Crustacean flavivirus, and detection method and application thereof
By designing a kit specifically for detecting infectious precocious puberty virus and utilizing nucleic acid amplification and antigen-antibody recognition methods, the challenge of detecting crustacean viruses has been solved, enabling efficient detection and control of infectious precocious puberty virus.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- YELLOW SEA FISHERIES RES INST CHINESE ACAD OF FISHERIES SCI
- Filing Date
- 2019-12-27
- Publication Date
- 2026-04-17
AI Technical Summary
Current technologies lack effective detection methods to identify and control infectious precocity flaviviruses that infect crustaceans, especially novel species of infectious precocity flavivirus in the Flaviviridae family, making it difficult to track, investigate, and control the virus.
This invention provides a kit for the specific detection of infectious precocious puberty virus, which utilizes the virus's genome sequence to design nucleic acid amplification, nucleic acid probes, and antigen-antibody recognition methods, including PCR, LAMP, ELISA, and other technologies, to achieve efficient detection of infectious precocious puberty virus.
This study achieved specific detection of infectious precocious puberty virus, providing a new method for the detection and control of viruses in crustacean aquaculture, and improving the accuracy and efficiency of virus detection.
Smart Images

Figure CN111019909B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of aquaculture, specifically relating to a flavivirus that can infect crustaceans and its detection method. Background Technology
[0002] Flaviviridae ( Flaviviridae Flaviviridae is a class of single-stranded positive-sense RNA viruses. The International Committee on Taxonomy of Viruses divides the Flaviviridae family into four genera, including the genus Flavivir (…). Flavivirus Hepatitis C virus genus ( Hepacivirus ) and plague virus genus ( Pestivirus )and Pegivirus The inventors have discovered a novel virus belonging to the Flaviviridae family in the giant freshwater prawn (Macrobrachium rosenbergii). This virus has been tentatively named Infectious Precocity Flavivirus. Effective detection of this virus is a prerequisite for tracking, investigating, preventing, and controlling it, as well as other viruses in the same genus. Therefore, an effective method for virus detection is needed. Summary of the Invention
[0003] In response to the need for detection and control of infectious precocity flavivirus infecting crustaceans, this invention provides a kit for the specific detection of infectious precocity flavivirus, a novel species belonging to the Flaviviridae family, which can infect crustaceans.
[0004] To achieve the above objectives, the present invention adopts the following technical solution.
[0005] Infectious precocity flavivirus (IPSFV) belongs to the Flaviviridae family and has the accession number CCTCC No. V201870.
[0006] The infectious precocious puberty virus is spherical, a single-stranded positive-sense RNA virus, with a diameter of 40-60 nm. It can infect giant freshwater prawns (Macrobrachium rosenbergii). Macrobrachium rosenbergii Crustaceans such as .
[0007] The infectious precocious puberty virus refers to a virus belonging to the infectious precocious puberty virus family ( ). Infectious precocity flavivirusThis refers to viruses of this species, or those named under other names. Because infectious precocity flaviviruses are RNA viruses, their RNA-dependent RNA polymerases, used to replicate their own genomic RNA, lack 3'-5' exonuclease activity. Therefore, this enzyme has no error-correcting ability during replication, resulting in significant variability in all or part of their genome. Segments of specific sequences within the genome may exhibit homology ≥82.7%, and progeny viruses containing these variant bases still possess the ability to infect and replicate in the same host. As a novel virus, the International Committee on Taxonomy of Viruses (ICTV) may provide other naming rules. Therefore, "infectious precocity flavivirus" is used as a general term to refer to the virus of the same name protected by this invention, as well as all other viruses represented by other names that conform to gene or polypeptide sequence homology. The determined genome sequence of infectious precocity flavivirus CCTCC No. V201870 is shown in SEQ ID NO: 1. The amino acid sequences translated from the genome sequence include, but are not limited to: ORF1 with a start site at 968, a programmed ribosomal frameshift (PRF) of -1 at position 5518, and a stop site at 12090, totaling 3707 amino acids; ORF2 with a start site at 968 and a stop site at 5560, totaling 1530 amino acids; and ORF3 with a start site at 5686 and a stop site at 12090, totaling 2134 amino acids.
[0008] Since infectious precocious puberty virus (IPB) is a single-stranded RNA virus, the synthesis of its genomic RNA is directly replicated by its RNA-dependent RNA polymerase. During RNA replication, the RNA-dependent RNA polymerase lacks 3'-5' error correction function, making the genome prone to mutation during natural replication. Variations with ≥82.7% homology may exist within the entire genome or fragments of specific sequences. Viruses with these genomic sequence variations also belong to the infectious precocious puberty virus referred to in this invention. Therefore, the genomic sequence of the infectious precocious puberty virus referred to in this invention can be:
[0009] (a): An RNA sequence as shown in SEQ ID NO: 1; or
[0010] (b): RNA sequences with ≥82.7% homology to a partial fragment of (a); or
[0011] (c): RNA sequences with ≥82.7% homology to the entire sequence of (a); or
[0012] (d): A sequence formed by connecting multiple partial segments that meet the characteristics of (a) or (b).
[0013] Nucleic acid sequences containing the following sequence characteristics are also present in tissues infected with precocious puberty virus:
[0014] (a): A partial RNA sequence that is inversely complementary to the sequence shown in SEQ ID NO: 1; or
[0015] (b): The complete RNA sequence that is inversely complementary to the sequence shown in SEQ ID NO: 1; or
[0016] (c): RNA sequences with ≥82.7% homology to a portion of (a) or (b); or
[0017] (d): RNA sequences with ≥82.7% homology to (a) or (b); or
[0018] (e): A sequence formed by connecting multiple partial segments that meet the characteristics of (a) or (c).
[0019] Infectious precocious puberty viruses also contain proteins or polypeptides translated from their genomic nucleic acid sequences, whose amino acid sequences conform to the following characteristics:
[0020] (a): The amino acid sequence translated from all or part of the genome of SEQ ID NO: 1; or
[0021] (b): The amino acid sequence translated from a sequence that has ≥82.7% homology to all or part of (a).
[0022] A kit for detecting the above-mentioned infectious precocious puberty virus. The detection sequence of the kit is:
[0023] (a): RNA sequence of SEQ ID NO: 1; or
[0024] (b): (a) the transformed DNA sequence; or
[0025] (c): RNA or DNA sequences with ≥82.7% homology to (a) and (b); or
[0026] (d): An RNA or DNA sequence containing degenerate bases of (a), (b), or (c); or
[0027] (e): RNA or DNA sequences in which degenerate bases in (d) are replaced by hypoxanthine or other equivalent bases; or
[0028] (f): RNA and DNA sequences that are reverse complementary to (a) or (b) or (c) or (d) or (e); or
[0029] (g): A portion of any sequence from (a) to (f).
[0030] Optionally, the length of the detection sequence is 12 nt to 3000 nt; more preferably, it is 30 nt to 1200 nt; and most preferably, it is 40 nt to 600 nt.
[0031] A kit for detecting infectious precocious puberty virus, the detection sequence of which is the following amino acid sequence:
[0032] (a): A polypeptide sequence translated in whole or in part from the nucleic acid sequence of SEQ ID NO: 1; or
[0033] (b): A polypeptide sequence that is fully or partially translated from a nucleic acid sequence that is ≥82.7% homologous to (a).
[0034] The above-mentioned kit uses the nucleic acid sequence or polypeptide sequence provided by the present invention as the detection target, and employs nucleic acid amplification method, nucleic acid probe method, immune reaction of antigen-antibody recognition or nucleic acid aptamer recognition method for antigen recognition.
