Compositions and methods for chemical cleavage and deprotection of surface-bound oligonucleotides

Abstract

Embodiments of the present disclosure relate to methods for preparing templates for polynucleotide sequencing. In particular, the present disclosure relates to linearizing clustered polynucleotides prepared for sequencing by cleaving one or more first chains of double-stranded polynucleotides fixed on a solid support using a transition metal complex (e.g., a palladium complex or a nickel complex). Further disclosure relates to linearizing clustered polynucleotides by cleaving one or more second chains of double-stranded polynucleotides containing azobenzene linkers fixed on a solid support using Na2S2O4. Nucleotides and oligonucleotides containing 3' phosphate capping groups are also disclosed, as well as methods for removing them using fluoride reagents.

Description

[0001] Incorporation by reference of priority application

[0002] This application claims priority to U.S. Provisional Application Nos. 62 / 671,816, filed May 15, 2018, and 62 / 788,045, filed January 3, 2019, each of which is hereby incorporated by reference in its entirety.

[0003] Sequence Listing in Electronic Format

[0004] This application is submitted with an electronic sequence listing as an ASCII text file via EFS-Web. The electronic sequence listing is provided as a file named ILLINC363WOSEQLIST.txt, created and last saved on May 10, 2019, and is 2,806 bytes in size. The information in the electronic sequence listing is incorporated herein by reference in its entirety. Background Art Technical Field

[0006] Embodiments of the present disclosure relate to methods for preparing templates for polynucleotide sequencing. In particular, the present disclosure relates to linearizing clustered polynucleotides prepared for sequencing by chemically cleaving one or more first strands of double-stranded polynucleotides immobilized on a solid support, which in some cases is carried out by reacting in the presence of a transition metal complex (e.g., a palladium complex or a nickel complex). In addition, the present disclosure relates to chemically mediated deprotection of modified primers on a solid support.

[0007] Various nucleic acid sequencing methods are known in the art. U.S. Patent No. 5,302,509 describes a method for sequencing polynucleotide templates, which involves implementing multiple extension reactions using DNA polymerase or DNA ligase to continuously incorporate labeled polynucleotides complementary to the template strand. In this "sequencing by synthesis" (SBS) reaction, by continuously incorporating each nucleotide complementary to the template strand, a new polynucleotide chain paired with the template strand base is established in the 5' to 3' direction. The substrate nucleoside triphosphate used in the sequencing reaction is labeled with different 3' marks at the 3' position, thereby allowing the determination of the identification of the incorporated nucleotides after adding continuous nucleotides.

[0008] In order to maximize the throughput of nucleic acid sequencing reactions, it is advantageous to be able to sequence multiple template molecules in parallel. The parallel processing of multiple templates can be achieved by using nucleic acid array technology. These arrays are usually composed of a high-density matrix of polynucleotides fixed on a solid support.

[0009] Various methods for arrays for making fixed nucleic acid assays have been described in the art. WO98 / 44151 and WO00 / 18957 have described methods for nucleic acid amplification, which allows amplification products to be fixed to solid supports, to form clusters or "colonies (colony)" formed by multiple identical fixed polynucleotide chains and multiple identical fixed complementary chains. This type of array is referred to as "cluster array" in this article. The nucleic acid molecules present in the DNA colonies on the cluster array prepared according to these methods can provide templates for sequencing reactions, such as described in WO98 / 44152. The product of the solid phase amplification reaction described in WO98 / 44151 and WO00 / 18957 is a so-called "bridge" structure, which is formed by annealing the pairing of fixed polynucleotide chains and fixed complementary chains, and both chains are attached to solid supports at 5' ends. In order to provide a more suitable template for nucleic acid sequencing, it is preferred to remove substantially all or at least a portion of one of the fixed chains in the "bridge" structure to produce a template that is at least partially single-stranded. The portion of the template that is single-stranded will therefore be available for hybridization with a sequencing primer. The method of removing all or part of one of the fixed strands in the "bridging" double-stranded nucleic acid structure is called "linearization". There are various ways to perform linearization, including but not limited to enzymatic cleavage, photochemical cleavage, or chemical cleavage. Non-limiting examples of linearization methods are disclosed in PCT Publication No. WO2007 / 010251, and U.S. Patent Publication No. 2009 / 0088327, and U.S. Patent Publication No. 2009 / 0118128, which are incorporated herein by reference in their entirety.

[0010] Enzymatic methods are known to promote efficient site-specific cleavage of oligonucleotides or polynucleotides to linearize double-stranded DNA clusters and deprotect surface-bound primers. Currently, enzymes have been widely used in these two types of reactions in various sequencing applications. However, there are specific problems with this enzymatic approach, including enzyme stability, cost of enzyme production, specific storage and handling requirements, variation in enzyme activity, and high background intensity in sequencing readout. Therefore, it is necessary to develop alternative linearization and deprotection methods for efficient DNA sequencing. However, there are many limitations on the types of reactions that can be used for the linearization step in this context, and the reason is that the reagents, conditions, and byproducts (a) must be compatible with upstream and downstream reactions, including hybridization and dehybridization of oligonucleotides, primer PCR extension, and DNA synthesis; (b) must show good stability under acidic, alkaline, and oxidizing conditions; (c) must undergo fast and clean chemical reactions; and (d) must not interfere with nucleotide detection methods. The present disclosure describes chemical cleavage and deprotection steps, which are effective alternatives that meet the above limitations. Summary of the invention

[0011] Some embodiments of the present disclosure relate to a method for linearizing a plurality of fixed double-stranded polynucleotides, comprising: providing a solid support comprising double-stranded polynucleotides, wherein each double-stranded polynucleotide comprises a first strand and a second strand, wherein the first strand and the second strand are each fixed to the solid support at their 5' ends, and wherein each first strand comprises a first cleavage site capable of chemical cleavage in the presence of a transition metal complex, wherein the transition metal complex is a palladium complex or a nickel complex; contacting the double-stranded polynucleotide with an aqueous solution of the transition metal complex, thereby cleaving one or more first strands at the first cleavage site, and producing one or more cleaved first nucleic acids and cleaved fixed first strands; and removing the cleaved first nucleic acid from the solid support. In such a method, after removing the cleaved first nucleic acid from the solid support, the fixed second strand remains on the solid support and remains hybridized with the cleaved fixed first strand. In some embodiments, the palladium (Pd) complex is a Pd(0) complex. In some embodiments, the nickel (Ni) complex is a Ni(0) complex. In some embodiments, the first cleavage site comprises an allyl functionality. In some other embodiments, the first cleavage site also comprises a phosphate moiety. In some embodiments, the first cleavage site is a modified nucleoside or nucleotide comprising an allyl phosphate moiety.

[0012] The present disclosure also relates to a method for chemically deprotecting an oligonucleotide on a solid support, comprising: providing a solid support having a plurality of oligonucleotides immobilized thereon, wherein each of the oligonucleotides comprises a protecting group on the 3' hydroxyl, such as a modified nucleotide or nucleoside containing a phosphate group capable of chemical deprotection, or a modified 3' terminal phosphate moiety; and reacting the oligonucleotide with a deprotecting agent to cleave the protecting group (such as the modified 3' terminal phosphate moiety) to produce an immobilized oligonucleotide and a free 3' hydroxyl. In some aspects, the protecting group is a 3' terminal phosphate moiety having a structure of formula (I):

[0013]

[0014] wherein the phosphate moiety is a phosphate at the 3' end of the immobilized oligonucleotide;

[0015] R 1 -NH2, -OH, -NHC(O)OR a or -OCH2OSi(R b )3;

[0016] Where R a C 1-4 alkyl, tert-butyl, allyl, benzyl or 9-fluorenylmethyl; and

[0017] Each R b Independently selected from C1-4 alkyl and phenyl; and

[0018] R 2 H, C 1-4 alkyl, optionally substituted tetrahydrofuran, or nucleotide.

[0019] In some aspects of Formula (I), R 1 Yes-NHC(O)OR a In some aspects, R a is 9-fluorenylmethyl, benzyl or allyl. In some aspects, R 1 Yes-OCH2OSi(R b )3. In some aspects, each R b In some aspects, each R b are independently methyl, ethyl, tert-butyl or phenyl.

[0020] In some aspects, the deprotection agent is a fluoride ion (e.g., TBAF, HF, or CsF) or a mild base (e.g., sodium hydroxide). In some aspects, the fixed oligonucleotide is a fixed first chain of cleavage produced by chemical cleavage of the first chain described herein. Therefore, in some aspects, the first chain comprises a modified nucleotide, which is present in the fixed first chain of cleavage after cleavage and removal of the cleaved first nucleic acid from the solid support. The method described herein includes: removing the 3' hydroxyl protecting group of the fixed first chain of cleavage after Read1 is completed. In some embodiments, the fixed first chain of cleavage comprises a terminal phosphate group. In other aspects, the method includes: blocking the 3' terminal phosphate of the fixed first chain of cleavage after cleavage and removal of the cleaved first nucleic acid from the solid support. In some aspects, the blocking is performed in the following manner: reacting the 3' terminal phosphate with the blocking group before sequencing the fixed second chain, and removing the blocking group after Read1 is completed to generate a 3' hydroxyl according to the chemical cleavage method described herein. During and after the deprotection reaction, the 3' end of the second chain remains hybridized with the fixed cleaved first chain.

[0021] In other aspects, the 3' hydroxyl protecting group is a phosphate group or moiety that is present in the cleaved fixed first strand after the first cleavage, and the method comprises removing the phosphate group or moiety in the presence of a dephosphorylating enzyme, such as T4PNK. During and after the enzymatic deprotection reaction, the 3' end of the second strand remains hybridized to the fixed cleaved first strand.

[0022] In some embodiments, the method further includes sequencing the fixed second strand after removing the cracked first nucleic acid from the solid support. In some aspects, sequencing includes continuous incorporation of labeled nucleotides complementary to the fixed second strand, and detecting the labeled nucleotides after each continuous incorporation. In paired end sequencing, both chains of the double-stranded nucleic acid are ultimately sequenced, and in this case, the sequencing of the fixed second strand is referred to as "Read1" in this article.

[0023] In other embodiments, each fixed second chain comprises a second cleavage site capable of chemical cleavage. In some aspects, after sequencing the second chain (Read1) and removing the 3'hydroxyl protecting group from the fixed cleaved first chain, the method further comprises synthesizing the complementary sequence of the fixed second chain to produce a derived double-stranded polynucleotide, wherein each derivative double-stranded polynucleotide comprises a second chain and a derived first chain, wherein the derived first chain and the second chain are each fixed to a solid support at their 5' ends. The method disclosed herein comprises: cleaving one or more second chains at a second cleavage site, thereby producing one or more cleaved second nucleic acids and cleaved fixed second chains; and, removing the cleaved second nucleic acids from the solid support. In such a method, the fixed derivative first chain remains on the solid support after removing the cleaved second nucleic acids from the solid support, and remains hybridized with the cleaved fixed second chain.

[0024] In some such embodiments, the second cleavage site of the second chain can be chemically cracked, and the second chain is cracked by chemical reaction.For example, the second cleavage site comprises one or more vicinal diols connected (can be cracked by oxidation, for example, with periodate reagent treatment), disulfide connected (cleavable, for example, under reducing conditions, such as DTT, or in the presence of phosphine), o-nitrobenzyl (cleavable, for example, by photolysis), azobenzene connected (cleavable, for example, at Na2S2O4 in the presence of), alkyl-selenium connected (cleavable, for example, by oxidation, such as hydrogen peroxide), silyl ether connected (cleavable, for example, by fluorine ion, acid or alkali) or allyl carbamate connected (cleavable, for example, in the presence of palladium complex).In some respects, select to connect so that the second cracking releases hydroxyl moiety.In some respects, cracking removes joint reaction site (for example, the oxidation of vicinal diols leaves two separated carbonyl compounds, and diols are no longer present). In some aspects, the second cleavage site is at any position along the second chain, but preferably near the 5' end of the second chain (for example, near the attachment point with a solid support) attached to the backbone. In some embodiments, the chemical cleavage conditions for cracking the first and second chains are different, and the first and second chains may not be cracked by the same cleavage conditions (for example, the cleavage sites are orthogonal). In some aspects, two cleavage steps do not have to be chemical cleavage steps. For example, the first chain can be cracked by an enzymatic reaction, and the second chain can be cracked by a chemical reaction, or the first chain can be cracked by a chemical reaction, and the second chain can be cracked by an enzymatic reaction.

[0025] Some additional embodiments of the present disclosure relate to methods for linearizing a plurality of fixed double-stranded polynucleotides, comprising: providing a solid support comprising double-stranded polynucleotides, wherein each double-stranded polynucleotide comprises a first strand and a second strand, wherein the first strand and the second strand are each fixed to the solid support at their 5' ends, and wherein each first strand comprises a first cleavage site, and each second strand comprises a second cleavage site comprising an azobenzene linker; cleaving one or more first strands at the first cleavage site, and producing one or more cleaved first nucleic acids and cleaved fixed first strands; removing the cleaved first nucleic acids from the solid support; sequencing the fixed second strands; resynthesizing a derivative first strand complementary to the second strand; and cleaving one or more second strands at the second cleavage site, and producing one or more cleaved second nucleic acids and cleaved fixed second strands. In certain aspects of such methods, the fixed derivative first strand remains on the solid support after the cleaved second nucleic acids are removed from the solid support, and remains hybridized with the cleaved fixed second strand.

