A bispecific nucleic acid aptamer, derivative, preparation method and application thereof

Abstract

The application provides a kind of dual-specificity nucleic acid aptamer, derivative, preparation method and its application, the nucleic acid aptamer includes first nucleic acid sequence, second nucleic acid sequence;First nucleic acid sequence includes target receptor specificity nucleic acid aptamer and first connecting part, and second nucleic acid sequence includes pairing receptor specificity nucleic acid aptamer and second connecting part;Target receptor specificity nucleic acid aptamer can be specifically combined with target receptor, and pairing receptor specificity nucleic acid aptamer can be specifically recognized with pairing receptor;First connecting part and second connecting part form connecting structure.Thereby, two nucleic acid aptamers can form stable dual-specificity nucleic acid aptamer structure.The dual-specificity nucleic acid aptamer and its derivative can hinder the binding and activation of ligand to target receptor, thereby further affecting cell function.The technical scheme of the application improves the regulation efficiency of nucleic acid aptamer on receptor and cell function.

Description

Technical Field

[0001] This invention relates to the fields of nucleic acid aptamers, nucleic acid aptamer drugs, and protein function regulation, specifically to a bispecific nucleic acid aptamer, its derivative, preparation method, and its application, particularly the application of nucleic acid aptamers as drugs in tumor treatment. Background Technology

[0002] Cell membrane receptor proteins participate in regulating most physiological and pathological processes of cells, such as cell cycle, cell communication, cell differentiation, immune response, apoptosis, cell proliferation, and cell migration. Notably, in biological research, because cell membrane receptor proteins are involved in the occurrence and development of many diseases—for example, complement receptors are often associated with inflammation, and protein tyrosine kinase (PTK) receptors are often associated with cancer—these membrane receptor proteins are frequently used as drug targets. Activating or inhibiting these targets can contribute to the treatment of related diseases.

[0003] Currently, many technologies have been developed to regulate the activity of cell surface receptor proteins, such as ultrasound, magnetism, and light, which can all modulate cellular signaling pathways. However, these physical regulatory methods often act on the entire cell, lacking molecular specificity and spatiotemporal resolution, and can cause significant cell damage. To overcome these shortcomings, many studies have reported using small molecules or monoclonal antibodies to replace physical stimulation in regulating protein function. However, many synthetic small molecules target more than one site, affecting multiple signaling pathways simultaneously and producing side effects; while monoclonal antibodies suffer from high cost, high immunogenicity, and poor thermal stability, which greatly limits their application in biomedical and other research fields.

[0004] Because nucleic acid aptamers interact with their targets in a manner similar to antibodies, they are also known as "chemical antibodies." Studies have reported that nucleic acid aptamers bind to target proteins with high affinity by folding into specialized three-dimensional structures, thereby regulating the activity of the target protein. However, this single-receptor protein regulation method is inefficient, and some proteins overexpressed on diseased cells are also expressed on normal cells, easily causing toxic side effects on non-target cells. Therefore, there is an urgent need to develop a new strategy that can efficiently and specifically regulate the activity of receptor proteins.

[0005] Multiple membrane receptor proteins are simultaneously expressed on the cell surface. Therefore, targeting multiple receptor proteins on the cell surface can improve the specificity of cell function regulation, thereby improving the accuracy of disease diagnosis and treatment. This invention proposes for the first time the use of bispecific nucleic acid aptamer probes to artificially induce protein pairing, thereby efficiently and specifically regulating the function of receptor proteins and ultimately controlling cell migration behavior. Furthermore, since the selected paired receptors are membrane proteins highly expressed in tumor cells, the constructed bispecific nucleic acid aptamer will not affect the function of cells with low or no expression of these proteins. In summary, this bispecific nucleic acid aptamer significantly improves the efficiency and specificity of regulating cell surface receptor proteins and cell behavior, reduces non-target cell toxicity, and is of great significance for advancing precision medicine. It also has the potential to act as an inhibitor of protein function and cell behavior. Summary of the Invention

[0006] The technical concept of this invention is to provide a bispecific nucleic acid aptamer, which is composed of two traditional "nucleic acid aptamers" that form a connecting structure, thereby enabling the two "nucleic acid aptamers" to form a stable bispecific nucleic acid aptamer structure.

[0007] The technical problems to be solved by this invention include, but are not limited to, any one or more of the following: how to achieve bispecificity of nucleic acid aptamers; how to achieve functional regulation of target receptors by nucleic acid aptamers or to achieve the effect of interfering with receptor-related signaling pathways; how to achieve the regulatory effect of nucleic acid aptamers on receptors and cell functions; how to achieve the treatment of tumor cells, etc.

[0008] To solve any one or more of the above technical problems, the present invention provides the following specific technical solutions.

[0009] A first aspect of the present invention provides a bispecific nucleic acid aptamer, the nucleic acid aptamer comprising a first nucleic acid sequence and a second nucleic acid sequence; the first nucleic acid sequence comprising a target receptor-specific nucleic acid aptamer and a first linker portion, the second nucleic acid sequence comprising a paired receptor-specific nucleic acid aptamer and a second linker portion; the target receptor-specific nucleic acid aptamer can specifically bind to a target receptor, and the paired receptor-specific nucleic acid aptamer can specifically recognize a paired receptor; the first linker portion and the second linker portion form a linker structure.

