “titer / potency” or “concentration” refer to the amount of compound produced by the host cells, expressed as the amount of compound produced per volume of fermentation medium in which the host cells are cultured (by weight).

[0107] Unless the context clearly indicates otherwise, the terms “a,” “an,” and “the” mean “at least one.”

[0108] 6.2 Biosynthetic pathway for myrcene formation

[0109] Myrcene is an aromatic hydrocarbon and an important component of many different plant essential oils. Myrcene is a monoterpene derived from the C5 compound isopentenyl pyrophosphate (IPP). As shown in Figure 1, the biosynthetic steps that enable IPP to generate monoterpenoids involve two enzymes, geranyl pyrophosphate synthase (GPPS) and myrcene synthase (MyrS). GPPS and MyrS are typically required in genetically modified microbial host cells for the production of myrcene, although some terpene synthases are known to be bifunctional as both GPPS and MyrS. Typically, GPPS transfers carbon flux from the C5-isopentenyl diphosphate metabolites isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP) to geranyl diphosphate (GPP). MyrS, in turn, converts the GPP precursor into myrcene. Although Figure 1 shows myrcene as the only monoterpene produced by the catalytic reaction of myrcene synthase and geranyl pyrophosphate, many other monoterpenoids can be produced as minor components by certain myrcene synthases.

[0110] Furthermore, although Figure 1 illustrates the generation of myrcene using the mevalonate pathway, the compositions and methods of the present invention are not limited to the generation of myrcene using the mevalonate pathway. There are two distinct pathways leading to the production of IPP and DMAPP: the mevalonate pathway (MEV pathway) and the non-mevalonate pathway (DXP pathway). Eukaryotes, except plants, typically use the mevalonate-dependent pathway. As shown in Figure 2A, the MEV pathway uses acetyl-CoA as an initial precursor to generate IPP and its isoform DMAPP via a series of MEV pathway enzymes. With some exceptions, prokaryotes typically use only the DXP pathway to generate IPP and DMAPP. Plants use both the MEV and DXP pathways. As shown in Figure 2B, the DXP pathway uses glyceraldehyde-3-phosphate and pyruvate as initial precursors to generate IPP and its isoform DMAPP via a series of DXP pathway enzymes. In some embodiments, either the MEV pathway or the DXP pathway enzymes can be used to generate precursors for the biosynthesis of myrcene in genetically modified microbial host cells.

[0111] In the compositions and methods provided by this invention, microbial host cells are genetically modified to include a heterologous myrcene synthase sequence. In some embodiments, the microbial host cells are further genetically modified to include a heterologous geranyl pyrophosphate synthase sequence. In some embodiments, additional heterologous nucleic acid molecules (e.g., MEV or DXP pathway genes) may be introduced together with the heterologous myrcene synthase and the heterologous geranyl pyrophosphate synthase to increase myrcene production in the genetically modified microbial host cells. In some embodiments, one or more endogenous genes of the host genome may be functionally disrupted or modified to improve myrcene production in the genetically modified microbial host cells.

[0112] 6.3 Myrcene synthase and its variants

[0113] In the literature, many myrcene synthase genes have been isolated and annotated as myrcene synthases. Although some of these have been biochemically characterized, none have shown significant biosynthesis of myrcene in genetically modified microbial host cells. The inventors have discovered that myrcene synthases derived from the basil species, particularly *Ocimum basilicum*, provide relatively high levels of myrcene production in genetically modified microbial host cells compared to myrcene synthase sequences obtained from other organisms.

[0114] Furthermore, as shown in the Examples section, wild-type basil (Ocimum basilicum) and its variants exhibit unique monoterpene product distribution characteristics when expressed in genetically modified microbial host cells, which can be distinguished from the monoterpene product distribution characteristics generated by myrcene synthases derived from other organisms. For example, the myrcene synthase provided by the present invention, when expressed in genetically modified microbial host cells, generates α-terpinene and γ-terpinene as byproducts along with myrcene. However, other myrcene synthases, such as those derived from Quercus ilex, do not generate α-terpinene and γ-terpinene as byproducts along with myrcene, see, for example, Figure 3A. Therefore, the product distribution characteristics of the myrcene synthase sequences provided by the present invention have a unique molecular fingerprint and are distinguishable from the product distribution characteristics of other myrcene synthase sequences. Therefore, they can be used to generate end products with potentially different characteristics (e.g., odor or flavor characteristics), such as fragrances and flavors, which may differ from the product characteristics generated by other myrcene synthases.

[0115] Therefore, the present invention provides a myrcene synthase sequence that, when expressed in genetically modified microbial host cells, produces myrcene in relatively high amounts with a unique monoterpene product distribution characteristic. In some embodiments, a wild-type myrcene synthase sequence from the genus *Basil* is codon-optimized for selected microbial host cells to produce myrcene. In some embodiments, the present invention provides a myrcene synthase variant in which one or more amino acid positions of the wild-type myrcene synthase are altered to further improve the in vivo performance of the enzyme, thereby increasing the amount, purity, and / or product distribution characteristic of myrcene.

[0116] 6.3.1. Amino acid sequence of myrcene synthase variant

[0117] This invention provides myrcene synthase variants that include amino acid residue modifications compared to a reference sequence, but still retain the biological activity of myrcene synthase. In one embodiment, the reference myrcene synthase is wild-type myrcene synthase (ObMS) of basil (Ocimum basilicum) comprising the amino acid sequence SEQ ID NO: 2. In another embodiment, the reference myrcene synthase may be a homolog of basil (Ocimum basilicum) myrcene synthase. For example, the reference myrcene synthase may be a myrcene synthase from a basil species other than basil (Ocimum basilicum) that has basic sequence identity with SEQ ID NO: 2. In some embodiments, the myrcene synthase variant may also be generated from other homologs or orthologs of basil (Ocimum basilicum) myrcene synthase from different organisms.

[0118] As used in this invention, the term "wild-type" myrcene synthase refers to a truncated form of a naturally occurring myrcene synthase lacking an N-terminal transport peptide. Terpene synthases derived from plants including basil (Ocimum basilicum) myrcene synthase preprotein include an N-terminal transport peptide sequence (also known as a plastid-targeting sequence), which is essential in plants for introducing nuclear-encoded plastid proteins into plastids. In microbial host cells, the N-terminal transport peptide sequence is not essential for expression. Therefore, to express basil (Ocimum basilicum) myrcene synthase or other myrcene synthases in microbial host cells, the N-terminal transport peptide in the myrcene synthase preprotein is truncated to remove the N-terminal transport peptide sequence. An exemplary embodiment of the basil (Ocimum basilicum) myrcene synthase nucleotide sequence without the transport peptide sequence is shown in SEQ ID NO: 1 (also known as 1xObMS nucleic acid), and the corresponding amino acid sequence is shown in SEQ ID NO: 2.

[0119] Compared to a reference myrcene synthase, myrcene synthase variants according to certain embodiments may include amino acid substitutions, deletions, additions, and / or insertions at certain amino acid positions. The deletions or additions may occur at the N-terminus or C-terminus of the reference protein. In one embodiment, an amino acid sequence may be added to one or both ends of the reference protein. For example, an amino acid sequence may be added to the reference myrcene synthase to increase the stability of the myrcene synthase variant. In another embodiment, the myrcene synthase variant may include the deletion of a non-functional portion of the enzyme. For example, compared to the reference sequence of SEQ ID NO: 2, the myrcene synthase variant may include a deletion of one, two, three, or four amino acid residues at the N-terminus. The amino acid sequence of SEQ ID NO: 2, which is a truncated wild-type basil (Ocimum basilicum) myrcene synthase, includes the RR(x)8W motif near the N-terminus. In this motif, R is arginine, W is tryptophan, and "(x)8" represents eight amino acid residues between R and W. The RR(x)8W motif is typically present at the N-terminal portion of class III terpene synthase proteins. The amino acid sequence of SEQ ID NO: 2 includes four amino acid residues MVEP at the N-terminus of the RR(x)8W motif. One or more of these MVEP amino acid residues may not necessarily affect the function of myrcene synthase or its expression in genetically modified microbial host cells. Therefore, in some embodiments, the myrcene synthase variant may further include the deletion of one or more amino acid residues of the MVEP at the N-terminus of SEQ ID NO: 2.

[0120] In other embodiments, the myrcene synthase variant may include one or more amino acid substitutions compared to the reference sequence. For example, the myrcene synthase variant may include 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acid substitutions compared to the reference myrcene synthase sequence, and retains the myrcene synthase activity of the reference sequence. In some embodiments, the myrcene synthase variant contains one or more amino acid substitutions of up to 5%, up to 10%, up to 15%, up to 20%, up to 25%, or up to 30% of the reference myrcene synthase sequence. In some embodiments, the amino acid substitutions may include conserved amino acid substitutions. For example, a basic amino acid residue (such as lysine) in the reference myrcene synthase may be exchanged for another basic amino acid residue (such as arginine). In another embodiment, a polar amino acid residue (such as serine) in the reference myrcene synthase may be substituted for another polar amino acid residue (such as threonine). In other embodiments, the amino acid substitutions may include non-conserved amino acid substitutions. For example, nonpolar amino acid residues (such as glycine) in reference myrcene synthase can be replaced by acidic amino acid residues (such as glutamine). In another embodiment, aromatic amino acid residues (such as tyrosine) can be replaced by cyclic amino acid residues (such as proline).

[0121] In some embodiments, the myrcene synthase variant comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with a reference myrcene synthase. In an embodiment, the reference myrcene synthase comprises the amino acid sequence of SEQ ID NO: 2, i.e., the wild-type sequence of basil (Ocimum basilicum) myrcene synthase. Therefore, in some embodiments, the myrcene synthase variant comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with SEQ ID NO: 2.

[0122] In some embodiments, the myrcene synthase variant is not a naturally occurring myrcene synthase and contains one or more amino acid substitutions compared to wild-type myrcene synthase. In some embodiments, the myrcene synthase variant may contain at least one variant amino acid residue at one or more of the following positions compared to SEQ ID NO: 2: 27, 28, 207, 213, 222, 342, 347, 381, 382, ​​389, 390, 401, 404, 428, 439, 466, 482, 484, 505, 514, 517, 524, 527, 528, 543, 544, and 552, wherein said positions are numbered with reference to SEQ ID NO: 2. As shown in the Examples section, one or more amino acid substitutions at these positions in SEQ ID NO: 2 produce beneficial mutations in improving the activity or performance of myrcene synthase in vivo. For example, as described in Example 7.9, in a competitive assay, one or more mutated myrcene synthase variants containing the amino acid sequence of SEQ ID NO: 2 exhibited improved rates of myrcene-to-limonene production. In another embodiment, as described in Example 7.11, one or more mutated myrcene synthase variants containing the amino acid sequence of SEQ ID NO: 2 exhibited improved myrcene production (e.g., potency) compared to myrcene synthases containing the amino acid sequence of SEQ ID NO: 2.

[0123] In some embodiments, the myrcene synthase variants of the present invention, relative to the basil (Ocimum basilicum) myrcene synthase of SEQ ID NO: 2, contain one or more amino acid substitutions at certain amino acid positions. However, the corresponding positions in homologs or orthologs of basil (Ocimum basilicum) myrcene synthase can be readily determined using sequence alignment algorithms known in the art, and the amino acid substitutions described with reference to the positions in SEQ ID NO: 2 can be applied to homologs or orthologs of basil (Ocimum basilicum) myrcene synthase (e.g., wild basil (O. campechianum), holy basil (O. tenuiflorum), African basil (O. centraliafricanum), etc.). Although SEQ ID NO: 2 is derived from basil (Ocimum basilicum), it is expected that myrcene synthases from other basil species or other homologous myrcene synthases may share basic sequence identity (e.g., at least 50%). Homologous myrcene synthases from basil (Ocimum basilicum) can also hybridize under stringent conditions with complementary sequences encoding the nucleic acid sequence of SEQ ID NO: 2 (e.g., the nucleotide sequence of SEQ ID NO: 1). Amino acid substitutions at one or more positions relative to SEQ ID NO: 2 can be incorporated into myrcene synthases from other basil species or other homologous sequences (e.g., having at least 70%, 80%, 90%, or 95% sequence identity with SEQ ID NO: 2) to generate additional myrcene synthase variants that retain or have improved myrcene synthase activity compared to the parent myrcene synthase.

[0124] Therefore, in some embodiments, the myrcene synthase variant comprises an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with SEQ ID NO: 2, and comprises one or more variant amino acid residues located at one or more positions selected from the group consisting of positions 27, 28, 207, 213, 222, 342, 347, 381, 382, ​​389, 390, 401, 404, 428, 439, 466, 482, 484, 505, 514, 517, 524, 527, 528, 543, 544, and 552, respectively, wherein said positions are numbered with reference to SEQ ID NO: 2.

[0125] In other embodiments, the myrcene synthase variant comprises an amino acid sequence encoded by a nucleic acid molecule hybridized to the complementary sequence of SEQ ID NO: 1 under strict hybridization conditions, and comprises one or more variant amino acid residues located at one or more positions selected from the group consisting of positions 27, 28, 207, 213, 222, 342, 347, 381, 382, ​​389, 390, 401, 404, 428, 439, 466, 482, 484, 505, 514, 517, 524, 527, 528, 543, 544, and 552, compared to SEQ ID NO: 2, wherein said positions are numbered with reference to SEQ ID NO: 2. In some embodiments, the myrcene synthase variant is encoded by a nucleic acid molecule hybridized under stringent conditions to the complementary sequence of SEQ ID NO: 3, and contains at least one variant amino acid residue at one or more positions selected from the group consisting of positions 27, 28, 207, 213, 222, 342, 347, 381, 382, ​​389, 390, 401, 404, 428, 439, 466, 482, 484, 505, 514, 517, 524, 527, 528, 543, 544, and 552, compared to SEQ ID NO: 2, wherein said positions are numbered with reference to SEQ ID NO: 2. The nucleotide sequence of SEQ ID NO: 3 encodes the amino acid sequence of SEQ ID NO: 2 and is a codon-optimized form of SEQ ID NO: 1 for expression in yeast host cells (e.g., Saccharomyces cerevisiae).

[0126] In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a substitution of histidine to isoleucine at position 27 (H27I). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a substitution of histidine to cysteine ​​at position 27 (H27C). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a substitution of serine to histidine at position 28 (S28H). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a substitution of isoleucine to valine at position 207 (I207V). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a substitution of lysine to cysteine ​​at position 213 (K213C). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a substitution of lysine to histidine at position 213 (K213H). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a substitution of lysine to arginine at position 213 (K213R). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a substitution of lysine to valine at position 213 (K213V). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a substitution of arginine to asparagine at position 222 (R222N). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a substitution of cysteine ​​to leucine at position 342 (C342L). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a tyrosine-to-arginine substitution (Y347R). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a phenylalanine-to-leucine substitution at position 381 (F381L). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a valine-to-leucine substitution at position 382 (V382L). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes an aspartic acid-to-glycine substitution at position 389 (D389G).In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a substitution of aspartic acid to serine at position 389 (D389S). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a substitution of glycine to aspartic acid at position 390 (G390D). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a substitution of asparagine to isoleucine at position 401 (N401I). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a substitution of asparagine to valine at position 401 (N401V). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a substitution of isoleucine to valine at position 404 (I404V). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a valine-to-leucine substitution at position 428 (V428L). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a tyrosine-to-leucine substitution at position 439 (Y439L). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes an alanine-to-cysteine ​​substitution at position 466 (A466C). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes an alanine-to-serine substitution at position 466 (A466S). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes an arginine-to-cysteine ​​substitution at position 482 (R482C). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a substitution of arginine to aspartic acid at position 482 (R482D). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a substitution of arginine to histidine at position 482 (R482H). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a substitution of arginine to isoleucine at position 482 (R482I). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a substitution of arginine to leucine at position 482 (R482L).In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a substitution of arginine to asparagine at position 482 (R482N). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a substitution of arginine to valine (R482V). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a substitution of histidine to tyrosine at position 484 (H484Y). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a substitution of cysteine ​​to isoleucine at position 505 (C505I). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a substitution of cysteine ​​to leucine at position 505 (C505L). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a cysteine-valine substitution (C505V). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a glycine-leucine substitution at position 514 (G514L). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a glycine-valine substitution at position 514 (G514V). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a serine-glycine substitution at position 517 (S517G). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a phenylalanine-leucine substitution at position 524 (F524L). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a substitution of phenylalanine to valine at position 524 (F524V). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a substitution of valine to cysteine ​​at position 527 (V527C). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a substitution of valine to phenylalanine at position 527 (V527F). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a substitution of valine to histidine at position 527 (V527H).In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a valine-to-leucine substitution at position 527 (V527L). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a valine-to-asparagine substitution at position 527 (V527N). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a valine-to-serine substitution at position 527 (V527S). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a valine-to-tyrosine substitution at position 527 (V527Y). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a glutamic acid-to-aspartic acid substitution at position 528 (E528D). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a substitution of methionine to isoleucine at position 543 (M543I). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a substitution of alanine to serine at position 544 (A544S). In some embodiments, the myrcene synthase variant has the amino acid sequence shown in SEQ ID NO: 2, but includes a substitution of glutamine to arginine at position 552 (Q552R). In some embodiments, the myrcene synthase variant has any combination of the amino acid substitutions described in this invention.