[0035] Furthermore, the above kit also includes one or more pairs of primers.
[0036] The primers can be nucleic acid-specific sequences that define bases or nucleic acid sequences containing degenerate bases, or sequences containing locked nucleic acids. For detecting nucleic acid sequences with ≥82.7% homology, the simplest approach is to treat mutation sites exhibiting single nucleotide diversity as degenerate sites of the corresponding bases, thus allowing the use of sequences containing degenerate bases with multiple mutant bases as primer sequences; hypoxanthine or other equivalent bases can also be used for this degeneracy approach.
[0037] The primers are 9 nt to 45 nt in length; preferably, they are 15 nt to 30 nt in length; more preferably, they are 18 nt to 25 nt in length.
[0038] Furthermore, the primers are selected from any two or more positive (F) and negative (R) complementary nucleic acid sequences as shown in SEQ ID NO: 2-SEQ ID NO: 45, or the nucleic acid sequence of SEQ ID NO: 1 between two of them or its negative complementary nucleic acid sequence.
[0039] When a single primer pair is included, conventional PCR detection, SYBR Green I-stained real-time quantitative PCR detection, digital PCR detection, or helicase-dependent isothermal amplification (HDA) detection can be used.
[0040] When more than one pair of primers are used, nested PCR or multiplex PCR can be employed. Nested PCR uses two nested primer pairs, with the outer pair serving as the outer primers for the first amplification step and the inner pair serving as the inner primers for the second amplification step. Multiplex PCR uses two or more independent primer pairs to detect infectious precocious puberty viruses or their variants at multiple loci or with different genotypes.
[0041] Alternatively, following the design requirements for loop-mediated isothermal amplification (LAMP) primers, the above-mentioned primer pair can be used as F3 and B3 primers. Inside these primers, four sequences can be selected and assembled to design FIP and BIP primers for LAMP detection. Another primer pair can be designed in the single-stranded loop region as LF and LB primers for enhanced amplification, enabling faster LAMP detection.
[0042] In primer design, artificial sequences, anchor sequences, or other designed sequences of 3nt-50nt can be attached to the 5' end of the primer, and other amplification and detection reactions can be performed according to the principles of anchor primer multiplex amplification detection or gene chip detection.
[0043] The detection method may further include a nucleic acid probe. The sequence of the nucleic acid probe is selected from the forward and reverse complementary nucleic acid-specific sequences shown in SEQ ID NO: 2-SEQ ID NO: 45, or the nucleic acid-specific sequence of SEQ ID NO: 1 between the two sequences or its reverse complementary nucleic acid-specific sequence.
[0044] Nucleic acid probes can be labeled with all nucleotides or specific nucleotides, such as DIG-dUTP, using digoxigenin (DIG), fluorescein, or radioisotopes. They can also be end-modified with DIG, fluorescein, reporter groups, fluorescence quenchers, or radioisotopes, for example, labeling the 5' end of the probe with FAM, HEX, VIC, etc., and the 3' end with the quencher group TAMRA, etc. They can be used for independent in situ hybridization or dot blot hybridization detection of the genomic nucleic acid of infectious precocious viruses or other variant homologous viruses. They can also be combined with real-time quantitative PCR technology for fluorescence quantitative PCR detection using TaqMan probes or Beacon probes.
[0045] The detection methods of the kit include, but are not limited to, conventional polymerase chain reaction (PCR), isothermal convection PCR, Tudor PCR, real-time fluorescence PCR, isothermal convection real-time fluorescence PCR, digital PCR, dot blot hybridization, in situ hybridization, loop-mediated isothermal amplification (LAMP), rolling circle amplification (RCA), single primer isothermal amplification, helicase-dependent isothermal amplification (HDA), cross-primer amplification, and nucleic acid express isothermal detection amplification technology; it may also include, but is not limited to, simultaneous detection of one or more infectious precocious puberty viruses and their homologs or variants by multiplex PCR, multiplex real-time fluorescence PCR, gene chips, and microarrays; it may also include, but is not limited to, simultaneous detection of infectious precocious puberty viruses and their homologs or variants by multiplex PCR, multiplex real-time fluorescence PCR, gene chips, and microarrays.
[0046] The detection method of the kit also includes a detection method using an immune reaction. The analyte or detection target is:
[0047] (a): The nucleic acid sequence shown in SEQ ID NO: 1, or a polypeptide or protein translated from a nucleic acid sequence with ≥82.7% homology thereto, is wholly or partially an antigen; or
[0048] (b): Antibody or nucleic acid aptamer of (a).
[0049] The antigen may be a whole viral strain, lysate, capsid, polypeptide, genetically engineered protein, or polypeptide. The antibody may be a polyclonal antibody, hybridoma cell, monoclonal antibody, or single-chain antibody. The nucleic acid aptamer may be one or more nucleic acid sequences of single-stranded RNA, single-stranded DNA, or single-stranded locked nucleic acid sequences obtained by screening one or more polypeptide-specific sequences using SELEX technology. Specific nucleic acid aptamers can be prepared through nucleic acid amplification, nucleic acid cloning, or artificial synthesis. The antigen, antibody, or nucleic acid aptamer may be prepared according to existing techniques.
[0050] The detection method of the kit can employ competitive, indirect, or sandwich immunoreaction methods, or it can use solid support or immunoprecipitation. The antibodies or antigenic fragments of the infectious precocious puberty virus can be labeled using existing technologies, such as fluorescent labeling, chemiluminescent labeling, radioactive labeling, or enzyme labeling. Amplification of probe signals can be achieved using biotin and avidin methods, enzyme-labeled and mediated immunoassays, such as ELISA.
[0051] The scope of protection of this invention also includes the antiserum, polyclonal antibody, hybridoma cell, monoclonal antibody, single-chain antibody or strain or cell line expressing single-chain antibody, nucleic acid aptamer or strain clonally expressing and producing nucleic acid aptamer for the aforementioned infectious precocious puberty virus. The antiserum, polyclonal antibody, hybridoma cell, monoclonal antibody, single-chain antibody or nucleic acid aptamer are prepared according to existing methods using a viral strain of infectious precocious puberty virus containing a polypeptide-specific sequence, lysate of the viral strain, or genetically engineered protein or polypeptide of the viral strain as an immunogen.
[0052] For example, the antibody against precocious puberty virus (PPV) is a monoclonal antibody. A concentrated PPV strain containing a polypeptide-specific sequence or specific antigen fragments, such as ORF1, ORF2, or ORF3 antigen proteins, can be administered to animals, such as mice. Appropriate adjuvants, such as Freund's complete adjuvant, can be added as needed for primary immunization. After an appropriate time interval, a secondary immunization can be administered as needed, using inactivated virus (or antigen protein) and an appropriate adjuvant. After an appropriate time interval, serum from the immunized animals is collected to assess mice suitable for spleen cell collection. Spleen cells from the suitable mice are fused with myeloma cells, such as FO or NS cell lines, using PEG. After screening for hybridoma cell lines with secretory capacity from the fused cells, a fused cell line is obtained that secretes a monoclonal antibody against PPV.
[0053] The present invention has the following advantages:
[0054] The infectious precocious puberty virus of this invention is a novel infectious precocious puberty virus that can infect giant freshwater prawns. This invention provides specific detection methods based on the characteristics of the infectious precocious puberty virus genome sequence, including nucleic acid amplification, nucleic acid hybridization, antigen binding, and nucleic acid aptamer recognition. It also provides reagent kits, detection equipment, and analytical applications based on these methods, offering new possibilities for the detection and control of infectious precocious puberty viruses in crustaceans.