[0010] Regarding the distribution of the target receptor, this technical solution is more effective and simpler for transmembrane receptors, wherein the target receptor is a first transmembrane receptor and the paired receptor is a second transmembrane receptor.

[0011] Furthermore, regarding the activation mode of the target receptor, the receptor activation mode of the target receptor is receptor dimerization, oligomerization, or multimerization.

[0012] Furthermore, the target receptor is activated by ligand-dependent receptor dimerization, oligomerization, or multimerization.

[0013] Furthermore, in order to further enhance the effect, especially the competitive inhibition effect, the ligand, the target receptor-specific nucleic acid aptamer, and the target receptor have the same or similar binding sites.

[0014] Regarding the length requirement of the hybridization portion, further, the connection structure formed by the first connecting portion and the second connecting portion can increase or decrease the spatial distance between the target receptor-specific nucleic acid aptamer and the paired receptor-specific nucleic acid aptamer of the same bispecific nucleic acid aptamer.

[0015] Furthermore, the connection structure formed by the first connection portion and the second connection portion can reduce the spatial distance between the target receptor-specific nucleic acid aptamer and the paired receptor-specific nucleic acid aptamer of the same bispecific nucleic acid aptamer.

[0016] Furthermore, the connection structure formed by the first connection portion and the second connection portion can reduce the spatial distance between the target receptor-specific nucleic acid aptamer and the paired receptor-specific nucleic acid aptamer of the same dual-specific nucleic acid aptamer to the target receptor and the paired receptor forming a spatial steric hindrance that hinders the activation of the target receptor.

[0017] Furthermore, in order to maximize the steric hindrance effect, the first connecting portion and the second connecting portion form a connecting structure, which can reduce the spatial distance between the target receptor-specific nucleic acid aptamer and the paired receptor-specific nucleic acid aptamer of the same bispecific nucleic acid aptamer to the formation of heterodimers by the target receptor and the paired receptor.

[0018] Alternatively, the following methods can be used to form a connection structure for the connection portion: the first connection portion and the second connection portion can form a double-stranded structure through mutual hybridization, a connection structure can be formed through affinity, a connection structure can be formed through covalent bonding, or the first nucleic acid sequence and the second nucleic acid sequence can be directly synthesized into a single nucleic acid sequence so that the first connection portion and the second connection portion directly form a connection structure.

[0019] For specific applications, it is preferable that the target receptor is a receptor highly expressed by tumor cells.

[0020] For specific applications, in order to further improve the technical effect, the paired receptor is a receptor highly expressed by tumor cells.

[0021] A second aspect of the present invention provides the use of the above-described bispecific nucleic acid aptamers in the preparation of drugs or in the preparation of protein function regulating molecules.

[0022] A third aspect of the present invention provides derivatives of the above-described bispecific nucleic acid aptamers.

[0023] In this context, "derivatives" refers to modifications of the aforementioned bispecific nucleic acid aptamers achieved through any chemical reaction without altering their specific recognition performance.

[0024] The fourth aspect of the present invention provides the application of the above-mentioned bispecific nucleic acid aptamer derivatives in the preparation of drugs or in the preparation of protein functional molecule regulation.

[0025] The fifth aspect of the present invention provides a method for preparing the above-mentioned bispecific nucleic acid aptamers, the specific method steps of which are as follows:

[0026] s1. Synthesize the first nucleic acid sequence;

[0027] s2. Synthesize the second nucleic acid sequence;

[0028] s3. The first connecting portion and the second connecting portion are hybridized to form a double-stranded structure, a connecting structure formed by affinity, or a connecting structure formed by covalent bonds;

[0029] s4. Obtain the bispecific nucleic acid aptamer.

[0030] The sixth aspect of the present invention provides another method for preparing the above-mentioned bispecific nucleic acid aptamer, the specific method steps of which are as follows:

[0031] s1. Determine the first nucleic acid sequence;

[0032] s2. Determine the second nucleic acid sequence;

[0033] s3. The first nucleic acid sequence and the second nucleic acid sequence are directly synthesized into a single nucleic acid sequence, such that the first linker portion and the second linker portion directly form a linker structure;

[0034] s4. Obtain the bispecific nucleic acid aptamer.

[0035] Furthermore, regarding the first to fifth aspects provided by this invention, the following are further exemplary examples:

[0036] The tumor cells mentioned are human prostate cancer cells DU145, human cervical cancer cells HeLa, human gastric cancer cells MKN-45, human liver cancer cells HepG2, human non-small cell lung cancer cells A549, human breast cancer cells MCF-7, and human acute lymphoblastic leukemia cells (CCRF-CEM), etc.; specifically, human prostate cancer cells DU145 are used as an example.

[0037] The target receptors are transmembrane receptors highly expressed on the surface of tumor cells, such as mesenchymal-epidermal transforming factor receptor (Met), epidermal growth factor receptor (EGFR), human epidermal growth factor receptor 2 (HER2), vascular endothelial growth factor receptor (VEGFR), metastatic growth factor β receptor (TGFβR), and tumor necrosis factor receptor (TNFR); specifically, mesenchymal-epidermal transforming factor receptor (Met) is taken as an example.

[0038] The target receptor is activated by ligand-dependent receptor dimerization, oligomerization, or multimerization, wherein the ligand is hepatocyte growth factor (HGF), epidermal growth factor (EGF), vascular endothelial growth factor (VEGF), transforming growth factor-β (TGFβ), tumor necrosis factor (TNF), etc.; specifically, hepatocyte growth factor (HGF) is used as an example.