[0127] In some embodiments, the present invention provides a myrcene synthase variant comprising an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with SEQ ID NO: 2, and comprising at least one variant amino acid residue compared to SEQ ID NO: 2, wherein said at least one variant amino acid residue is selected from H27I, H27C, S28H, I207V, K213C, K213H, K213R, K213V, R222N, C342L, Y347R, F381L, V382L, D389G, D389S, G390D, N401I, N401V, I404V, V428L, Y439L, A466C, A466S, R482C The group consisting of R482D, R482H, R482I, R482L, R482N, R482V, H484Y, C505I, C505L, C505V, G514L, G514V, S517G, F524L, F524V, V527C, V527F, V527H, V527L, V527N, V527S, V527Y, E528D, M543I, A544S, and Q552R, wherein the positions of the amino acid residues are numbered according to SEQ ID NO: 2.

[0128] In some embodiments, the present invention provides a myrcene synthase variant encoded by a nucleic acid molecule hybridized under stringent conditions to the complementary sequence of SEQ ID NO: 1, SEQ ID NO: 3, or SEQ ID NO: 4, and comprising at least one variant amino acid residue compared to SEQ ID NO: 2, wherein the at least one variant amino acid residue is selected from H27I, H27C, S28H, I207V, K213C, K213H, K213R, K213V, R222N, C342L, Y347R, F381L, V382L, D389G, D389S, G390D, N401I, N401V, I404V, V428L, Y439L, A466C, A466S, R482 The group consisting of C, R482D, R482H, R482I, R482L, R482N, R482V, H484Y, C505I, C505L, C505V, G514L, G514V, S517G, F524L, F524V, V527C, V527F, V527H, V527L, V527N, V527S, V527Y, E528D, M543I, A544S, and Q552R, wherein the positions of the amino acid residues are numbered according to SEQ ID NO: 2.

[0129] In some embodiments, the myrcene synthase variant contains one variant amino acid residue compared to SEQ ID NO: 2. In some embodiments, the myrcene synthase variant contains two variant amino acid residues compared to SEQ ID NO: 2. In some embodiments, the myrcene synthase variant contains three variant amino acid residues compared to SEQ ID NO: 2. In some embodiments, the myrcene synthase variant contains four variant amino acid residues compared to SEQ ID NO: 2. In some embodiments, the myrcene synthase variant contains five variant amino acid residues compared to SEQ ID NO: 2. In some embodiments, the myrcene synthase variant contains at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more amino acid substitutions compared to SEQ ID NO: 2.

[0130] In some embodiments, compared to SEQ ID NO: 2, the myrcene synthase variant comprises at least one set of variant amino acid residues, and said at least one set of variant amino acid residues is selected from the group consisting of the following variant amino acid residue groups: (a) F381L, I404V, E528D, and M543I; (b) I404V and E528D; (c) F381L, D389G, I404V, Y439L, and E528D; (d) F381L, E528D, and M543I; (e) F381L, I404V, and E528D; (f) F381L, I404V, E528D, and A544S; and (g) F381L, I404V, E528D, and Q552R, wherein said positions are numbered with reference to SEQ ID NO: 2. As described in the Examples section, when the background of SEQ ID NO: 2 is introduced, each of these variant amino acid residue groups further improves the activity of the myrcene synthase relative to the reference myrcene synthase containing SEQ ID NO: 2. One or more of these variant amino acid residue groups may also be introduced into the homologous sequence of SEQ ID NO: 2.

[0131] As described in the Examples section, it was found that when encoded by the wild-type nucleotide sequence having SEQ ID NO: 1, in microbial host cells (e.g., Saccharomyces cerevisiae), the myrcene synthase variant containing the variant amino acid residue set F381L, I404V, and E528D exhibits approximately 14-fold increased myrcene synthase activity relative to the reference myrcene synthase containing SEQ ID NO: 2. Therefore, in some embodiments, one or more of the variant amino acid residues may be further introduced into the myrcene synthase variant (referred to as the "14xObMS" variant) to generate additional myrcene synthase variants with improved myrcene synthase activity. For example, other myrcene synthase variants can be obtained by introducing one or more variant amino acid residues into the 14xObMS variant, such as H27I, H27C, S28H, I207V, K213C, K213H, K213R, K213V, R222N, C342L, Y347R, V382L, D389G, D389S, G390D, N401I, N401V, V428L, Y439L, A466C, A4 It is generated from 66S, R482C, R482D, R482H, R482I, R482L, R482N, R482V, H484Y, C505I, C505L, C505V, G514L, G514V, S517G, F524L, F524V, V527C, V527F, V527H, V527L, V527N, V527S, V527Y, M543I, A544S and Q552R.

[0132] In addition to the specific amino acid substitutions described in this invention, other variations in amino acid substitutions, deletions, additions, and insertions in the reference myrcene synthase are also within the scope of this invention. The function of these myrcene synthase variants can be readily determined by expressing each variant in a microbial host cell and measuring the amount of myrcene produced using the plate assay, headspace assay, competitive assay, and GC technique described in the Examples section, or other suitable techniques known in the art.

[0133] As illustrated in the Examples section, the amino acid substitutions in the myrcene synthase variants of this invention alter the in vivo performance of the reference myrcene synthase, specifically its ability to convert geranium pyrophosphate substrates to myrcene when expressed in microbial host cells. Without wishing to be bound by any theory, the changes in the in vivo performance of the myrcene synthase variants may be due to variations in substrate binding affinity, enzyme kinetics, transcription, protein expression levels, protein stability, etc. In some embodiments, the myrcene synthase variants may also alter substrate utilization or monoterpene product distribution.

[0134] In some embodiments, changes in the in vivo performance of myrcene synthase variants can be assessed by measuring and comparing the amount of myrcene produced by the myrcene synthase variant with that produced by a reference myrcene synthase (e.g., wild-type myrcene synthase from basil) under the same culture conditions. Myrcene production in terms of potency, yield, and / or productivity can be determined using any suitable technique known in the art. For example, the culture conditions and myrcene potency analysis techniques described in the Examples section can be used to determine myrcene production.

[0135] In some embodiments, when expressed in genetically modified microbial host cells, the amount of myrcene produced by the myrcene synthase variant is at least 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 2 times, at least about 2.5 times, at least about 5 times, at least about 10 times, at least about 20 times, at least about 30 times, at least about 40 times, at least about 50 times, at least about 75 times, and at least about 100 times higher than the amount of myrcene produced by a reference myrcene synthase. In some embodiments, the amount of myrcene produced by the myrcene synthase variant is increased several times compared to the amount of myrcene produced by a reference myrcene synthase, wherein the reference myrcene synthase comprises SEQ ID NO:2 encoded by SEQ ID NO:1. In the implementation scheme, the GC technique described in Examples 6.4 and 6.5 of the Examples section is used to determine the amount of myrcene produced. The amount of myrcene produced by the variant myrcene synthase is compared with that of the reference myrcene synthase under equivalent experimental conditions (e.g., host cells, control sequences, culture conditions, etc.).

[0136] In other embodiments, changes in the in vivo performance of myrcene synthase variants can be assessed by determining the titer of myrcene and a contrast monoterpene in a competitive assay. An exemplary example of a competitive assay uses a known monoterpene synthase (e.g., limonene synthase) as a contrast enzyme to compare with the myrcene synthase variant. The contrast monoterpene synthase and each myrcene synthase variant are co-expressed in a microbial host cell and then compete in the host cell for the same substrate (e.g., geranyl pyrophosphate) to generate their respective monoterpenoid compounds. Since the performance of the contrast enzyme remains constant in genetically modified microbial host cells, any change in the ratio of the titer of the monoterpenoid compound generated by the tested myrcene synthase variant to that of the contrast monoterpene synthase is a direct result of the activity of the myrcene synthase variant. For example, if limonene synthase is used as a contrast enzyme, the ratio of the titer of myrcene to limonene for each myrcene synthase variant can be determined. Therefore, this ratio can be used to identify myrcene synthase variants with improved in vivo performance and / or to quantitatively compare the in vivo kinetics of myrcene synthase variants in the conversion of geranium pyrophosphate to myrcene. Exemplary competitive assays suitable for screening are further described in the Examples section.

[0137] In some embodiments, the myrcene synthase variant exhibits a myrcene to contrast monoterpene synthase (e.g., limonene synthase) potency ratio that is improved by at least 5%, at least 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 2 times, at least about 2.5 times, at least about 5 times, at least about 10 times, at least about 20 times, at least about 30 times, at least about 40 times, at least about 50 times, at least about 75 times, and at least about 100 times.

[0138] In some embodiments, additional assays comparing the product distribution characteristics of a myrcene synthase variant with those of a reference myrcene synthase can be used to determine whether the myrcene synthase variant retains or improves the monoterpene product distribution characteristics. As shown in Example 7.7, when expressed in genetically modified microbial host cells, the wild-type myrcene synthase containing SEQ ID NO: 2 generates approximately 89% to 92% myrcene, compared to the total amount of monoterpenoids generated by the genetically modified microbial host cells. Compared to the wild-type myrcene synthase containing SEQ ID NO: 2, it may be necessary to screen for myrcene synthase variants capable of generating myrcene at a higher proportion, for example, generating at least approximately 93%, 94%, 95%, 96%, 97%, 98%, or 99% myrcene. The GC techniques described in the Examples section can be used to determine whether the myrcene synthase variant at least retains or improves its monoterpene product distribution characteristics by increasing the proportion of myrcene in the monoterpenoids generated by the genetically modified microbial host cells.

[0139] The above assays are merely exemplary, and other suitable assays that are obvious to those skilled in the art for determining the in vivo performance of myrcene synthase variants may be used to screen for myrcene synthase variants with improved in vivo performance.

[0140] 6.3.2. Myrcene synthase variant nucleic acid sequence

[0141] On the other hand, the present invention provides isolated nucleic acid molecules encoding the myrcene synthase described in the present invention. In some embodiments,

[0142] The isolated nucleic acid molecule may contain nucleotide substitutions, deletions, additions, and / or insertions of SEQ ID NO: 1, which may or may not result in changes to the corresponding amino acid sequence. In some embodiments, the isolated nucleic acid molecule may contain nucleotide substitutions, deletions, additions, and / or insertions into a homologous sequence encoding myrcene synthase of SEQ ID NO: 1. In some embodiments, due to the degeneracy of the genetic code, modifications to the isolated nucleic acid molecule may be silenced, and the protein encoded by the variant is identical to the protein encoded by the reference nucleotide sequence. In some embodiments, modifications to the isolated nucleic acid molecule may cause amino acid substitutions in the protein encoded by the variant, compared to the protein encoded by the reference nucleotide sequence.

[0143] In some embodiments where the nucleotide change does not result in an alteration of the amino acid sequence, the change can still lead to improved activity of myrcene synthase, for example, through codon optimization. The codons of the nucleic acid molecule encoding myrcene synthase can be optimized for any selected microbial host cell. In some embodiments, the nucleotide sequence encoding the myrcene synthase is altered to reflect the codon preference of Saccharomyces cerevisiae (see, for example, Bennetzen and Hall (1982) J. Biol. Chem. 257(6):3026-3031). In some implementations, the nucleotide sequence encoding the myrcene synthase is altered to reflect the codon preference of *E. coli* (see, for example, Gouy and Gautier (1982) Nucleic Acids Res. 10(22):7055-7074; Eyre-Walker (1996) Mol. Biol. Evol. 13(6):864-872; Nakamura et al. (2000) Nucleic Acids Res. 28(1):292). Codon optimization for other microbial host cells can be readily determined using codon usage tables or commercially available software such as CodonOp from Integrated DNA Technologies.

[0144] In one embodiment, the present invention provides an isolated nucleic acid molecule comprising the nucleotide sequence shown in SEQ ID NO: 3. The nucleotide sequence of SEQ ID NO: 3 includes different codon optimizations for expression in yeast host cells (e.g., *Saccharomyces cerevisiae*). The nucleotide sequence having SEQ ID NO: 3 is referred to as the 5xObMS variant nucleotide sequence. In some embodiments, when 5xObMS is expressed in genetically modified microbial host cells, as described in the Examples section, it exhibits approximately a 5-fold increase in myrcene synthase activity in a competitive assay compared to 1xObMS (comprising the wild-type basil (*O. basilicum* myrcene synthase nucleic acid molecule of SEQ ID NO: 1, which is not codon-optimized). The codon-optimized nucleotide sequence shown in SEQ ID NO: 3 for yeast host cells is merely exemplary, and other codon-optimized nucleotide sequences for yeast or other microbial host cells can be generated using codon usage tables or codon optimization software.

[0145] In some embodiments, the present invention provides isolated nucleic acid molecules encoding the aforementioned variant of myrcene synthase. For example, the isolated nucleic acid molecule encodes a myrcene synthase variant comprising an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with SEQ ID NO: 2. In some embodiments, the isolated nucleic acid molecule encodes a myrcene synthase variant comprising an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with SEQ ID NO: 2, and comprising at least one variant amino acid residue at one or more positions selected from the group consisting of 27, 28, 207, 213, 222, 342, 347, 381, 382, ​​389, 390, 401, 404, 428, 439, 466, 482, 484, 505, 514, 517, 524, 527, 528, 543, 544, and 552, wherein said positions are numbered with reference to SEQ ID NO: 2. In some implementations, the isolated nucleic acid molecule encoding the myrcene synthase variant is not a naturally occurring nucleic acid molecule.

[0146] In some embodiments, the present invention provides an isolated nucleic acid molecule that hybridizes under stringent conditions to the complementary sequence of SEQ ID NO: 1 and encodes a myrcene synthase variant comprising at least one variant amino acid residue at one or more positions selected from the group consisting of 27, 28, 207, 213, 222, 342, 347, 381, 382, ​​389, 390, 401, 404, 428, 439, 466, 482, 484, 505, 514, 517, 524, 527, 528, 543, 544, and 552, compared to SEQ ID NO: 2, wherein said positions are numbered with reference to SEQ ID NO: 2. In some embodiments, the present invention provides an isolated nucleic acid molecule that hybridizes under stringent conditions to the complementary sequence of SEQ ID NO: 3 and encodes a myrcene synthase variant comprising at least one variant amino acid residue at one or more positions selected from the group consisting of 27, 28, 207, 213, 222, 342, 347, 381, 382, ​​389, 390, 401, 404, 428, 439, 466, 482, 484, 505, 514, 517, 524, 527, 528, 543, 544, and 552, compared to SEQ ID NO: 2, wherein said positions are numbered with reference to SEQ ID NO: 2. As described above, the nucleotide sequence of SEQ ID NO: 3 encodes the amino acid sequence of SEQ ID NO: 2 and is a codon-optimized form of SEQ ID NO: 1 for expression in yeast host cells (e.g., Saccharomyces cerevisiae). In some embodiments, the present invention provides an isolated nucleic acid molecule that hybridizes under stringent conditions to the complementary sequence of SEQ ID NO: 4 and encodes a myrcene synthase variant comprising at least one variant amino acid residue at one or more positions selected from the group consisting of 27, 28, 207, 213, 222, 342, 347, 381, 382, ​​389, 390, 401, 404, 428, 439, 466, 482, 484, 505, 514, 517, 524, 527, 528, 543, 544, and 552, compared to SEQ ID NO: 2, wherein said positions are numbered with reference to SEQ ID NO: 2. The nucleotide sequence of SEQ ID NO: 4 encodes the amino acid sequence of SEQ ID NO: 2 having three amino acid substitutions F381L, I404V, and E528D, wherein said positions are numbered with reference to SEQ ID NO: 2.

[0147] In some embodiments, the present invention provides an isolated nucleic acid molecule encoding a myrcene synthase variant, said myrcene synthase variant comprising an amino acid sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with SEQ ID NO: 2, and ... NO: 2, at least one variant amino acid residue, wherein the at least one variant amino acid residue is selected from H27I, H27C, S28H, I207V, K213C, K213H, K213R, K213V, R222N, C342L, Y347R, F381L, V382L, D389G, D389S, G390D, N401I, N401V, I404V, V428L, Y439L, A466C, A466S, R48 The group consisting of 2C, R482D, R482H, R482I, R482L, R482N, R482V, H484Y, C505I, C505L, C505V, G514L, G514V, S517G, F524L, F524V, V527C, V527F, V527H, V527L, V527N, V527S, V527Y, E528D, M543I, A544S, and Q552R, wherein the positions are numbered according to SEQ ID NO: 2. In some embodiments, the present invention provides isolated nucleic acid molecules that hybridize under stringent conditions to the complementary sequence of SEQ ID NO: 1, 3, or 4 and encode myrcene synthase variants, said myrcene synthase variants comprising the sequence of SEQ ID NO: 1, 3, or 4. NO: 2, at least one variant amino acid residue, wherein the at least one variant amino acid residue is selected from H27I, H27C, S28H, I207V, K213C, K213H, K213R, K213V, R222N, C342L, Y347R, F381L, V382L, D389G, D389S, G390D, N401I, N401V, I404V, V428L, Y439L, A466C, A466S, R4 The group consisting of 82C, R482D, R482H, R482I, R482L, R482N, R482V, H484Y, C505I, C505L, C505V, G514L, G514V, S517G, F524L, F524V, V527C, V527F, V527H, V527L, V527N, V527S, V527Y, E528D, M543I, A544S, and Q552R, wherein the positions are numbered with reference to SEQ ID NO: 2.