[0026] In some aspects, the method further comprises: sequencing the fixed derivative first strand after removing the cleaved second nucleic acid from the solid support. In some aspects, sequencing comprises continuously incorporating labeled nucleotides complementary to the fixed derivative first strand, and detecting the labeled nucleotides after each continuous incorporation. In paired end sequencing, both strands of the double-stranded nucleic acid are ultimately sequenced, in which case the sequencing of the fixed derivative first strand is referred to herein as "Read2".

[0027] Some embodiments of the present disclosure relate to methods for preparing a 3' capping portion that can be removed by a chemical reaction in a paired end sequencing method (described in U.S. Publication No. 2009 / 0088327, which is incorporated herein by reference in its entirety). The method comprises: providing a solid support comprising a double-stranded polynucleotide, each double-stranded polynucleotide comprising a first strand and a second strand, wherein the first strand and the second strand are fixed to the solid support at their 5' ends, wherein each first strand comprises a first cleavage site; cleaving one or more first strands at the first cleavage site to produce one or more cleaved first nucleic acids and a fixed cleaved first strand; and, introducing a 3' capping portion to the 3' end of the cleaved fixed first strand, wherein the 3' capping portion can be removed by a chemical reaction. In some other embodiments, instead of introducing a 3' capping portion to the 3' end of the cleaved fixed first strand, a 3' capping portion is generated by the first cleavage site after the cleavage step. In some embodiments, the 3' capping portion comprises a modified nucleoside or nucleotide containing a phosphate moiety. In one such embodiment, the 3' capping moiety comprises a modified nucleoside containing an additional -CH2OH or protected -CH2OH at the 5' position of the nucleoside. In another such embodiment, the 3' capping moiety comprises a modified nucleoside containing an additional -CH2NH2 or protected -CH2NH2 at the 5' position of the nucleoside. In some embodiments, the method further comprises removing the 3' capping moiety in a chemical reaction, such as in an aqueous solution containing a fluoride reagent or a base.

[0028] Some embodiments of the present disclosure relate to a solid support, which includes a plurality of first chain polynucleotides fixed thereon, each of which includes a first cleavage site capable of chemical cleavage by a palladium complex or a nickel complex, wherein a plurality of first chain polynucleotides are fixed to the solid support at its 5' end. In some embodiments, the solid support also includes a plurality of second chain polynucleotides fixed thereon, each of which includes a second cleavage site, wherein a plurality of second chain polynucleotides are fixed to the solid support at its 5' end. In some embodiments, the palladium complex is a palladium (0) complex. In some embodiments, the first cleavage site includes an allyl functionality. In one embodiment, the first cleavage site includes allyl dT. In some other embodiments, the first cleavage site also includes a phosphate moiety, which remains on the fixed first chain of the cleavage after chemical cleavage. In one embodiment, the phosphate moiety includes a structure of formula (I). In some embodiments, the second cleavage site can be cleaved by a method selected from chemical cleavage, photocleavage, enzymatic cleavage or a combination thereof. In one embodiment, the second cleavage site is cleaved by a chemical cleavage reaction. In some such embodiments, the second cleavage site may comprise a diol linker of Formula (VIII) or (VIIIa), as described below, or an azobenzene linker of Formula (X).

[0029] The present disclosure also relates to modified nucleosides or nucleotides and oligonucleotides, and methods for preparing such compounds. In one aspect, the modified nucleosides or modified nucleotides comprise a structure of formula (II):

[0030]

[0031] Where R is H, OH or OPG; R 1 H or PG; R 2 H, PG, or -OR 2 is a phosphate group; PG is a hydroxyl protecting group; the base is adenine, guanine, cytosine, thymine or uracil, or a derivative thereof. In some embodiments, the phosphate group may be negatively charged (e.g., -PO4 - In one aspect, the modified nucleoside or nucleotide has the structure of formula (IIa):

[0032]

[0033] In one aspect are modified nucleosides or nucleotides which, when the modified nucleosides or nucleotides of formula (II) are incorporated into an oligonucleotide or polynucleotide, comprise a structure of formula (II'), wherein the 3' oxygen of the allyl-modified nucleoside or nucleotide is covalently attached to the 5' end of another nucleotide (structure not shown):

[0034] In some embodiments, the phosphate group can be negatively charged (e.g., -PO4 - ).

[0035] In another aspect is an oligonucleotide comprising an allyl nucleoside or nucleotide, wherein the oligonucleotide is a compound of formula (III):

[0036]

[0037] wherein each base is independently adenine, guanine, cytosine, thymine or uracil, or a derivative thereof; and the oligonucleotide is optionally bound to a solid support. In some embodiments, the phosphate group may be negatively charged (e.g., -PO4 - ).

[0038] In some aspects, the 5' end of the oligonucleotide (at the asterisk) is bound to a solid support.

[0039] Additional disclosures relate to chemical agents for incorporating allyl nucleotides into polynucleotides, wherein the chemical agent is a compound of formula (IV):

[0040]

[0041] wherein PG is H or a hydroxyl protecting group; and the base is adenine, guanine, cytosine, thymine or uracil, or a derivative thereof.

[0042] In some aspects, PG is a protecting group cleavable under mild acidic conditions. In some aspects, PG is triphenylmethyl or dimethoxytriphenylmethyl (DMT).

[0043] In certain aspects, a method for preparing a compound of formula (IV) comprising:

[0044]

[0045] Reaction with a vinyl Grignard reagent (e.g. vinyl MgCl or vinyl MgBr), optionally at room temperature, to form a compound of formula B:

[0046]

[0047] In some aspects, the method comprises oxidizing a compound of formula C (optionally via Pfitzner-Moffatt oxidation, or using 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC), or N,N'-dicyclohexylcarbodiimide (DCC), dichloroacetic acid (DCA), and DMSO):

[0048] Thus, the compound of formula A is formed.

[0049] In some aspects, the method comprises making a compound of formula D:

[0050]

[0051] Compounds of formula C are formed by reaction with TBDPSCl (tert-butyldiphenylsilyl chloride) in the presence of a base such as imidazole, followed by reaction with a mild acid such as PTSA (p-toluenesulfonic acid) in a one-pot process without isolating the doubly protected intermediate.

[0052] Another aspect is a nucleoside or nucleotide having a 3' blocking moiety comprising the structure of formula (I):

[0053]

[0054] Where R 1 -NH2, -OH, -NHC(O)OR a or -OCH2OSi(R b )3; R a C 1-4 alkyl, tert-butyl, allyl, benzyl or 9-fluorenylmethyl; each R b Independently selected from C 1-4 alkyl and phenyl; and R 2 H, C 1-4 Alkyl, optionally substituted tetrahydrofuran, or nucleotide. In some embodiments, the phosphate group can be negatively charged (e.g., PO4 - ).

[0055] In another aspect is a 3' phosphate modified nucleoside or nucleotide comprising the structure of Formula (V):

[0056]

[0057] Where R 1 -NH2, -OH, -NHC(O)OR a or -OCH2OSi(R b )3;

[0058] R a C 1-4 Alkyl, tert-butyl, allyl, benzyl or 9-fluorenylmethyl;

[0059] Each R b Independently selected from C 1-4 an alkyl group and a phenyl group; and

[0060] The base is optionally protected adenine, guanine, cytosine, thymine or uracil, or a derivative thereof. In some embodiments, the phosphate group may be negatively charged (e.g., PO4 - In some embodiments, the compound of formula (V) can be prepared from the compound of formula (V'):

[0061]

[0062] Where X is O or NH; R 1 ' is a protected OH (ie, -O-TOM, -O-triphenylmethyl, -O-DMT, -OTMS, -O-TBDMS, -O-TIPS, -OBz) or a protected NH2 (ie, -NH-Boc, -NH-Fmoc, -NH-CBz, -NH-Alloc); R 1 It is NH2 or OH.

[0063] In another aspect is an oligonucleotide comprising a 3' phosphate modified nucleotide of formula (V), wherein the oligonucleotide is a compound of formula (VI):

[0064]

[0065] Where R 1 -NH2, -OH, -NHC(O)OR a or -OCH2OSi(R b )3;

[0066] R a C 1-4 Alkyl, tert-butyl, allyl, benzyl or 9-fluorenylmethyl;

[0067] Each R b Independently selected from C 1-4 Alkyl and phenyl.

[0068] Each base is independently an optionally protected adenine, guanine, cytosine, thymine or uracil, or a derivative thereof. In some embodiments, the oligonucleotide is optionally bound to a solid support. In some embodiments, the phosphate group may be negatively charged (e.g., PO4 - In some embodiments, the compound of formula (VI) can be prepared from the compound of formula (VI'):

[0069]

[0070] Where X is O or NH; R 1' is a protected OH (ie, -O-TOM, -O-triphenylmethyl, -O-DMT, -OTMS, -O-TBDMS, -O-TIPS, -OBz) or a protected NH2 (ie, -NH-Boc, -NH-Fmoc, -NH-CBz, -NH-Alloc); R 1 It is NH2 or OH.

[0071] In certain aspects of Formula (V) or (VI), R 1 -NHC(O)OR a In some aspects, R a is 9-fluorenylmethyl, benzyl or allyl. In some aspects, R 1 Yes-OCH2OSi(R b )3. In some aspects, each R b In some aspects, each R b are independently methyl, ethyl, tert-butyl or phenyl.

[0072] The present disclosure also relates to a chemical reagent for introducing a 3' phosphate-modified nucleotide into a polynucleotide, wherein the chemical reagent is a compound of formula (VII):

[0073]

[0074] Where R 1 As defined above; PG is H or a hydroxy protecting group; and the base is optionally protected adenine, guanine, cytosine, thymine or uracil, or a derivative thereof.

[0075] In some aspects of Formula (VII), R 1 Yes-NHC(O)OR a In some aspects, R a is 9-fluorenylmethyl, benzyl or allyl. In some aspects, R 1 Yes-OCH2OSi(R b )3. In some aspects, each R b In some aspects, each R b are independently methyl, ethyl, tert-butyl or phenyl.

[0076] The present disclosure also relates to methods for preparing a diol linker for incorporation into a polynucleotide. In some aspects, the diol linker is a diol linker described in U.S. Patent No. 8,715,966. In some aspects, the diol linker has a structure of formula (VIII):

[0077]

[0078] Where r is 2, 3, 4, 5 or 6;

[0079] s is 2, 3, 4, 5, or 6;

[0080] The "a" oxygen is the 3' hydroxyl oxygen of the first nucleotide; and

[0081] The "b" oxygen is the 5' hydroxyl oxygen of the second nucleotide.

[0082] In some aspects, the diol linker has the structure of Formula (VIIIa):

[0083]

[0084] wherein "a" and "b" are as defined above.

[0085] The present disclosure relates to methods for preparing a chemical reagent for incorporating a linker of formula (VIII) or (VIIIa) into a polynucleotide, wherein the chemical reagent is a compound of formula (IX):

[0086]

[0087] wherein r is 2, 3, 4, 5 or 6 (in some aspects, r is 5);

[0088] s is 2, 3, 4, 5 or 6 (in some aspects, s is 3); and

[0089] PG is a protecting group removable under weakly acidic conditions (eg, triphenylmethyl or dimethoxytriphenylmethyl). BRIEF DESCRIPTION OF THE DRAWINGS

[0090] Figure 1 An embodiment of a workflow for Illumina's sequencing by synthesis (SBS) chemistry is shown.

[0091] Figure 2A Typhoon images of a non-patterned high primer density flow cell surface before and after treatment with a Pd(0) complex, wherein the flow cell surface is grafted with allyl-modified primers.

[0092] Figure 2B It is displayed in Figure 2A Bar graph of the change in primer density after Pd(0) treatment compared to a flow cell surface grafted with a control primer without allyl functionality.

[0093] Figure 3A is a bar graph showing TET dye epifluorescence QC assay (TET-QC) results from a non-patterned high primer density primed flow cell grafted with allyl-modified P5 primers and standard P7 primers (lanes 1-4) compared to a flow cell grafted with standard P5 / P7 primers (lanes 5-8).

[0094] Figure 3B Show Figure 3A Typhoon image of the flow cell surface after TET-QC as described in.

[0095] Figure 4 The use of standard and novel flow cells is described. % error rate for sequencing data on a 2-channel instrument.

[0096] Figure 5A The P15 cleavage activity of preparations isolated from Pd(C3H5)Cl)2 in the presence of 1 to 10 equivalents of THP (10 mg / mL, N=4 for each condition) is shown, which is compared to preparations of (Pd(C3H5)Cl)2 (6 mM), THP (60 mM) and sodium ascorbate (6 mM) (N=2).

[0097] Figure 5B The P15 cleavage activity of formulations containing [Pd(C3H5)(THP)2]Cl and 1 equivalent or more of THP (12 mM Pd, N=2 for each condition) is shown, compared to formulations of (Pd(C3H5)Cl)2 (6 mM), THP (60 mM) and sodium ascorbate (6 mM) (N=2).

[0098] Fig. 6A NovaSeq showing the effect of 10 mM Pd(THM)4 on the Pd(0) reagent generated in situ TM Average Read1 intensity.

[0099] Figure 6B NovaSeq showing the effect of 10 mM Pd(THM)4 on the Pd(0) reagent generated in situ TM Average PhiX error rate.

[0100] Figure 7 Pd(THP) is shown 2-4 (10 mg / mL) of P15 lytic activity compared to formulations of (Pd(C3H5)Cl)2 (6 mM), THP (60 mM), and sodium ascorbate (6 mM).