[0039] The paired receptors are transmembrane receptors highly expressed on the surface of tumor cells, such as transferrin receptor (TfR), nucleolin, epithelial cell adhesion molecule (EpCAM), mucin (MUC1), protein tyrosine kinase 7 (PTK7), and epidermal growth factor receptor (EGFR); specifically, transferrin receptor (TfR) is taken as an example.

[0040] The bispecific nucleic acid aptamer (Apt-Met-TfR) includes a first nucleic acid sequence of ATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGGTGGGTTGGCAAGTCTGATAAGTAGAACGTTATGACTAA and a second nucleic acid sequence of GGATAGGGATTCTGTTGGTCGGCTGGTTGGTATCCTTTAGTCATAACGTTCTAC; the target receptor-specific nucleic acid aptamer and the first linker in the first nucleic acid sequence are ATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTGAT and GTAGAACGTTATGACTAA, respectively; the paired receptor-specific nucleic acid aptamer and the second linker in the second nucleic acid sequence are GGATAGGGATTCTGTTGGTCGGCTGGTTGGTATCC and TTAGTCATAACGTTCTAC, respectively.

[0041] The first linker and the second linker hybridize to form an 18bp double-stranded structure, which reduces the spatial distance between the target receptor Met and the paired receptor TfR of the same bispecific nucleic acid aptamer (Apt-Met-TfR), forming a heterodimer of Met and TfR. This creates steric hindrance around the Met receptor, preventing HGF from binding to Met and inducing the formation of Met dimers.

[0042] The method for preparing the bispecific nucleic acid aptamer is as follows:

[0043] s1. Synthesize the first nucleic acid sequence ATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTGATAAGTAGAACGTTATGACTAA;

[0044] s2. Synthesize the second nucleic acid sequence GGATAGGGATTCTGTTGGTCGGCTGGTTGGTATCCTTTAGTCATAACGTTCTAC;

[0045] s3. Mix the first nucleic acid sequence and the second nucleic acid sequence in phosphate buffer at a molar ratio of 1:1;

[0046] s4. The bispecific nucleic acid aptamer Apt-Met-TfR was obtained by reacting at 25°C for 15 minutes.

[0047] This invention provides the application of the aforementioned bispecific nucleic acid aptamer in the preparation of drugs, such as anti-tumor cell proliferation drugs, anti-tumor metastasis drugs, and drugs that induce tumor cell apoptosis.

[0048] This invention provides derivatives of the aforementioned bispecific nucleic acid aptamer, including derivatives in which the bispecific nucleic acid aptamer sequence is replaced with artificial bases, the bispecific nucleic acid aptamer backbone is replaced with a thiophosphate backbone, the bispecific nucleic acid aptamer sequence is modified into a peptide nucleic acid, and derivatives in which the bispecific nucleic acid aptamer sequence is modified with polyethylene glycol and still has the same function as the aforementioned bispecific nucleic acid aptamer.

[0049] The beneficial effects of this invention are as follows: It is the first development of a method for preparing and applying bispecific nucleic acid aptamers and their derivatives. Furthermore, the bispecific nucleic acid aptamer drug is used to regulate the function of receptors highly expressed on the surface of tumor cells. The bispecific nucleic acid aptamer can specifically recognize two types of receptors highly expressed on tumor cells: a target receptor and a paired receptor. The spatial distance between the two receptors is altered through the connection structure, such as the double-stranded DNA structure formed by the complementary sequences at the ends of the nucleic acid aptamer. Due to the proximity of the paired receptor, significant steric hindrance is formed around the target receptor, hindering the binding and activation of the target receptor by the ligand, thereby further affecting cell function. This bispecific nucleic acid aptamer enhances the regulatory effect of nucleic acid aptamers on receptors and cell function. Furthermore, the bispecific nucleic acid aptamer can be used to prepare antitumor drugs. Attached Figure Description

[0050] Figure 1 This is a schematic diagram illustrating the regulation of receptor function by the bispecific nucleic acid aptamer drug Apt-Met-TfR.

[0051] Figure 2 (A) Schematic diagram of the structure of a bispecific nucleic acid aptamer drug. (B) PAGE gel images of different nucleic acid aptamer drug structures. Lane 1: Apt-Me needle; Lane 2: Apt-TfR; Lane 3: Apt-Met-TfR. (C) Fluorescence spectra of different nucleic acid aptamer drugs.

[0052] Figure 3 (A) Flow cytometry analysis of DU145 cells incubated with different nucleic acid aptamer drugs. (B) Laser confocal imaging of DU145 cells incubated with different nucleic acid aptamer drugs. Scale bar: 50 μm.

[0053] Figure 4 To analyze the expression levels of Met and p-Met in DU145 cells using Western blotting.

[0054] Figure 5 To analyze the expression levels of Met and p-Met in DU145 cells after incubation with different concentrations of the bispecific nucleic acid aptamer drug Apt-Met-TfR (0-50 nM) using Western blotting.

[0055] Figure 6 To analyze the expression levels of Met and p-Met in DU145 cells after incubation with different concentrations of Met aptamers (0-1000 nM) using Western blotting.

[0056] Figure 7 To analyze the expression levels of Met and p-Met in DU145 cells after incubation with different concentrations of the Met inhibitor ARQ 197 (0-3000 nM) for Western blot analysis.