[0148] In some embodiments, the present invention provides an isolated nucleic acid molecule encoding a myrcene synthase variant comprising at least one set of variant amino acid residues compared to SEQ ID NO: 2, wherein the at least one set of variant amino acid residues is selected from the group consisting of the following variant amino acid residue groups: (a) F381L, I404V, E528D, and M543I; (b) I404V and E528D; (c) F381L, D389G, I404V, Y439L, and E528D; (d) F381L, E528D, and M543I; (e) F381L, I404V, and E528D; (f) F381L, I404V, E528D, and A544S; and (g) F381L, I404V, E528D, and Q552R, wherein the positions are numbered with reference to SEQ ID NO: 2. In some embodiments, the present invention provides isolated nucleic acid molecules that hybridize under stringent conditions to the complementary sequence of SEQ ID NO: 1, 3, or 4 and encode a myrcene synthase variant, said myrcene synthase variant comprising the sequence of SEQ ID NO: 1, 3, or 4. NO:2, and wherein the at least one group of variant amino acid residues is selected from the group consisting of the following variant amino acid residues: (a) F381L, I404V, E528D, and M543I; (b) I404V and E528D; (c) F381L, D389G, I404V, Y439L, and E528D; (d) F381L, E528D, and M543I; (e) F381L, I404V, and E528D; (f) F381L, I404V, E528D, and A544S; and (g) F381L, I404V, E528D, and Q552R, wherein the positions are numbered with reference to SEQ ID NO:2.

[0149] In some embodiments, isolated nucleic acid molecules encoding myrcene synthase variants can be generated using a nucleotide sequence having SEQ ID NO: 3 (which is codon-optimized) as a background nucleotide sequence to replace specific codons, thereby encoding variant myrcene synthases. For example, SEQ ID NO: 4 is generated by using SEQ ID NO: 3 as a background nucleotide sequence having three codons to replace and encode a myrcene synthase variant containing three variant amino acid residues F381L, I404V, and E528D compared to SEQ ID NO: 2, wherein the positions are numbered with reference to SEQ ID NO: 2. As described in the Examples section, when nucleic acid molecules containing the SEQ ID NO: 4 sequence are expressed in genetically modified microbial host cells, this myrcene synthase variant (also known as 14xObMS) is found to exhibit approximately 14-fold increased myrcene synthase activity compared to genetically modified microbial host cells expressing wild-type myrcene synthase encoded by the nucleic acid sequence containing SEQ ID NO: 1.

[0150] Other myrcene synthase variant nucleic acid molecules can be generated using any suitable genetic engineering techniques known in the art. These techniques include, for example, error-prone PCR, shuffling, oligonucleotide directed mutagenesis, assembly PCR, site-specific mutagenesis, cassette mutagenesis, etc. Furthermore, combinatorial libraries based on saturation mutagenesis can be generated to modify other myrcene synthase variant nucleic acid molecules, thereby improving the in vivo performance of myrcene synthase.

[0151] 6.4 Co-expression of other enzymes used for the biosynthesis of myrcene with myrcene synthase

[0152] On the other hand, the myrcene synthase described in this invention can be co-expressed with other enzymes used for the biosynthesis of myrcene in microbial host cells. In some embodiments, in addition to the heterologous nucleic acid molecule encoding myrcene synthase, the microbial host cell can be genetically modified to include a heterologous nucleic acid molecule encoding one or more enzymes of the MEV pathway. In other embodiments, in addition to the heterologous nucleic acid molecule encoding myrcene synthase, the microbial host cell can be genetically modified to include one or more heterologous nucleic acid molecules encoding one or more enzymes of the DXP pathway. In another embodiment, in addition to the heterologous nucleic acid molecule encoding myrcene synthase, the microbial host cell can be genetically modified to include a heterologous nucleic acid molecule encoding geranyyl pyrophosphate synthase. In yet another embodiment, the microbial host cell can be genetically modified to include any combination of these and other heterologous nucleic acid molecules.

[0153] 6.4.1. Geranyl pyrophosphate synthase

[0154] In some embodiments, the myrcene synthase provided by this invention is co-expressed with geranylide pyrophosphate synthase (GPPS). GPPS is an enzyme that condenses one molecule of isopentenyl pyrophosphate (IPP) with one molecule of dimethylallyl pyrophosphate (DMAPP) to form one molecule of geranylide pyrophosphate (“GPP”). As shown in Figure 1, geranylide pyrophosphate is a precursor of myrcene synthase. Therefore, in some embodiments, a heterologous nucleic acid molecule encoding geranylide pyrophosphate synthase (GPPS) can be introduced together with a heterologous nucleic acid molecule encoding myrcene synthase into a microbial host cell to catalyze the formation of the GPP substrate of said myrcene synthase. In some embodiments, the GPPS nucleotide sequence can be modified (e.g., codon optimization, truncation, mutagenesis, etc.) before co-expressing the GPPS sequence and the myrcene synthase sequence.

[0155] Exemplary examples of nucleotide sequences encoding such GPPS include, but are not limited to: (AF513111; Abies grandis)), (AF513112; AF513112).1. Giant fir), (AF513113; Giant fir), (AY534686; Snapdragon (Antirrhinum majus)), (AY534687; Snapdragon), (AA82860; Snapdragon), (AA82859; Snapdragon), (ACQ90682; Humulus lupulus)), (ACQ90681; Humulus), (Y17376; Arabidopsis thaliana)), (AE016877, locus AP11092; Bacillus cereus; ATCC 14579), (AJ243739; Citrus sinensis)), (AY534745; Clarkia breweri)), (AY953508; Ips pini), (DQ286930; tomato (Lycopersicon esculentum)), (AF182828; peppermint (Mentha x piperita)), (AF182827; peppermint), (MPI249453; peppermint), (PZE431697, locus CAD24425; zeaxanthinifaciens paracoccus), (AY866498; Picrorhiza kurrooa)), (AY351862; grape (Vitis vinifera)), (AF203881, locus AAF12843; Zymomonas mobilis)), (ABS50454; culeolatus streptomyces); (AAR08151; grape), and (JX417185; periwinkle (Catharanthus) roseus), (JX417183; periwinkle), (JX417184; periwinkle), (AEZ55677; salvia miltiorrhiza), (AEZ55681; salvia miltiorrhiza), (AEZ55678; salvia miltiorrhiza), (AFJ52721; mango (Mangifera indica)), (AFJ52722; mango), (GQ369788; Norway spruce (Picea abies)), (EU432047; Norway spruce), (ABY90133; soybean (Glycine max)), (AEL29573; alfalfa (Medicago sativa)), (ABV71395; Phalaenopsis bellina)), and (BAH90987; japonica rice (Oryza sativa subsp. Japonica)). .

[0156] Among many of these known sequences, the inventors have found bacterial geranyl pyrophosphate synthase sequences, such as those derived from *Streptomyces aculeolatus*, to be particularly useful. For example, when co-expressed with the myrcene synthase described in this invention, the codon-optimized *Streptomyces aculeolatus* geranyl pyrophosphate synthase (SaGPPS) exhibits sufficient enzymatic activity in microbial host cells to support normal strain growth and relatively high levels of myrcene production. See, for example, Example 7.8, for comparison with other GPPS sequences for myrcene production. Therefore, in some embodiments, the compositions and methods provided by this invention utilize bacterial geranyl pyrophosphate synthase, particularly SaGPPS, for the production of myrcene in microbial host cells. In one embodiment, SaGPPS comprising the amino acid sequence of SEQ ID NO: 7 or its homologous sequence can be used in the compositions and methods provided by this invention. In another embodiment, a codon-optimized SaGPPS nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 6 can be used in the compositions and methods provided by this invention.

[0157] 6.4.2. MEV pathway enzymes

[0158] In some embodiments, the myrcene synthase provided by the present invention is co-expressed in microbial host cells with one or more heterologous nucleic acid molecules encoding one or more mevalonate pathway enzymes. Figures 1 and 2A illustrate an example of the mevalonate pathway. In some embodiments, this biosynthetic pathway can be used in genetically modified microbial host cells to provide sufficient carbon flux to generate dimethylallyl pyrophosphate (DMAPP) and isopentenyl pyrophosphate (IPP), which can then be used to generate geraniol pyrophosphate and myrcene. Thus, in some embodiments, the genetically modified microbial host cells, containing one or more heterologous nucleic acid molecules encoding one or more enzymes of the mevalonate pathway, produce an increased amount of myrcene compared to unmodified parental cells.

[0159] In some embodiments, the microbial host cell that generates myrcene may be further genetically modified to include a heterologous nucleotide sequence encoding an enzyme (such as acetyl-CoA thiolase) that can condense two molecules of acetyl-CoA to form acetoacetyl-CoA. Exemplary examples of nucleotide sequences encoding such enzymes include, but are not limited to: (NC_000913REGION:2324131.2325315; *Escherichia coli*), (D49362; *Paracoccus denitrificans*), and (L20428; *Saccharomyces cerevisiae*).

[0160] In some embodiments, the myrcene-generating microbial host cell contains a heterologous nucleotide sequence encoding an enzyme (such as HMG-CoA synthase) that can condense acetyl-CoA with another molecule of acetyl-CoA to form 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA). Exemplary examples of nucleotide sequences encoding such enzymes include, but are not limited to: (NC_001145.complement 19061.20536; Saccharomyces cerevisiae), (X96617; Saccharomyces cerevisiae), (X83882; Arabidopsis thaliana), (AB037907; Griseola davidii), (BT007302; Homo sapiens), and (NC_002758, locus marker SAV2546, gene ID 1122571; Staphylococcus aureus).

[0161] In some embodiments, the myrcene-generating microbial host cell contains a heterologous nucleotide sequence encoding an enzyme (such as HMG-CoA reductase) that can convert HMG-CoA to mevalonate. Exemplary examples of nucleotide sequences encoding such enzymes include, but are not limited to: (NM_206548; Drosophila melanogaster), (NC_002758, locus marker SAV2545, gene ID 1122570; Staphylococcus aureus), (NM_204485; Red junglefowl), (AB015627; Streptomyces .KO 3988), (AF542543; Tobacco wild), (AB037907; Griseola cuspidata), (AX128213, providing a sequence encoding a truncated HMGR; Saccharomyces cerevisiae), and (NC_001145: complement 115734.118898; Saccharomyces cerevisiae).

[0162] In some embodiments, the microbial host cell that generates myrcene contains a heterologous nucleotide sequence encoding an enzyme (such as mevalonate kinase) that can convert mevalonic acid to mevalonate 5-phosphate. Exemplary examples of nucleotide sequences encoding such enzymes include, but are not limited to, (L77688; Arabidopsis thaliana) and (X55875; Saccharomyces cerevisiae).

[0163] In some embodiments, the microbial host cell that generates myrcene encodes a heterologous nucleotide sequence of an enzyme (such as phosphate-5-methylvalerate kinase) that can convert mevalonate 5-phosphate to mevalonate 5-pyrophosphate. Exemplary examples of nucleotide sequences encoding such enzymes include, but are not limited to: (AF429385; Rubber tree of Brazil), (NM_006556; Homo sapiens), and (NC_001145.complement 712315.713670; Saccharomyces cerevisiae).

[0164] In some embodiments, the microbial host cell that generates myrcene contains a heterologous nucleotide sequence encoding an enzyme (such as mevalonate pyrophosphate decarboxylase) that can convert mevalonate 5-pyrophosphate to IPP. Exemplary examples of nucleotide sequences encoding such enzymes include, but are not limited to: (X97557; Saccharomyces cerevisiae), (AF290095; Enterococcus faecalis), and (U49260; Homo sapiens).

[0165] In some embodiments, the myrcene-generating microbial host cell contains one or more heterologous nucleotide sequences encoding more than one enzyme in the MEV pathway. In some embodiments, the myrcene-generating microbial host cell contains one or more heterologous nucleotide sequences encoding two enzymes in the MEV pathway. In some embodiments, the myrcene-generating microbial host cell contains one or more heterologous nucleotide sequences encoding an enzyme that converts HMG-CoA to mevalonate and an enzyme that converts mevalonate to mevalonate 5-phosphate. In some embodiments, the myrcene-generating microbial host cell contains one or more heterologous nucleotide sequences encoding three enzymes in the MEV pathway. In some embodiments, the myrcene-generating microbial host cell contains one or more heterologous nucleotide sequences encoding four enzymes in the MEV pathway. In some embodiments, the myrcene-generating microbial host cell contains one or more heterologous nucleotide sequences encoding five enzymes in the MEV pathway. In some embodiments, the myrcene-generating microbial host cell contains one or more heterologous nucleotide sequences encoding six enzymes in the MEV pathway. In some embodiments, the microbial host cell that generates myrcene also contains a heterologous nucleotide sequence encoding an enzyme that converts IPP generated via the MEV pathway into its isomer, dimethylallyl pyrophosphate (“DMAPP”). IPP and DMAPP can be condensed and modified by the action of geranyl pyrophosphate synthase and myrcene synthase to generate myrcene (Figures 1 and 2A).

[0166] 6.4.3. DXP pathway enzymes

[0167] In some embodiments of the method provided by this invention, the microbial host cell that generates myrcene contains one or more heterologous nucleotide sequences encoding one or more enzymes of the DXP pathway, and produces an increased amount of one or more myrcenes compared to an unmodified parent cell. The DXP pathway shown in Figure 2B is an alternative biosynthetic pathway for generating intermediate metabolites (such as DMAPP), which can catalyze the formation of GPP.

[0168] In some embodiments, the microbial host cell that generates myrcene encodes a heterologous nucleotide sequence that enables the condensation of pyruvate with D-glyceraldehyde 3-phosphate to prepare 1-deoxy-D-xylinose-5-phosphate (such as 1-deoxy-D-xylinose-5-phosphate synthase). Exemplary examples of nucleotide sequences encoding this enzyme include, but are not limited to: (AF035440; Escherichia coli), (NC_002947, locus marker PP0527; Pseudomonas putida KT2440), (CP000026, locus marker SPA2301; Salmonella paratyphi A, see ATCC 9150), (NC_007493, locus marker RSP_0254; Rhodopseudomonas 2.4.1), (NC_005296, locus marker RPA0952; Rhodopseudomonas palustris CGA009), (NC_004556, locus marker PD1293; Xylella fastidiosa Temecula1), and (NC_003076, locus marker AT5G11380; Arabidopsis thaliana).

[0169] In some embodiments, the myrcene-generating microbial host cell contains a heterologous nucleotide sequence encoding an enzyme such as 1-deoxy-D-xylitol-5-phosphate reductase, which converts 1-deoxy-D-xylitol-5-phosphate to 2C-methyl-D-erythritol-4-phosphate. Exemplary examples of nucleotide sequences include, but are not limited to: (AB013300; Escherichia coli), (AF148852; Arabidopsis thaliana), (NC_002947, locus marker PP1597; Pseudomonas putida KT2440), (AL939124, locus marker SCO5694; Streptomyces azureae A3(2)), (NC_007493, locus marker RSP_2709; Rhodophyton floccosum 2.4.1), and (NC_007492, locus marker Pfl_1107; Pseudomonas fluorescens PfO-1).

[0170] In some embodiments, the myrcene-generating microbial host cell contains a heterologous nucleotide sequence encoding an enzyme (such as cytidine-2C-methyl-D-erythritol synthase) that can convert 2C-methyl-D-erythritol-4-phosphate to cytidine-2C-methyl-D-erythritol. Exemplary examples of nucleotide sequences include, but are not limited to: (AF230736; *Escherichia coli*), (NC_007493, locus marker RSP_2835; *Rhodophyta 2.4.1*), (NC_003071, locus marker AT2G02500; *Arabidopsis thaliana*), and (NC_002947, locus marker PP1614; *Pseudomonas putida* KT2440).

[0171] In some embodiments, the myrcene-producing microbial host cell contains a heterologous nucleotide sequence encoding an enzyme such as cytidine-2C-methyl-D-erythritol kinase, which converts cytidine-2C-methyl-D-erythritol to cytidine-2C-methyl-D-erythritol-2-phosphate. Exemplary examples of nucleotide sequences include, but are not limited to: (AF216300; *Escherichia coli*) and (NC_007493, locus marker RSP_1779; *Rhodotorula glutinis* 2.4.1).

[0172] In some embodiments, the myrcene-producing microbial host cell contains a heterologous nucleotide sequence encoding an enzyme such as 2C-methyl-D-erythritol 2,4-cyclic diphosphate synthase, which converts cytidine-2C-methyl-D-erythritol-2-phosphate to 2C-methyl-D-erythritol 2,4-cyclic diphosphate. Exemplary examples of nucleotide sequences include, but are not limited to: (AF230738; *Escherichia coli*), (NC_007493, locus marker RSP_6071; *Rhodophyton floccosum* 2.4.1), and (NC_002947, locus marker PP1618; *Pseudomonas putida* KT2440).

[0173] In some embodiments, the myrcene-producing microbial host cell contains a heterologous nucleotide sequence encoding an enzyme such as 1-hydroxy-2-methyl-2-(E)-butenyl-4-bisphosphate synthase, which converts 2C-methyl-D-erythritol 2,4-cyclic diphosphate to 1-hydroxy-2-methyl-2-(E)-butenyl-4-bisphosphate. Exemplary examples of nucleotide sequences include, but are not limited to: (AY033515; *Escherichia coli*), (NC_002947, locus marker PP0853; *Pseudomonas putida* KT2440), and (NC_007493, locus marker RSP_2982; *Rhodotorula glutinis* 2.4.1).