[0101] Figure 8 It is a bar graph of the fluorescence intensity of the flow cell grafted with P15 / P7 primers after treatment with Pd-THP or Ni-THP. DETAILED DESCRIPTION

[0102] Non-enzymatic chemical linearization strategy is an attractive alternative for the double-stranded polynucleotide structure of cleavage bridges before each sequencing readout. In particular, chemicals can be stored at room temperature for a long time, and are relatively cheap compared to enzymes. The application relates to a chemical linearization method for a double-stranded polynucleotide cluster fixed on a solid support for generating a sequencing template. Each double-stranded polynucleotide comprises a first chain and a second chain. The first chain is produced by extending a first extension primer fixed to a solid support, and the second chain is produced by extending a second extension primer fixed to a solid support. Each of the first and second chains comprises a cleavage site. In some embodiments, the first chain comprises a cleavage site that can be cleaved by a palladium complex or a nickel complex, such as a palladium (0) complex or a Ni (0) complex. In a specific embodiment, the cleavage site is located in the first extension primer portion of the first chain. In another embodiment, the cleavage site comprises a thymidine or nucleotide analog with an allyl functionality. In some embodiments, the second chain comprises a cleavage site, and the cleavage site comprises an azobenzene joint that can be cleaved by a chemical reagent, such as Na2S2O4. Alternatively, the second strand comprises a cleavage site comprising a diol linker that can be cleaved by periodate, such as NaIO4. The methods described herein can be used as a cleavage site in a biosensor such as Illumina (San Diego, CA). or Part of a sequencing by synthesis (SBS) reaction on the system.

[0103] Figure 1An embodiment of the standard workflow of Illumina SBS chemistry is described. First, a solid support is provided, which comprises a plurality of P5 / P7 primers fixed on the surface of the solid support. Each P5 and P7 primer has a cleavage site in the sequence. In one embodiment, the cleavage site on the P5 primer is deoxyuridine (U). In one embodiment, the cleavage site on the P7 primer is 8-oxoguanine nucleotide (oxo-G). A group of target DNA molecules to be sequenced is hybridized to the fixed P5 / P7 primers. After hybridization, the original target DNA molecule is removed, leaving only a complementary copy of the extended polynucleotide containing the P5 / P7 primer. This step is also referred to as the "seeding" step. Then, the extended P5 / P7 polynucleotide is amplified by a method referred to as "bridge amplification" to form a double-stranded cluster, wherein the two chains are attached to the solid support at the 5' end. After the "clustering" step, a first linearization is implemented to remove a portion of the extended polynucleotide containing the P5 primer. In one embodiment, this removal is promoted by using an enzyme USER to cleave the enzymatic cleavage reaction of the U position on the P5 primer. After the first round of SBS (Read 1), resynthesis is performed to form a double-stranded polynucleotide again. Then, a second linearization is performed to remove a portion of the extended polynucleotide containing the P7 primer. In one embodiment, this removal is promoted by using the enzyme FPG to cleave the enzymatic cleavage reaction of the oxo-G position on the P7 primer. Then a second round of SBS (Read 2) is performed to sequence the target DNA.

[0104] The P5 and P7 primers are used on the surface of commercial flow cells sold by Illumina, Inc. and Genome Primer sequences are described in U.S. Patent Publication No. 2011 / 0059865A1, which is incorporated herein by reference in its entirety.

[0105] Standard P5 and P7 primer sequences for paired-end sequencing include:

[0106] P5: paired end 5'→3'

[0107] AATGATACGGCGACCACCGAGAUCTACAC(SEQ ID NO.1)

[0108] P7: paired end 5'→3'

[0109] CAAGCAGAAGACGGCATACGAG*AT(SEQ ID NO.2)

[0110] wherein G* is 8-oxo-guanine.

[0111] Optionally, one or both of the P5 and P7 primers may contain a poly-T tail. The poly-T tail is usually located at the 5' end of the above sequence, but may be located at the 3' end in some cases. The poly-T sequence may contain any number of T nucleotides, for example 2 to 20.

[0112] Standard P5 and P7 primer sequences for use on PAZAM-coated flow cells with poly-T spacers include:

[0113] P5 primer with poly-T spacer:

[0114] 5'-Alkyne

[0115] -TTTTTTTTTTAATGATACGGCGACCACCGAGAUCTACAC(SEQ ID NO.3)

[0116] P7 primer with poly-T spacer:

[0117] 5'-yne-TTTTTTTTTTCAAGCAGAAGACGGCATACGAG*AT(SEQ ID NO:4)

[0118] wherein G* is 8-oxo-guanine.

[0119] Other primer sequences include a set of P5 and P7 primers for single-read SBS:

[0120] P5: Single read 5'→3'

[0121] AATGATACGGCGACCACCGA(SEQ ID NO.7)

[0122] P7: Single read 5'→3'

[0123] CAAGCAGAAGACGGCATACGA(SEQ ID NO.8)

[0124] As used herein, when a standard P5 / P7 primer or oligonucleotide is modified to incorporate a first cleavage site or a second cleavage site capable of chemical cleavage (e.g., by a Pd complex or a Ni complex), the modification of the P5 / P7 primer may refer to the replacement or substitution of an existing nucleotide (or nucleoside) in the P5 / P7 sequence with a different chemical entity (e.g., a modified nucleotide or nucleoside analog having a specific functionality) to achieve site-specific chemical cleavage. Modification may also refer to the insertion of a new chemical entity into an existing P5 / P7 sequence, wherein the new chemical entity is capable of site-specific chemical cleavage. In some embodiments, the modified P5 / P7 primers are referred to as P15 / P17 primers, respectively, including the following:

[0125] P15 primer 5'→3'

[0126] 5'-yne-TTTTTTAATGATACGGCGACCACCGAGAXCTACAC(SEQ ID NO.5)

[0127] As shown in Scheme 1, where X = allyl T nucleoside.

[0128] P17 primer 5'→3'

[0129] 5'-yne-TTTTTTYYYCAAGCAGAAGACGGCATACGAGAT(SEQ ID NO.6)

[0130] wherein Y is a diol linker subject to chemical cleavage, for example, oxidation with a reagent such as periodate, as disclosed in U.S. Publication No. 2012 / 0309634, which is incorporated herein by reference in its entirety. In some embodiments, the diol linker comprises Formula (VIII) or (VIIIa) described herein.

[0131] definition

[0132] The section headings used herein are for reference purposes only and are not to be construed as limiting the subject matter described.

[0133] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. The use of the term "including" and other forms (such as "include", "includes" and "included") is not restrictive. The use of the term "having" and other forms (such as "have", "has" and "had") is not restrictive. As used herein, whether in a transitional phrase or in the body of the claim, the terms "comprise(s)" and "comprising" should be interpreted as having an open meaning. That is, the above terms will be interpreted synonymously with the phrases "at least having" or "at least including". For example, when used in the context of a method, the term "comprising" means that the method includes at least the steps, but may include other steps. When used in the context of a compound, composition or device, the term "comprising" means that the compound, composition or device includes at least the listed features or components, but may also include other features or components.

[0134] As used herein, common organic abbreviations are defined as follows:

[0135] AC Acetyl

[0136] Ac2O Acetic anhydride

[0137] Alloc Allyloxycarbonyl

[0138] Aq. Water-based

[0139] BOC or Boc tert-butoxycarbonyl

[0140] Bz Benzyl

[0141] ℃ Temperature (Celsius)

[0142] Cbz benzyloxycarbonyl

[0143] CVD Chemical Vapor Deposition

[0144] dATP deoxyadenosine triphosphate

[0145] dCTP deoxycytidine triphosphate

[0146] dGTP deoxyguanosine triphosphate

[0147] dTTP deoxythymidine triphosphate

[0148] ddNTP deoxyribonucleotide

[0149] DCM Dichloromethane

[0150] DMF Dimethylformamide

[0151] DMT or DMTr dimethoxytriphenylmethyl

[0152] EtOAc Ethyl acetate

[0153] FC Flow Cell

[0154] Fmoc Fluorenylmethoxycarbonyl

[0155] g

[0156] h or hr hour

[0157] IPA Isopropyl Alcohol

[0158] LCMS liquid chromatography-mass spectrometry

[0159] mL milliliters

[0160] Nickel

[0161] PE Petroleum Ether

[0162] PAZAM Poly(N-(5-azidoacetamidopentyl)acrylamide-co-acrylamide) with any ratio of acrylamide to Azapa

[0163] Pd Palladium

[0164] RT Room temperature

[0165] SBS Sequencing by Synthesis

[0166] TBAF Tetra-n-butylammonium fluoride

[0167] TBDMS Tributyldimethylsilyl

[0168] TEA Triethylamine

[0169] TFA Trifluoroacetic acid

[0170] Tert, t uncle

[0171] THF Tetrahydrofuran

[0172] THM Tris(hydroxymethyl)phosphine

[0173] THP Tri(hydroxypropyl)phosphine

[0174] TIPS Triisopropylsilyl

[0175] TLC Thin Layer Chromatography

[0176] TMS Trimethylsilyl

[0177] TOM triisopropylsiloxymethyl

[0178] Trityl triphenylmethyl

[0179] μL microliter

[0180] As used herein, the term "covalent attachment" or "covalent bonding" refers to the formation of a chemical bond characterized by the sharing of electron pairs between atoms. For example, a covalently attached polymer coating refers to a polymer coating that forms a chemical bond with the functionalized surface of a substrate as opposed to being attached to the surface by other means, such as adhesion or electrostatic interactions.

[0181] As used herein, the term "extension primer" refers to an oligonucleotide or polynucleotide immobilized on a solid support, wherein the oligonucleotide or polynucleotide is capable of specifically binding to the sequence of a target single-stranded nucleic acid molecule. After the hybridization process, the oligonucleotide or polynucleotide is extended to include a sequence complementary to the target nucleic acid molecule. In some cases, the term "extension primer" can be used interchangeably with "amplification primer".

[0182] As used herein, the terms "nucleic acid" and "nucleotide" are intended to be consistent with their use in the art, and include naturally occurring species or functional analogs thereof. Particularly useful functional analogs of nucleic acids can hybridize with nucleic acids in a sequence-specific manner, or can be used as a template for replicating a specific nucleotide sequence. Naturally occurring nucleic acids typically have a backbone comprising a phosphodiester bond. Analog structures can have alternative backbone connections, including various backbones known in the art. Naturally occurring nucleic acids typically have deoxyribose (e.g., found in deoxyribonucleic acid (DNA)) or ribose (e.g., found in ribonucleic acid (RNA)). Nucleic acids can include nucleotides with any of a variety of analogs of these sugar moieties known in the art. Nucleic acids can include natural or non-natural nucleotides. In this regard, natural deoxyribonucleic acids can have one or more bases selected from adenine, thymine, cytosine or guanine, while ribonucleic acids can have one or more bases selected from uracil, adenine, cytosine or guanine. Useful non-natural bases that can be included in nucleic acids or nucleotides are known in the art. When used for nucleic acids, the term "probe" or "target" is intended to be a semantic identifier of the nucleic acid in the context of the methods or compositions described herein, and does not necessarily limit the structure or function of the nucleic acid, unless otherwise explicitly stated. The terms "probe" and "target" can be similarly applied to other analytes, such as proteins, small molecules, cells, etc.

[0183] As used herein, the term "polynucleotide" generally refers to nucleic acids, including DNA (e.g., genomic DNA cDNA), RNA (e.g., mRNA), synthetic oligonucleotides, and synthetic nucleic acid analogs. Polynucleotides can include natural or non-natural bases, or combinations thereof; and natural or non-natural backbone connections, such as thiophosphates, PNA or 2'-O-methyl-RNA, or combinations thereof. In some cases, the terms "polynucleotide," "oligonucleotide," or "oligonucleotide (oligo)" are used interchangeably.

[0184] As used herein, "cleavage site" refers to a position on a polynucleotide sequence at which a portion of the polynucleotide can be removed by a cleavage reaction. The position of the cleavage site is preferably predetermined, meaning that the position at which the cleavage reaction occurs is predetermined, rather than being cleaved at a random site whose position is not known in advance.

[0185] As used herein, the term "solid carrier" refers to a rigid substrate that is insoluble in aqueous liquids. The substrate can be nonporous or porous. The substrate can optionally be capable of absorbing liquids (e.g., due to pores), but will generally have sufficient rigidity so that the substrate does not substantially swell when absorbing liquids, and does not substantially shrink when the liquids are removed by drying. Nonporous solid carriers are generally impermeable to liquids or gases. Exemplary solid carriers include, but are not limited to, glass and modified or functionalized glass, plastics (e.g., acrylic resins, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethane, Teflon TM , cycloolefins, polyimides, etc.), nylon, ceramics, resins, Zeonor, silica or silica-based materials (including silicon and modified silicon), carbon, metals, inorganic glasses, fiber bundles, and polymers. Particularly useful solid supports for certain embodiments are components of a flow cell located within a flow cell instrument. The solid support may have a flat surface, such as a flow cell, or a non-flat surface, such as a bead.

[0186] Whenever a substituent is described as a diradical (i.e., having two points of attachment to the rest of the molecule), it is understood that the substituent may be attached in any orientation unless otherwise specified. Thus, for example, a substituent represented as -AE- or Substituents of include those oriented such that A is attached at the leftmost attachment point of the molecule, as well as those where A is attached at the rightmost attachment point of the molecule.

[0187] The first chemical linearization method assisted by palladium (Pd) or nickel (Ni)

[0188] Some embodiments of the present disclosure relate to a method for linearizing a plurality of fixed double-stranded polynucleotides, comprising: providing a solid support comprising double-stranded polynucleotides, wherein each double-stranded polynucleotide comprises a first strand and a second strand, wherein the first strand and the second strand are each fixed to the solid support at their 5' ends, and wherein each first strand comprises a first cleavage site capable of chemical cleavage in the presence of a cleavage reagent; contacting the double-stranded polynucleotide with a cleavage reagent, thereby cleaving one or more first strands at the first cleavage site, and producing one or more cleaved first nucleic acids and cleaved fixed first strands; and, removing the cleaved first nucleic acid from the solid support. In some aspects, the cleavage site can be cleaved in the presence of a Pd complex or a Ni complex. In some aspects, the cleavage reagent is an aqueous solution of a Pd complex or a Ni complex. In some aspects, the cleavage reagent is prepared in situ.