[0057] Figure 8 Western blot analysis was performed on the expression levels of Met, Akt, Erk, p-Met, p-Akt, and p-Erk in (A) DU145 cells and (B) MKN-45 cells.

[0058] Figure 9 To analyze the expression levels of Met and p-Met in DU145 cells using Western blotting.

[0059] Figure 10 To analyze the expression levels of Met and TfR proteins in L02 and DU145 cells using (A) Western blotting and (B) laser co-concentration imaging. Scale bar: 25 μm.

[0060] Figure 11 To analyze the expression levels of Met and p-Met in L02 cells using Western blotting.

[0061] Figure 12 To analyze the effect of nucleic acid aptamer drugs on HGF-induced migration behavior of DU145 cells in a scratch repair assay.

[0062] Figure 13 To analyze the effect of aptamer drugs on HGF-induced migration behavior of DU145 cells using scattering experiments. Scale bar: 200 μm.

[0063] Figure 14 To analyze the effects of nucleic acid aptamer drugs on HGF-induced migration behavior of DU145 cells in Transwell cell migration assays.

[0064] Figure 15 Microscopic images showing the movement of DU145 cells. Scale bar: 100 μm. Detailed Implementation

[0065] The following examples and comparative examples illustrate specific implementations of the present invention in more detail, but the technical scope of the present invention is not limited to the following examples.

[0066] To intuitively illustrate the technical content of the embodiments and comparative examples of the present invention, please refer to... Figure 1 The following explanation is provided:

[0067] like Figure 1 As shown, the embodiments of the present invention ( Figure 1The left-hand portion of the study selected the mesenchymal-epidermal transformation factor (Met) receptor protein, which is involved in the development and progression of tumor cells, as the target receptor. The Met receptor is a homologous receptor of hepatocyte growth factor (HGF). HGF activates the Met receptor by binding to it and promoting its dimerization, thereby promoting cell migration. Furthermore, the transferrin receptor (TfR), which is highly expressed in tumor cells, was selected as the paired receptor. A bispecific nucleic acid aptamer drug, named Apt-Met-TfR, was constructed. After incubation with cells, this drug simultaneously targets both the Met and TfR receptors, bringing them closer together and inducing the formation of an artificial receptor heterodimer. Notably, the proximity of the paired TfR receptor creates a significant steric hindrance near the target Met receptor, hindering the binding of the HGF ligand to the Met receptor and inhibiting the activation of the Met receptor signaling pathway, thereby further inhibiting cell migration. This inhibitory effect is better than that of a single nucleic acid aptamer probe.

[0068] The experimental supplies and related verification methods involved in this specific embodiment are as follows:

[0069] Chemical reagents: All experimental water was ultrapure water (18.2 MΩ•cm) purified by a Milli-Q Integarl integrated pure / ultrapure water system. All DNA used in the experiments was synthesized and purified by Sangon Biotech (Shanghai) Co., Ltd. GelRed nucleic acid staining solution, RIPA lysis buffer, and BCA protein quantification kit were purchased from Beyotime Biotechnology Co., Ltd. Phosphate-buffered saline (PBS), MEM medium, DMEM medium, RPMI-1640 medium, penicillin / streptomycin antibiotics, fetal bovine serum (FBS), Lipofectamine 3000, Hoechst 33342, and ECL Plus chemiluminescence solution were purchased from Life Technologies, Inc. (USA). Protease inhibitors and phosphatase inhibitors were purchased from Roche, Inc. (USA). Crystal violet and 1% paraformaldehyde were purchased from Solarbio Science & Technology Co., Ltd. (Beijing). The Met receptor small molecule inhibitor ARQ 197 was purchased from AdooQ Bioscience, Inc. (USA). Recombinant human HGF factor was purchased from PeproTech, Inc. (USA). Anti-Met antibodies, anti-phosphorylated Met antibodies, anti-Erk antibodies, anti-phosphorylated Erk antibodies, anti-Akt antibodies, anti-phosphorylated Akt antibodies, and HRP-labeled anti-rabbit antibodies were all purchased from Cell Signaling Technology, USA. Human prostate cancer cell line DU145 and human normal liver cell line L02 were purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences, and human gastric cancer cell line MKN-45 was purchased from the Wuhan University Cell Bank.

[0070] Example 1

[0071] The mesenchymal-epidermal transformation factor (Met) receptor protein, which is involved in the development and progression of tumor cells, was selected as the target receptor, and the transferrin receptor (TfR), which is highly expressed in tumor cells, was selected as the pairing receptor. Complementary DNA sequences were added to the ends of the Met and TfR aptamers, respectively, to form the single-specific aptamers Apt-Met and Apt-TfR. The two were mixed in a 1:1 ratio and incubated at room temperature with shaking for 15 minutes to form the bispecific aptamer drug Apt-Met-TfR.

[0072] The sequences of Apt-Met and Apt-TfR in this embodiment 1 are shown in Table 1.

[0073] Comparative Example 1

[0074] Apt-Met or Apt-TfR from Example 1 were used alone as nucleic acid aptamer drugs, and all other experimental conditions were the same.