[0174] In some embodiments, the microbial host cell that generates myrcene contains a heterologous nucleotide sequence encoding an enzyme (such as isopentenyl / dimethylallyl diphosphate synthase) that can convert 1-hydroxy-2-methyl-2-(E)-butenyl-4-bisphosphate to IPP or its isomer DMAPP. Exemplary examples of nucleotide sequences include, but are not limited to: (AY062212; *Escherichia coli*) and (NC_002947, locus marker PP0606; *Pseudomonas putida* KT2440).

[0175] In some embodiments, the myrcene-generating microbial host cell contains one or more heterologous nucleotide sequences encoding more than one enzyme in the DXP pathway. In some embodiments, the myrcene-generating microbial host cell contains one or more heterologous nucleotide sequences encoding two enzymes in the DXP pathway. In some embodiments, the myrcene-generating microbial host cell contains one or more heterologous nucleotide sequences encoding three enzymes in the DXP pathway. In some embodiments, the myrcene-generating microbial host cell contains one or more heterologous nucleotide sequences encoding four enzymes in the DXP pathway. In some embodiments, the myrcene-generating microbial host cell contains one or more heterologous nucleotide sequences encoding five enzymes in the DXP pathway. In some embodiments, the myrcene-generating microbial host cell contains one or more heterologous nucleotide sequences encoding six enzymes in the DXP pathway. In some embodiments, the myrcene-generating microbial host cell contains one or more heterologous nucleotide sequences encoding seven enzymes in the DXP pathway.

[0176] In some embodiments, the microbial host cell that generates myrcene also contains a heterologous nucleotide sequence encoding an enzyme (such as an IPP isomerase) that can convert IPP generated via the MEV pathway into DMAPP. Exemplary examples of nucleotide sequences encoding such enzymes include, but are not limited to: (NC_000913, 3031087, 3031635; *Escherichia coli*), and (AF082326; *Haematococcus pluvialis*).

[0177] In some implementations, crosstalk (or interference) between the host microbial cell's own metabolic processes and the processes involved in IPP generation is minimized or completely eliminated. For example, when the host microorganism relies entirely on the DXP pathway for IPP synthesis and the MEV pathway is introduced to provide additional IPP, crosstalk is minimized or completely eliminated. This host organism will not have the ability to alter the expression of MEV pathway enzymes or process MEV pathway-related intermediates. Organisms that rely entirely or primarily on the DXP pathway include, for example, *Escherichia coli*.

[0178] In some embodiments, the microbial host cell generates IPPs solely or in combination with the DXP pathway via the MEV pathway. In other embodiments, the host's DXP pathway is functionally disabled, such that the host cell generates IPPs solely via the heterologously introduced MEV pathway. The DXP pathway can be functionally disabled by inactivating gene expression or by inactivating one or more DXP pathway enzymes.

[0179] 6.4.4. Modification of other enzymes used in the biosynthesis of myrcene and identification of other useful homologous enzymes.

[0180] The above description illustrates examples of specific biosynthetic enzymes and genes useful in methods and compositions according to certain embodiments; however, it will be recognized that absolute identity with such enzymes and genes is not necessary. For example, the sequences of known biosynthetic pathway enzymes can be modified by substitution, insertion, and deletion. In some embodiments, such changes include conserved amino acid mutations and silencing mutations. In other embodiments, the nucleotide sequences encoding other biosynthetic pathway enzymes can be modified to reflect the codon preferences of a specific host cell regarding the myrcene synthase sequence as described above. Using preferred codons for a specific host cell generally increases the likelihood of the nucleotide sequence being translated and thus expressed. Furthermore, any gene encoding the above-described enzymes (or any other gene mentioned in this invention or any regulatory element controlling or regulating its expression) can be optimized using genetic / protein engineering techniques such as directed evolution and / or rational mutagenesis. For example, the activity of an enzyme in a host can be altered in a variety of ways, including, but not limited to, expressing a higher or lower K+ expression for the substrate. cat Or lower or higher K m Modified forms of enzymes, or altered forms of enzymes whose expression is more or less affected by feedback or feedforward regulation from another molecule in the pathway. Specific gene or polynucleotide alterations containing sequences encoding enzymes can be performed using methods known in the art, and the expression or activity of functional enzymes can be screened.

[0181] Furthermore, the genes encoding these enzymes can be identified from other fungi, bacteria, plants, or other species, and can be expressed to regulate this biosynthetic pathway. Various organisms can serve as sources of these enzymes, including but not limited to: *Saccharomyces cerevisiae* and *Saccharomyces uvarum*, *Kluyveromyces* spp. including *Kluyveromyces thermomotolerans*, *Kluyveromyces lactis*, and *Kluyveromyces marxianus*, *Pichia* spp., *Hansenula* spp. including *H. polymorpha*, *Candida* spp., *Trichosporon* spp., *Yamadazyma* spp. including *Y. spp. Stipitis*, *Torulaspora pretoriensis*, *Issatchenkia orientalis*, and *SchizoSaccharomyces*. *S.* spp. include *S. pombe*, *Cryptococcus* spp., *Aspergillus* spp., *Neurospora* spp., or *Ustilago* spp. Genetic sources from anaerobic fungi include, but are not limited to, *Piromycess* spp., *Orpinomyces* spp., or *Neocallimastix* spp. Useful sources of prokaryotic enzymes include, but are not limited to, *Escherichia coli*, *Zymomonas mobilis*, *Staphylococcus aureus*, *Bacillus* spp., *Clostridium* spp., *Corynebacterium* spp., *Pseudomonas* spp., *Lactococcus* spp., *Enterobacters* spp., and *Salmonella* spp. In some embodiments, the sequences encoding enzymes in biosynthetic pathways may be obtained from plant species.These include, but are not limited to, Norway spruce (Picea abies), soybean (Glycine max), alfalfa (Medicago sativa), Phalaenopsis bellina, Salvia miltiorrhiza, and mango (Mangifera indica).

[0182] Techniques known to those skilled in the art are suitable for identifying other homologous genes and homologous enzymes. Typically, homologous genes and / or homologous enzymes can be identified through functional analysis and exhibit functional similarity. Techniques known to those skilled in the art are suitable for identifying similar gene enzymes. For example, to identify homologous GGPS genes, proteins, or enzymes, techniques may include, but are not limited to, PCR cloning of the gene using primers based on publicly available GPPS gene / enzyme sequences, or amplification of conserved regions in the GPPS gene via degenerate PCR using designed degenerate primers. Furthermore, techniques skilled in the art can be used to identify homologous genes, proteins, or enzymes that have functional homology or similarity. Techniques include detecting the catalytic activity of the enzyme in cells or cell cultures by an in vitro enzyme assay for said activity (e.g., as described in this invention or in Kiritani, K., Branched-Chain Amino Acids Methods Enzymology, 1970), followed by purification to isolate the enzyme having said activity. The protein sequence of the enzyme can be determined using techniques such as Edman degradation; PCR primers targeting possible nucleic acid sequences can be designed; the DNA sequence can be amplified by PCR; and the nucleic acid sequence can be cloned. To identify homologous or similar genes and / or homologous or similar enzymes, the technique also includes comparing relevant data on candidate genes or enzymes with databases such as BRENDA, KEGG, or MetaCYC. The candidate genes or enzymes can be identified in the aforementioned databases.

[0183] 6.5 Preparation of nucleic acid molecules, constructs and expression vectors

[0184] The nucleic acid molecules described in this invention can be prepared using various conventional recombination techniques and synthetic methods. In short, the nucleic acid molecules can be prepared from genomic DNA fragments, cDNA, and RNA. All genomic DNA fragments, cDNA, and RNA can be extracted directly from cells or generated through various amplification methods, including but not limited to PCR and rt-PCR recombination. These and other recombination techniques are described, for example, in Sambrook et al., 2001, *Molecular Cloning – A Laboratory Manual*, 3rd edition, Cold Spring Harbor Laboratories, Cold Spring Harbor, NY, and Ausubel et al., eds. Current Edition, *Current Protocols in Molecular Biology*, Greene Publishing Associates and Wiley Interscience, NY.

[0185] Direct chemical synthesis of nucleic acid molecules typically involves the sequential addition of 3'-blocking and 5'-blocking nucleotide monomers to the terminal 5'-hydroxyl group of a growing nucleotide polymer chain, wherein each addition is performed via nucleophilic attack on the terminal 5'-hydroxyl group of the growing chain at the 3' position of the added monomer. The additions are typically phosphorus derivatives, such as triphosphates, phosphoramides, etc. Such methods are known to those skilled in the art and are documented in relevant texts and literature (e.g., Matteudiet al. (1980) Tet. Lett. 521:719; U.S. Patent No. 4,500,707 to Caruthers et al.; and U.S. Patent Nos. 5,436,327 and 5,700,637 to Southern et al.).

[0186] In addition, nucleic acid molecules can be customized from a variety of commercial sources. These include, for example, Twist Bioscience (San Francisco, CA), Biomatik (Wilmington, DE), Genescript (Piscatavir, NJ), and GeneArt gene synthesis services available at www.introgen.com.

[0187] Furthermore, the present invention provides a nucleic acid construct comprising a segregated nucleic acid molecule operatively linked to one or more control sequences, said control sequences directing the expression of the coding sequence in a suitable microbial host cell under conditions compatible with said control sequences. The control sequences may include any suitable promoter sequence, transcriptional terminal sequence, polyadenylation sequence, etc. In some embodiments, these control sequences may be any nucleotide sequence regulating transcriptional activity in a selected microbial host cell and may be obtained from genes encoding one or more enzymes in a biosynthetic pathway homologous or heterologous to that of the microbial host cell.

[0188] Various control sequences for expression in microbial host cells are well known in the art. For example, useful promoters for expression in yeast host cells may be derived from genes homologous to the transformed microbial host cell and / or native genes that generate the host. In some embodiments, the promoter operatively linked to the nucleic acid molecule is inducible. In other embodiments, the promoter operatively linked to the nucleic acid molecule encoding the coding sequence is constitutive. In some embodiments, one or more nucleic acid sequences are operatively linked to an inducible promoter, and one or more other nucleic acid sequences are operatively linked to a constitutive promoter. Exemplary examples of promoters suitable for yeast cells include, but are not limited to, the promoter of the TEF1 gene of *Kluyveromyces lactis*, the promoter of the PGK1 gene of *Saccharomyces cerevisiae*, the promoter of the TDH3 gene of *Saccharomyces cerevisiae*, repressive promoters such as the promoter of the CTR3 gene of *Saccharomyces cerevisiae*, and inducible promoters such as galactose-inducible promoters of *Saccharomyces cerevisiae* (e.g., promoters of the GAL1, GAL2, GAL7, and GAL10 genes). Additional promoters and other control sequences for microbial host cells are documented, for example, in Romanos et al., 1992, Yeast8:423-488; Bitter et al., 1987, Methods in Enzymology, 153:516-544; and Maximizing Gene Expression, ed. Reznikoff and Gold, 2014, Elsevier.

[0189] The present invention also provides a vector comprising a nucleic acid construct containing a nucleic acid molecule encoding an enzyme of a biosynthetic pathway, including myrcene synthase, which catalyzes the formation of myrcene and other monoterpenoid compounds. Vectors for transforming suitable microbial host cells are well known in the art. In some embodiments, the vector contains control sequences for transcription and translation that guide related genes, selection markers, and sequences that allow autonomous replication or chromosomal integration. Suitable vectors contain a 5' region of a coding sequence having a transcription initiation control and a 3' region of a coding sequence controlling transcription termination.

[0190] The vector can be any vector suitable for expressing the enzyme. Expression vectors for expressing nucleotide sequences encoding polypeptides include viral vectors (e.g., retroviral, adenoviral, and adeno-associated virus), plasmid vectors, and granules. Exemplary examples of expression vectors suitable for yeast cells include, but are not limited to, CEN / ARS and 2μ plasmids. The choice of vector will depend on the compatibility of the vector with the microbial host cell into which it is to be introduced and the final application of the host cell. In some embodiments, the vector can be a chromosome integration construct that further includes elements that allow the vector to integrate into the host cell genome. In other embodiments, the vector can be an expression vector that replicates autonomously and exists extrachromosomally within the host cell. Vectors suitable for microbial host cells are described, for example, in “Cloning Vectors for Introducing Genes into Host Cells,” The ABCs of Gene Cloning, 2006, pp. 93-124, Springer US. Protein Expression, a Practical Approach, Higgins and Hames, Oxford University Press, 1999. Vectors suitable for microbial host cells are also available commercially from various sources, such as Life Technologies, Sigma-Aldrich, and New England BioLabs.

[0191] The methods for connecting the above-mentioned elements to construct the recombinant expression vector or chromosome integration construct are well known to those skilled in the art (see, for example, Sambrook et al., 1989, ibid.).

[0192] 6.6 Genetically Modified Microbial Host Cells

[0193] This invention provides genetically modified microbial host cells that generate heterologous myrcene. Heterologous nucleic acid molecules encoding myrcene synthase, gerany pyrophosphate synthase, and / or other biosynthetic pathway enzymes can be introduced into the microbial host cells using any suitable vector described herein and known in the art. Methods for genetically modifying microorganisms in host cells using expression vectors or chromosome constructs are well known in the art. See, for example, Sherman, F., et al., Methods Yeast Genetics, Cold Spring Harbor Laboratory, NY (1978); Guthrie, C., et al. (Eds.) Guide To Yeast Genetics and Molecular Biology Vol. 194, Academic Press, San Diego (1991); Sambrook et al., 2001, Molecular Cloning—A Laboratory Manual, 3 rd The published literature cited in this paper is incorporated herein by reference in the editions of Cold Spring Harbor Laboratory, Cold Spring Harbor, NY; and Ausubel et al., eds., Current Edition, Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley Interscience, NY.

[0194] Exemplary techniques for host cell transformation include, but are not limited to, protoplastization, electroporation, PEG 1000-mediated transformation, and lithium acetate or lithium chloride-mediated transformation. Furthermore, heterologous nucleic acid molecules can be integrated into selected sites in the host genome using any suitable technique. For example, specific genomic sites can be induced by site-specific nucleases (e.g., zinc finger nucleases, homing endonucleases, transcription activator-like effector nucleases, CRISPR / Cas systems) to induce targeted mutagenesis, induce targeted deletion of cellular DNA sequences, and promote targeted recombination of heterologous nucleic acid molecules within the targeted genomic site. See, for example, U.S. Patent No. 8,685,737; and Horwitz et al. (2015), Cell Systems 1,1-9, U.S. Patent Publications Nos. 20030232410, 20050208489, 20050026157, 20050064474, and 20060188987, and WO 2007 / 014275, all of which are incorporated herein by reference in their entirety for all purposes.

[0195] In some embodiments, the microbial host cell may further contain genetic modifications (e.g., insertion, deletion, or modification of nucleic acids) to provide the desired effect of increasing intracellular levels of geranium pyrophosphate or myrcene-generating geranium pyrophosphate expressing the myrcene synthase described in this invention. For example, endogenous farnesyl pyrophosphate synthase in the host genome may be functionally disrupted to increase carbon flow to the production of geranium pyrophosphate precursors and myrcene.

[0196] Furthermore, the copy number of one or more biosynthetic enzymes in the host cell can be altered by modifying the transcription of the gene encoding the enzyme. This can be achieved, for example, by modifying the copy number of the nucleotide sequence encoding the enzyme, for example by using an expression vector containing a higher or lower copy number of the nucleotide sequence, or by introducing additional copies of the nucleotide sequence into the host cell genome. For instance, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more copies of the myrcene synthase gene can be chromosomally integrated into the genome of the microbial host cell. In another embodiment, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more copies of the geranium pyrophosphate synthase gene can be chromosomally integrated into the genome of the microbial host cell. In some embodiments, the copy number of the myrcene synthase gene and the geranium pyrophosphate synthase gene can be modulated relative to each other to increase carbon flow to myrcene production. In some embodiments, the copy number of the myrcene synthase gene integrated into the microbial host cell genome is equal to or greater than the copy number of the geranium pyrophosphate gene integrated into the microbial host cell genome.

[0197] Furthermore, the suppression or reduction of gene expression levels that lead to increased myrcene production in host cells can be achieved through deletion or disruption of nucleotide sequences in the host cell genome, mutation, and / or gene recombination. Antisense RNA, siRNA, miRNA, ribozymes, triple-stranded DNA, trans-acting DNA-binding proteins such as TAL effectors or CRISPR-guided Cas9, and transcriptional and / or translational repressors can also be used. Additionally, transposons can be used to disrupt gene expression, for example, by inserting them between a promoter and a coding region or between two adjacent genes to inactivate one or both genes. Other modifications may include altering the order of the coding sequence on the polycistronic mRNA of an operon or breaking the operon into individual genes, each with its own control elements, or by increasing the strength of a promoter or operon operatively linked to a nucleotide sequence. In some forms, the gene or coding sequence may be replaced by a selection marker or a selectable marker. Various methods for introducing the above-described genetic modifications are well known in the art and include other mechanisms such as homologous recombination. See, for example, Green et al., Molecular Cloning: A Laboratory Manual, 4th ed., Cold Spring Harbor Laboratory Press (2012) and Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd ed., Cold Spring Harbor Laboratory Press (2001).