[0189] In some embodiments of the Pd / Ni linearization method described herein, each first chain is extended from the first extension primer fixed to a solid support. In some such embodiments, the first extension primer comprises a nucleotide sequence, which is a P5 or P7 sequence disclosed herein or a sequence complementary to P5 or P7. In one embodiment, the first extension primer comprises a P5 nucleotide sequence (SEQ ID NO.1). In another embodiment, the first extension primer comprises a poly-T spacer P5 nucleotide sequence (SEQ ID NO.3). In one embodiment, the first extension primer is a P5 primer. In another embodiment, the first extension primer is a poly-T spacer P5 primer. In a further embodiment, the first extension primer comprises a nucleotide sequence, which is a P5 or P7 sequence disclosed herein or a sequence complementary to P5 or P7, wherein one nucleotide of the sequence is replaced by a modified nucleotide susceptible to cleavage in the presence of a palladium complex. In some aspects, the first extension primer comprises the nucleotide sequence (SEQ ID NO.5) of P15 described herein.

[0190] In some embodiments of the Pd / Ni linearization methods described herein, the first extended primer comprises a first cleavage site. In some other embodiments, the first cleavage site comprises a modified nucleotide or nucleoside capable of chemical cleavage, for example, by a palladium complex. In some embodiments, the modified nucleoside or nucleotide has a structure of formula (II):

[0191]

[0192] Where R is H, OH or OPG; R 1 H or PG; R 2 H, PG or -OR 2 is a phosphate group; PG is a hydroxyl protecting group; the base is adenine, guanine, cytosine, thymine or uracil, or a derivative thereof. In some embodiments, the phosphate group may be negatively charged (e.g., -PO4 - In one aspect, the modified nucleoside or nucleotide has the structure of formula (IIa):

[0193]

[0194] In some embodiments, the first cleavage site incorporated into the modified nucleoside or nucleotide moiety comprises a structure of Formula (II'), wherein the 3' oxygen of the allyl-modified nucleoside or nucleotide is covalently attached to the 5' end of another nucleotide (structure not shown):

[0195] In some embodiments, the phosphate group can be negatively charged (e.g., -PO4 - ).

[0196] In some other embodiments, the modified nucleotide or nucleoside can be further labeled with a detectable label, such as a fluorescent label. In some embodiments, the modified nucleotide includes a vinyl substituent at the 5' carbon of the nucleotide or nucleoside, thereby forming an allyl moiety relative to the 5' hydroxyl. In some embodiments, the 5' hydroxyl is connected to the 3' phosphate of the second nucleotide, so that the dinucleotide unit includes a cleavage site with an allyl phosphate moiety. In some embodiments, the modified nucleotide or nucleoside is a thymine (T) nucleoside or a nucleotide analog. In some further embodiments, the group of 3' hydroxyl protection (or end-capping), such as a phosphate moiety (shown as formula (II')) is retained on the fixed first chain of the cleavage after the chemical cleavage of the first chain. In one such embodiment, the 3' phosphate moiety of the second nucleotide is covalently attached to the 5'-carbon position (that is, the phosphate group includes the 5' hydroxyl of the modified nucleotide) of the modified nucleoside analog. In some embodiments, the cleavage site is located near the 3' end of the first extension primer, for example, within a distance of 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides from the 3' end of the first extension primer. In some other embodiments, the cleavage site is located near the 5' end of the first extension primer, for example, within a distance of 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides from the 5' end of the first extension primer. In some cases, in order to ensure effective DNA resynthesis, the cleavage site is preferably located towards the 3' end of the first primer, for example, a distance of 2 to 8, or 3 to 7, or 4 to 6 nucleotides. In one embodiment, the first extension primer is a P5 primer, and the first cleavage site is located in the P5 primer sequence (for example, by adding to or replacing a nucleotide, a modified nucleotide is incorporated into the P5 primer sequence). Therefore, the P5 sequence disclosed herein (SEQ ID NO.1 or SEQ ID NO.3) is modified to include a first cleavage site that can be chemically cleaved by a Pd / Ni complex, thereby forming a modified P5 primer. In one embodiment, the modified P5 primer comprises or is the P15 primer disclosed herein (SEQ ID NO. 5).

[0197] Palladium reagent

[0198] In some embodiments of the Pd linearization method described herein, the Pd complex used in the chemical linearization method is water-soluble. In some such embodiments, the Pd complex is a Pd(0) complex. In some cases, the Pd(0) complex can be generated in situ by reducing a Pd(II) complex with a reagent such as an olefin, an alcohol, an amine, a phosphine, or a metal hydride. Suitable palladium sources include Na2PdCl4, (PdCl(C3H5))2, [Pd(C3H5)(THP)]Cl, [Pd(C3H5)(THP)2]Cl, Pd(OAc)2, Pd(Ph3)4, Pd(dba)2, and Pd(TFA)2. In one such embodiment, a Pd(0) complex is generated in situ from Na2PdCl4. In another embodiment, the palladium source is an allylpalladium chloride (II) dimer [(PdCl(C3H5))2]. In some embodiments, the Pd(0) complex is produced in aqueous solution by mixing the Pd(II) complex with a phosphine. Suitable phosphines include water-soluble phosphines such as tris(hydroxypropyl)phosphine (THP), tris(hydroxymethyl)phosphine (THM), 1,3,5-triaza-7-phosphaadamantane (PTA), bis(p-sulfonylphenyl)phenylphosphine dihydrate potassium salt, tris(carboxyethyl)phosphine (TCEP), and triphenylphosphine-3,3',3"-trisulfonic acid trisodium salt.

[0199] In some embodiments, Pd(0) is prepared by mixing a Pd(II) complex [(PdCl(C3H5))2] with THP in situ. The molar ratio of the Pd(II) complex to THP is about 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, or 1:10. In some other embodiments, one or more reducing agents, such as ascorbic acid or a salt thereof (e.g., sodium ascorbate), may be added.

[0200] In some embodiments, Pd(0) is prepared by mixing a Pd(II) precatalyst, such as [Pd(C3H5)(THP)]Cl, [Pd(C3H5)(THP)2]Cl with additional THF. [Pd(C3H5)(THP)]Cl and [Pd(C3H5)(THP)2]Cl can be prepared by reacting (PdCl(C3H5))2 with 1-5 equivalents of THP and can be isolated prior to use in the chemical linearization reaction.

[0201] In some other embodiments, the Pd(0) complex is Pd(THM)4, Pd(THP)2, Pd(THP)3, or PD(THP)4, or a combination thereof.

[0202] Nickel reagent

[0203] In some embodiments of the Ni linearization method described herein, the Ni complex used in the chemical linearization method is water-soluble. In some such embodiments, the Ni complex is a Ni(0) complex. In some cases, the Ni complex can be generated in situ by reducing a Ni(II) compound with a reagent such as an olefin, an alcohol, an amine, a phosphine, or a metal hydride. In some embodiments, the Ni(II) compound is NiCl2. Suitable phosphines include water-soluble phosphines, such as tri(hydroxypropyl)phosphine (THP), tri(hydroxymethyl)phosphine (THM), 1,3,5-triaza-7-phosphaadamantane (PTA), bis(p-sulfonylphenyl)phenylphosphine dihydrate potassium salt, tri(carboxyethyl)phosphine (TCEP) and triphenylphosphine-3,3',3"-trisulfonic acid trisodium salt. In one embodiment, the Ni complex is prepared by mixing NiCl2 with 1 to 10 equivalents of THP.

[0204] Some embodiments of the present disclosure relate to a method for linearizing a plurality of fixed double-stranded polynucleotides, comprising: providing a solid support comprising double-stranded polynucleotides, each double-stranded polynucleotide comprising a first strand and a second strand, wherein each first strand is extended from a modified P5 primer fixed to the solid support, each second strand is extended from a P7 primer fixed to the solid support, and the first strand and the second strand are both fixed to the solid support at their 5' ends, wherein each modified P5 primer comprises a first cleavage site capable of chemical cleavage by a Pd(0) complex; contacting the double-stranded polynucleotide with an aqueous solution of a Pd(0) complex, thereby cleaving one or more first strands at the first cleavage site, and producing one or more cleaved first nucleic acids and cleaved fixed first strands; and removing the cleaved first nucleic acid from the solid support. In some embodiments, the first cleavage site comprises a modified T nucleoside or nucleotide having an allyl functionality. The cleavage site may further comprise a 3' capping portion, such as a phosphate portion, which remains on the first strand after the Pd cleavage reaction to cap the 3'-OH of the cleaved fixed first strand. In some embodiments, the 3' blocking portion comprises a modified nucleoside or nucleotide containing a phosphate group, which can be deprotected by a chemical reaction or by an enzymatic reaction. In one embodiment, the modified P5 primer comprises or is P15. 3'-Deprotection

[0205] Some embodiments of the present disclosure relate to methods for removing a 3' terminal protecting group from an oligonucleotide, comprising: providing a solid support comprising a plurality of oligonucleotides immobilized at their 5' ends on the solid support, wherein each of the oligonucleotides comprises a 3' terminal protecting group having a structure of formula (I) as described herein; and contacting the oligonucleotides with a deprotecting agent, thereby cleaving the 3' terminal protecting group to produce oligonucleotides each having a free 3' terminal hydroxyl group. A 3' terminal modified phosphate moiety having a structure of formula (I):

[0206]

[0207] Among them, R 1 -NH2, -OH, -NHC(O)OR a or -OCH2OSi(R b )3; R a C 1-4 alkyl, tert-butyl, allyl, benzyl or 9-fluorenylmethyl; each R b Independently selected from C 1-4 alkyl and phenyl; and R 2 H, C 1-4 alkyl, optionally substituted tetrahydrofuran, or nucleotide.

[0208] In some other embodiments, the protecting group comprises a structure of Formula (V):

[0209]

[0210] Wherein the base is optionally protected adenine, guanine, cytosine, thymine or uracil, or a derivative thereof. In some embodiments, one or more phosphate groups in formula (I) or (V) may be negatively charged (e.g., PO4 - ).

[0211] In some embodiments of Formula (I) or (V), R 1 Yes-NHC(O)OR a In some embodiments, R a is 9-fluorenylmethyl, benzyl or allyl. 1 OCH2OSi(R b )3. In some embodiments, each R b In some embodiments, each R b are independently methyl, ethyl, tert-butyl or phenyl.

[0212] In some embodiments, the modified phosphate groups of formula (I) or (V) can be removed by chemical deprotection reagents, such as fluoride-containing reagents, or bases. Non-limiting examples include tetra-n-butylammonium fluoride (TBAF), HF, NH4F, CsF, NaOH and KOH, and combinations thereof.

[0213] In some embodiments of the Pd / Ni linearization method described herein, after the first linearization, the remainder of the fixed first chain has an unprotected 3' terminal hydroxyl group, and the method further comprises: capping the 3' end of the remainder of the cleaved fixed first chain after the Pd / Ni cleavage reaction. In one such embodiment, the capping includes a 3' end of the phosphorylated cleaved fixed first chain as a 3' hydroxyl protecting group. In some other embodiments, the 3' end of each cleaved fixed first chain comprises a protecting group. In some such embodiments, the capping effect can be achieved by a phosphate moiety or a modified phosphate moiety remaining on the cleaved fixed first chain after the cleavage reaction, which serves as a capping group for the 3'-OH of the cleaved fixed first chain. In some embodiments, the modified phosphate moiety comprises a structure of formula (I) or (V) described herein.

[0214] Prior to DNA resynthesis, the phosphate group or modified phosphate group is removed to produce a derivative first strand complementary to the fixed second strand. In some embodiments, the 3' terminal protecting group is a phosphate group, which can be removed by a phosphatase, such as T4PNK. In some other embodiments, the 3' terminal protecting group is a modified phosphate group of formula (I) or (V), which can be removed by a fluoride-containing reagent or base, such as tetra-n-butylammonium fluoride (TBAF), HF, NH4F, CsF, NaOH or KOH or a combination thereof.

[0215] Second linearization method

[0216] In some embodiments of the Pd / Ni linearization method described herein, each second chain is extended from a second extension primer fixed to a solid support, and each second chain comprises a second cleavage site. In some such embodiments, the second extension primer comprises a nucleotide sequence selected from a P5 or P7 sequence disclosed herein, or a sequence complementary to P5 or P7. In one embodiment, the second extension primer comprises a P7 nucleotide sequence (SEQ ID NO.2). In another embodiment, the second extension primer comprises a poly-T spacer P7 nucleotide sequence (SEQ ID NO.4). In some aspects, the second extension primer comprises a nucleotide sequence as P5 or P7, wherein a modified nucleotide (a base with a 3' hydroxyl protective group is added or a base in a substitution sequence) is incorporated. In another embodiment, the second extension primer comprises a P17 primer (SEQ ID NO.6). In one embodiment, the second extension primer is a P7 primer. In another embodiment, the second extension primer is a poly-T spacer P7 primer. In another embodiment, the second extension primer is a P17 primer.