[0055] Biological Preservation Information
[0056] Infectious precocity flavivirus, accession number CCTCC No. V201870, deposited at the China Center for Type Culture Collection (CCTCC), Wuhan University Collection Center, Wuhan, China, on January 24, 2019. Attached Figure Description
[0057] Figure 1 Agarose gel electrophoresis image for genome sequencing of infectious precocious puberty virus;
[0058] Figure 2Electron micrographs of giant freshwater prawns infected with transmissible precocious puberty virus;
[0059] Figure 3 Phylogenetic tree of infectious precocious puberty virus;
[0060] Figure 4 2% agarose gel electrophoresis image for detecting infectious precocious puberty virus;
[0061] Figure 5 A 2% agarose gel electrophoresis image of infectious precocious puberty virus detected based on reverse complementary sequences;
[0062] Figure 6 The results are from LAMP testing for infectious precocious puberty virus;
[0063] Figure 7 The results are from the quantitative real-time RT-qPCR detection of infectious precocious puberty virus.
[0064] Figure 8 Results of nucleic acid homology analysis of different infectious precocious puberty virus isolates;
[0065] Figure 9 Results of amino acid homology analysis of different infectious precocious puberty virus isolates. Detailed Implementation
[0066] The present invention will be further described below with reference to the embodiments and accompanying drawings, but the present invention is not limited to the following embodiments.
[0067] Example 1: Isolation, purification, and identification of infectious precocious puberty virus
[0068] 1.1 Separation and Purification
[0069] (1) Take 2-3 g of the cephalothorax of the giant freshwater prawn and add it to a centrifuge tube. Add pre-cooled TNEP buffer and 200 μL of PMSF isopropanol solution, and homogenize for 10 s at 10,000 rpm in an ice bath.
[0070] (2) The homogenate was centrifuged at 10,000 g for 30 min at 4°C in a high-speed centrifuge, and the supernatant was retained;
[0071] (3) Use filters with pore sizes of 0.45 μm and 0.22 μm to filter out tissue fragments, bacteria and other impurities in turn; centrifuge the supernatant at 120,000 g for 240 min at 4°C in an ultracentrifuge, soak it in TN buffer and shake it slowly to suspend the precipitate, and take 10 μL for electron microscopy observation.
[0072] (4) Based on the TEM scan results, a sucrose concentration (W / W) gradient of 20%, 31.5%, 43%, 54.5%, and 66% was laid from top to bottom in an ultracentrifuge tube. After being placed at 4°C overnight, the supernatant was added and centrifuged at 120,000 g for 240 min at 4°C. After desugaring, the virus was obtained and temporarily named Infectious Precocity Flavivirus.
[0073] (5) Whole genome amplification of viral sequences: Based on obtaining some novel infectious precocious virus sequences through high-throughput sequencing, primers were designed to amplify and verify long fragments of the whole genome. Figure 1 Then, the 3' and 5' ends were amplified using the SMARTER RACE cDNA Amplification Kit to obtain the whole genome sequence, as shown in SEQ ID NO: 1.
[0074] Table 1 Primers for genome sequencing of infectious precocious puberty virus
[0075] .
[0076] 1.2 Species Identification
[0077] Electron micrographs of precocious puberty virus, such as Figure 2 As shown, the virus is spherical, with a diameter of 40-60 nm. Based on the amino acid sequence of RNA-dependent RNA polymerase (RdRp) of Flaviviridae (genus) viruses, comparisons were performed using Muscle software, and a maximum similarity phylogenetic tree was constructed using Mega software. Figure 3 A phylogenetic tree constructed based on RNA-dependent RNA polymerase (RdRp) ( Figure 3 The results indicate that the virus belongs to a new species of the Flaviviridae family. It has been deposited with the accession number CCTCC No. V201870.
[0078] Example 2 Infection of Giant Freshwater Prawn by Infectious Precocious Puberty Virus
[0079] Homogenize samples of diseased giant freshwater prawns, sterilely filter and ultracentrifuge them, and then artificially infect them through feeding and immersion experiments. Both methods successfully infected the prawns, with the main symptoms being stunted growth and precocious sexual maturity. Electron micrographs of giant freshwater prawns infected with infectious precocious puberty virus are shown below. Figure 2 As shown in the image, viral particles of infectious precocious puberty virus were visible in all samples of giant freshwater prawns.
[0080] Example 3: PCR kit for detecting infectious precocious puberty virus
[0081] Primers were synthesized according to the sequences in Table 3, and PCR kits for detecting infectious precocious puberty virus were prepared according to the concentrations in Table 2.
[0082] Table 2. Composition of the PCR kit for detecting infectious precocious puberty virus.
[0083]
[0084] Table 3 Primer sequences for detecting precocious puberty virus
[0085] .
[0086] Please refer to the following methods for testing:
[0087] Take 20 mg of diseased giant freshwater prawn samples and samples from giant freshwater prawns infected with Tembusu virus (TMUV), giant freshwater prawn Nodamu virus (MrNV), yellow head virus genotype 8 (YHV-8), mutated Nodamu virus (CMNV), and healthy giant freshwater prawns, and place them separately in 1.5 mL RNase-free EP tubes. After grinding, add 0.75 mL of TRIzol to each tube. TM Mix the reagents thoroughly by vortexing and incubate at room temperature for 5 min. Centrifuge at 12,000 rpm for 5 min at 4°C, and transfer the supernatant to a new RNase-free microcentrifuge tube. Add 1 / 5 volume of chloroform, shake vigorously for 15 sec, and incubate at room temperature for 5 min. Centrifuge at 12,000 rpm for 15 min at 4°C. Carefully aspirate the upper aqueous phase and transfer it to a new RNase-free microcentrifuge tube. Add an equal volume of isopropanol, invert the tube to mix thoroughly, and incubate at room temperature for 10 min. Centrifuge at 12,000 rpm for 10 min at 4°C, and discard the supernatant. Add 1 mL of RNase-free 75% ethanol, invert the tube to wash the precipitate, and centrifuge at 7,000 rpm for 5 min at 4°C. Carefully discard the supernatant. Air dry the precipitate at room temperature. Dissolve the RNA precipitate in 20 µL of RNase-free water and use immediately for RT-PCR or store at -80°C for later use. Immediately before use, adjust the RNA template concentration to 500 ng / µL. Reverse transcribe into cDNA, then perform nested PCR amplification using the systems shown in Tables 4 and 5.
[0088] Table 4 First-round PCR amplification system
[0089]
[0090] Table 5 Second-round PCR amplification system
[0091] .
[0092] The specific reaction system and conditions are as follows:
[0093] Prepare a large-volume premix (excluding Taq DNA polymerase) and aliquot it for storage at -20°C. Before detection, aspirate the enzyme-free premix and add the appropriate volume of Taq DNA polymerase, mix well, and aliquot into 24 μL tubes. First-round amplification program: denaturation at 94°C for 2 min; 30 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 55 s; extension at 72°C for 10 min. Second-round amplification program: denaturation at 94°C for 2 min; 30 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 30 s; extension at 72°C for 10 min.
[0094] The PCR products were electrophoresed on a 2% agarose gel, and the results are as follows: Figure 4 As shown. Figure 4 The initial amplification band of 871 nt can be observed in (above). Figure 4 A secondary amplification band of 319 nt can be observed in (below). Figure 4 In the study, no amplification bands were observed in TMUV (1), MrNV (2), YHV (3), CMNV (4), normal giant freshwater prawns (6), and water (7) in either the first or second round. However, diseased giant freshwater prawns (5) amplified a target band of 871 nt in the first round and a target band of 319 nt in the second round.