[0198] Optionally or additionally, the copy number of an enzyme in a host cell can be altered by modifying the translational level of the mRNA encoding the enzyme. This can be achieved, for example, by modifying the stability of the mRNA, modifying the sequence of the ribosome binding site, modifying the distance or sequence between the ribosome binding site and the start codon of the enzyme coding sequence, modifying the entire cistron region upstream or near the 5' side of the start codon in the enzyme coding region, using hairpins and specialized sequences to stabilize the 3' end of the mRNA transcript, etc.

[0199] Genetic modification of microbial host cells is not limited to the specific modifications described in this invention. Other suitable means for genetically modifying microbial host cells, which will be apparent to those skilled in the art, are also within the scope of this invention and can be used to increase the production of myrcene by increasing carbon flow through biosynthetic pathways.

[0200] 6.6.1. Microbial host cells

[0201] The microbial host cells that can be used in the methods and compositions provided by this invention include any cells capable of naturally or recombinantly generating myrcene. In some embodiments, the cell is a prokaryotic cell. In some embodiments, the cell is a bacterial cell. In some embodiments, the cell is an *Escherichia coli* cell. In some embodiments, the cell is a eukaryotic cell. In some embodiments, the cell is a single-celled eukaryotic cell. In some embodiments, the cell is a yeast cell. In some embodiments, the cell is a *Saccharomyces cerevisiae* cell.

[0202] In some embodiments, the cells are hyphae bacterial cells. In some embodiments, the hyphae bacterial cells belong to the genus Actinomycetes. In specific implementation schemes, the mycelial bacterial cells belong to the genus *Streptomyces*, such as *Streptomyces ambofaciens*, *Streptomyces avermitilis*, *Streptomyces azureus*, *Streptomyces cinnamonensis*, *Streptomyces coelicolor*, *Streptomyces curacoi*, *Streptomyces erythraeus*, *Streptomyces fradiae*, *Streptomyces galilaeus*, *Streptomyces glaucescens*, *Streptomyces hygroscopicus*, *Streptomyces lividans*, and *Streptomyces microsporum*. Streptomyces parvulus, Streptomyces peucetius, Streptomyces rimosus, Streptomyces roseofulvus, Streptomyces thermotolerans, and Streptomyces violaceoruber.

[0203] In another embodiment, the microbial host cell is a fungal cell. In a more specific embodiment, the cell is a yeast cell. Yeasts that can be used in the methods and compositions provided by this invention include those preserved in microbial libraries (e.g., IFO, ATCC, etc.) and belonging to the genera *Aciculoconidium*, *Ambrosiozyma*, *Arthroascus*, *Arxiozyma*, *Ashbya*, *Babjevia*, *Bensingtonia*, *Botryoascus*, *Botryozyma*, *Brettanomyces*, *Bullera*, and *Blettanomyces*. *Bulleromyces*, *Candida*, *Citeromyces*, *Clavispora*, *Cryptococcus*, *Cystofilobasidium*, *Debaryomyces*, *Dekkara*, *Dipodascopsis*, *Dipodascus*, *Eeniella*, *Endomycopsella*, *Eremascus*, *Eremascus* *Mothecium*, *Erythrobasidium*, *Fellomyces*, *Filobasidium*, *Galactomyces*, *Geotrichum*, *Guilliermondella*, *Hanseniaspora*, *Hansenula*, *Hasegawaea*, *Holtermannia*, *Hormoascus*, *Hyphopichia*, *Issamyces* *Kloeckera*, *Kloeckeraspora*, *Kluyveromyces*, *Kondoa*, *Kuraishia*, *Kurtzmanomyces*, *Leucosporidium*, *Lipomyces*, *Lodderomyces*, *Malassezia*, *Metschnikowia*, *Mrakia*, *Myxozyma**Nadsonia*, *Nakazawaea*, *Nematospora*, *Ogataea*, *Oosporidium*, *Pachysolen*, *Phachytichospora*, *Phaffia*, *Pichia*, *Rhodosporidium*, *Rhodotorula*, *Saccharomyces*, *Sacch* *Saccharomycopsis*, *Saitoella*, *Sakaguchia*, *Saturnospora*, *Schizoblastosporion*, *SchizoSaccharomyces*, *Schwanniomyces*, *Sporidiobolus*, *Sporobolomyces*, *Sporop* The genera *Achydermia*, *Stephanoascus*, *Sterigmatomyces*, *Sterigmatosporidium*, *Symbiotaphrina*, *Sympodiomyces*, *Sympodiomycopsis*, *Torulaspora*, *Trichosporiella*, *Trichosporon*, *Trigonopsis*, *Tsuchiyaea*, *Udeniomyces*, *Waltomyces*, *Wickerhamia*, *Wickerhamiella*, *Williopsis*, *Yamadazyma*, *Yarrowia*, *Zygoascus*, *ZygoSaccharomyces*, *Zygowilliopsis*, and *Zygozyma*, etc. ,

[0204] In specific embodiments, the yeasts useful in the methods and compositions provided by the present invention include Saccharomyces cerevisiae, Pichia pastoris, SchizoSaccharomyces pombe, Dekkera bruxellensis, Kluyveromyces lactis (formerly known as lactic acid yeast), Kluyveromyces marxianus, Arxula adeninivorans, or Pichia angusta (now known as Pichia angusta). In some embodiments, the microorganism is a strain of the genus Candida, such as Candida lipolytica, Candida guilliermondii, Candida krusei, Candida pseudotropicalis, or Candida utilis.

[0205] In a specific embodiment, the cell is a *Saccharomyces cerevisiae* cell. In some embodiments, the strain of the *Saccharomyces cerevisiae* cell is selected from the group consisting of *Baker's yeast*, CBS 7959, CBS 7960, CBS 7961, CBS 7962, CBS 7963, CBS 7964, IZ-1904, TA, BG-1, CR-1, SA-1, M-26, Y-904, PE-2, PE-5, VR-1, BR-1, BR-2, ME-2, VR-2, MA-3, MA-4, CAT-1, CB-1, NR-1, BT-1, and AL-1. In some embodiments, the strain of the *Saccharomyces cerevisiae* is selected from the group consisting of PE-2, CAT-1, VR-1, BG-1, CR-1, and SA-1. In a specific embodiment, the strain of the *Saccharomyces cerevisiae* is PE-2. In another specific embodiment, the strain of the *Saccharomyces cerevisiae* is CAT-1. In another specific embodiment, the strain of the brewing yeast is BG-1.

[0206] In some embodiments, the cell is a haploid microbial cell. In other embodiments, the cell is a diploid microbial cell. In some embodiments, the cell is heterozygous. In other embodiments, the cell is homozygous except for its mating type allele (i.e., if the cell is to form spores, the resulting four haploid microbial cells are genetically identical except for their mating type allele, wherein in two haploid cells it will be mating type a, and in the other two haploid cells it will be mating type α).

[0207] In some embodiments, the cells are cells adapted for industrial fermentation. In specific embodiments, the cells are adapted to survive in high solvent concentrations, high temperatures, expanded substrate utilization, nutrient limitations, oxygen limitations, osmotic pressure, acidity, sulfite and bacterial contamination, or combinations thereof, all of which are recognized stress conditions in industrial fermentation environments. In specific embodiments, the cells are adapted to survive at high myrcene concentrations.

[0208] 6.7 Fermentation composition and the formation of myrcene

[0209] On the other hand, the present invention provides a fermentation composition generated from genetically modified microbial host cells and a method for generating myrcene. Fermentation is carried out by culturing genetically modified microbial host cells in a carbon-source-containing medium under suitable culture conditions for a period of time, sufficient to generate the desired host cell biomass and / or the desired amount of myrcene.

[0210] In some embodiments, the fermentation process is carried out in two phases: a build-up phase and a generation phase. The build-up phase lasts for a period sufficient to generate a sufficient amount of cell biomass to support the generation of myrcene during the generation phase. The build-up phase lasts for a period sufficient to allow the cell population present at inoculation to undergo multiple doublings until the desired cell density is reached. In some embodiments, the build-up phase lasts for a period sufficient to allow the host cell population in the fermenter or fermentation vessel in which the build-up phase is carried out to reach a cell density (OD) between 0.01 and 400. 600 In some implementations, the construction phase is performed until an OD of at least 0.01 is achieved. 600 In some implementations, the construction phase is carried out until an OD of at least about 0.1 is reached. 600 In some implementations, the construction phase is carried out until an OD of at least approximately 1.0 is reached. 600 In some implementations, the construction phase is carried out until at least about 10 OD is reached. 600 In some implementations, the construction phase is carried out until at least 100 OD is achieved. 600In some implementations, the build phase is performed until an OD between 0.01 and 100 is reached. 600 In some implementations, the build phase is performed until an OD between 0.1 and 10 is reached. 600 In some implementations, the construction phase is carried out until an OD between 1 and 100 is reached. 600 In other implementations, the construction phase lasts for at least 12, 24, 36, 48, 60, 72, 84, 96 hours or more.

[0211] In some embodiments, the generation phase lasts for a period of time sufficient to generate the desired amount of myrcene. In some embodiments, the generation phase lasts for at least 12, 24, 36, 48, 60, 72, 84, 96 hours, or more than 96 hours. In some embodiments, the generation phase lasts for a period between 3 and 20 days. In some embodiments, the generation phase lasts for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 days, or more than 20 days.

[0212] In specific embodiments, the method for generating myrcene includes fermentation of genetically modified host cells under aerobic conditions sufficient to allow the genetically modified host cells to grow and be maintained; followed by providing microaerobic fermentation conditions sufficient to induce the generation of myrcene (and other monoterpene byproducts), and maintaining these microaerobic conditions throughout the fermentation process. In some embodiments, an inducer is added during the generation phase to activate the promoter or alleviate the inhibition of transcriptional regulatory factors, thereby promoting the generation of myrcene and other monoterpene byproducts.

[0213] In another embodiment, the method for generating myrcene includes culturing microbial host cells in separate construction and generation media. For example, the method may include culturing genetically modified microbial host cells during a construction phase, wherein the cells are cultured under non-generation conditions (e.g., non-induction conditions) to generate an inoculum, and then transferring the inoculum to a second fermentation medium under conditions suitable for inducing myrcene generation (e.g., induction conditions), and maintaining steady-state conditions during the second fermentation phase to generate a cell culture containing myrcene.

[0214] 6.7.1. Culture medium and culture conditions

[0215] The culture media and conditions used for the maintenance and growth of microbial cultures are well known to those skilled in the art of microbiology or fermentation science (see, for example, Bailey et al., Biochemical Engineering Fundamentals, second edition, McGraw Hill, New York, 1986). Appropriate culture media, pH values, temperatures, and aerobic, microaerobic, or anaerobic conditions are selected based on the specific requirements of the microbial host cell, fermentation, and process.

[0216] In some embodiments, the culture medium used in the method for generating myrcene provided by the present invention includes any culture medium in which genetically modified microorganisms capable of generating monoterpenoids can survive, i.e., support and maintain growth and viability. In some embodiments, the culture medium also promotes the biosynthetic pathways necessary for the generation of the desired monoterpenoids (especially myrcene).

[0217] In some embodiments, the culture medium is an aqueous medium containing assimilable carbon, nitrogen, and phosphate sources. Such media may also include suitable salts, minerals, metals, and other nutrients. In some embodiments, the carbon source and each essential cellular nutrient are added incrementally or continuously to the fermentation medium, and each required nutrient is maintained at a minimum level necessary for substantially efficient assimilation by allowing cells to grow, for example, according to a predetermined cell growth curve based on the metabolic or respiratory function of cells converting carbon sources into biomass.

[0218] In some embodiments, the carbon source is a monosaccharide (simple sugar), a disaccharide, a polysaccharide, a non-fermentable carbon source, or one or more combinations thereof. Non-limiting examples of suitable monosaccharides include glucose, galactose, mannose, fructose, ribose, and combinations thereof. Non-limiting examples of suitable disaccharides include sucrose, lactose, maltose, trehalose, cellobiose, and combinations thereof. Non-limiting examples of suitable polysaccharides include starch, glycogen, cellulose, chitin, and combinations thereof. Non-limiting examples of suitable non-fermentable carbon sources include acetate and glycerol. In some embodiments, the carbon source may be derived from a variety of crops and sources. Some non-limiting examples of suitable crops or sources include sugarcane, bagasse, miscanthus, sugar beets, sorghum, switchgrass, barley, hemp, kenaf, potato, sweet potato, cassava, sunflower, fruit, molasses, whey or skim milk, corn, straw, cereals, wheat, wood, paper, rice straw, cotton, many types of cellulose waste, and other biomass. In some embodiments, suitable crops or sources include sugarcane, sugar beets, and corn. In other embodiments, the sugar source is sugarcane juice or molasses. In some embodiments, any combination of the above-mentioned carbon sources may be used.

[0219] In some implementations, the suitable culture medium is supplemented with one or more additional agents, such as inducers (e.g., when one or more nucleotide sequences encoding a gene product are under the control of an inducible promoter), repressors (e.g., when one or more nucleotide sequences encoding a gene product are under the control of a repressive promoter), or selectors (e.g., antibiotics that select for microorganisms containing genetic modifications).

[0220] In some embodiments, a liquid organic capping layer may be added to the culture medium during the fermentation build-up phase. In some embodiments, the liquid organic capping layer is an immiscible organic liquid in contact with the aqueous culture medium, and myrcene and other byproducts secreted by the microorganisms can be captured in the liquid organic capping layer. The liquid organic capping layer can reduce the evaporation of volatile monoterpenoids from the fermentation vessel and reduce the potential toxicity of myrcene to the microorganisms. Examples of capping layers include, but are not limited to, isopropyl myristate (IPM) or other hydrocarbon liquids such as white mineral oils or polyalphaolefins.

[0221] Fermentation methods can be carried out in suitable vessels or containers, including but not limited to cell culture plates, flasks, or fermenters. In some embodiments, the fermentation is carried out in a closed system to capture monoterpenoid compounds in the gas phase. For example, the closed system may include a series of containers connected to each other to capture exhaust gases containing monoterpenoid compounds in the gas phase. For example, a first container may contain a culture medium containing an aqueous medium and genetically modified microorganisms. A second container containing an organic coating may be connected in series with the first container to capture volatile monoterpenoid compounds. In some embodiments, one or more additional containers may be connected in series and / or in parallel with the first container to capture a gaseous composition containing myrcene and other monoterpenoid byproducts.

[0222] Furthermore, the method can be carried out at any fermentation scale known in the art to support the industrial production of microbial products. Any suitable fermenter can be used, including stirred tank fermenters, air-lift fermenters, foam fermenters, or any combination thereof. In a specific embodiment utilizing *Saccharomyces cerevisiae* as the host cell, the strain can be grown in a fermenter, as detailed in Kosalic, et al., in Ullmann's Encyclopedia of Industrial Chemistry, Sixth Edition, Volume 12, pages 398-473, Wiley-VCH Verlag GmbH & Co. KDaA, Weinheim, Germany. Moreover, the method can be carried out at any fermentation volume, from laboratory scale (e.g., 10 ml to 20 L) to pilot-scale (e.g., 20 L to 500 L) to industrial scale (e.g., 500 L to ≥500,000 L).

[0223] Further details relating to culture conditions and fermentation methods suitable for certain embodiments are available in U.S. Patent Nos. 8,603,800, 7,659,097, and WO2007 / 139924, all of which are incorporated herein by reference in their entirety for all purposes.

[0224] 6.7.2. Fermentation Composition

[0225] On the other hand, the present invention provides a fermentation composition comprising a genetically modified microbial host cell as described in the present invention, a culture medium, and a monoterpene compound generated by the genetically modified microbial host cell. In the fermentation composition provided by the present invention, the monoterpene compound comprises myrcene as a major component and one or more byproducts as minor components (which are generated simultaneously with myrcene). In some embodiments, the monoterpene compound in the fermentation composition comprises at least about 85% myrcene and less than about 15% monoterpene byproducts (excluding geraniol) based on the relative area percentage of the monoterpene peaks in the GC chromatogram of the monoterpene compound, compared to the total amount of monoterpene product in the culture medium. In some embodiments, the fermentation composition comprises at least about 88% to about 93% myrcene compared to the total amount of monoterpene product in the culture medium.

[0226] In some embodiments, the fermentation composition comprises a number of different byproducts catalyzed by myrcene synthases in vivo in genetically modified microbial host cells. For example, the fermentation composition may contain 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 monoterpenoid byproducts as minor components. In some embodiments, as shown in FIG. 3B, the fermentation composition comprises 4-terpineol as one of the monoterpenoid byproducts generated simultaneously with myrcene. In contrast, other myrcene synthases (e.g., those obtained from holly oak (QiMS)) do not generate 4-terpineol, see, for example, FIG. 3A. In some embodiments, the fermentation composition of the present invention also comprises γ-terpinene and α-terpinene, which are not generated by other myrcene synthases. See, for example, FIG. 3A. In other embodiments, the minor byproducts may further comprise sapinene, limonene, β-ocimene, and / or β-linalool. In other embodiments, the minor byproducts may further comprise α-thujene, (E)-hydrated juniperene, and / or (Z)-hydrated juniperene. In a specific embodiment, the fermentation composition comprises myrcene as a major component and γ-terpinene, α-terpinene, juniperene, limonene, β-ocimene, β-linalool, and / or 4-terpineol as minor components. In a specific embodiment, the fermentation composition comprises myrcene as a major component and γ-terpinene, α-terpinene, juniperene, limonene, β-ocimene, β-linalool, α-thujene, (E)-hydrated juniperene, and (Z)-hydrated juniperene, and / or 4-terpineol as minor components.