[0217] In some embodiments of the Pd / Ni linearization method described herein, the second extended primer comprises a second cleavage site. In some such embodiments, the second cleavage site cannot be chemically cleaved by a palladium complex or a nickel complex. In some respects, the second cleavage site can be cleaved by a method selected from chemical cleavage, photolysis, enzymatic cleavage, or a combination thereof. In one embodiment, the second cleavage site can be cleaved by an enzymatic cleavage reaction. In one embodiment, the second extended primer is a P7 primer disclosed herein (SEQ ID NO.2 or SEQ ID NO.4), and the second cleavage site is oxo-G. In some such embodiments, the enzyme used for the cleavage reaction is FPG.

[0218] In some other embodiments, the second cleavage site can be cleaved by a chemical cleavage reaction. In one such embodiment, the second extended primer comprises or is a P7 primer, which is modified to include modified nucleotides that are susceptible to chemical cleavage according to the pattern described herein. In some embodiments, the second extended primer comprises or is a P17 primer disclosed herein (SEQ ID NO.6), and the second cleavage site comprises one or more diol connections, which can be cleaved by treatment with a periodate, such as sodium periodate. In some such embodiments, the diol linker comprises a structure of formula (VIII):

[0219]

[0220] Where r is 2, 3, 4, 5 or 6;

[0221] s is 2, 3, 4, 5, or 6;

[0222] The "a" oxygen is the 3' hydroxyl oxygen of the first nucleotide; and

[0223] The "b" oxygen is the 5' hydroxyl oxygen of the second nucleotide.

[0224] In some embodiments, the diol linker has the structure of Formula (VIIIa):

[0225]

[0226] wherein "a" and "b" are as defined above.

[0227] In some other embodiments, the second cleavage site comprises an azobenzene linker, which can be cleaved by a chemical cleavage reagent, such as Na2S2O4. In some such embodiments, the azobenzene linker comprises a structure of formula (X):

[0228]

[0229] Where R 1is H, hydroxyl or protected hydroxyl; R 2 H, C 1-6 Alkyl or C 1-6 Alkoxy; each R 3 and R 4 are independently H, halogen, -C(O)OR 5 or -C(O)NHR 6 ; Each R 5 and R 6 Independently H, C 1-6 Alkyl or C 6-10 Aryl; X is -C(O)-, -CH 2- or -C(O)NH-; and each m1, m2, and m3 are independently 1, 2, 3, 4, 5, or 6. In some aspects, R 1 In some other aspects, R 1 is a protected hydroxyl group, such as -OBz. In certain aspects, R 3 -C(O)OR 5 In some respects, R 3 -C(O)NHR 6 In some of these respects, R 5 and R 6 Independently for C 1-6 In other aspects, R 3 H. In some respects, R 2 H. In some aspects, R 4 is H. In certain aspects, X is -CH 2- In some other aspects, X is -C(O)NH-. In some aspects, m1 is 2, 3, or 4. In some aspects, m2 is 1, 2, or 3. In some aspects, m3 is 1, 2, or 3.

[0230] In some embodiments of the azobenzene linker of formula (X), one terminal oxygen atom is further connected to a phosphate group, for example having a structure of formula (Xa) or formula (Xb):

[0231]

[0232] In some aspects, the "a" oxygen is the 3' hydroxyl oxygen of the first nucleotide. In some aspects, the "b" oxygen is the 5' hydroxyl oxygen of the second nucleotide. In some other aspects, the "b" oxygen is the 3' hydroxyl oxygen of the first nucleotide. In some other aspects, the "a" oxygen is the 5' hydroxyl oxygen of the second nucleotide.

[0233] The azobenzene linker (Xa) or (Xb) of Formula I can be incorporated into an oligonucleotide or polynucleotide via a chemical reagent, wherein the chemical reagent is a phosphoramidite compound of Formula (XIa) or (XIb):

[0234]

[0235] Where R 1 -R 4 , X, m1, m2 and m3 are defined in (X); and

[0236] PG is a protecting group removable under weakly acidic conditions (eg, triphenylmethyl or dimethoxytriphenylmethyl).

[0237] Some other embodiments of the present disclosure relate to a method for linearizing a plurality of fixed double-stranded polynucleotides, comprising: providing a solid support comprising double-stranded polynucleotides, each double-stranded polynucleotide comprising a first chain and a second chain, wherein the first chain and the second chain are fixed to the solid support at their 5' ends, wherein each first chain comprises a first cleavage site, and each second chain comprises a second cleavage site containing an azobenzene linker; cleaving one or more first chains at the first cleavage site, and producing one or more cleaved first nucleic acids and cleaved fixed first chains; removing the cleaved first nucleic acids from the solid support; sequencing the fixed second chain; resynthesizing a derivative first chain complementary to the second chain; and, cleaving one or more second chains at the second cleavage site, and producing one or more cleaved second nucleic acids and cleaved fixed second chains. In some embodiments of such methods, each first chain is extended from a first extension primer fixed to a solid support, and wherein the first extension primer comprises a first cleavage site. In some embodiments of such methods, the first cleavage site can be cleaved by a method selected from chemical cleavage, photocleavage, enzymatic cleavage, and a combination thereof, for example, the first cleavage site can be cleaved by a Pd / Ni method described herein, or an enzymatic method (e.g., UDG). In some such embodiments, the first extension primer comprises P5, modified P5 or P15. In some embodiments, each second chain is extended from a second extension primer fixed to a solid support, and wherein the second extension primer comprises a second cleavage site. In some such embodiments, the azobenzene linker comprises a structure of formula (X), (Xa) or (Xb) as described herein. In some embodiments, the azobenzene linker is cleaved by Na2S2O4. In some embodiments, the sequencing of the fixed second chain includes continuously incorporating labeled nucleotides complementary to the fixed second chain and detecting the labeled nucleotides. In some embodiments, the 3' end of each cleaved fixed first chain comprises a protecting group, such as a phosphate group or a modified phosphate portion of a structure comprising formula (I) or (V) as described herein. The protecting group can be removed by an enzymatic reaction (e.g., enzyme T4PNK) or chemical deprotection, for example, a fluoride-containing reagent or base as described herein, which is used to deprotect the modified phosphate portion of the structure comprising formula (I) or (V). In some embodiments, the method further comprises removing the cleaved second nucleic acid from the solid support and sequencing the derived first strand. In some embodiments, after removing the cleaved second nucleic acid from the solid support, the fixed derived first strand remains on the solid support and remains hybridized with the cleaved fixed second strand.

[0238] In some embodiments of the first and second linearization methods described herein, the double-stranded polynucleotide is fixed to a solid support by covalent bonding. In one embodiment, the double-stranded polynucleotide is covalently bonded to a hydrogel or polymer coating on a solid support. In one embodiment, the hydrogel or polymer coating comprises PAZAM. In some embodiments, the hydrogel or polymer coating is also covalently attached to the surface of the solid support, for example, by reacting with a functionalized silane deposited on the surface. In one embodiment, the functionalized silane is a norbornene-derived silane. Non-limiting examples of hydrogels or polymer coatings on silanized solid supports and methods for grafting polynucleotides or primers to hydrogel or polymer-coated solid supports are disclosed in U.S. Publication Nos. 2014 / 0079923 and 2015 / 0005447, which are incorporated herein by reference in their entirety.

[0239] Grafted solid supports for Pd linearization

[0240] Some embodiments of the present disclosure relate to a solid support comprising a plurality of first-strand polynucleotides immobilized thereon, each first-strand polynucleotide comprising a first cleavage site capable of chemical cleavage (e.g., by a palladium complex or a nickel complex as described herein), wherein the plurality of first-strand polynucleotides are immobilized at their 5' ends to the solid support.

[0241] In some embodiments of the solid support herein, each first chain comprises the first extension primer fixed to the solid support or extends therefrom. In some such embodiments, the first extension primer comprises a nucleotide sequence selected from the P5 or P7 sequence disclosed herein or a sequence complementary to P5 or P7. In one embodiment, the first extension primer comprises a P5 nucleotide sequence (SEQ ID NO.1). In another embodiment, the first extension primer comprises a poly-T spacer P5 nucleotide sequence (SEQ ID NO.3). In one embodiment, the first extension primer is a P5 primer. In another embodiment, the first extension primer is a poly-T spacer P5 primer. In some embodiments, the P5 or P7 sequence is modified to include a modified nucleoside or nucleotide of at least a portion forming a cleavage site.

[0242] In some embodiments of the solid support herein, the first extended primer comprises a first cleavage site. In some other embodiments, the first cleavage site comprises a modified nucleotide or nucleoside that can be chemically cleaved, for example, by a palladium complex or a nickel complex. In some such embodiments, the modified nucleotide or nucleoside is a T nucleoside or a nucleotide analog. In one such embodiment, the cleavage site comprises a T nucleoside analog, which comprises an allyl functionality, for example, a vinyl substitution is included at the 5'-carbon position of the T nucleoside analog, thereby forming an allyl moiety relative to the 5' hydroxyl. In some such embodiments, the modified nucleoside or nucleotide comprises the structure of formula (II) as described herein. In some embodiments, the 5' hydroxyl is connected to the 3' phosphate of the second nucleotide, so that the dinucleotide unit comprises a cleavage site with an allyl phosphate moiety. In some such embodiments, the modified nucleoside or nucleotide comprises the structure of formula (II') as described herein. In some embodiments, the first extended primer comprises or is a P15 primer. In some further embodiments, on the second nucleotide, the cleavage site also comprises a 3' protection (or end-capping) moiety, such as a phosphate moiety. After chemical cleavage of the first chain, the capping portion remains on the fixed first chain of the cleavage. In one embodiment, the 3' phosphate moiety of the second nucleotide is covalently attached to the 5'-carbon position of the modified nucleoside analog (that is, the phosphate group includes the 5' hydroxyl group of the modified nucleotide). In some embodiments, the capping group retained on the fixed first chain of the cleavage comprises a structure of formula (I) or formula (V) as described herein, which can be removed in a chemical deprotection reagent, such as a fluoride-containing compound or base. In some embodiments, the capping group retained on the fixed first chain of the cleavage is a phosphate group, which can be removed by a phosphatase (e.g., T4PNK). In some embodiments, the cleavage site is located near the 3' end of the first extension primer, for example, within a distance of 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides from the 3' end of the first extension primer. In some other embodiments, the cleavage site is located near the 5' end of the first extension primer, for example, within a distance of 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides from the 5' end of the first extension primer. In some cases, in order to ensure effective DNA resynthesis, the cleavage site is preferably located towards the 3' end of the first primer, for example, a distance of 2 to 8, or 3 to 7, or 4 to 6 nucleotides. In one embodiment, the first extension primer is a P5 primer, and the first cleavage site is located in the P5 primer sequence (for example, by adding to or replacing a nucleotide, a modified nucleotide is incorporated into the P5 primer sequence). Therefore, the P5 sequence disclosed herein (SEQ ID NO.1 or SEQ ID NO.3) is modified to include a first cleavage site that can be chemically cleaved by a Pd / Ni complex, thereby forming a modified P5 primer.In one embodiment, the modified P5 primer comprises or is the P15 primer disclosed herein (SEQ ID NO. 5). In some other embodiments, the modified nucleotides or nucleosides can be further labeled with a detectable label, such as a fluorescent label. The detectable label enables direct quantification of the grafting reaction immediately after the grafting reaction is completed.

[0243] In some embodiments of the solid support herein, the Pd complex used in the chemical linearization method is water-soluble. In some such embodiments, the Pd complex is a Pd(0) complex. In some cases, the Pd(0) complex can be generated in situ by reducing the Pd(II) complex with a reagent such as an olefin, an alcohol, an amine, a phosphine or a metal hydride. Suitable palladium sources include Na2PdCl4, (PdCl(C3H5))2, [Pd(C3H5)(THP)]Cl, [Pd(C3H5)(THP)2]Cl, Pd(OAc)2, Pd(Ph3)4, Pd(dba)2 and Pd(TFA)2. In one such embodiment, Pd(0) complex is generated in situ from Na2PdCl4. In another embodiment, the palladium source is an allylpalladium chloride (II) dimer [(PdCl(C3H5))2]. In some embodiments, a Pd(0) complex is produced in aqueous solution by mixing a Pd(II) complex with a phosphine. Suitable phosphines include water-soluble phosphines such as tris(hydroxypropyl)phosphine (THP), tris(hydroxymethyl)phosphine (THM), 1,3,5-triaza-7-phosphaadamantane (PTA), bis(p-sulfonylphenyl)phenylphosphine dihydrate potassium salt, tris(carboxyethyl)phosphine (TCEP), and triphenylphosphine-3,3',3"-trisulfonic acid trisodium salt. In some embodiments, Pd(0) is prepared by mixing [(PdCl(C3H5))2] with THP in situ. One or more reducing agents such as ascorbic acid or a salt thereof (e.g., sodium ascorbate) may be added. In some embodiments, the Pd(0) complex is Pd(THM)4, Pd(THP)2, Pd(THP)3, or PD(THP)4, or a combination thereof.

[0244] In some embodiments of the solid support herein, the Ni complex used in the chemical linearization is water soluble. In some such embodiments, the Ni complex is a Ni(0) complex. In some cases, the Ni complex can be produced in situ by reducing a Ni(II) compound (e.g., NiCl) by being similar to those reagents used in reducing Pd(II) to Pd(0) as described herein. In one embodiment, the Ni complex is prepared by mixing NiCl with 1 to 10 equivalents of THP.