[0095] Example 4: PCR kit for detecting infectious precocious puberty virus designed based on reverse complementary sequences
[0096] Primers were synthesized according to the sequences in Table 5, and PCR kits for detecting infectious precocious puberty virus were prepared according to the concentrations in Table 6.
[0097] Table 6. Composition of the PCR kit for detecting infectious precocious puberty virus
[0098]
[0099] Table 7 Primer sequences for detecting precocious puberty virus
[0100] .
[0101] Please refer to the following methods for testing:
[0102] Take 20 mg of diseased giant freshwater prawn samples and samples containing TMUV, MrNV, YHV-8, CMNV, and healthy giant freshwater prawns, and place them separately into 1.5 mL RNase-free EP tubes. After grinding, add 0.75 mL of TRIzol. TMReagents: Vibrate thoroughly to mix, incubate at room temperature for 5 min; centrifuge at 12,000 rpm for 5 min at 4°C, and transfer the supernatant to a new RNase-free microcentrifuge tube; add 1 / 5 volume of chloroform, shake vigorously for 15 sec, and incubate at room temperature for 5 min; centrifuge at 12,000 rpm for 15 min at 4°C. Carefully aspirate the upper aqueous phase and transfer it to a new RNase-free microcentrifuge tube; add an equal volume of isopropanol, invert the tube to mix thoroughly, and incubate at room temperature for 10 min; centrifuge at 12,000 rpm for 10 min at 4°C, and discard the supernatant. Add 1 mL of RNase-free 75% ethanol to each tube, invert to wash the precipitate, and centrifuge at 7,000 rpm for 5 min at 4°C, carefully discarding the supernatant; air dry the precipitate at room temperature. Dissolve the RNA precipitate in 20 µL of RNase-free water, and use immediately for RT-PCR or store at –80°C for later use. Immediately before use, adjust the RNA template concentration to 500 ng / µL. Reverse transcribe into cDNA, then perform nested PCR amplification using the systems shown in Tables 8 and 9:
[0103] Table 8 First-round PCR amplification system
[0104]
[0105] Table 9 Second-round PCR amplification system
[0106] .
[0107] The specific reaction system and conditions are as follows:
[0108] Prepare a large-volume premix (excluding Taq DNA polymerase) and aliquot it for storage at -20°C. Before detection, aspirate the enzyme-free premix and add the appropriate volume of Taq DNA polymerase, mix well, and aliquot 24 μL / tube. First-round amplification program: denaturation at 94°C for 2 min; 30 cycles of 94°C for 30 s, 59°C for 30 s, and 72°C for 65 s; extension at 72°C for 10 min. Second-round amplification program: denaturation at 94°C for 2 min; 30 cycles of 94°C for 30 s, 59°C for 30 s, and 72°C for 30 s; extension at 72°C for 10 min.
[0109] The PCR products were electrophoresed on a 2% agarose gel, and the results are as follows: Figure 3 As shown. Figure 5 A primary amplification band of 1038 nt can be observed in (above). Figure 5 A secondary amplification band of 395 nt can be observed in (below). Figure 5In the study, no amplification bands were observed in TMUV (1), MrNV (2), YHV (3), CMNV (4), normal giant freshwater prawns (5), and water (6) in either the first or second round. However, diseased giant freshwater prawns (7) amplified a target band of 1038 nt in the first round and a target band of 395 nt in the second round.
[0110] Example 5: LAMP detection targeting specific sequences of infectious precocious puberty virus.
[0111] First, synthesize the primers shown in Table 10, such as SEQ ID NO: 38-43, and then perform the detection of infectious precocious puberty virus according to the following steps:
[0112] Table 10 LAMP primers for infectious precocious puberty virus
[0113]
[0114] (1) Preparation of template RNA: Take 20 mg of giant freshwater prawn sample into a 1.5 mL RNase-free EP tube, grind it, and then add 0.75 mL of TRIzol. TM Mix the reagents thoroughly by vortexing and incubate at room temperature for 5 min. Centrifuge at 12,000 rpm for 5 min at 4°C, and transfer the supernatant to a new RNase-free microcentrifuge tube. Add 1 / 5 volume of chloroform, shake vigorously for 15 sec, and incubate at room temperature for 5 min. Centrifuge at 12,000 rpm for 15 min at 4°C. Carefully aspirate the upper aqueous phase and transfer it to a new RNase-free microcentrifuge tube. Add an equal volume of isopropanol, invert the tube to mix thoroughly, and incubate at room temperature for 10 min. Centrifuge at 12,000 rpm for 10 min at 4°C, and discard the supernatant. Add 1 mL of RNase-free 75% ethanol, invert the tube to wash the precipitate, and centrifuge at 7,000 rpm for 5 min at 4°C. Carefully discard the supernatant and air-dry the precipitate at room temperature. Dissolve the RNA precipitate in 20 µL of RNase-free water and use immediately for RT-PCR or store at -80°C for later use. Before use, adjust the RNA template concentration to 500 ng / µL;
[0115] (2) Preparation of the reaction system: 0.2 µM each of primers HE-F3 and HE-E3, 0.8 µM each of primers HE-FIP and HE-BIP, 1.6 µM each of primers HE-LF and HE-LB, 1.4 mM each of dNTPs, 6 mM MgCl2, 1.2 M betaine, 20 mM Tris-HCl, 10 mM KCl, 2 mM MgSO4, 10 mM (NH4)2SO4, and 0.1% Triton X-100. BstAdd 8 U of DNA polymerase to sterile double-distilled water to bring the final volume of each tube to 25 µL. After the above reaction system is prepared, mix well and dispense into sterile EP tubes (200 µL).
[0116] (3) Perform gene amplification reaction according to the following reaction procedure: incubate at 63℃ for 40 min, then incubate at 80℃ for 5 min;
[0117] (4) Determine the detection results: After the reaction is complete, add the nucleic acid dye GeneFinder to the reaction system. TM Add 0.5 µL of the sample and observe the color of the reaction product under sunlight. If it is green fluorescence, the result of the test for infectious precocious puberty virus is positive. If it is light orange, the result of the test for infectious precocious puberty virus is negative.
[0118] Using the above method, samples of giant freshwater prawns carrying infectious precocious puberty virus (RFPV), samples carrying Tembusu virus (TMUV), and samples of Litopenaeus vannamei carrying white spot syndrome virus (WSSV) from different sources were tested. Sterile water was used as a negative control. The results showed that sample tubes of giant freshwater prawns carrying RFPV as the template showed green fluorescence, while templates from other sources and sterile water tubes all showed light orange fluorescence. Figure 6 ).
[0119] Example 6: Quantitative Real-Time RT-PCR Detection Kit for Infectious Precocious Puberty Virus
[0120] Synthesize primers and probes according to the sequences in Table 12, and prepare the fluorescent quantitative RT-PCR detection kit for detecting infectious precocious puberty virus according to the concentrations in Table 11:
[0121] Table 11 Composition of the Real-Time RT-PCR Kit for Detecting Precocious Puberty Virus
[0122]
[0123] Table 12 Primer and probe sequences for quantitative real-time RT-PCR detection of infectious precocious puberty virus.