[0075] Table 1. DNA sequences used in Example 1 and Comparative Example 1

[0076]

[0077] Example 2

[0078] The mesenchymal-epidermal transformation factor (Met) receptor protein, which is involved in the development and progression of tumor cells, was selected as the target receptor, and nucleolin, which is highly expressed in tumor cells, was selected as the paired receptor. Complementary DNA sequences were added to the ends of the Met and Nucleolin aptamers, respectively, to form the single-specific aptamers Apt-Met and Apt-Nucleolin. The two were mixed in a 1:1 ratio and incubated at room temperature with shaking for 15 minutes to form the bispecific aptamer drug Apt-Met-Nucleolin.

[0079] The sequences of Apt-Met and Apt-Nucleolin in this embodiment 2 are shown in Table 2.

[0080] Comparative Example 2

[0081] Apt-Met or Apt-Nucleolin from Example 2 were used alone as nucleic acid aptamer drugs, and all other experimental conditions were the same.

[0082] Table 2. DNA sequences used in Example 2 and Comparative Example 2

[0083]

[0084] (I) Relevant Experimental Procedures

[0085] The relevant nucleic acid aptamer drugs from Example 1, Comparative Example 1, Example 2, and Comparative Example 2 were subjected to the following related experiments:

[0086] A. Fluorescence detection

[0087] 50 nM Apt-Met-Cy5 and 50 nM Apt-TfR-Cy3 were incubated at room temperature with shaking for 15 minutes. The changes in Cy5 fluorescence were detected using a Hitachi F-4600 fluorescence spectrophotometer. The instrument was set to an excitation wavelength of 520 nm and an emission wavelength of 540-750 nm.

[0088] B. Polyacrylamide gel electrophoresis (PAGE) analysis:

[0089] Apt-Met and Apt-TfR were mixed at a 1:1 ratio and incubated with shaking at room temperature for 15 minutes. Electrophoresis was then performed on a PAGE gel in 1×TBE buffer. After electrophoresis, the gel was stained with GelRed nucleic acid staining solution and analyzed using a gel imaging system.

[0090] C. Flow cytometry analysis

[0091] DU145 cells were pre-starved in MEM fasting medium containing 0.5% BSA for 24 hours. After starvation, the medium was discarded, the cells were washed twice with PBS, digested with 0.2% Na2EDTA, and collected in 1.5 mL centrifuge tubes. Cell counts were performed, with approximately 3 × 10⁻⁶ cells per sample. 5 Cells were incubated with 50 nM Apt-Met-Cy5, Apt-TfR-Cy3 probes, and Apt-Met-Cy5 and Apt-TfR-Cy3 probes respectively, with shaking at room temperature for 30 minutes. After incubation, cells were washed three times with PBS and analyzed using a FACSCanto™ II flow cytometer. Experimental data were analyzed using FlowJo 7.6 software.

[0092] D. Confocal fluorescence imaging

[0093] Cells were pre-seeded in 35 mm confocal culture dishes. After cell attachment, the culture medium was replaced with MEM medium containing 0.5% BSA and cultured for 24 hours under starvation conditions. For imaging analysis of FRET of cell surface DNA probes, after cell starvation culture, cells were incubated at room temperature for 30 minutes with 50 nM Apt-Met-Cy5 probe, Apt-TfR-Cy3 probe, and Apt-Met-Cy5 and Apt-TfR-Cy3 probe, respectively. Cells were washed three times with PBS and then imaged using a laser scanning confocal microscope.

[0094] E. Western blot analysis

[0095] Cells were seeded in 6-well plates 24 hours in advance and then starved in MEM medium (0.5% BSA) for 24 hours.

[0096] For the inhibition experiment of nucleic acid aptamer drugs, the cells were first incubated with different concentrations of Apt-Met, Apt-TfR or Apt-Met-TfR at room temperature for 15 minutes, and then 30 ng / mL HGF was added and incubated at room temperature for another 30 minutes.

[0097] For the inhibition experiment of ARQ 197, a small molecule inhibitor of the Met receptor, cells were first incubated with different concentrations of ARQ 197 for 24 hours, and then incubated with 30 ng / mL HGF for 30 minutes.

[0098] After incubation, cells were lysed using RIPA lysis buffer (containing protease and phosphatase inhibitors). Proteins extracted after cell lysis were separated using an 8% SDS-polyacrylamide gel electrophoresis, and the separated proteins were transferred to a PVDF membrane. The corresponding bands were cut and blocked with 5% milk powder / TBST for 2 hours. After blocking, the PVDF membrane was incubated overnight at 4 °C with antibodies against Met, phosphorylated Met, Erk, phosphorylated Erk, Akt, and phosphorylated Akt, respectively. After washing three times with 1×TBST, the membrane was incubated with HRP-labeled anti-rabbit antibody at room temperature for 1 hour, washed three times with 1×TBST, and then ECL Plus high-sensitivity chemiluminescence buffer was added. Imaging analysis was performed using a gel imaging system.

[0099] F. Cell scratch repair experiment

[0100] DU145 cells were seeded in 12-well plates 24 hours in advance and cultured until the cells were fully adhered and covered the bottom of the wells. After culturing in starvation medium for 24 hours, a straight line was evenly drawn in the center of the bottom of the well using a sterile 20 μL pipette tip. The cells were washed three times with D-PBS to remove floating cell debris, and the starvation medium was replaced with fresh one. The area of ​​the scratch was imaged using an inverted microscope, and this scratch area was the scratch area at t = 0. Subsequently, the cells were subjected to different treatments: 1) Cells were cultured in starvation medium for a longer period; 2) Cells were incubated with 30 ng / mL HGF for 12 hours; 3) Cells were first incubated with 50 nM Apt-Met for 15 minutes, and then incubated with 30 ng / mL HGF for another 12 hours; 4) Cells were first incubated with 50 nM Apt-Met-TfR for 15 minutes, and then incubated with 30 ng / mL HGF for another 12 hours. Images of scratch area changes were recorded at 0, 4, and 12 hours during cell incubation, and the scratch area was analyzed using ImageJ image analysis software.