[0245] In some embodiments of the solid support herein, the solid support also includes a plurality of second chain polynucleotides fixed thereon, each second chain polynucleotide includes a second cleavage site, wherein a plurality of second chain polynucleotides are fixed to the solid support at its 5' end. In some such embodiments, each second chain polynucleotide includes a second extension primer fixed to the solid support or extends therefrom. In some such embodiments, the second extension primer includes a nucleotide sequence selected from a P5 or P7 sequence disclosed herein or a sequence complementary to P5 or P7. In one embodiment, the second extension primer includes a P7 nucleotide sequence (SEQ ID NO.2). In another embodiment, the second extension primer includes a poly-T spacer P7 nucleotide sequence (SEQ ID NO.4). In another embodiment, the second extension primer includes a P15 sequence (SEQ ID NO.6). In one embodiment, the second extension primer is a P7 primer. In another embodiment, the second extension primer is a poly-T spacer P7 primer. In some embodiments, the P7 primer or poly-T spacer P7 primer is modified to remove 8-oxo-guanine and insert a chemically cleavable linker, such as one or more diol units. In another embodiment, the second extended primer is a P17 primer. In some embodiments, the second extended primer comprises a second cleavage site. In some such embodiments, P5, P7 or P17 sequences are modified to include modified nucleotides with a cleavable joint. In some further embodiments, the second cleavage site can not be chemically cleaved by the palladium complex or nickel complex used in the first chemical linearization reaction. The second cleavage site can be cleaved by a method selected from chemical cleavage, photolysis, enzymatic cleavage or a combination thereof. In one embodiment, the second cleavage site can be cleaved by an enzymatic cleavage reaction. In one such embodiment, the second extended primer is a P7 primer (SEQ ID NO.2 or SEQ ID NO.4) disclosed herein, and the second cleavage site is oxo-G. In another embodiment, the second cleavage site can be cleaved by a chemical cleavage reaction. For example, the second cleavage site can include one or more vicinal diol connections (which can be cleaved by oxidation, such as treatment with a periodate reagent), disulfide connections (cleavable, such as under reducing conditions, such as DTT, or in the presence of a phosphine), o-nitrobenzyl (cleavable, such as by photolysis), azobenzene connections (cleavable, such as in the presence of Na2S2O4), alkyl-selenium connections (cleavable, such as by oxidation, such as hydrogen peroxide), silyl ether connections (cleavable, such as by fluoride ions, acids or bases), or allyl carbamate connections (cleavable, such as in the presence of a palladium complex). These connections can generate at least one free hydroxyl group after chemical cleavage.In one such embodiment, the second extended primer comprises or is a P17 primer disclosed herein (SEQ ID NO.6), and the second cleavage site comprises one or more diol links that can be cleaved by oxidation (e.g., by treatment with sodium periodate). In some embodiments, the diol linker comprises a structure of formula (VIII) or (VIIIa) as described herein. In some embodiments, the azobenzene linker comprises a structure of formula (X), (Xa) or (Xb) as described herein.

[0246] Some embodiments of the present disclosure relate to a solid support, comprising a plurality of first-strand polynucleotides and a plurality of second-strand polynucleotides fixed thereon, each first-strand polynucleotide being extended from a modified P5 primer fixed to the solid support, the modified P5 primer comprising a first cleavage site; each second-strand polynucleotide being extended from a P7 primer fixed to the solid support, the P5 primer comprising a second cleavage site; wherein both the first-strand and the second-strand polynucleotides are fixed to the solid support at their 5' ends, and wherein the first cleavage site is capable of chemical cleavage by a Pd complex or a Ni complex, such as a palladium (0) complex or a Ni (0) complex. In some embodiments, the first cleavage site comprises a modified T nucleoside having an allyl functionality as described herein. The cleavage site may further include a portion that can be used as a 3' end-capping portion, such as a phosphate or a modified phosphate portion, which remains on the first-strand polynucleotide after the Pd / Ni cleavage reaction to cap the 3'-OH of the fixed first-strand polynucleotide cleaved.

[0247] In some embodiments of the solid support herein, the first and second strand polynucleotides are fixed to the solid support by covalent bonding with a polymer or hydrogel coating on the surface of the solid support. In one embodiment, the hydrogel or polymer coating comprises PAZAM. In some embodiments, the hydrogel or polymer coating is also covalently attached to the surface of the solid support, for example, by reacting with a functionalized silane deposited on the surface. In one embodiment, the functionalized silane is a norbornene-derived silane. In one embodiment, the solid support includes or is a flow cell.

[0248] Solid support surface

[0249] In some embodiments, before primer grafting, the surface of solid carrier includes the region coated with functionalized molecules and the inert region without coating. In some such embodiments, the functionalized molecular coating is a hydrogel or polymer coating. The coating region may include reactive sites, and therefore may be used for attaching molecules by chemical bonding or other molecular interactions, such as hybridization or covalent reactions. In some embodiments, the coating region (for example, reactive features, channels, pads, beads or holes) and the inert region (referred to as the gap region) may alternate to form a pattern or grid. Such a pattern may be one-dimensional or two-dimensional. In some embodiments, the inert region may be selected from glass region, metal region, mask region or gap region or a combination thereof. Alternatively, these materials may form a reaction region. Inertness or reactivity will depend on the chemistry and process used on the substrate. In one embodiment, the surface of solid carrier includes glass region. In another embodiment, the surface includes metal region.

[0250] In some embodiments, the solid support herein forms at least a portion of a flow cell or is located in the flow cell. In some such embodiments, the flow cell also includes polynucleotides attached to the surface of the solid support via functionalized molecular coatings, such as polymers or hydrogel coatings. In some embodiments, the polynucleotides are present in the flow cell in the form of polynucleotide clusters, wherein the polynucleotides of the polynucleotide clusters are attached to the surface of the flow cell via hydrogels or polymer coatings. In such embodiments, the surface of the flow cell body to which the polynucleotides are attached is considered to be a solid support. In other embodiments, a separate solid support with a surface coated with a hydrogel or polymer is inserted into the flow cell body. In a preferred embodiment, the flow cell is a flow chamber divided into a plurality of swimming lanes or a plurality of sectors, wherein one or more of the plurality of swimming lanes or a plurality of sectors include a surface coated with a covalently attached hydrogel or polymer as described herein. In some embodiments of the flow cell described herein, the attached polynucleotides in a single polynucleotide cluster have identical or similar nucleotide sequences. In some embodiments of the flow cell described herein, the attached polynucleotides of different polynucleotide clusters have different or dissimilar nucleotide sequences. Exemplary flow cells and substrates for making flow cells that can be used with the methods or compositions described herein include, but are not limited to, those commercially available from Illumina, Inc. (San Diego, CA), or described in U.S. Publication Nos. 2010 / 0111768A1 and 2012 / 0270305, each of which is incorporated herein by reference.

[0251] PAZAM

[0252] One embodiment of a hydrogel or polymer coating on a solid support surface comprises PAZAM, a polyacrylamide copolymer comprising the following two repeating units:

[0253]

[0254] In some embodiments, PAZAM is a linear polymer. In some other embodiments, PAZAM is a lightly cross-linked polymer. PAZAM can be functionalized or modified for use in the compositions or methods described herein. The preparation of PAZAM and its analogs is disclosed in U.S. Patent No. 9,012,022, which is hereby incorporated by reference in its entirety.

[0255] 3' blocking group

[0256] During the SBS cycle, to ensure that only a single incorporation occurs, a structural modification ("protecting group") is added to each labeled nucleotide that is added to the growing chain to ensure that only one nucleotide is incorporated. After the nucleotide with the protecting group has been added, the protecting group is then removed under conditions that do not interfere with the integrity of the DNA being sequenced. The sequencing cycle can then continue with the incorporation of the next protected, labeled nucleotide.

[0257] In order to be useful in DNA sequencing, nucleotides, more generally nucleotide triphosphates, usually require 3'-hydroxyl protecting groups to prevent the polymerase used to be incorporated into the polynucleotide chain from continuing to replicate when the base on the nucleotide is added. There are many restrictions on the group types that can be added to the nucleotide and still suitable. Protecting groups should prevent other nucleotide molecules from being added to the polynucleotide chain, and can easily be removed from the sugar moiety and can not damage the polynucleotide chain. In addition, modified nucleotides need to be tolerated by the polymerase or other suitable enzymes that are used to be incorporated into the polynucleotide chain. Therefore, ideal protecting groups show medium and long-term stability, can be effectively incorporated by polymerase enzyme, cause end-capping secondary or further nucleotide to be incorporated, and can be removed under mild conditions that can not damage the polynucleotide structure, preferably under aqueous mild conditions.

[0258] Reversible protecting groups have been reported previously. For example, Metzker et al., (Nucleic Acids Research, 22 (20): 4259-4267, 1994) discloses the synthesis and use of eight 3'-modified 2-deoxyribonucleoside 5'-triphosphates (3'-modified dNTPs), and tests the incorporation activity in two DNA template assays. WO2002 / 029003 describes a sequencing method, which may include using an allyl protecting group to block the 3'-OH group of the growing DNA chain in a polymerase reaction. Other reversible protecting groups and methods for deprotecting them under DNA compatible conditions include azidomethyl or modified azidomethyl, which are disclosed in International Application Publication Nos. WO2004 / 018497 and WO2014 / 139596, and are incorporated herein by reference in their entirety.

[0259] One embodiment of a 3'-OH protecting group as described herein is a phosphate group, which can be removed by phosphatases.

[0260] Detectable Label

[0261] Some embodiments described herein involve the use of detectable labels. Detection can be performed by any suitable method, including fluorescence spectroscopy or by other optical means. Preferred labels are fluorophores, which emit radiation of a defined wavelength after absorbing energy. Many suitable fluorescent labels are known. For example, Welch et al. (Chem. Eur. J. 5(3): 951-960, 1999) discloses dansyl-functionalized fluorescent moieties that can be used in the present invention. Zhu et al. (Cytometry 28: 206-211, 1997) describes the use of fluorescent labels Cy3 and Cy5, which can also be used in the present invention. Labels suitable for use are also disclosed in Prober et al. (Science 238:336-341, 1987); Connell et al. (BioTechniques 5(4):342-384, 1987); Ansorge et al. (Nucl. Acids Res. 15(11):4593-4602, 1987); and Smith et al. (Nature 321:674, 1986). Other commercially available fluorescent labels include, but are not limited to, fluorescein, rhodamine (including TMR, Texas Red and Rox), alexa, bodipy, acridine, coumarin, benzopyrene, benzanthracene and anthocyanidin.

[0262] In some embodiments, detectable labels can be used for the first cleavage site of polynucleotides capable of Pd cleavage in the methods and solid supports described herein. In particular, the first cleavage site can comprise a labeled modified nucleotide or nucleoside. This method can further simplify the current Illumina manufacturing workflow. In one embodiment, the allyl-modified P5 primer described herein can be modified to include a fluorescent tag, which enables direct quantitative grafting reactions immediately after the grafting reaction is completed, thereby eliminating the need for a separate hybridization assay for this quantitative step.

[0263] Detectably labeled linkers

[0264] In some embodiments described herein, the nucleobase of modified nucleotide or nucleoside can be connected to detectable label as described above. In some such embodiments, the joint used is cleavable. Use cleavable joint to ensure that the label can be removed (if necessary) after detection to avoid any interference signal with any labeled nucleotide or nucleoside subsequently incorporated.

[0265] In some other embodiments, the linker used is non-cleavable.Since in each case of incorporating a labeled nucleotide of the invention, no nucleotide needs to be subsequently incorporated, the label does not need to be removed from the nucleotide.

[0266] Cleavable joints are known in the art, and conventional chemistry can be applied to attach joints to nucleotide bases and labels. The joint can be cleaved by any suitable method, including exposure to acid, alkali, nucleophilic reagents, electrophilic reagents, free radicals, metals, reducing agents or oxidants, light, temperature, enzymes, etc. The joints discussed herein can also be cleaved using the same catalyst for cleavage of 3'-O-protecting group bonds. Suitable joints can be adapted from the normalized chemical protecting groups disclosed in Greene & Wuts, Protective Groups in Organic Synthesis, John Wiley & Sons. Other suitable cleavable joints for solid phase synthesis are disclosed in Guillier et al. (Chem. Rev. 100: 2092-2157, 2000).

[0267] The use of the term "cleavable linker" is not meant to imply that the entire linker needs to be removed from, for example, a nucleotide base. In the case where the detectable label is attached to the base, the nucleoside cleavage site can be located at a position on the linker that ensures that a portion of the linker remains attached to the nucleotide base after cleavage.

[0268] In the case where the detectable label is attached to a base, the linker can be attached at any position on the nucleotide base as long as Watson-Crick base pairing can still be performed. In the case of purine bases, the linker is preferably attached through the 7-position of a purine or a preferred deazapurine analog, through an 8-modified purine, through an N-6 modified adenosine, or an N-2 modified guanine. For pyrimidines, attachment is preferably through the 5-position on cytosine, thymine or uracil, and the N-4 position on cytosine.

[0269] In some embodiments, the linker may be composed of functionality similar to the 3'-OH protecting group. This will make the deprotection and deprotection methods more efficient, as only a single treatment will be required to remove both the label and the protecting group. A particularly preferred linker is one containing a phosphine-cleavable azide.

[0270] Cracking method

[0271] In the linearization step, various cleavage methods can be used to cleave one or both strands of the double-stranded nucleic acid molecule, such as for the cleavage of the second strand polynucleotide described herein. Preferred but non-limiting embodiments of suitable cleavage methods are discussed in further detail below.

[0272] A) Chemical lysis

[0273] The term "chemical cleavage" encompasses any method for the cracking of one or two chains in a double-stranded nucleic acid molecule utilizing non-nucleic acid and non-enzymatic chemical reagents to promote / realize. If desired, one or two chains in a double-stranded nucleic acid molecule may include one or more non-nucleotide chemical moieties, and / or non-natural nucleotides, and / or non-natural backbone connections, to allow chemical cleavage reactions to be carried out at specific cleavage sites, preferably predetermined cleavage sites. In a non-limiting embodiment, a chain in a double-stranded nucleic acid molecule may include a glycol connection, which allows cleavage by processing with periodate (e.g., sodium periodate). A glycol connection may be located at the cleavage site, and its precise location may be selected by the user. It should be understood that more than one glycol may be included at the cleavage site.