[0124]
[0125] Take 20 mg of diseased giant freshwater prawn samples and samples containing TMUV, and place them separately into 1.5 mL RNase-free EP tubes. After grinding, add 0.75 mL of TRIzol to each tube. TMReagents: Vibrate thoroughly to mix, incubate at room temperature for 5 min; centrifuge at 12,000 rpm for 5 min at 4°C, and transfer the supernatant to a new RNase-free microcentrifuge tube; add 1 / 5 volume of chloroform, shake vigorously for 15 sec, and incubate at room temperature for 5 min; centrifuge at 12,000 rpm for 15 min at 4°C. Carefully aspirate the upper aqueous phase and transfer it to a new RNase-free microcentrifuge tube; add an equal volume of isopropanol, invert the tube to mix thoroughly, and incubate at room temperature for 10 min; centrifuge at 12,000 rpm for 10 min at 4°C, and discard the supernatant. Add 1 mL of RNase-free 75% ethanol to each tube, invert the tube to wash the precipitate, and centrifuge at 7,000 rpm for 5 min at 4°C, carefully discarding the supernatant; air dry the precipitate at room temperature. Dissolve the RNA precipitate in 20 µL of RNase-free water, and use immediately for quantitative RT-PCR or store at –80°C for later use. Before use, adjust the RNA template concentration to 500 ng / µL, and then perform real-time RT-PCR amplification using the primers shown in Table 12.
[0126] The specific reaction system and conditions are as follows:
[0127] Table 13. Quantitative Real-Time RT-PCR Reaction System for Detecting Precocious Puberty Virus
[0128]
[0129] Calculate the volume of each component in the reaction system based on the number of samples, and add them to 1.5 mL RNase-free centrifuge tubes under light-protected conditions. Perform three replicates for each sample. After thorough mixing by inverting, quickly aliquot the mixture into eight-tube bundles. Add the sample RNA to the eight-tube bundles in sequence, centrifuge, and then perform quantitative PCR. The specific reaction conditions are as follows: reverse transcription at 55℃ for 10 min, denaturation at 95℃ for 1 min; then 95℃ for 10 s, 60℃ for 30 s, for 40 cycles.
[0130] The test results showed that TMUV and negative control did not produce a peak, while positive control and positive test samples did produce a peak. Figure 7 ).
[0131] Example 7: ELISA kit for detecting precocious puberty virus antigen
[0132] This kit consists of: one 96-well plate coated with a 10:1 rabbit anti-precocious puberty virus polyclonal antibody, 10 mL of bovine serum albumin blocking buffer, 0.5 mL of a 160:1 mouse anti-precocious puberty virus monoclonal antibody, 0.5 mL of a 160:1 horseradish peroxidase goat anti-mouse IgM secondary antibody-enzyme conjugate, TMB chromogenic solution, 2M sulfuric acid, 5 mL of tissue lysis buffer, 100 mL of washing buffer (PBST, NaCl 0.8 g, KH2PO4 0.02 g, Na2HPO4·12H2O 0.29 g, KCl 0.02 g, Tween 20 0.05 mL, sodium azide 0.01 g, diluted with double-distilled water to 100 mL, pH 7.4), 5 mL of PBS sample dilution buffer, one positive control, and one negative control. Perform the assay according to the following steps:
[0133] (1) Coating and blocking: Dilute the antibody to an appropriate concentration, add 100 µL to each well, and incubate at 37°C for 4 h; discard the liquid in the wells (to avoid evaporation, the plate should be covered or placed flat in a metal humidifier with a damp gauze at the bottom); block with 5% fetal bovine serum at 37°C for 40 min. When blocking, fill each reaction well with blocking solution and remove air bubbles from each well. After blocking, wash the wells three times with washing solution for 3 min each time. Washing method: aspirate the reaction solution from the wells, fill the wells with washing solution, let stand for 2 min, shake slightly, aspirate the liquid from the wells, pour out the liquid, and pat dry on absorbent paper;
[0134] (2) Add the sample to be tested (establish a suitable concentration gradient): The dilution ratio is generally 1:50-1:400, and the sample volume should be >20 µL. Add the diluted sample to the enzyme-labeled reaction wells, with at least two wells per sample, 100 µL per well, and incubate at 37℃ for 60 min. Wash the wells three times with washing buffer, 3 min each time;
[0135] (3) Add enzyme-labeled antibody: according to the reference working dilution provided by the enzyme conjugate provider. Incubate at 37°C for 60 min. Add 100 µL to each well. Wash as before;
[0136] (4) Add substrate solution (prepare fresh for use): Add 100 µL of TMB-hydrogen peroxide urea solution to each well and place at 37°C in the dark for 3-5 minutes;
[0137] (5) Termination of reaction: Add 50 µL of termination solution to each well to terminate the reaction, and measure the experimental results within 20 min;
[0138] (6) Result judgment: The absorbance values of each well at a wavelength of 450 nm were measured and the results were judged. The results are shown in Table 14:
[0139] Table 14 ELISA test results
[0140] .
[0141] Example 8 High-throughput sequence analysis of infectious precocious puberty virus