[0227] In some embodiments, each of the monoterpene byproducts is generated simultaneously with myrcene at a detectable level by GC-FID or GC-MS, but in a small, detectable amount relative to myrcene. In some embodiments, each monoterpene byproduct is present in the fermentation composition at an amount greater than 0.1% but less than about 5% of the total amount of monoterpene compounds, based on the relative area percentage of monoterpene compounds in GC-MS. In some embodiments, monoterpene byproducts are present in the fermentation composition at an amount greater than 0.5% but less than 4% of the total amount of monoterpene compounds, based on the relative area percentage of monoterpene compounds in GC-MS chromatograms. In some embodiments, monoterpene byproducts are present in the fermentation composition at an amount greater than 1% but less than 3% of the total amount of monoterpene compounds, based on the relative area of ​​monoterpene compounds in GC-MS chromatograms.

[0228] In a specific embodiment, the fermentation composition comprises about 89.09% to about 92.01% myrcene, based on the relative area percentage of the monoterpenoids in a GC-MS chromatogram, compared to the total amount of monoterpenoids. In a specific embodiment, the fermentation composition further comprises at least about 0.65% to 0.90% α-terpinene, based on the relative area percentage of the monoterpenoids in a GC-MS chromatogram, compared to the total amount of monoterpenoids. In a specific embodiment, the fermentation composition further comprises at least about 1.00% to about 1.06% γ-terpinene, based on the relative area percentage of the monoterpenoids in a GC-MS chromatogram, compared to the total amount of monoterpenoids. In a specific embodiment, the fermentation composition further comprises at least about 2.32% to about 2.42% 4-terpineol, based on the relative area percentage of the monoterpenoids in a GC-MS chromatogram, compared to the total amount of monoterpenoids. In a specific embodiment, the fermentation composition further comprises at least about 0.80% to about 0.98% juniperene, compared to the total amount of monoterpenoids. In a specific embodiment, the fermentation composition further comprises at least about 0.54% to about 1.01% limonene, based on the relative area percentage of the monoterpenoids in the GC-MS chromatogram, compared to the total amount of monoterpenoids. In a specific embodiment, the fermentation composition further comprises about 0.91% to about 0.21% β-ocimene, based on the relative area percentage of the monoterpenoids in the GC-MS chromatogram, compared to the total amount of monoterpenoids. In a specific embodiment, the fermentation composition further comprises about 0.76% to about 1.17% β-linalool, compared to the total amount of monoterpenoids. In a specific embodiment, the fermentation composition further comprises about 0% to about 0.51% α-thujone, based on the relative area of ​​the monoterpenoids in the GC-MS chromatogram, compared to the total amount of monoterpenoids. In a specific embodiment, the fermentation composition further comprises about 0.54% to about 1% (E)-hydrated halogen, based on the relative area percentage of the monoterpenoids in the GC-MS chromatogram, compared to the total amount of monoterpenoids. In a specific embodiment, the fermentation composition further comprises about 0.98% to about 1.13% (Z)-hydrated halogen, based on the relative area of ​​the monoterpenoids in the GC-MS chromatogram, compared to the total amount of monoterpenoids.

[0229] Many myrcene synthase variants derived from basil (Ocimum basilicum) exhibit monoterpene product distribution characteristics substantially similar to those of wild-type basil myrcene synthase and maintain high levels of myrcene production. Basil myrcene synthases and their variants are particularly useful in certain embodiments because they are able to produce myrcene at relatively high titers during fermentation in genetically modified microbial host cells. Furthermore, as mentioned above, when expressed in genetically modified microbial host cells, the wild-type basil (Ocimum basilicum) and its variants provided by this invention produce unique monoterpene product distribution characteristics that are distinguishable from those produced by myrcene synthases derived from other organisms. For example, the myrcene synthases described in this invention, when expressed in genetically modified microbial host cells, produce one or more α-terpinene and γ-terpinene as monoterpene byproducts along with myrcene. In contrast, these byproducts are not produced along with myrcene by other myrcene synthases, such as holly oak myrcene synthase. Therefore, monoterpenoids generated from the myrcene synthase sequence provided by this invention have unique molecular fingerprints that cannot be assigned by myrcene synthase sequences derived from other organisms.

[0230] In some embodiments, the myrcene is generated in an amount greater than about 1 gram per liter of fermentation medium. In some embodiments, the myrcene is generated in an amount greater than about 5 grams per liter of fermentation medium. In some embodiments, the myrcene is generated in an amount greater than about 10 grams per liter of fermentation medium. In some embodiments, the myrcene is generated in an amount from about 10 to about 200 grams per liter of fermentation medium, or in an amount from about 10 to about 100 grams per liter of fermentation medium. In some embodiments, the myrcene is generated in an amount greater than about 10 grams, greater than about 20 grams, greater than about 25 grams, or greater than about 30 grams per liter of fermentation medium.

[0231] In some embodiments, the myrcene is produced in an amount greater than about 1 mg per gram of stem cells. In some embodiments, the myrcene is produced in an amount greater than about 10 mg per gram of stem cells. In some embodiments, the myrcene is produced in an amount greater than about 50 mg per gram of stem cells. In some embodiments, the myrcene is produced in an amount greater than about 50 mg per gram of stem cells. In some embodiments, the myrcene is produced in amounts from about 50 to about 1500 mg, greater than about 100 mg, greater than about 150 mg, greater than about 200 mg, greater than about 250 mg, greater than about 500 mg, greater than about 750 mg, or greater than about 1000 mg per gram of stem cells.

[0232] In some embodiments, the amount of myrcene produced is at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 2 times, at least about 2.5 times, at least about 5 times, at least about 10 times, at least about 20 times, at least about 30 times, at least about 40 times, at least about 50 times, at least about 75 times, at least about 100 times, at least about 200 times, at least about 300 times, at least about 400 times, at least about 500 times, or at least about 1000 times or more higher than the amount of myrcene produced by a microbial host cell that does not contain a heterologous nucleic acid molecule encoding myrcene synthase, based on a unit volume of cell culture.

[0233] In some embodiments, the amount of myrcene produced is at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 2 times, at least about 2.5 times, at least about 5 times, at least about 10 times, at least about 20 times, at least about 30 times, at least about 40 times, at least about 50 times, at least about 75 times, at least about 100 times, at least about 200 times, at least about 300 times, at least about 400 times, at least about 500 times, or at least about 1000 times or more higher than the amount of myrcene produced by a microbial host cell that does not contain a heterologous nucleic acid molecule encoding myrcene synthase, based on the weight of one unit of stem cell.

[0234] In some embodiments, the amount of myrcene produced is at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 2 times, at least about 2.5 times, at least about 5 times, at least about 10 times, at least about 20 times, at least about 30 times, at least about 40 times, at least about 50 times, at least about 75 times, at least about 100 times, at least about 200 times, at least about 300 times, at least about 400 times, at least about 500 times, or at least about 1000 times or more higher than the amount of myrcene produced by a microbial host cell that does not contain a heterologous nucleic acid molecule encoding myrcene synthase, based on a unit volume of cell culture per unit time.

[0235] In some embodiments, the amount of myrcene produced is at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 2 times, at least about 2.5 times, at least about 5 times, at least about 10 times, at least about 20 times, at least about 30 times, at least about 40 times, at least about 50 times, at least about 75 times, at least about 100 times, at least about 200 times, at least about 300 times, at least about 400 times, at least about 500 times, or at least about 1000 times or more higher than the amount of myrcene produced by a microbial host cell that does not contain a heterologous nucleic acid molecule encoding myrcene synthase, based on the weight of a unit of stem cell per unit time.

[0236] 6.7.3. Recovery of Myrcene

[0237] Monoterpenoids, including myrcene, generated by the genetically modified microbial host cells described in this invention can be isolated from the fermentation composition using any suitable isolation and purification method known in the art. In some embodiments, the monoterpenoids are secreted into the culture medium and can spontaneously form a liquid organic phase, such as an emulsion phase, separate from the aqueous phase of the culture medium. In some embodiments, the secreted monoterpenoids can be partitioned into an organic capping layer added to the culture medium. In some embodiments, the secreted monoterpenoids can evaporate from the culture medium and can be captured as a gaseous composition in the headspace of the container. In some embodiments, the monoterpenoids can be recovered from the cellular components of the genetically modified microbial host cells. The monoterpenoids in each phase can be recovered using techniques known in the art. For example,

[0238] The generation and recycling techniques described in WO2007 / 139924 are incorporated herein by reference in their entirety.

[0239] In some embodiments, the liquid organic phase containing myrcene can be separated from the fermentation medium by centrifugation. In other embodiments, the liquid organic phase containing myrcene can be spontaneously separated from fermentation. In other embodiments, the liquid organic phase containing myrcene is separated from fermentation by adding a demulsifier and / or a nucleating agent to the fermentation reaction. Exemplary examples of demulsifiers include flocculants and coagulants. Exemplary examples of nucleating agents include droplets of myrcene itself and organic solvents such as dodecane, isopropyl myristate, methyl oleate, mineral oil, polyalphaolefins, etc. In some embodiments, the genetically modified microbial host cells can be cultured in a generating medium having an organic phase capping layer (e.g., a 10% or 50% capping layer of isopropyl myristate) to facilitate recovery.

[0240] In some embodiments, the myrcene can be separated from other products that may be present in the organic phase. In some embodiments, separation can be achieved using adsorption, distillation, gas-liquid extraction (stripping), liquid-liquid extraction (solvent extraction), ultrafiltration, and standard chromatography techniques.

[0241] Myrcene produced by host cells can be recovered using any of a variety of methods, including but not limited to chromatography, extraction, solvent extraction, membrane separation, electrodialysis, reverse osmosis, distillation, chemical derivatization, and crystallization.

[0242] Other processing steps to improve the quantification or separation of myrcene include, but are not limited to, breaking down host cells. Suitable methods include, but are not limited to, vortexing, sonication, homogenization, and the use of glass beads. Other processing steps may include centrifugation to remove unwanted cellular debris from the supernatant.

[0243] The generation of myrcene can be readily quantified using methods known in the art, including but not limited to gas chromatography (GC), gas chromatography-mass spectrometry (GC / MS), nuclear magnetic resonance (NMR), Raman spectroscopy, optical absorption spectrometry (UV / VIS), infrared spectroscopy (IR), high-performance liquid chromatography (HPLC), liquid chromatography-mass spectrometry (LC / MS), ion chromatography-mass spectrometry, thin-layer chromatography, pulsed amperometric detection, and ultraviolet-visible spectrophotometry.

[0244] In some embodiments, the myrcene is pure, for example, at least about 40% pure, at least about 50% pure, at least about 60% pure, at least about 70% pure, at least about 80% pure, at least about 90% pure, at least about 95% pure, at least about 98% pure, or more than 98% pure, wherein, in the context of myrcene, "pure" means myrcene free from other terpenoid compounds or contaminants.

[0245] 7. Example

[0246] 7.1 Construction of nucleic acid constructs and plasmids

[0247] This embodiment describes a method for preparing nucleic acid constructs and plasmids that can be used for the generation and characterization of myrcene synthase variants.

[0248] A high-copy plasmid (2μ / leu2d plasmid) was used to express myrcene synthase from different organisms. The 2μ / leu2d plasmid is described in Erhart and Hollenberg, J. Bacteriol. 1983, 156(2): 625–635.

[0249] Plasmid pAM11613 was used for competitive assays of layer I mutagenesis and has the nucleotide sequence of SEQ ID NO: 33. In addition to the yeast vector backbone, plasmid pAM11613 has the following as major components: pUC origin (bp 3218 to 2551); CYC1 terminator (bp 3595 to 3405); trichodiene synthase (“TDS”; bp 4729 to 3605); Gal1 / 10 promoter (bp 5403 to 4737); limonene synthase form A from lemon (“LMSvA”; bp 5414 to 7096); ADH1 terminator (bp 7262 to 7098); and Leu2d (bp 8107 to 9198).

[0250] Plasmid pAM11614 was used for competitive assay analysis of ObMS mutant combinatorial libraries and has the nucleotide sequence of SEQ ID NO: 34. In addition to the yeast vector backbone, plasmid pAM11614 has the following as major elements: pUC origin (bp 2551 to 3218); CYC1 terminator (bp 3405 to 3595); trichodiene synthase (“TDS”; bp 3605 to 4729); Gal1 / 10 promoter (bp 4737 to 5403); limonene synthase form B from lemon (“LMSvB”; bp 5414 to 7099); ADH1 terminator (bp 7101 to 7265); and Leu2d (bp 8110 to 9201).

[0251] Plasmid pAM2947 contains an F-CphI gene operatively linked to the pTDH3 promoter, kanmx4 marker, and Cen-ARS. The nucleotide sequence of plasmid pAM2947 is shown in SEQ ID NO: 35.

[0252] 7.2 Microbial host strain

[0253] This embodiment describes a method for preparing yeast strains for the generation and characterization of myrcene synthase variants.

[0254] Yeast strain Y13203, derived from the wild-type Saccharomyces cerevisiae strain (CEN.PK2), was used to express and screen for myrcene synthases from various organisms. This strain overexpresses the mevalonate pathway genes (acetyl-CoA thiolysis, HMG-CoA synthase, HMG-CoA reductase, mevalonate kinase, phosphate mevalonate kinase, mevalonate pyrophosphate decarboxylase, and IPP isomerase genes) from Saccharomyces cerevisiae via chromosomal integration under the control of the GAL promoter. Further information regarding the chromosomal integration of the mevalonate pathway genes and IPP isomerase and their sequences can be found in U.S. Patent Nos. 8,221,982 and 8,859,261, the entire contents of which are incorporated herein by reference. The strain can also be engineered to downregulate ERG20 gene expression by operably linking ERG20 to the promoter pCTR3 (Labbe and Thiele, Methods of Enzymology, vol. 306, pages 145-153).

[0255] Yeast strain Y21605 is derived from wild-type Saccharomyces cerevisiae strain (CEN.PK2). This strain is derived from strain Y13203. The strain contains ObMS nucleic acid (SEQ ID NO: 3) operably linked to promoters Pgal1 and AgGPPS (SEQ ID NO: 8), and the ObMS nucleic acid is operably linked to promoter Pgal10 on a 2 μ / leu2d plasmid. The strain also contains mevalonate pathway genes (acetyl-CoA thiolysis, HMG-CoA synthase, HMG-CoA reductase, mevalonate kinase, phosphate mevalonate kinase, mevalonate pyrophosphate decarboxylase, and IPP isomerase genes) integrated into the chromosome of Saccharomyces cerevisiae under the control of the GAL promoter. The strain can also be programmed to downregulate ERG20 gene expression by operably linking ERG20 to promoter pCTR3.

[0256] Myrcene screening host strain Y21704 was used to screen GPPS from various organisms. This strain is derived from strain Y13203 and further contains an ObMS nucleic acid sequence labeled with GB1 expression operably linked to the promoter Pgal1 on the leu2d plasmid. The GB1 expression label is as described in Chen and Patel, Biochem. Biophys. Res. Comm. 317(2):401-405 (2004).

[0257] Yeast strain Y10566 was used in a competitive assay against plasmids pAM11613 and pAM11614. This strain is derived from the wild-type Saccharomyces cerevisiae strain (CEN.PK2). The strain contains the aforementioned nucleic acid of strain Y13203 and further contains two copies of the AgGPPS gene (SEQ ID NO: 8).

[0258] Yeast strain X100 was used to express 1xObM, 5xObM, and 14xObMS nucleic acids and their myrcene titers were compared. This strain was derived from the wild-type Saccharomyces cerevisiae strain (CEN.PK2). The strain contained the aforementioned nucleic acids of Y13023 and further contained two copies of SaGPPS (SEQ ID NO: 7) operatively linked to the pGAL1 promoter, ERG20 operatively linked to the pMAL1 promoter, and a landing pad for myrcene synthase nucleic acid.

[0259] 7.3 Cell density measurement

[0260] This embodiment describes a method for determining the cell density of a microbial culture.

[0261] The amount or density of microorganisms per liter of fermentation material can be determined by measuring the weight of microorganisms isolated from a given volume of fermentation medium. The density is the dry weight of cells per liter of fermentation medium. Another method for monitoring fermentation is by measuring the optical density of the medium. A common method is to measure the optical density at a wavelength of 600 nm, expressed as OD. 600 Alternatively, OD can be used as a reference. The OD may be correlated with the density of a specific type of organism in a specific culture medium, but the specific relationship between OD and microbial biomass per unit volume may not generally apply to all types of organisms in all types of culture media. Calibration curves can be created by measuring OD and stem cell weight at a range of cell densities. In some cases, these correlations can be used for different fermentations of the same or similar microorganisms in the same or similar culture media.

[0262] Determining the cell density (OD) of yeast cell cultures 600 An exemplary method is shown below. 8 μL of cell culture sample was combined with 92 μL of Triton OD diluent (20 g / L Triton X-114, 200 mL / L PEG 200, 200 mL / L 100% ethanol, the remainder being water) in a clear 96-well plate. After stirring the solution at 1,000 RPM for 6 minutes, the absorbance at 600 nm was measured using an M5 spectrophotometer (Molecular Devices, Sunnyvale, CA, Canada) to determine the OD. 600 value.

[0263] 7.4 Determination of the proportion and potency of myrcene in a mixture of monoterpenoids by GC method

[0264] This example describes an exemplary gas chromatography (GC)-based method for determining the area % product purity and myrcene potency of yeast cell cultures.