[0274] Diol linker units based on phosphoramidite chemistry suitable for incorporation into polynucleotide chains are commercially available from Fidelity Systems, Inc. (Gaithersburg, MD, USA). One or more diol units can be incorporated into polynucleotides using standard methods for automated chemical DNA synthesis. In order to place the diol linker at the optimal distance from the solid support, one or more spacer molecules can be included between the attachment site of the diol linker and the solid support. The spacer molecule can be a non-nucleotide chemical part. Suitable spacer units based on phosphoramidite chemistry for binding to diol linkers are also provided by Fidelity Systems, Inc. The diol linker is cleaved by treating with a "cleavage reagent", which can be any substance that promotes diol cleavage. A preferred cleavage reagent is periodate, preferably sodium periodate (NaIO4) aqueous solution. After treating with a cleavage reagent (e.g., periodate) to cleave the diol, the cleaved product can be treated with a "blocking agent" to neutralize the reactive species produced in the cleavage reaction. Suitable blocking agents for this purpose include amines, such as ethanolamine. Advantageously, a blocking agent (eg ethanolamine) may be included in a mixture with the lysis agent (eg periodate) so that the reactive species is blocked as soon as it is formed.

[0275] The combination of diol ligation and a cleavage agent such as periodate, which achieves cleavage of one strand of a double-stranded nucleic acid molecule, is preferred for the linearization of nucleic acid molecules on a solid support polyacrylamide hydrogel because treatment with periodate is compatible with the integrity of the nucleic acid and the chemistry of the hydrogel surface. However, the diol method can also be used for the linearization of nucleic acids immobilized on other surfaces, including supports coated with functionalized silanes.

[0276] In another embodiment, the strand to be cleaved (or if prepared by solid phase amplification, the amplification primer from which it is derived) may include a disulfide group that allows cleavage with a chemical reducing agent, such as tris(2-carboxyethyl)phosphate hydrochloride (TCEP).

[0277] B) Cleavage of abasic sites in double-stranded molecules

[0278] "Abasic sites" are defined as nucleoside positions in a polynucleotide chain from which base components have been removed. Abasic sites can occur naturally in DNA under physiological conditions by hydrolysis of nucleoside residues, but can also be formed chemically under artificial conditions or by the action of enzymes. Once formed, abasic sites can be cleaved (e.g., by treatment with endonucleases or other single-strand cleavage enzymes, exposure to heat or alkali), thereby providing a means for site-specific cleavage of polynucleotide chains.

[0279] In one non-limiting embodiment, an abasic site can be generated at a predetermined position on one of the strands in a double-stranded polynucleotide, and then cleaved at a predetermined cleavage site in the double-stranded nucleic acid molecule by first incorporating deoxyuridine (U). This can be achieved, for example, by including U in one of the primers used to prepare the double-stranded nucleic acid molecule by solid phase PCR amplification. The enzyme uracil DNA glycosylase (UDG) can then be used to remove the uracil base, thereby generating an abasic site on one strand. The polynucleotide strand including the abasic site can then be cleaved at the abasic site by treatment with an endonuclease (e.g., EndoIV endonuclease, AP lyase, glycosylase FPG / AP lyase, EndoVIII glycosylase / AP lyase), heat or alkali.

[0280] Abasic sites can be used to generate free 3'-hydroxyl moieties for use as sequencing primers. If both amplification primers are modified so that they can be sequentially cleaved, the second cleavage can be used to cleave the first strand from the surface. The first (or second) primer can contain uracil bases, which can be cleaved by an enzyme (UDG), and the second (or first) primer can contain 8-oxo-guanine bases, which can be cleaved by a second orthogonal enzyme, FPG glycosylase. The cleavage of the second abasic site can be used to attach the sequencing primer to the surface, thereby incorporating the G base as the first cycle of sequencing, or the cleaved double strands can be denatured to allow the sequencing primer to hybridize in solution.

[0281] C) Ribonucleotide cleavage

[0282] Incorporation of one or more ribonucleotides into a polynucleotide chain that otherwise comprises deoxyribonucleotides (with or without additional non-nucleotide chemical moieties, non-natural bases, or non-natural backbone linkages) can provide a site for cleavage using a chemical reagent that is capable of selectively cleaving the phosphodiester bond between deoxyribonucleotides and ribonucleotides, or using a ribonuclease (RNAse). Thus, the present invention further encompasses the generation of a sequencing template by cleaving one strand (of a double-stranded nucleic acid molecule) at a site containing one or more consecutive ribonucleotides using such a chemical cleavage reagent or RNAse. Preferably, the strand to be cleaved contains a single ribonucleotide to provide a predetermined site for chemical cleavage.

[0283] Suitable chemical cleavage agents that selectively cleave the phosphodiester bonds between deoxyribonucleotides and ribonucleotides include metal ions, such as rare earth metal ions (particularly La 3+ , especially Tm 3+ , Yb 3+ , or Lu 3+(Chen et al., Biotechniques, 2002, 32: 518-520; Komiyama et al. Chem. Commun. 1999, 1443-1451)), Fe(3) or Cu(3), or exposure to elevated pH, for example, treatment with a base such as sodium hydroxide. "Selective cleavage of the phosphodiester bond between deoxyribonucleotides and ribonucleotides" means that the chemical cleavage reagent cannot cleave the phosphodiester bond between two deoxyribonucleotides under the same conditions. The base composition of one or more ribonucleotides is generally not important, but can be selected to optimize chemical (or enzymatic) cleavage. For example, if cleavage is to be performed by exposure to metal ions, particularly rare earth metal ions, rUMP or rCMP is generally preferred.

[0284] One or more ribonucleotides will generally be incorporated into one of the chains in the double-stranded nucleic acid molecule, and can be located in the single-stranded region (i.e., in the 5' overhang portion) when the two complementary chains of the double-stranded molecule are annealed. In particular, if a double-stranded nucleic acid molecule is prepared by solid-phase PCR amplification using forward and reverse amplification primers, one of which contains at least one ribonucleotide, the standard DNA polymerase used for PCR amplification cannot replicate the ribonucleotide template. Therefore, the product of the solid-phase PCR reaction will contain the overhang 5' region, which contains one or more ribonucleotides and any residues of the amplification primer upstream of the one or more ribonucleotides.

[0285] The phosphodiester bond between a ribonucleotide and a deoxyribonucleotide or between two ribonucleotides can also be cleaved by an RNA enzyme. Any endocytic ribonuclease with appropriate substrate specificity can be used for this purpose. If one or more ribonucleotides are present in the single-stranded region (i.e., in the 5' overhang portion) when two complementary chains of a double-stranded molecule are annealed, then the RNA enzyme will be a specific endonuclease to the single-stranded region containing the ribonucleotide. In order to use ribonuclease-catalyzed cleavage, preferably two or more continuous ribonucleotides are included, and preferably 2 to 10 or 5 to 10 continuous ribonucleotides. The precise sequence of ribonucleotides is usually unimportant, except that some RNA enzymes have specificity for the cleavage after specific residues. Suitable RNA enzymes include, for example, RNA enzyme A, which cleaves after C and U residues. Therefore, when cleaved with RNA enzyme A, the cleavage site must include at least one C or U ribonucleotide.

[0286] Polynucleotides incorporating one or more ribonucleotides can be readily synthesized using suitable ribonucleotide precursors using standard techniques for chemical synthesis of oligonucleotides. If double-stranded nucleic acid molecules are prepared by solid phase nucleic acid amplification, it is convenient to incorporate one or more ribonucleotides into one of the primers to be used in the amplification reaction.

[0287] D) Photochemical cleavage

[0288] The term "photolysis" or "photochemical cleavage" encompasses any method for utilizing light energy to achieve the cleavage of one or both chains in a double-stranded nucleic acid molecule. A predetermined site for photochemical cleavage can be provided by a non-nucleotide chemical spacer unit in one of the chains of a double-stranded molecule. Suitable photochemical cleavable spacers include PC spacer phosphoramidites (4-(4,4'-dimethoxytriphenylmethoxy)butyrylamide methyl)-1-(2-nitrophenyl)-ethyl]-2-cyanoethyl-(N,N-diisopropyl)-phosphoramidites), provided by Glen Research, Sterling, Virginia, USA. The spacer unit can be cleaved by exposure to a UV light source. Standard techniques for chemical synthesis of oligonucleotides can be used to attach the spacer unit to the 5' end of the polynucleotide, and to allow the thiophosphate group attached to a solid surface. Conveniently, the spacer unit can be incorporated into a forward or reverse amplification primer for synthesizing a double-stranded nucleic acid molecule that can be photocleaved by solid phase amplification.

[0289] E) PCR blocker

[0290] In another embodiment, double-stranded nucleic acid can be prepared by solid phase amplification using forward and reverse primers, one of which contains a "PCR blocker". A "PCR blocker" is any portion (nucleotide or non-nucleotide) that prevents the polymerase used for amplification from reading through so that it cannot replicate beyond that point. As a result, the amplified chain derived by extending the primer containing the PCR blocker will contain a 5' overhang portion. The 5' overhang (except the PCR blocker itself) can be composed of naturally occurring deoxyribonucleotides, mainly with natural backbone connections, that is, it can simply be a stretch of single-stranded DNA. A cleavage reagent (e.g., an enzyme) can then be used to cleave the molecule in the 5' overhang region, which is selective for cleaving single-stranded DNA rather than cleaving double-stranded DNA, such as mung bean nuclease.

[0291] A PCR blocker can be any moiety that substantially prevents read-through of a polymerase used in an amplification reaction. Suitable PCR blockers include, but are not limited to, hexaethylene glycol (HEG), abasic sites, and any non-natural or modified nucleotides that prevent read-through of a polymerase, including DNA analogs such as peptide nucleic acids (PNA).

[0292] Stable abasic sites can be introduced during chemical oligonucleotide synthesis using suitable spacer units containing stable abasic sites. For example, abasic furan (5'-O-dimethoxytriphenylmethyl-1', 2'-dideoxyribose-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite) spacers commercially available from Glen Research, Sterling, Virginia, USA can be incorporated during chemical oligonucleotide synthesis to introduce abasic sites. Such sites can therefore be easily introduced into oligonucleotide primers for solid phase amplification. If abasic sites are incorporated into forward or reverse amplification primers, the resulting amplification product will have a 5' overhang on one chain including the abasic site (in single-stranded form). The single-stranded abasic site can then be cleaved by the action of an appropriate chemical agent (eg, exposure to base) or an enzyme (eg, AP-endonuclease VI, Shida el al., Nucleic Acids Research, 1996, Vol. 24, 4572-4576).

[0293] F) Cleavage of the peptide linker

[0294] It is also possible to introduce a cleavage site into one of the chains in a double-stranded nucleic acid molecule by preparing a conjugate structure in which a peptide molecule is connected to one of the chains in a nucleic acid molecule. The peptide molecule can then be cleaved by a peptidase with appropriate specificity, or by any other appropriate means of non-enzymatic chemistry or photochemical cleavage. Typically, the conjugate between a peptide and a nucleic acid will be formed by covalently linking the peptide to only one of the chains in a double-stranded nucleic acid molecule, wherein the peptide portion is conjugated to the 5' end of the chain, adjacent to the attachment point to a solid surface. If a double-stranded nucleic acid is prepared by solid phase amplification, the peptide conjugate can be incorporated at the 5' end of one of the amplified products. Obviously, the peptide component of the primer will not be replicated during the PCR amplification process. Therefore, the "bridging" amplified product will include a cleavable 5' peptide "cantilever" on one chain.

[0295] Conjugates between peptides and nucleic acids in which the peptide is conjugated to the 5' end of the nucleic acid can be prepared using techniques generally known in the art. In one such technique, the peptide and nucleic acid components of the desired amino acid and nucleotide sequences can be synthesized separately, for example, by standard automated chemical synthesis techniques, and then conjugated in aqueous / organic solutions. For example, OPeC, commercially available from Glen Research TMThe system is based on the "native ligation" of N-terminal thioester functionalized peptides to 5'-cysteine ​​oligonucleotides. Pentafluorophenyl S-benzyl sulfosuccinate is used for the final coupling step of standard Fmoc-based solid phase peptide assembly. Deprotection with trifluoroacetic acid produces peptides substituted with N-terminal S-benzyl sulfosuccinyl in solution. In the final coupling step of standard phosphoramidite solid phase oligonucleotide assembly, O-trans-4-(Na-Fmoc-S-tert-butylsulfinyl-1-cysteinyl)aminocyclohexyl O-2-cyanoethyl-N,N-diisopropylphosphoramidite is used. Deprotection with aqueous ammonia produces 5'-S-tert-butylsulfinyl-L-cysteinyl functionalized oligonucleotides in solution. The thiobenzyl terminus of the modified peptide is converted to the thiophenyl analog by using thiophenol, while the modified oligonucleotide peptide is reduced using tris(carboxyethyl)phosphine. Coupling of these two intermediates, followed by a "native ligation" step, results in the formation of the oligonucleotide-peptide conjugate.