[0142] Six positive samples of infectious precocious puberty virus (IPV) were selected from the infected giant freshwater prawns of Example 2 and confirmed positive by electron microscopy and Example 3. Simultaneously, two IPV-positive samples were obtained through epidemiological sampling using the methods of Examples 3, 5, and 6. RNA was extracted from all eight samples, and host ribosomal RNA was removed using a commercially available kit. Libraries were constructed, and sequencing was performed using Illumina Hiseq. The sequencing data were then assembled and analyzed using Genious (version 11.1.5) and DNAstar biological software. The results showed that the IPV nucleic acid homology was lowest among the eight samples, at 82.7%. Figure 8 The lowest amino acid homology was 84.2%. Figure 9 ). sequence list <110> Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences <120> A Flavivir of Crustaceans, its Detection Method and Application <130> 20191105 <160> 1 <170> PatentIn version 3.5 <210> 1 <211> 12630 <212> RNA <213> Infectious precocity flavivirus <400> 1 aauaaaaaac augccguuua acggcuuguu uuuuauucug ugggggguguc uuuugccaga 60 120 agaacccaac uaacaggguc uuuuucaaaa uucaaccccu uuucaaacuc uuucuagcgu 180 cuuuuacaau uugaguuuug uuucucaagg gguggagaga ggaacucguu gucccgcgcg 240 uaaucucuac accucgccca auuggucgaa cuuuuguaa uugauacugu uauucuacua 300 ugcaaugggg aggggacuaa ccgaagucag agcgacagcg agagccuugu uuggggcgcg 360 acuuguaagc uuuuggguuu guuugaggug ugaaaguuuu gggacgaucc cagacccggu 420 auuuuagcua uccguggugu ggaaccuaag uaagagacag ccgaaacaaa augugguga 480 agcuguaagc ccagcuuagg caaccaggug acucucauua ccggaacacu ucuagaacuc 540 aggggcugaa ggggcgggcc ucacacuugg cucuuguuua ugguggcaga cuaaagcccc 600 auuuaaugcu ucucaugaug aacuagcggg guguuacuac uauccaagcc uuaaacacca 660 caacaagucag uggucucaug agaaccugau uuggagugcu ccauuuggca cuuuucgccu 720 ugaaguuccu ccgucagugg cccucuuugu gcuuggggac uuccacauau gauagguuag 780 uuacuuaaac cagagcguag caguauccccc ugccuaggga cuggugcuag ucaucgaaac 840 aggagggauc gcccagcucg caacugggu acgcccuagg gacguugaag cuuggacaaa 900 cuaacagua cuccaaguu aaagcacacc cacuuuugaa cuaacuag ucaagagucu 960 agucaguaug gcuaaguuag agaagaaaaagggccaa agagguaaa cucagcagcc 1020 acuaaaaacag ccaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaag 1080 gaaagugaug gccaauccaa chuuugaagg uguguuuug chuuccuug ggcugguagc 1140 chick cuckcuckcu uaaggugau aguagcuuua cuckoo cuckoo 1200 ucuuauuuug gccauggcua aaccaacuaa agccauagac auucguugua uagaaacgug 1260 ugggagugu gcgccggaau gcuuccagau gaaccagguu ggaggshaau ugcagggaa 1320 ucacacgugg guuuccgcug cuauuuca uuccauggaa auuaccuuag ugaacguug 1380 uccgaaagaa ggcaagucac gcggaggcga ucuggaug ccaauauggc uacaugucac 1440 uccgaaacu cauagagua aaagggagac aucugaucug caugcuugaug cauagauca 1500 gcacucaac uucauccuu uugagaauuu gcagaguugg uggaggac caacgcagug 1560 gguugogggu wuauuuac ucucccuuac oagagaagug quaggaggua aagcuguggc 1620 auagugouu uuagcaagu uguugaugcc agggacauau gcgugugauu ggauacaacc 1680 auuaggucuu gauguguca gccacucaga uguguacgcu ucauuccca uggauggug 1740 ugugacuggc augguugagc aagaucccau ouuguuuaga guaagcccca aggaugaugc 1800 cacuauuuuuu aguuuggagg agguauacc aagaccuua guggucucug agcacacac 1860 Oucacaugo Chagguga Cuugouga Oogogouacc Gaaggugau Acugugaga 1920 uaagacaacc ccucuuggau ggucagaugg auguuuuuuc auugcagcag cucuuggaug 1980 cacuugcuu aacuaacug cuccuguga uccuuacaag guguuucuu cuggucucu 2040 caugcagau cgucuaccca cuguuuugag ugugaguau aaaggaaag uccaugaggu 2100 gcccuugaau ggagacacgg gcuuuguuca uccggcucuu ggacgaguuu uggcucuug 2160 ugaugaacu gauccguuac crab acgauuguu gugcaaguug auagacuga 2220 ugcugaagcg ucuaugugug agauccacuc ucgucuuca acacaauag gaucacccca 2280 ugcaccagga cuggugagc gaguuuuugga uggaacagg gcuaucaggu ggcaugcuug 2340 uaccucagaa gguugugguu augauuucgu ugagaguugg gacgacauug uuaguaaaga 2400 acuccucaau gcuaaauguu augaagggaa aguacccuu auugaaggcu ucuuuagacc 2460 cacccaacug aaacucaca acucauggaa uugccgucug aauuuugaac ggauuaucac 2520 cacagcccca uauucaaacc cuugugauuu gucgguuagg ccgacuguac gagucacucc 2580 ugaggaaaua caaauagcg uaaaucacac cgauuuggaa uguucugugg cuuucaguuc 2640 gccaugcugg cuuucaagag gauggauguc aagagaacag caacaaccga uaaaguauau 2700 auguucugag gacaguuuug ugaugguugg ugaucagagg gucccuuuga aaaagucucc 2760 uuuuaucac uuaucauacc auuauaucca gagggcuuau acacaggugc agcauuaugu 2820 agguaaagu aaaauugauu caugaouca agccuugagg acuggaguga guaacuacuc 2880 ccaguuuaug cacaauacuu uuggcaaacu cuuaggauc uggaaccccu ucuuggcccu 2940 cgucauggcg gcaggagugg cuuacuucuu cuuuggaagg aaaguggcca uuguugucgc 3000 ucugcugguu ggcguuguag cgguuuucgg agccgaagac uauugugcag uucuggggagg 3060 acaccagggg cggauuguu cucuacaca auuuguuuug cguuuggga aguuuuuug 3120 cuguguugag aagugcacgg gugugugugc uaguugcccu cucgaggaug ccguagggg 3180 agucugcccu agaggucugu gcugxagac agcucuc gcgacugug cucuuaugg 3240 uggggouuuu gcugauagou gugagggucg ugaaaocuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuga oooougcccc ooooooooooooooooooooooooooooooooooooogg 3360 aggguuuugu gauaauugaou gguacuguug uaauauaaaca agggccacua ccaucaagcc 3420 uguaccaauu caacuacca cauccucuac guugacuaca acaacuacca cucaggagac 3480 uacaacu uccccgaagg uugacaccac ccuuucaacc acgcagcuuu uucuucac 3540 spider spider spider spider spider spider 3600 ucgugaaacc acacagaaac acguggaagg 3660 aagccuuguu uacuauucua gcacuacuga uaauuauauaau guacaacau uacagccaa 3720 cauacagu gaguacua caacuaugac aacgcagagu gcagaggaag aaguougugg 3780 ucaaguagga gguuaugugg gggauuguga cgaguacaua augguagggu cgaccaaoug 3840 uugcaggaau gcccagguga agcccuauua cugucgaagu ugguaaauu cuguagacag 3900 guuuauaucc uggaugggcu ucucaacca ugagguuuuc cccauggggg agaagucca 3960 uaaaggaugg uacacugauu uaaaggauu uacacugauu gcacagcacc 4020 aaggcacguu ucaggaggcc uacugccuga agcacaaccc aguccaauu guacacaagg 4080 gcacuuuuca guggagggag uuccauucca gaaccaauu guggaua aguaogguga 4140 gcgaguuugg auugcuauca uacauccuau gaccccagga cagucaggaa uccuguguu 4200 ucaaggagcg acuucugug gagucuuggg guaaggucuu aagacagaug gugaaugua 4260 caaccuauua gcacgagagg agacauca uccacagga gagggouuug gcuoggacga 4320 gcuagucaac aucaaguug gaauggaug gaucuuug aagcgaggac cacuuagac 4380 auguugggcu ccgcgacacu uacacugcc cunccagag ucccuucca auccagauug 4440 cucaaagua acuuuugaga uagaugggga accagugacu cguggcguga cuagagcua 4500 uguuuuaagga gugcaguuca auuagucca uuuucccacc aagccagguc agucgggaau 4560 aguccuuagg gaggguuccc gagugugugg uuucuuggc uauggguaggc aagcaauagg 