[0101] G. Transwell cell migration assay

[0102] DU145 cells were pre-seeded in the upper chamber of a Transwell apparatus. After cell attachment, the starvation medium was replaced, and the cells were cultured for 24 hours. Subsequently, the cells underwent different treatments: 1) Cells were cultured in starvation medium; 2) Cells were incubated with 30 ng / mL HGF for 12 hours; 3) Cells were incubated with 50 nM Apt-Met for 15 minutes, followed by incubation with 30 ng / mL HGF for 12 hours; 4) Cells were incubated with 50 nM Apt-Met-TfR for 15 minutes, followed by incubation with 30 ng / mL HGF for 12 hours. After incubation, the cells in the upper chamber were gently wiped away with a moistened cotton swab, washed twice with PBS, fixed with 1% paraformaldehyde, stained with 0.1% crystal violet, washed with PBS, and observed and counted using an inverted fluorescence microscope. The migration ability of DU145 cells was differentiated by the difference in the number of cells migrating to the lower surface of the filter membrane.

[0103] H. Cell scattering experiment

[0104] DU145 cells were seeded into 6-well plates, with approximately 1000 cells per well. After 3 days of culture, the complete culture medium was replaced with starvation medium. Following 24 hours of starvation culture, the cells were subjected to different treatments: 1) Cells were cultured in starvation medium for an additional 12 hours; 2) Cells were incubated with 30 ng / mL HGF; 3) Cells were incubated with 50 nM Apt-Met for 15 minutes, followed by incubation with 30 ng / mL HGF for an additional 12 hours; 4) Cells were incubated with 50 nM Apt-Met-TfR for 15 minutes, followed by incubation with 30 ng / mL HGF for an additional 12 hours. After incubation, the cell distribution was observed using an inverted fluorescence microscope.

[0105] J. Single-cell migration experiment

[0106] DU145 cells were seeded in 35 mm confocal culture dishes and cultured for 24 hours after cell adhesion. Cell nuclei were stained with Hoechst 33342. After washing twice with PBS, cells were incubated with 50 nM Apt-Met or 50 nM Apt-Met-TfR for 15 minutes, followed by incubation with 30 ng / mL HGF for another 2 hours. Real-time imaging was performed using a rotating confocal microscope, with images taken every 20 minutes. Single-cell migration trajectories were statistically analyzed using Nikon NIS-Elements software.

[0107] (II) Relevant Experimental Results

[0108] A. Construction and characterization of the bispecific nucleic acid aptamer drug Apt-Met-TfR:

[0109] The bispecific nucleic acid aptamer drug Apt-Met-TfR consists of an aptamer targeting the Met receptor (Apt-Met) and an aptamer targeting TfR (Apt-TfR). Each of these aptamers has an 18-base complementary sequence extended from its end, allowing Apt-Met and Apt-TfR to form a stable bispecific nucleic acid aptamer, Apt-Met-TfR. Figure 2 A). The formation of Apt-Met-TfR was investigated by polyacrylamide gel electrophoresis and fluorescence spectroscopy. When two nucleic acid aptamers were co-incubated, a hybridization probe was formed, and the migration rate of DNA slowed down. Figure 2 B), and can generate FRET signals ( Figure 2 (C) The results showed that Apt-Met and Apt-TfR could hybridize in solution to form a stable Apt-Met-TfR, indicating that the bispecific nucleic acid aptamer drug Apt-Met-TfR was successfully constructed. To investigate whether the constructed Apt-Met-TfR still had receptor recognition ability on the cell membrane surface, we confirmed by flow cytometry and confocal microscopy that when cells were incubated with Apt-Met-TfR, the Cy5 signal of Apt-Met and the Cy3 signal of Apt-TfR could be detected simultaneously on the cells. Figure 3 This indicates that our constructed Apt-Met-TfR still possesses receptor recognition capabilities on the cell membrane surface. These experimental results demonstrate that our designed Apt-Met and Apt-TfR can efficiently hybridize to form Apt-Met-TfR, and retain highly specific targeting recognition capabilities on the cell membrane surface.

[0110] B. Inhibitory effect of the bispecific nucleic acid aptamer drug Apt-Met-TfR on the Met receptor signaling pathway:

[0111] We hypothesize that the bispecific nucleic acid aptamer drug Apt-Met-TfR brings the Met receptor and TfR receptor closer together to form an artificially induced receptor heterodimer, which can inhibit HGF-induced Met receptor dimerization, thereby inhibiting the activation of the Met receptor signaling pathway. To verify this hypothesis, we first examined the differences in Met phosphorylation levels under different treatment conditions using Western blotting analysis. Figure 4As shown, when cells were pre-incubated with Apt-Met-TfR and then incubated with HGF, the level of Met phosphorylation was significantly reduced. However, when cells were incubated with Apt-Met or Apt-TfR and then incubated with HGF, the level of Met phosphorylation was comparable to that treated with HGF alone, and it did not inhibit Met phosphorylation. We also compared the differences in the IC50 values ​​of Met phosphorylation inhibition by different treatments. The IC50 value of the bispecific nucleic acid aptamer drug Apt-Met-TfR for inhibiting Met phosphorylation was approximately 20 nM (…). Figure 5 ), far lower than the single-specific nucleic acid aptamer drug Apt-Met (IC50 approximately 750 nM) ( Figure 6 ) and ARQ197 (IC50 is approximately 1000 nM) Figure 7 The IC50 value for inhibiting Met phosphorylation was determined. Furthermore, the feasibility of this strategy in other cell lines expressing Met and highly expressing TfR (such as the HeLa cell line) was investigated. These experimental results demonstrate that the bispecific nucleic acid aptamer drug Apt-Met-TfR can efficiently bring Met and TfR receptors closer together to form an artificially induced receptor heterodimer, inhibiting HGF-induced Met receptor dimerization, thereby inhibiting the activation of the Met receptor signaling pathway. Moreover, this inhibitory effect is significantly superior to that of the single-specific nucleic acid aptamer drug Apt-Met.

[0112] Next, we investigated the inhibitory effects of the bispecific nucleic acid aptamer drug Apt-Met-TfR on downstream signaling pathways of the Met receptor (such as Akt and Erk). Figure 8 A) When DU145 cells were incubated with Apt-Met-TfR, the phosphorylation levels of intracellular Akt and Erk molecules were significantly reduced, while incubation with the single-specific nucleic acid aptamer drugs Apt-Met or Apt-TfR showed almost no change in the phosphorylation levels of intracellular Akt and Erk molecules. Furthermore, it is noteworthy that Apt-Met-TfR cannot inhibit ligand-independent receptor activation. In this study, we selected MKN-45 cells as the model cell, which highly expresses the Met receptor. In the absence of the ligand HGF, this Met receptor can undergo self-dimerization, forming an active dimer. Figure 8As shown in Figure B, after MKN-45 cells were incubated with the Apt-Met-TfR probe, the phosphorylation levels of intracellular Akt and Erk molecules were not different from those in the control group without the nucleic acid aptamer probe, indicating that Apt-Met-TfR has no inhibitory effect on the activation of ligand-independent receptors. These experimental results demonstrate that Apt-Met-TfR is only suitable for inhibiting the activation of ligand-dependent signaling pathways, and not for inhibiting the activation of ligand-independent signaling pathways. Furthermore, this result further confirms our hypothesis that Apt-Met-TfR, by bringing the TfR receptor closer to the Met receptor, increases the steric hindrance of the Met receptor, thereby inhibiting the interaction between the HGF ligand and the Met receptor, and thus inhibiting the activation of the Met receptor signaling pathway. For the activation of ligand-independent receptors, no interaction between the ligand and receptor is required; therefore, steric hindrance does not affect receptor activity.

[0113] In Example 2, to further investigate the universality of this strategy for other paired proteins, we selected nucleolin, which is highly expressed in tumor cells, instead of TfR as another paired receptor model, and designed the bispecific nucleic acid aptamer drug Apt-Met-Nucleolin. When Apt-Met-Nucleolin was co-incubated with DU145 cells, it brought nucleolin and Met protein closer together. The resulting artificial receptor heterodimer exhibited a similar inhibitory effect on Met phosphorylation as Apt-Met-TfR. Figure 9 This demonstrates the universality of our proposed strategy for other paired receptors.

[0114] C. Cellular specificity of the bispecific nucleic acid aptamer drug Apt-Met-TfR in inhibiting the Met receptor signaling pathway:

[0115] To further investigate the cell specificity of the bispecific nucleic acid aptamer drug AA pt-Met-TfR in inhibiting the Met receptor signaling pathway, we selected the L02 human normal hepatocyte cell line with low TfR expression as the experimental cells. First, we used Western blotting (… Figure 10 A) and laser confocal imaging ( Figure 10 B) Comparing the differences in Met and TfR expression levels between the DU145 and L02 cell lines, the results showed that the TfR expression level in the L02 cell line was indeed lower than that in the DU145 cell line. When the Apt-Met-TfR probe was incubated with L02 cells, the IC50 value of its inhibitory effect on Met phosphorylation in L02 cells was 250 nM. Figure 11The IC50 of the inhibitory effect on Met phosphorylation in DU145 cells with high TfR expression was approximately 12 times that of the inhibitory effect on Met signaling in cells with high expression of the pairing protein (TfR), indicating that the probe has a significant inhibitory effect on the Met signaling pathway only in cells with high expression of the pairing protein (TfR), while having a smaller effect on the Met signaling pathway in cells with low expression of the pairing protein. In other words, the probe can specifically act on target cells and has less toxic side effects on other cells.