[0265] The area % product distribution characteristic purity of samples containing myrcene was determined using gas chromatography-mass spectrometry (GC-FID) with flame ionization detection. The parameters of the GC-FID method are listed in Table 1A. The area % product distribution characteristic purity is a purity metric, where % purity is the area due to myrcene, expressed as a percentage of the total area of ​​monoterpenoid compounds, and is a measure of the product distribution characteristic purity of a specific enzyme.

[0266] Table 1A. GC-FID parameters used to obtain the area % product distribution characteristics and purity of myrcene in the sample.

[0267] Column box Initial temperature (°C) 40.0 Initial hold (min) 8.0 Rate 1 (°C / min) 5.0 Temperature 1 (°C) 150.0 Final time 1 (min) 30.0 Rate 2 (°C / min) 50.0 Final temperature (°C) 320 Final time: 2 (min) 31.4 Rate 3 (°C / min) 0.0 Final temperature (°C) 320 Final time: 3 minutes 36.4 Rate 4 (°C / min) closure Running time (min) 36.4

[0268] column Agilent HP-1 size 50m x 0.20mm, 0.11μm membrane

[0269] The retention time window for monoterpenes (C10) on GC-FID chromatography was defined as between 10.0 and 23.0 minutes. As determined by testing terpene standards and GC-MS analysis of the synthase product (with molecular ion 136), no monoterpenes showed elution before 10.0 minutes or after 23 minutes. Furthermore, any unknown peaks observed in the analyzed samples, if detected in a negative control, were excluded as non-terpenes. The negative control was a strain possessing non-functional myrcene synthase.

[0270] To determine the myrcene potency, a GC-FID with an LTM column was used in conjunction with external standard calibration. The GC-FID parameters used to determine the amount of myrcene are listed in Table 1B. The external standard calibration was prepared on a volumetric-weight basis. Known amounts of myrcene were diluted in ethyl acetate to prepare serially diluted solutions of 10–200 mg / L, which were used to calibrate the instrument.

[0271] Table 1B. GC-FID parameters used to obtain myrcene content

[0272] 7.5 Headspace analysis to determine myrcene potency

[0273] This example describes an exemplary method for myrcene in the gas phase of the headspace of a quantitative well plate.

[0274] For a competitive assay where both the myrcene synthase variant and the control enzyme ((R)-limonene synthase) sequence are cloned on the same plasmid, headspace analysis was used to quantify myrcene and limonene. The strain was grown in sealed 2.2 mL 96-well plates, and the volatile myrcene and limonene present in the headspace were analyzed by headspace gas chromatography / flame ionization detection (GC / FID). The GC / FID system consisted of an Agilent 7890 gas chromatograph with an FID detector and a Gerstel MPS autosampler. 100 μL of headspace gas was injected into the GC, using hydrogen as the carrier gas, and the sample was separated using an Agilent HP-5 P / N 1909J413 column (7 m x 0.200 mm, 0.33 μm membrane). The GC column oven temperature was set to 55 °C. To quantify myrcene, calibration standards with known concentrations of myrcene and / or limonene were prepared in the IPM coating, then filled into 2.2 ml plates, sealed, and run in parallel with the samples.

[0275] 7.6 Screening for wild-type myrcene synthase genes from different species

[0276] This example describes the screening of wild-type myrcene synthase genes from several different species to select myrcene synthase genes suitable for expression in yeast cells.

[0277] A number of myrcene synthase genes from different organisms, which have been biochemically characterized or presumed to be myrcene synthases in the literature, were selected to screen for suitable myrcene synthase genes for heterologous expression in yeast host cells. As shown in Table 2 below, these genes include those obtained from Norway spruce (Martin et al. (2004) Plant Physiol. 135, 1908-1927); giant fir (Bohlmann et al. (1997) JBC 272, 21784); basil (Irijima et al. (2004) Plant physiol. 136, 3724-3736); holly oak (Fischbach et al. (2001) Eur. J. Biochem. 268, 5633-5638); snapdragon (Dudareva et al. (2003) Plant Cell 15, 1227-124); Peruvian lily (Aros et al. (2012) J. Exp. Botany 63, 2739-2752); and medicago truncatula. The nucleotide sequences can also be obtained from NCBI GenBank.

[0278] For each gene, using software provided by Integrated DNA Technologies (Coralville, IA) (http: / / www.idtdna.com / CodonOpt), *Saccharomyces cerevisiae* was selected as the codon organism, and two different codon-optimized sequences were designed according to a standard protocol. Two examples of the codon-optimized sequences are shown as SEQ ID NO: 3 (*Ocimum basilicum* myrcene synthase) and SEQ ID NO: 36 (*Quercus ilex* myrcene synthase). Testing was performed on *Saccharomyces cerevisiae* strain Y13203, which possesses myrcene synthase nucleic acid and AgGPPS nucleic acid expressed on the high-copy plasmid 2μ / leu2d (SEQ ID: 6; codon-optimized).

[0279] Strains containing different myrcene synthase genes were picked from colonies on agar plates and placed in 2 ml of 2% sucrose Bird Seed Media (BSM, originally described in van Hoek et al., Biotechnology and Bioengineering 68(5), 2000, pp. 517-523) in Falcon centrifuge tubes and incubated with shaking at 30°C for 24 hours. The strain variants were then subcultured to 0.08 OD in 125 ml baffled flasks containing 10 ml of 4% galactose BSM and 125 μM CuSO4 as a top dressing. 600 Sampling can be performed at 24, 48, or 72 hours as needed. Myrcene potency is determined by diluting 100 μl IPM of the sample taken at the desired time point in 900 μl of ethyl acetate in a glass GC vial. The sample is vortexed and analyzed by gas chromatography (GC) as described in Example 7.4. Cell density is determined by diluting 100 μl of liquid culture medium in 900 μl of sterile water in a cuvette at OD values. 600 The determination was performed at the specified location. The cuvette was vortexed, and the OD was measured using a spectrophotometer. 600 Cell density at that location.

[0280] Table 2. Myrcene production from various strains containing different myrcene synthase genes is shown below:

[0281]

[0282] As summarized in Table 2, the preferred myrcene synthases are ObMS (~1 g / L), QiMS (200 mg / L), and PaMS (50 mg / L), from which myrcene production was observed. Other myrcene synthases shown in Table 2 produce inactive or low-activity myrcene synthases. Two of them (MtMS1 and MtMS2) do not produce myrcene, indicating that they may not be myrcene synthases. When the amino acid sequence of ObMS is aligned with the other myrcene synthase sequences in Table 2, the ObMS amino acid sequence shares less than 50% identity with the other myrcene synthase amino acid sequences (analysis according to Clone Manager Suite, method: FastScan-Max Qual(Cons N)).

[0283] As described in Example 7.4, GC-MS and GC-FID analyses were used to analyze the monoterpenoids produced by host strains expressing ObMS, QiMS, and PaMS. The results showed that QiMS and PaMS appeared to produce a comparable or higher proportion of myrcene in the monoterpenoid mixture than ObMS (i.e., myrcene purity distribution characteristics). However, as shown in Table 2, ObMS expressed in genetically modified microbial host cells produced at least five times more myrcene than the other myrcene producer (i.e., QiMS) after 72 hours of culture. Low levels of geraniol were observed, but it was not included as an impurity in the calculation of myrcene purity, as it is likely produced by hydrolysis in yeast that is independent of myrcene synthase.

[0284] Figure 3A shows a comparison of GC-FID traces of myrcene and other byproducts generated by yeast host cells containing ObMS (middle trace) and QiMS (bottom trace). As the differences between the two traces indicate, each myrcene synthase exhibits a distinct product distribution profile. Specifically, the ObMS trace indicates that monoterpenes generated by genetically modified microbial host cells expressing ObMS include α-terpinene, γ-terpinene, and 4-terpineol, none of which are present in monoterpenes generated by yeast cells expressing QiMS. Numerous samples containing yeast host cells exhibiting other myrcene synthases were analyzed by GC-FID. Similar to QiMS, other myrcene synthases do not generate α-terpinene, γ-terpinene, 4-terpineol, or other monoterpenoid byproducts.

[0285] 7.7 Distribution characteristics of monoterpenoid products generated by myrcene synthase from basil (Ocimum basilicum)

[0286] In this example, the distribution characteristics of monoterpene products in ObMS, as determined by GC-MS analysis, are described in detail.

[0287] The Y21605 strain containing ObMS nucleic acid (SEQ ID NO: 3) was pre-cultured for 2 days in Falcon centrifuge tubes containing 2 ml BSM 2% sucrose medium and incubated with shaking at 30°C. For production, the strain was grown for 96 hours at 30°C in a 125 ml unbaffled shake flask containing 10 ml BSM 4% galactose and 125 μM CuSO4, with 10 ml IPM as a capping layer. 1 ml of IPM was sampled from the capping layer and precipitated by downward rotation to remove all present biomass. 500 μl of the clarified IPM was diluted twice in 500 μl of ethyl acetate in a GC vial and analyzed by GC-MS using an Agilent 7890 gas chromatograph equipped with mass spectrometer.

[0288] As shown below, GC-MS was used to analyze the sample. An HP-1, 50m x 0.2mm x 0.11µm column was used for myrcene analysis. In short, 1µl or 3µl of sample (approximately 0.5g / L) was injected onto the column, and the following temperature gradient was applied: hold at 40°C for 8 minutes; ramp to 150°C at a rate of 5°C / min; then hold at a slope of 120°C to 320°C for 5 minutes to bake the column. Helium was used as the carrier gas at a flow rate of 1.5mL / min. The inlet was set to 250°C, and the split ratio was 10:1. The MS source was set to 230°C, and the MS quadrupole was set to 15°C. The solvent delay was set to 4 minutes, and the EMV mode gain factor was 15.

[0289] Data were analyzed using the Kovats Retention Index (KI) and compound MS traces via NIST 2009 and Wiley 9th Edition Libraries, with proposed attributions given in Table 3. KI is a relative retention value based on a scale defined by a series of n-alkane elutions and calculated using the following equation:

[0290] For temperature-programmed chromatography, Kovacs ( Kovats The exponent is given by the following equation.

[0291]

[0292] in:

[0293] I = Kovacs ( Kovats Retention index,

[0294] n = the number of carbon atoms in a smaller n-alkanes

[0295] N = the number of carbon atoms in a relatively large n-alkane.

[0296] t r= Retention time.

[0297] The available true standards for the compounds provisionally identified by library matching were analyzed to determine the deterministic conformations for peak assignment, as summarized in Table 3. See also Figure 4 for the molecular structures of the compounds associated with peak assignment.

[0298] Table 3 shows the calculated KI index values ​​for selected peaks at MW 136 (C10 terpenes) and 154 (C10 terpene alcohols). Matching compounds were selected from the NIST library based on fragmentation patterns and KI. "?" indicates a provisional assignment due to a lower library score.

[0299]

[0300] Table 4 shows the KI values ​​of the test standards and the corresponding values ​​of the peaks detected in the analytical samples. Test standards were selected based on the results in Table 3.

[0301]

[0302]

[0303] Table 5 shows the area % purity for analysis of myrcene samples injected at 3 μl and 1 μl, respectively (i.e., relative monoterpenoids in the sample composition based on area %). For area % calculation, the areas of all peaks with MW136 (C10 terpenes) and MW154 (C10 terpenols) were added to 100% (assuming all compounds had the same signal response). Peaks with an area percentage less than 0.5% were excluded, and the area % of the remaining compounds was recalculated.

[0304]

[0305] GC-MS analysis of the ObMS myrcene sample extracted from the fermentation broth of Y21605 revealed six other C10 terpenes and four C10 terpene alcohols as minor components, in addition to myrcene. See Figure 3B. The major impurity among the minor byproducts was 4-terpineol, comprising approximately 2.3%. In Figure 3B, peak 1 represents thujone; peak 2 represents sapinene; peak 3 represents myrcene; peak 4 represents α-terpinene; peak 5 represents limonene; peak 6 represents ocimene; peak 7 represents γ-terpinene; peak 8 represents (E)-hydrated sapinene; peak 9 represents (Z)-hydrated sapinene; peak 10 represents β-linalool; and peak 11 represents 4-terpineol. The molecular structures of all ten byproducts are shown in Figure 4. The relative area % of each byproduct was measured at two different injection volumes of the sample, with higher injection volumes yielding higher impurity levels (Table 5). Based on the peak area, the purity of myrcene was determined again to be 89-92%, consistent with the previous results. GC-MS analysis of other samples derived from host cells genetically modified with the myrcene synthase variants described in Examples 7.9 to 7.11 below showed substantially similar levels of myrcene purity and other byproduct peaks, as shown in Figure 3B (data not shown).

[0306] 7.8 Screening wild-type geranylide pyrophosphate synthase genes from various organisms for co-expression with myrcene synthase

[0307] This embodiment describes the screening of wild-type geranyl pyrophosphate synthase genes from various organisms to select geranyl pyrophosphate genes suitable for co-expression with myrcene synthase in yeast host cells.

[0308] Several GPPSs, including homodimers and heterodimers, were selected for screening. See Table 6 below. For each gene, using software provided by Integrated DNA Technologies (Coralville, IA) (http: / / www.idtdna.com / CodonOpt), *Saccharomyces cerevisiae* was selected as the codon organism, and two different codon-optimized sequences were designed according to a standard protocol. For initial testing, each sequence was cloned into yeast strain Y13203, which expressed ObMS on the high-copy plasmid 2μ / leu2d, via single-copy integration. In these strains, myrcene production (determined by GC) depended on GPPS activity; more active GPPS converted more carbon from sugar to higher levels of GPP for ObMS, resulting in a higher myrcene titer. Several strains were also constructed using (R)-limonene synthase (ClLMS from lemon) (an enzyme with higher activity than ObMS in yeast), and limonene production was compared to myrcene production to help diagnose whether myrcene synthase had limitations.

[0309] Previous experiments using AgGPPS showed that a single copy of AgGPPS is insufficient to support the growth of normal strains and only supports low levels of myrcene production (data not shown). Therefore, it is unclear whether integrating a single copy of GPPS will provide sufficient activity for this screening purpose prior to screening. However, the single-copy integration method may allow for faster and more definitive identification of the most active GPPS than plasmid-based methods, where weaker GPPS are compensated for by higher copy numbers. Indeed, while strains containing AgGPPS grow poorly and produce relatively low amounts of myrcene, homodimeric bacterial GPPS, *Streptomyces aculeolatus*, was found to support robust strain growth, as shown in Table 6.

[0310] Table 6. Summary of GPPS screening results. Activity is defined as the amount of strain growth in a plate in which GPPS has been integrated into a single copy.

[0311]

[0312]

[0313] Myrcene production was also determined in strain Y21704. Myrcene screening of host strain Y21704 containing Pgal1-driven ObMS on the leu2d plasmid failed to reach maximum OD under culture conditions when galactose was induced with 125 μM CuSO4 in the absence of functional GPPS. 600 Thus, nonfunctional GPPS variants were identified by the absence of growth of their host strains in a 96-well plate model. Strain variants, each containing GPPS genes from different organisms, were picked from single colonies on agar plates and incubated in 96-well plates containing 360 μl of 2% sucrose BSM with shaking at 30°C for 24 hours. For generation, 6 μl per well was then subcultured into new 96-well plates containing 360 μl of 4% galactose BSM and incubated in 30°C with shaking for 72 hours. OD was obtained at 72 hours. 600 The samples were measured, and the functional GPPS variants were determined by forward growth. The amount of myrcene generated from the subset of functional GPPS variants integrated into Y21704 was tested in a 125 ml baffled shake flask as described in Example 7.6. The samples were analyzed using the GC analysis method described in Example 7.4.

[0314] Figure 5 shows a comparison of myrcene production using two types of GPPS: SaGPPS and AgGPPS. The codon-optimized nucleotide sequence of SaGPPS is shown as SEQ ID NO: 6. The codon-optimized nucleic acid sequence of AgGPPS is shown as SEQ ID NO: 8. As shown in Figure 5, the bacterial GPPS derived from *Streptomyces aculelatus* supports at least a three-fold increase in myrcene production compared to AgGPPS derived from the plant species. Therefore, bacterial SaGPPS was selected as the GPPS co-expressed with ObMS in other experiments.

[0315] 7.9 Generation of Myrcene Synthase Variants - Layer I Mutagenesis

[0316] This embodiment describes a method and competitive assay for generating a library of myrcene synthase variants to rank the myrcene synthase activity relative to the parental sequence for each variant.

[0317] In the competitive assay, each variant sequence was cloned into plasmid pAM11613. The control enzyme, (R)-limonene synthase (CILSvA) from lemon, was also expressed on the same plasmid as the tested myrcene synthase variant, and both synthases competed for the same substrate (GPP) in the microbial host cell to produce myrcene and limonene, respectively. Strains containing the competing plasmid co-produced myrcene and limonene, and the ratio of myrcene to limonene was used as a reading of the relative activities of these enzymes for different myrcene synthase variants. Myrcene synthase variants were identified by their superior performance against their parent in competitively opposing limonene synthase to convert GPP to myrcene rather than limonene (i.e., a higher myrcene to limonene ratio than their parent).

[0318] To design the mutagenic library, protein sequence alignments were established between ObMS and several other terpene synthases. Residue "hotspots" from which beneficial mutations were generated in those terpene synthases were identified, along with proposed active site residues covering the alignments. Potential hotspots for ObMS were predicted and ranked by importance based on the conservation of the region or residue, the size of previously identified hits, and the number of synthases to which the residue was found to be beneficial. A total of 47 hotspots were selected.