4620 auccgacaac uuuaugaacc uccugggacc agaaucagaa auaauagaau ggaggggauc 4680 uucgaccacgc acaagauguu cauacacagu uggagcacac ucaaaaaaca uagacauauac 4740 accuauaugc acaauuaugc aagcaaccau caauaaacac uugugcgggc aggcuuaac 4800 4860 ggcuucccuc cuagaaccag aggggcugug cccagaacaa cauguagagg gauaugccgc 4920 acuauugagu gaacaagaug gaacugggc cguaacguug ggacaagcuc aagugaaaug 4980 ggugaacauu uaugugucuu ucacguuaaa uccagugaaa acagccaugu caucaucaca 5040 ugauguucac cuagcaacu ugcccuuggg ggucacucuc uucguuuag aagagggugg 5100 agcaacugac ggaaucaca ggucagccac uucaauauauauauggcccc aaaucgccug 5160 guugucuccc ucguccacag uccuggcuca uggaacggga ugguggacaa acacugaguu 5220 gguuagaguu cccgcgggcu cugaacugcc aaacugcaaa gggggaaagc caugguauaa 5280 gaccguggaa cgcucaagaa cggaacggca ggacuuuaa agcucaauua aauacugca 5340 ugcuagggcu cgcaaaaaca aacaaucaau acuguauuug guugauccgg aucuaauaau 5400 uacagauugg ccaucaaugu uucaagguac ccuugagaug gaagggac caugggauc 5460 cggcuaccaa acucugguga uaggccacaa gaagaaau gaucuugcag auugucagga 5520 uuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu ccucuaucua cuucugauca uuguuauggc gauugucaca uugucaauag ucauagugaa 5640 gcacaggagg aaguccaaau ugauaucacg gacggcgagc ucuuuaugaa cucagcugug 5700 gaacaggaga ugacaucgcu gucugaugcu auaaauaguuc uugcaaccuu ugucuacguu 5760 ugcauacuug uggaugugau gacagagaau auaacaaacu auuaugaggu uagauugaga 5820 uugacuuuua gggaacuaga ugaagcaguc ucagccaugc gugaugggau uccuuuggac 5880 cagauaguuc caccaggaaa gaacaagcaa guccaccucc agcaguuguc agccgcuaug 5940 ggaaacucuu ugucuagguc acaaauucag gcaaaugcaa uacauccucc uaugaaccc 6000 auuagagaaa gugacaaguu agguaaggaa ggucugucac cuauggaaa uaucuuuuu 6060 aucuguguuc ccuuaaugcc ggaagucuca guccucuuuc uugcuugguu ucguuuuaac 6120 uggaagcugg cucagucauc accagccugg caaguuuaca uggcaaugau uggcuauuug 6180 ucagugcacg uguuuguugc cacucaaagu uucguuuuug uggcccuagu ucuuucggug 6240 uucucgcuuc cugaguuuua uuugucuuug uuauuccgc gaucaguaga gucuguuuuc 6300 aggacgcgag aguuaaccua ugcuaugggu gugacuuucu auaccgucac aaaagcuauu 6360 cuuuuguugu augcuaggcu ugcagcucuu uuuuuagcu cagccguugc cgauccuauu 6420 cuugucaugu uggcuuuggg cuuugcccug ucagccaugg guccaucugg aguauugauc 6480 ggagcuuuug ugaugacucc ugaacaguu caugcucaau cuacaucaaa uagaaccagu 6540 uuaaauuuac aacaucauau agcugaaacc ucuuuagaag caucaaaguc uaugucacau 6600 ggaucaucca ucacucgaaa ugcuaaagca cucaougagg uuaucggag gcagccaggg 6660 cuugccauuu cuuuugggu aaccauggcu uuacucuuug auuauucucac aggcuuuuaac 6720 acagucuuuu gcacgccacu gguaaugugg uacuugucuc agagccucuc agguuuguu 6780 uugucgcagc aaacuaggca gccaugcaau ggugauauuc ugcguauaac aucacguagu 6840 6900 6960 gauuauguuu ugaugagggg ugaaguguau aaucuuaugu ucacagauaa ugacauauca 7020 uccuauggug agccugcu gaugguuccc auuacagagg gggaaacugu caauguuuuc 7080 cugucuaaag caggggcaa gguuaagagg aucauagguu caccaacccc uuaucuagga 7140 accacauccu ggacccugcc uugucaugac aucgucaagg ggaugucugg gucuccagua 7200 cucaacuccg agggaaaggu agcaggacuu guaacagcca aaguggagcu ugauggguuu 7260 augcaccuug uuuuuagcac uauucccugc auuucaaaga cuaugagaac aucuaggcag 7320 ggaucauuua ccauacaccu aaaacacccu ggggccggga agacaagggu ugauaucaag 7380 aauauagcg acagggcuga gaagcgggu aggaagugc ucguucuagc uccaacuaga 7440 guugucgcca gggaaaacua ugcuguccuu gggggggcuu ugaaguguuc ugaugccaca 7500 caagaggagc gucaggggac uaguccuguc auuaugacuc aucaggguuu cuacaaauua 7560 gcuuugcaga gaauuccuu uaccuaugau guugucgugg uugaugaagg ucacuaugag 7620 aauuccagac cucugauccg ucucuaagau ucauuuguu ucaugagaaaa acauuuugcuu 7680 accgcaacau ggcaugcgaa uggucagcuu aaaacugaac agggcucaaa uuucucaaua 7740 gcugauuccg uggucccuaa acuaauca uaucuugacc auguugagga cauuauaggc 7800 gcuaaccccu cuauccaaag augggucgug uucuguccua gugcaguugg aaccaaugga 7860 gcagaagu gcgcucagcg guuccagaac aagaacaugg aggcaguuuc uauauaccgc 7920 gccaaguaug gugaggcag gaaggagua gcaaaacacg ccggaccacu caucaucugc 7980 8040 uggcgcgucc uuccugugca gaaaacccga accauuucag acuuagggu cagacccauu 8100 acaauggccu cuauugucca gcagagggggg cguguuggga ggcgcagacc ugguagugcu 8160 uggcugguaa aggauggaga acugcuuaau gaguaauag augaugaag cacacacuug 8220 uacagagacu gccuagacua cauccagaac cauggaaugu augcuuggca gacucuuccc 8280 uuaaccaaga aagagucaca gaucauagau auguaaggu cucuuaagu uccuagaa 8340 cacgacugga auaggcgcac aacuccuuc cuauggcuc auggcauuga ggaugugcgu 8400 cgagcugguc caggccugua ugacaccucc auaggcaag aacuugaugc cuugauguc 8460 augugccag aguugugggg ucacagugu aagacaggua uguucaugg ccuucuggug 8520 uguuucguuc uagucuucu cuagcuaug ucauauugccu acauacca uggagguagg 8580 caguaugacc uacacuccau guguguuucu auucuggag gaacuuucau ggagaugacu 8640 ggguuggagc ucauucc acuucgucau uuagugaac aucuuuuugg gcccuacaua 8700 acucuuugga agcuuuuuga uaggaucaua ccacgccaag uuauuucagg gaaggucccu 8760 uuaccaaccu uggccgcuuc uuaccacgcug cugcuuuugc uuaccaaccu cucuccaca 8820 guaaaaacagg caguuguuga ucaccccucca uuacuccuuu ggucgcuucc 8880 cugcuuuaa gcuggacguc acugagaa gucucagcua gucucucacu cucucagua 8940 gcacuucuuc uaaugcugu gcguauguca gccgaaacca gaugacagg uaagugcgca 9000 gaccgggugu auugcuggu gucuauaauuc caccagugu accaguccu ucuugguaua 9060 aguaugagag uuuuuccugu uuuugagguu ccaccuugc cugcucuucu ugcugauucu 9120 cuckoo cuckoo aggugauguc aguagauccag auuacuccca uuguagucau gcuccaagcc 9180 aucuucuugu cagucgcuga neighborhood aucuucuugu uggcuaggaa ggcauauaaa 9240 cgggggacaa agcgggaguu accuccug ougagauuuuu ccagauuguu 9300 cccaucauug uuuguauugu ugagguuuuc cuucauug uuguccucccc uuuucccacg 9360 stir up stir up stir up stir up uuauguugcg 9420 ucuucuuggg gugcagcagc gugugggaau cagauagcgg ggucggcagc ucgcagagca 9480 gaggccaucc quaagugcc aagagagca guucccaacg cauaugcau ggugacaaca 9540 cucucuugg ccgccaccca guuucuugg cuucgaugga ucggcuuggc ugguuaugug 9600 cucucucucu cucucucucucucucucucucuag uuacugacag uuggcucug 9660 aauuugugu uggcuaugcc cacauacuu ugcugcua gugagcagag gugguuuacc 9720 gcggccagug ucuaucucau