[0116] D. Inhibition of DU145 cell migration behavior by the bispecific nucleic acid aptamer drug Apt-Met-TfR:

[0117] The HGF / Met signaling pathway is involved in regulating cell migration, which is often associated with tumor cell metastasis. We investigated whether the bispecific nucleic acid aptamer drug Apt-Met-TfR could inhibit cell migration induced by Met signaling pathway activation. First, we validated this through a scratch assay, such as... Figure 12 As shown, DU145 cells treated with Apt-Met-TfR exhibited significantly slower scratch healing compared to cells treated with Apt-Met and those not treated with the probe. We also investigated this using scattering experiments, such as... Figure 13 As shown, DU145 cells form aggregated colonies when not stimulated; when stimulated with HGF, cell migration increases, and the aggregated colonies disperse, exhibiting a scattering pattern; when cells are incubated with Apt-Met-TfR and then stimulated with HGF, the cell colonies remain aggregated, while the cell colonies treated with Apt-Met exhibit a scattering pattern. Furthermore, in Transwell experiments ( Figure 14 After treatment with Apt-Met-TfR, significantly fewer DU145 cells migrated to the other side of the membrane compared to cells treated with Apt-Met alone. These results indicate that Apt-Met-TfR can inhibit HGF-induced migration behavior of DU145 cells. To further verify the inhibitory effect of the bispecific nucleic acid aptamer drug Apt-Met-TfR on cell migration, we used a rotating confocal microscope to examine the movement and migration trajectory of single cells, such as... Figure 15 As shown, compared to cells incubated with Apt-Met and those not incubated with the nucleic acid drug, cells incubated with Apt-Met-TfR exhibited significantly shorter migration distances. These experimental results demonstrate that Apt-Met-TfR can effectively inhibit HGF-induced cell migration and possesses the potential to become an emerging nucleic acid inhibitor.

[0118] In this invention, we constructed a bispecific nucleic acid aptamer drug that artificially induces receptor pairing, forming an artificial receptor heterodimer. This probe regulates cell migration behavior by modulating the Met receptor signaling pathway. This probe not only inhibits the Met receptor signaling pathway more efficiently than single-specific nucleic acid aptamer drugs but also acts more specifically on target cells, avoiding impacts on non-target cells. Furthermore, the use of DNA as the regulatory element in this study simplifies the design of this regulatory strategy and broadens its applicability. By simply changing the sequence of the nucleic acid aptamer, it can be adapted to regulate various types of receptor functions. Therefore, our constructed bispecific nucleic acid aptamer drug has broad application prospects in the regulation of cell signaling pathways and cell behavior, and is expected to become a potential inhibitor of cell functions such as cell growth, migration, and differentiation. SEQUENCE LISTING <110> Fuzhou University <120> A bispecific nucleic acid aptamer, its derivative, its preparation method, and its application. <130> 9 <160> 9 <170> PatentIn version 3.3 <210> 1 <211> 70 <212> DNA <213> Artificial sequence <400> 1 atcaggctgg atggtagctc ggtcggggtg ggtgggttgg caagtctgat aagtagaacg 60 ttatgactaa 70 <210> 2 <211> 54 <212> DNA <213> Artificial sequence <400> 2 ggataggggat tctgttggtc ggctggttgg tatcctttag tcataacgtt ctac 54 <210> 3 <211> 49 <212> DNA <213> Artificial sequence <400> 3 atcaggctgg atggtagctc ggtcggggtg ggtgggttgg caagtctga 49 <210> 4 <211> 18 <212> DNA <213> Artificial sequence <400> 4 gtagaacgtt atgactaa 18 <210> 5 <211> 35 <212> DNA <213> Artificial sequence <400> 5 ggataggggat tctgttggtc ggctggttgg tatcc 35 <210> 6 <211> 18 <212> DNA <213> Artificial sequence <400> 6 ttagtcataa cgttctac 18 <210> 7 <211> 53 <212> DNA <213> Artificial sequence <400> 7 ggataggggat tctgttggtc ggctggttgg tatccttagt cataacgttc tac 53 <210> 8 <211> 71 <212> DNA <213> Artificial sequence <400> 8 atcaggctgg atggtagctc ggtcggggtg ggtgggttgg caagtctgat ttactgtaga 60 acgttatcat a 71 <210> 9 <211> 52 <212> DNA <213> Artificial sequence <400> 9 ggtggtggtg gttgtggtgg tggtggtaaa aaaatgataa cgttctacag ta 52

Claims

1. A bispecific nucleic acid aptamer, characterized in that, The bispecific nucleic acid aptamer comprises a first nucleic acid sequence and a second nucleic acid sequence; the first nucleic acid sequence comprises a target receptor specific nucleic acid aptamer and a first connecting part, and the second nucleic acid sequence comprises a counterpart receptor specific nucleic acid aptamer and a second connecting part; the target receptor specific nucleic acid aptamer can specifically bind to a target receptor, and the counterpart receptor specific nucleic acid aptamer can specifically recognize a counterpart receptor; the first connecting part and the second connecting part form a connecting structure; The nucleotide sequence of the first nucleic acid sequence is shown in SEQ ID No. 1; The nucleotide sequence of the second nucleic acid sequence is shown in SEQ ID No. 2; The target receptor is mesenchymal-epidermal transformation factor receptor Met; The counterpart receptor is transferrin receptor TfR; The preparation method of the bispecific nucleic acid aptamer is as follows: s1. Synthesizing the first nucleic acid sequence; s2. Synthesizing the second nucleic acid sequence; s3. Inter-hybridizing the first connecting part and the second connecting part to form a double-stranded structure; s4. Obtaining the bispecific nucleic acid aptamer.

2. The method of claim 1, wherein the bi-specific nucleic acid aptamer is prepared by, The preparation method comprises the following steps: s1. Synthesizing the first nucleic acid sequence; s2. Synthesizing the second nucleic acid sequence; s3. Inter-hybridizing the first connecting part and the second connecting part to form a double-stranded structure; s4. Obtaining the bispecific nucleic acid aptamer.

Images