[0319] A saturated mutagenesis library was constructed at each of the 47 amino acid positions using NDT degenerate codons, resulting in changes to 12 possible amino acids at those positions. Site-directed mutagenesis libraries were created using polymerase chain reaction (PCR) mutagenesis as templates, employing wild-type myrcene synthase sequences encoding ObMS. Mutations were introduced using degenerate NDT codons to convert residues at the identified positions from their wild-type amino acid sequences to 12 possible amino acid sequences (Phe, Leu, Ile, Val, Tyr, His, Asn, Asp, Cys, Arg, Ser, Gly). The internal degenerate primers and flanking primer sequences used to introduce mutations at residue positions 213, 381, 389, 404, 439, 484, 482, 528, and 543 are listed in Table 7.

[0320] Table 7. The forward and reverse primers used to introduce mutations into ObMS are shown below. The first column indicates the amino acid position of SEQ ID NO: 2 (ObMS amino acid sequence) and the forward or reverse primer, the second column indicates the sequence ID number, and the third column indicates the nucleotide sequence of the primer.

[0321]

[0322]

[0323]

[0324]

[0325] To introduce the mutation at the identified location, two overlapping fragments of the myrcene synthase sequence were generated using a 5' outer forward primer (AM-405) and an inner reverse primer (IR), and an inner forward primer (IF) and a 3' outer reverse primer (AM-168), respectively, for two PCR reactions. The primer sequences are shown in Table 7. According to the manufacturer's manual, the following steps were performed: All PCR reactions were performed using high-fidelity DNA polymerase.

[0326] To create a mutagenic library in yeast, plasmid pAM11613 was digested with BamHI and NheI, and the digested vector backbone was purified. One μL of each PCR fragment was mixed with 15 ng of digested pAM11613, and vacancies were repaired in yeast strain Y10566. Twelve random clones from selected transformations were sequenced to confirm that the library contained appropriate diversity and mutation frequencies at the desired residue positions.

[0327] To screen for improved myrcene synthase activity, 36 yeast clones at each residue position were inoculated into 360 μl of pre-medium (bird's broth containing 14 g / L sucrose, 7 g / L maltose, and 1 g / L lysine) in 96-well plates and grown at 30°C with shaking at 1000 rpm for two days. Then, 3 μl of the culture was subcultured into 2.2 ml of 96-well deep-well plates containing 75 μl of generating medium (bird's broth containing 4% galactose and 125 μM CuSO4). The plates were then sealed with foil using a heat sealer (e.g., PlateLoc Thermal Microplate Sealer, Agilent Technologies) and grown at 30°C with shaking at 1000 rpm for three days.

[0328] The GC headspace analysis method described in Example 7.5 was used to quantify myrcene generated in a sealed plate at the end of growth and generation. Headspace gas was directly injected into the GC, and the peak areas of myrcene (generated by a myrcene synthase mutant) and limonene (generated by limonene synthase present in vector pAM11613) were quantified. The ratio of the myrcene peak area to the limonene peak area for each yeast clone in the plate was calculated and compared to the ratio of the myrcene peak area to the limonene peak area for a yeast clone expressing wild-type myrcene synthase with the sequence SEQ ID NO: 2. Yeast clones with increased myrcene / limonene ratios were identified, and their myrcene synthase sequences were amplified and sequenced.

[0329] A total of 19 beneficial mutations identified from the saturated mutagenesis library screened by 1xObMS were transferred to 5xObMS, and the new codon variants were approximately 5-fold better than those using 1xObMS. The 19 mutants in the 1xObMS background showed at least approximately 10% activity improvement compared to their parental 1xObMS. As summarized in Table 8, for most mutants, approximately 10-70% activity improvement was obtained relative to the new parental 5xObMS, a level of improvement similar to that observed with 1xObMS. The myrcene synthase variants 5xObMS_M543I and 5xObMS_E528D, which exhibited the highest activity, showed improvements of more than 8-fold compared to 1xObMS.

[0330] Table 8. Beneficial mutations can be transferred from 1xObMS to 5xObMS. Competition ratios are normalized to the competition ratios of 5xObMS. The CVs are calculated from 6 replicates. Selected beneficial mutations included in the combinatorial library are marked with "X".

[0331]

[0332]

[0333] To identify other beneficial mutations that could improve 5xObMS enzyme activity, a second saturated mutagenesis library was constructed and screened using 5xObMS as the parent. To construct the library, 100 amino acid residues were selected to introduce mutations using NDT degenerate primers as described above. The primer sequences are summarized in Table 7. The selection of the 100 amino acid residues was based on two criteria: 1) additional “hotspots” from other terpene synthases (as described above) not included in the first mutagenesis library; and 2) ObMS homology models. Mutations located at active sites 8 and... Residues between. The library was screened using the same protocol as described above. A total of 29 beneficial mutations located at 16 unique amino acid positions were identified. Based on the competitive assay, these variants showed improvements relative to the parental 5xObM ranging from 12% to 78% (see Table 9).

[0334] Table 9. Other beneficial mutations identified by screening a second saturated mutagenesis library for 5xObMS. Competition ratios were normalized to the competition ratios for 5xObMS. The CVs were calculated from 6 replicates.

[0335]

[0336]

[0337] 7.10 Generation and Screening of Combinatorial Libraries for Other Myrcene Synthase Variants

[0338] This embodiment describes a method for using a monoterpene synthase competitive assay in yeast to combine mutations and screen for improved myrcene synthase variants.

[0339] To further improve myrcene synthase activity, eight beneficial mutations (K213H, F381L, D389G, I404V, Y439L, R482I, E528D, and M543I) were selected for the design and construction of combinatorial libraries. 5xObM was used as the parental sequence. The created library contained all 28 possible combinations of these eight mutations. To create the combinatorial library, overlapping PCR products containing the expected mutations and g-block sequences (SEQ ID NO: 39 to 54) were generated. Two PCR reactions were performed using 5xObM as a template with the following primers:

[0340] AMN449: CTATACTTTAACGTCAAGGAGAAAAAACGGATCCATGGTCGAACCAAGAAGATCCGGTA (SEQ ID NO: 29); and

[0341] YY317: ATAAGCTTCAACCAAATCCAACCAAGACTT (SEQ ID NO: 30).

[0342] PCR products were purified by gel electrophoresis. A total of 16 gblocks were used to introduce all mutant combinations of F381L, D389G, I404V, Y439L, R482I, E528D, and M543I. 50 ng of each PCR fragment and 10 ng of each gblock were mixed and used... High-fidelity DNA polymerase was used for overlap extension PCR. The PCR mixture was first established without primers, denatured at 95°C for 3 minutes, and then subjected to 10 cycles (95°C, 30 seconds; 55°C, 30 seconds; and 72°C, 2 minutes). The following primers were added to the reaction:

[0343] JW730:TACTTTAACGTCAAGGAGAA (SEQ ID NO: 31)

[0344] ATN009: TTCAGGTTGTCTAACTCCTTTCCTTTTCGG (DQ ID NO: 32).

[0345] After adding primers JW730 and ATN009, the reaction was performed for 20 cycles (95°C, 30 seconds; 56°C, 30 seconds; and 72°C, 2 minutes). The amplified full-length product was extracted and quantified by gel extraction. 9 ng of the full-length product was mixed with 15 ng of BamHI / NheI-digested vector pAM 11614, and vacancies were repaired in yeast strain Y10566.

[0346] To screen the combined libraries, 800 yeast clones were inoculated into the wells of 96-well plates and grown and analyzed as previously described. Yeast clones exhibiting an increased myrcene / limonene ratio compared to the parental strain containing 5xObMS were identified, and their myrcene synthase sequences were amplified and sequenced. More than 50 hit mutations were identified from the initial tier 1 screening, representing at least a 2-fold improvement over the parent. Subsequent tier 1 screening led to the confirmation of the 5 highest-hit targets (based on a competitive assay), which were 2.5 to 2.8-fold higher than the parental 5xObMs (see Table 10).

[0347] Table 10. The top five hit targets identified from the screening of myrcene synthase combinatorial libraries. Their degree of improvement is relative to the parental strain of the library at 5xObMS. To track overall progress in myrcene synthase engineering, their degree of improvement relative to the enzyme at 1xObMS is also listed.

[0348]

[0349] These highest hit sequences lead to some valuable insights into these beneficial mutations. All hits included the E528D mutation, which appears to be one of the most beneficial mutations among the eight mutations included in this combined library. On the other hand, the highest hits did not include the K213H or R482I mutations. Furthermore, there appears to be a synergistic effect between I404V and E528D, as the combined improvement from these two mutations (potentially 250% in hits at T4-55 and T4-43) exceeds the sum of the individual improvements (~110%). In contrast, the E528, M543I, and F381L mutations appear to be completely additive when combined, with a total activity increase of 150% expected from the sum of their individual improvements (from Table 10). The hit T4-43 containing three amino acid variations (F381L, I404V, and E528D) is referred to in this invention as the 14xObMS variant because its overall activity is greater than 14 times that of the 1xObMS (wild-type myrcene synthase from basil).

[0350] 7.11 Improvement in myrcene formation in the 14xObMS variant

[0351] This example illustrates the extent of improvement in myrcene production via ObMS variants 5xObMS and 14xObMS compared to wild-type 1xObMS.

[0352] The host strain X100 was created by integrating two copies of SaGPPS driven by the pGAL1 promoter and a myrcene synthase endonuclease landing pad. The landing pad consisted of the pGAL1 promoter, an F-CphI cleavage site, and a terminator. 1xObM, 5xObM, and 14xObMS were amplified using primers homologous to the pGAL1 promoter and the terminator, and each was co-transformed into strain X100 with a pAM2947 plasmid containing the F-CphI endonuclease to generate new strains. Each strain, with a single copy of 1xObM, 5xObMS, and 14xObMS, was integrated into the chromosome. The generation of these strains was tested in a sealed 2.2 ml 96-well plate model containing 120 μl of 1% sucrose and 30 μl of IPM containing 1 g / L limonene as an internal standard. After shaking culture at 30°C for 72 hours, the sample in the plate was analyzed, and the production of myrcene was quantified using headspace analysis as described in Example 7.5.

[0353] The results are shown in Figure 6. As shown in Figure 6, the wild-type 1xObMS enzyme has been rapidly improved through a combination of codon optimization (5xObM variant) and a combination of codon optimization and directed evolution (14xObMS variant). Compared with wild-type 1xObMS nucleic acid (which is not codon optimized), the 14xObMS variant showed an approximately 3.5-fold improvement in myrcene production when expressed in yeast cells.

[0354] 7.12 Improvement of the ObMS variant relative to its parent 14xObMS

[0355] This example describes the screening of myrcene synthase variants that are improved relative to their parent 14xObMS in a competitive assay of monoterpene synthases in yeast.

[0356] Site-directed mutagenesis libraries were created using polymerase chain reaction (PCR) mutagenesis with the 14xObMS sequence as a template. The parental 14xObMS enzyme contains three amino acids (F381L, I404V, and E528D). As described in Section 6.9 above, mutations were introduced using degenerate NDT codons on the 14xObMS sequence (SEQ ID NO: 4). Primer sequences are listed in Table 7 above. Screening and competitive / headspace assays were performed using strain Y10566 as described in Examples 6.4, 6.5, and 6.9 above.

[0357] Two hits were identified and confirmed from the screening assay. The exact nucleotide sequence changes were determined after sequencing the myrcene synthase sequences of these two hits. The two hits were: A544S (codon change from gct to agt) and Q552R (codon change from caa to cgt). The improvement in myrcene synthase activity relative to the parental 14xObMS for these two hits is shown in Figure 7, where the Y-axis represents the percentage improvement relative to the parental enzyme. As shown in Figure 7, both the mutants A544S and Q552R increased myrcene synthase activity by at least 10% relative to the parental 14xObMS.

[0358] One or more features from any embodiment of the invention or the accompanying drawings may be combined with one or more features from any other embodiment of the invention described in the accompanying drawings without departing from the scope of the invention.

[0359] All publications, patents, and patent applications referenced in this specification are incorporated herein by reference, just as each individual publication or patent application is specifically and individually mentioned by reference. Although the foregoing embodiments have been described in detail by way of example and examples for clarity of understanding, it will be apparent to those skilled in the art, based on the teachings of the embodiments / exemplifications of this invention, that certain changes and modifications / modifications may be made thereto without departing from the spirit or scope of the appended claims.

Claims

1. A fermentation composition comprising: (I) Genetically modified yeast host cells cultured in a culture medium, wherein the yeast host cells contain (i) A heterologous nucleic acid molecule encoding a basil myrcene synthase, said basil myrcene synthase being represented by an amino acid sequence having at least one set of variant amino acid residues compared to SEQ ID NO: 2, wherein said at least one set of variant amino acid residues is selected from the group consisting of the following variant amino acid residue groups: (a) F381L, I404V, E528D, and M543I; (b) I404V and E528D; (c) F381L, D389G, I404V, Y439L, and E528D; (d) F381L, E528D, and M543I; (e) F381L, I404V, and E528D; (f) F381L, I404V, E528D, and A544S; and (g) F381L, I404V, E528D, and Q552R, The locations mentioned therein are numbered according to SEQ ID NO: 2; and (ii) Heterologous nucleic acid molecules encoding gerany-based pyrophosphate synthase; and (II) A monoterpene compound generated from the yeast host cell, wherein the monoterpene compound comprises myrcene as a major component and one or more byproducts as minor components, and wherein the one or more byproducts comprises α-terpinene and γ-terpinene.

2. The fermentation composition according to claim 1, wherein the basil myrcene synthase comprises variant amino acid residues F381L, I404V and E528D compared to SEQ ID NO: 2, wherein the positions are numbered with reference to SEQ ID NO:

2.

3. The fermentation composition according to claim 1, wherein the basil myrcene synthase comprises variant amino acid residues F381L, I404V, E528D and A544S compared to SEQ ID NO: 2, wherein the positions are numbered with reference to SEQ ID NO:

2.

4. The fermentation composition according to claim 1, wherein the basil myrcene synthase comprises variant amino acid residues F381L, I404V, E528D and Q552R compared to SEQ ID NO: 2, wherein the positions are numbered with reference to SEQ ID NO:

2.

5. Genetically modified yeast host cells, comprising: (i) Encoding the species of basil ( Ocimum A heterologous nucleic acid molecule of myrcene synthase from the species *Basil*, wherein the myrcene synthase is represented by an amino acid sequence having at least one set of variant amino acid residues compared to SEQ ID NO: 2, wherein the at least one set of variant amino acid residues is selected from the group consisting of the following variant amino acid groups: (a) F381L, I404V, E528D, and M543I; (b) I404V and E528D; (c) F381L, D389G, I404V, Y439L, and E528D; (d) F381L, E528D, and M543I; (e) F381L, I404V, and E528D; (f) F381L, I404V, E528D, and A544S; and (g) F381L, I404V, E528D, and Q552R, The locations mentioned therein are numbered according to SEQ ID NO: 2; and (ii) Heterologous nucleic acid molecules encoding gerany-based pyrophosphate synthase.

6. The genetically modified yeast host cell according to claim 5, wherein the basil myrcene synthase variant comprises variant amino acid residues F381L, I404V and E528D compared to SEQ ID NO: 2, wherein the positions are numbered with reference to SEQ ID NO:

2.

7. The genetically modified yeast host cell according to claim 5, wherein the basil myrcene synthase variant comprises variant amino acid residues F381L, I404V, E528D and A544S compared to SEQ ID NO: 2, wherein the positions are numbered with reference to SEQ ID NO:

2.

8. The genetically modified yeast host cell according to claim 5, wherein the basil myrcene synthase variant comprises variant amino acid residues F381L, I404V, E528D and Q552R compared to SEQ ID NO: 2, wherein the positions are numbered with reference to SEQ ID NO:

2.

9. An isolated nucleic acid molecule encoding basil myrcene synthase, wherein the basil myrcene synthase is represented by an amino acid sequence having at least one set of variant amino acid residues compared to SEQ ID NO: 2, wherein the at least one set of variant amino acid residues is selected from the group consisting of the following variant amino acid residue sets: (a) F381L, I404V, E528D, and M543I; (b) I404V and E528D; (c) F381L, D389G, I404V, Y439L, and E528D; (d) F381L, E528D, and M543I; (e) F381L, I404V, and E528D; (f) F381L, I404V, E528D, and A544S; and (g) F381L, I404V, E528D, and Q552R, The locations mentioned therein are numbered with reference to SEQ ID NO:

2.

10. The isolated nucleic acid molecule according to claim 9, wherein the basil myrcene synthase variant comprises variant amino acid residues F381L, I404V and E528D compared to SEQ ID NO: 2, wherein the positions are numbered with reference to SEQ ID NO:

2.

11. The isolated nucleic acid molecule according to claim 9, wherein the basil myrcene synthase variant comprises variant amino acid residues F381L, I404V, E528D and A544S compared to SEQ ID NO: 2, wherein the positions are numbered with reference to SEQ ID NO:

2.

12. The isolated nucleic acid molecule according to claim 9, wherein the basil myrcene synthase variant comprises variant amino acid residues F381L, I404V, E528D and Q552R compared to SEQ ID NO: 2, wherein the positions are numbered with reference to SEQ ID NO: 2.

Images