vakaggagcc agcccuuuuu ggcgagacuc gauguuugga 9780 gccacacaca siacagaugg aagggagagg gcacgacagu acugcugcc aaauauccua 9840 gcagcuuuua ggaggagau uucaaguug ucaucugcag agcuuaugc cuuuccuca 9900 uauugauaugc cagaauuga uauugacacca gaugaacaga agaggoaugu ugaaaguaug 9960 gcuggggagg augucuuaugu auccacgucu acauchaugg aucucucacu cuggaugg 10020 cucciaaccc ucuuccgccu ccaugccgcc cuggaccca gagucuugga ccuaauggaa 10080 gaguugagg gcguucuuuu ugaccaccc ggaucuag augacgaauu cucucugugg 10140 guccagaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaoooooooooooooooooooooooooooooooooooo so so far caugagagau uaaagaggua caagcaug gacccuggac aaaaaaagaa uauacgcccg 10260 uucccagaag accuugagug cacaguucca aucuccagac augucucggg ugucaucaac 10320 aaacucauaa gugauuaugg uuuagagaug auuucugaga cuuuucucaua cagaguugggg 10380 gaccugagag cuucuuuuuc uuggcacaag augggaucaa auucugaggu agucaacaga 10440 guaauagcuu ucuucaccuc uaaguucgcu ccuuauuuua gguacuauca aacucuuuac 10500 agagccuaca ccuuacuuc aacaaaaauu ugggaugugu gguacauguu uaaguugaag 10560 10620 gaugaccugu cccggaaucu gccaagcaug ccccugcuua cagagcagga gauuggagca 10680 gcccucaacc gcaaaggagc cagcggaaug cccccuccgu augacaacaa aaccuugggg 10740 gaacucuggg acgaugacau cuucagggcu ggcuuuuggg auuuuuguuuc agagguuaga 10800 ucuggaauug ucaccggccu cgaguuuuuuc cauacgaugg gcaaaagaga gaaaagau 10860 cuccuuca aaccaagaag aaguucccga cugauagccu aucuuccugc uuacuauaga 10920 10980 gcaguaaccc acauaccuuu gguagauuau ggcgaucuga uggcuggcuu ugaagcauac 11040 gaagccaaug auguggaggc augggauaca aaggucggua gucaauuucu agauuuggag 11100 gaucauuucu uuagaggucu cucgcaugau ccucuucuag uugagagaau auugagcuu 11160 uauaggagcc cccuuauacu ucuuccaaua uaugagggg gggacuacaa agcucauuug 11220 auucaaggcc uugggaagag aaugagugg acuuacguca cguacauugc caacacuguc 11280 accaauacug uccuuaacug cuacagggcc aaaagagccu uuuccugcac cacacaagag 11340 gucuuuagua aacucucuu uuucauauca ggagaugacc ugguuauagc aggaacucuu 11400 gaaaaoagc agcgccuggc agaacaggac guccaugaug aguuaggcuu caaucuuaaa 11460 ggaggcuaca aacccauaac ugagaacuuu gaagagauag acuuuuguuc acaccauuau 11520 accaagguug ugaagaagga uaagaaaagu caugagaucc ucuuuucaaa guggaugcca 11580 guccgcccca uccccgagau auuugggaga gcccgucuuc uugugggugc ucuggguggc 11640 gaguugaugg ggcguuggaac uucgguagaa agagcucacg cagcaacugu gggccgccag 11700 11760 guagccccag aaaacauguu uuugcuuggu aaacaaucag uugcuaccac cccuaaacca 11820 uggcuuaacc aagaaaaggu ggacgagaug augcuucgcu gguuuucacu cccucuaaau 11880 gagcucccau augugcgcca ucgaguggac auggacuug gcaguacuau ucacgucaaa 11940 gaagcuuuaa cagcaucuag gcgagcugcc augcuugauu auuaugaga gauucgcagu 12000 gaguguuauc ucguugggg gcgcaacugg cucgaugcua uggcaaagua ucgcuacggg 12060 ucgguuggga gagcccccuc cuucuuuaag aagggaccu ccauccugua caguguaaau 12120 auuugugucg cacucacuuu guaaauguaa gcacgcuuuu gggcaggcau gcccuuacug 12180 uaagaaaug cccaaauuc cucucuuagg caaggagguu ucugguuugc acuaucgccu 12240 guucgugaug cuaugggguu agcauugcgu ucuguauuua ccccccgaug agacguugag 12300 cgaaucucau ugacauauagc ucagaccuug aaguuuuga gacucccuuc aagggccuaug 12360 uauuagaguc ucguuuuuaa guuuacacac cgaaggucgu aagaccuucg gcuaauuggc 12420 cacagacaua cagauuaaac cauuggcuua aagccacucu acuguggcuc auuucaaauu 12480 gaauccaaau uugacaugua uacaccaccu ccaccugggg uuuaacaggu ggggaguacu 12540 acucacgcaa ccacagcgca cuaaugaguc cgaaaaauuu cggugcgcug gggaugugag 12600 aguaacauuc caaaaaaaaa aaaaaaaaaa 12630
Claims
1. An infectious precocity flavivirus, with accession number CCTCC No. V201870.
2. The infectious premature virus according to claim 1, characterized in that, Its genome sequence is shown in SEQ ID NO:
1.
3. The use of the virus as described in any one of claims 1-2 in the preparation of a reagent for detecting infectious precocious puberty virus.
4. A kit for detecting infectious myotropic virus, characterized by, It includes at least one pair of primers consisting of DNA or RNA fragments extracted from the viral genome sequence described in claim 2; Its detection sequence is: (a): The complete RNA sequence as shown in SEQ ID NO: 1; or (b): (a) the transformed DNA sequence; or (c): RNA and DNA sequences that are reverse complementary to (a) or (b); or (d): Partial sequences of (a), (b), and (c); the length of the detection sequence is 140 nt-3000 nt; The primers are selected from the sequences shown in SEQ ID NO: 2-SEQ ID NO: 45; The detection methods of the kit are selected from polymerase chain reaction, loop-mediated isothermal amplification, and helicase-dependent isothermal amplification.
5. The kit of claim 4, wherein The kit contains two pairs of primers, with the outer primer sequences shown in SEQ ID NO: 2 and 3, and the inner primer sequences shown in SEQ ID NO: 4 and 5; or The outer primer sequences are shown in SEQ ID NO: 6 and 7, and the inner primer sequences are shown in SEQ ID NO: 8 and 9.
6. The reagent kit according to claim 4, characterized in that, The kit uses loop-mediated isothermal amplification, and its F3 primer is shown in SEQ ID NO: 38, B3 primer is shown in SEQ ID NO: 39, FIP primer is shown in SEQ ID NO: 40, BIP primer is shown in SEQ ID NO: 41, LF primer is shown in SEQ ID NO: 42, and LB primer is shown in SEQ ID NO:
43.
7. The reagent kit according to claim 4, characterized in that, It also includes one or more probes.
8. The reagent kit according to claim 7, characterized in that, The primer sequences of the kit are shown in SEQ ID NO:44 and SEQ ID NO:45, and the fluorescent probe sequence is shown in SEQ ID NO:
46. The fluorescent group is FAM and the quenching group is TAMRA.
Citation Information
Patent Citations
Primer for detecting infectious bursal disease viruses and method and kit thereof
CN101671748A
Method for detecting genome sequence based on orientavirus penaei and application thereof
CN109628638A