[0296] The conjugated strand comprising the peptide and nucleic acid can be covalently attached to the solid support using any suitable covalent bonding technique known in the art that is compatible with the selected surface. For example, covalent attachment to the polyacrylamide hydrogel surface of the solid support can be achieved by including a phosphorothioate group on the "free" end (i.e., the end not conjugated to the nucleic acid) of the peptide component. If the peptide / nucleic acid conjugate structure is an amplification primer for solid phase PCR amplification, attachment to the solid support must keep the 3' end of the nucleic acid component free.

[0297] The peptide component can be designed to be cleaved by any selected peptidase, many of which are known in the art. The nature of the peptidase is not particularly limited, only that the peptidase cleaves somewhere in the peptide component. Similarly, the length and amino acid sequence of the peptide component are not particularly limited, except that the selected peptidase "cleaves".

[0298] The length and exact sequence of the nucleic acid component are also not particularly limited and it may have any desired sequence. If the nucleic acid component functions as a primer in solid phase PCR, its length and nucleotide sequence will be selected to enable annealing to a template to be amplified.

[0299] transsexual

[0300] In any embodiment of the method for cracking, the product of the cleavage reaction can be subjected to denaturation conditions to remove one or more parts of the chain of one or more cracks that are not attached to a solid support. With reference to standard molecular biology procedures, suitable denaturation conditions are apparent to readers in the art (Sambrook et al., 2001, Molecular Cloning, A Laboratory Manual, 3rd Ed, Cold Spring Harbor Laboratory Press, Cold Spring Harbor Laboratory Press, NY; Current Protocols, eds., Ausubel et al.). Denaturation (and subsequent reannealing of the cleavage chain) results in the production of partially or substantially single-stranded sequencing templates. Then sequencing reactions can be initiated by hybridizing sequencing primers with the single-stranded portions of the template.

[0301] In other embodiments, sequencing can be started directly after the cleavage step without denaturation to remove a portion of one or more cleaved strands. If the cleavage step produces a free 3' hydroxyl on a cleaved strand that is still hybridized to the complementary strand, sequencing can be performed from this point using a strand displacement polymerase without an initial denaturation step. In particular, strand displacement sequencing can be used in conjunction with template generation by nicking endonuclease cleavage or by hydrolysis of abasic sites with endonucleases, heating, or alkali treatment.

[0302] Sequencing methods

[0303] In some embodiments, the solid support and method herein can be used to determine the nucleotide sequence of polynucleotides. In such embodiments, the method may include the following steps: (a) contacting a polynucleotide polymerase with a delinear polynucleotide cluster attached to a substrate surface (e.g., by any of a polymer or gel coating as described herein); (b) providing nucleotides to the substrate surface so that a detectable signal is generated when the polynucleotide polymerase utilizes one or more nucleotides; (c) detecting the signal of one or more attached polynucleotides (or one or more clusters generated by the attached polynucleotides); (d) repeating steps (b) and (c) to determine the nucleotide sequence of the polynucleotide attached to the substrate.

[0304] Nucleic acid sequencing can be used to determine the nucleotide sequence of polynucleotides by various methods known in the art. In a preferred method, sequencing by synthesis (SBS) is utilized to determine the nucleotide sequence of the polynucleotides attached to the substrate surface (for example, by any polymer coating described herein). In such a method, one or more nucleotides are provided to the template polynucleotide associated with a polynucleotide polymerase. One or more nucleotides are incorporated into a newly synthesized nucleic acid chain complementary to a polynucleotide template by a polynucleotide polymerase. Synthesis begins with an oligonucleotide primer, which is complementary to a part of a universal or invariant nucleic acid covalently bound to one end of a template polynucleotide. When nucleotides are incorporated into a template polynucleotide, a detectable signal is generated, which allows determination of which nucleotide has been incorporated in each step of the sequencing process. In this way, the sequence of a nucleic acid complementary to at least a portion of a template polynucleotide can be produced, thereby allowing determination of the nucleotide sequence of at least a portion of a template polynucleotide.

[0305] The flow cell provides a convenient form for accommodating arrays produced by the method of the present disclosure and subjected to sequencing by synthesis (SBS) or other detection technologies involving cyclic repeated delivery of reagents. For example, in order to start the first SBS cycle, one or more labeled nucleotides, DNA polymerases, etc. can be flowed into / flowed through the flow cell accommodating the nucleic acid array prepared by the method described herein. Those array sites where the primer extension causes the labeled nucleotide to be involved can be detected. Optionally, the nucleotide can further include a reversible termination characteristic, which once adds the nucleotide to the primer, terminates further primer extension. For example, a nucleotide analog with a reversible terminator portion can be added to the primer so that subsequent extension does not occur until the unblocking agent is delivered to remove the portion. Therefore, for an embodiment using reversible termination, the unblocking agent can be delivered to the flow cell (before or after detection). Washing can be performed between each delivery step. The cycle can then be repeated n times to extend the primer by n nucleotides, thereby detecting a sequence of length n. Exemplary SBS procedures, fluidic systems, and detection platforms that can be readily adapted for use with arrays produced by the methods of the present disclosure are described, for example, in Bentley et al., Nature 456:53-59 (2008); WO 04 / 018497; US 7,057,026; WO 91 / 06678; WO 07 / 123744; US 7,329,492; US 7,211,414; US 7,315,019; US 7,405,281; and US 2008 / 0108082, which are incorporated herein by reference in their entirety.

[0306] In some embodiments of the above methods using flow cells, only a single type of nucleotide is present in the flow cell during a single flow step. In such embodiments, the nucleotide can be selected from dATP, dCTP, dGTP, dTTP and analogs thereof. In other embodiments of the above methods using flow cells, multiple different types of nucleotides are present in the flow cell during a single flow step. In such methods, the nucleotide can be selected from dATP, dCTP, dGTP, dTTP and analogs thereof.

[0307] By detecting the signal produced at or near the polynucleotide template, it is possible to determine the nucleotides or nucleosides incorporated during each flow step for one or more polynucleotides on the polymer coating on the substrate surface present in the flow cell. In some embodiments of the above method, the detectable signal comprises an optical signal. In other embodiments, the detectable signal comprises a non-optical signal. In such an embodiment, the non-optical signal is included in or near the pH change of one or more polynucleotide templates.

[0308] The application and use of the substrate of the present disclosure have been illustrated herein with respect to nucleic acid. However, it will be understood that other analytes can be attached to the substrates described herein and analyzed. One or more analytes can be present in or on the substrate of the present disclosure. The substrate of the present disclosure is particularly useful for detecting analytes or performing synthesis reactions with analytes. Therefore, any of the various analytes to be detected, characterized, modified, synthesized, etc. can be present in or on the substrate described herein. Exemplary analytes include, but are not limited to, nucleic acids (e.g., DNA, RNA or their analogs), proteins, polysaccharides, cells, antibodies, epitopes, receptors, ligands, enzymes (e.g., kinases, phosphatases or polymerases), small molecule candidate drugs, etc. The substrate can include a variety of different substances from an analyte library. For example, species can be different antibodies in an antibody library, nucleic acids with different sequences in a nucleic acid library, proteins with different structures and / or functions in a protein library, candidate drugs in a small molecule combinatorial library, etc.

[0309] In some embodiments, analytes can be distributed to the features on the substrate so that they can be distinguished individually. For example, a single molecule of each analyte can be present at each feature. Alternatively, analytes can exist as colonies or populations so that it is not necessary to distinguish single molecules. With respect to analytes that only contain a single species (although there are multiple copies), colonies or populations can be homogeneous. Taking nucleic acids as an example, each feature on a substrate can include a colony or population of nucleic acids, and each nucleic acid in a colony or population can have the same nucleotide sequence (single-stranded or double-stranded). Such colonies can be produced by cluster amplification or bridge amplification as previously described herein. Multiple repetitions of a target sequence can be present in a single nucleic acid molecule, such as a connector produced using a rolling circle amplification procedure. Therefore, the feature on a substrate can include multiple copies of a single type of analyte. Alternatively, a colony or population of an analyte with a feature can include two or more different species. For example, one or more holes on a substrate can each include a mixed colony with two or more different nucleic acid species (i.e., nucleic acid molecules with different sequences). The two or more nucleic acid species in a mixed colony may be present in non-negligible amounts, for example, allowing for detection of more than one nucleic acid in a mixed colony.

[0310] Example

[0311] Additional embodiments are disclosed in further detail in the following embodiments, which in no way limit the scope of the claims.

[0312] General surface treatment process

[0313] Clean Silanization of the flow cell

[0314] The norbornene-functionalized flow cell was produced by chemical vapor deposition (CVD) using a YES (Yield Engineering Systems) silanization chamber or dryer. The CVD process was typically performed at 60°C for 1-24 hours.

[0315]

[0316] PAZAM coupling

[0317] The silanized flow cell can then be coated and grafted using a variety of tool options. For example, the cBOT fully automated clonal cluster generation system for Illumina sequencing (available from Illumina) can be used to implement these operations. In a typical method, the flow cell is initially rinsed with IPA / H2O (1:1; 100 μL / min, 2 minutes). Next, deionized water is rinsed through the channel (100 μL / min, 2 minutes). Prepare an aliquot of 0.5wt% PAZAM (aq.) solution (enough for 8 channels). The polymer flows into the channel (100 μL / min, 2 minutes). The PAZAM coupling step is completed at 60°C for 1 hour. After completing this step, the channel is rinsed with water to prepare for the subsequent grafting step. After completing the polymer coating step, the flow cell can be stored in a 4°C download buffer (e.g., saline-sodium citrate (SSC) buffer). Alternatively, the grafting step can be completed immediately after the PAZAM coating.

[0318] Grafting and QC of PAZAM-coated flow cells

[0319] This procedure describes the grafting of Procedure for flow cell. Grafting procedure polished the flow cell surface, where allyl-modified P5 sequence oligonucleotide primers and diol-modified P7 sequence primers were covalently attached to the PAZAM surface in a ratio of approximately 1:1. Typical grafting mixtures were prepared according to standard Illumina procedures and depended on the primer concentration to be used. The typical primer concentration used was about 1-20 μM, and the target primer density was 20-250000 units (fluorescence counts). According to standard Illumina procedures, QC steps were implemented using the cBot system and then imaged on the Typhoon (fluorescence flatbed scanner).

[0320] After QC, the channels of the flow cell were flushed with 5x SSC (60 μL / min, total volume = 300 μL / flow cell) to remove the sodium hydroxide (used for the dehybridization step).

[0321] The grafted flow cell was then stored at 4°C before use in downstream biochemical processes (clustering, sequencing) Example 1

[0322] In this embodiment, modified oligonucleotides comprising modified thymidine analogs are used as specific sites to be efficiently cleaved by chemical reagents under biological conditions without interfering with double-stranded pairing properties and PCR extension properties.

[0323] In particular, the oligonucleotide comprises a single modified T-nucleoside with a vinyl group grafted to the 5'-C position. When treated with a solution of Na2PdCl4 or (PdAllylCl)2 and THP in an aqueous buffer (generating a palladium(0) complex in situ), the oligonucleotide is cleaved at the modified T position, and the resulting shorter oligonucleotide contains a phosphate group at the 3'-end. The reaction is shown in Scheme 1 below, where Nu represents a nucleophile.

[0324] Solution 1

[0325]

[0326] The synthesis of modified T nucleoside phosphoramidites is described in Scheme 2. The starting materials are commercially available. Most reaction steps gave >70% yields. Excellent yields of the final DNA oligonucleotides containing the modified T nucleoside are also reported.

[0327] Solution 2

[0328]

[0329] 5'-O-dimethoxy triphenylmethyl-thymine-3'-O-TBDPS (2). 5'-O-dimethoxy triphenylmethyl-thymine (1) (15g, 1eq, 27.54mmol) is dried under high vacuum for 1h. Anhydrous DCM (300ml) is added under N2. In this solution, imidazole (4.69g, 2.5eq, 69mmol) in solid form is first added, and then tert-butyldiphenylsilyl chloride (91ml, 1.3eq, 35.8mmol) is added. The reaction mixture is stirred for 1h under N2 at room temperature. The completion of the reaction is checked by TLC. The reaction is quenched with saturated NaHCO3 solution (100ml), and stirred for 5min. DCM (100ml) is added to the reaction mixture, and the water layer is extracted twice with DCM. The organic phase is washed with saturated NaHCO3 (200ml), then brine (200ml). After drying the combined organics over MgSO4, the solvent was removed in vacuo and dried thoroughly under vacuum to afford 2 as a white / light yellow foam. Compound 2 was used as a crude product in the next step. LC-MS (ES and CI): (-ve) m / z 782 (MH + ),(-ve)m / z 817(M+Cl-). 1HNMR(CDCl3)δ0.99(s,9H,tBu),1.27(s,3H,Me),1.96-2.06(m,1H,H-2'),2.25-2.3 5(m,1H,H-2'),2.80(dd,J=4,12Hz,1H,H-5'),3.15(dd,J=4,12Hz,1H,H-5'),3.71( s, 6H, OMe), 3.96-4.01 (m, 1H, H-4'), 4.45-4.50 (m, 1H, H-3'), 6.42 (dd, J = 8, 12 Hz, 1H, H-1'), 6.79-6.72 (m, 4H, aromatic compounds), 7.68-7.00 (m, 24H, aromatic compounds + CH), 8.01 (s, 1H, NH).

[0330] 3'-O-TBDPS-thymine (3). Crude 5'-O-dimethoxytriphenylmethyl-thymine-3'-O-TBDPS (2) (maximum 27.54mmol) was dissolved in anhydrous MeOH (300ml) under N2. TFA (10% by volume, 30ml) was added, and the reaction was stirred at room temperature under N2 for 2 hours and 30 minutes. The reaction was followed by TLC to complete. The reaction was carefully quenched with saturated NaHCO3 (200ml) and stirred at room temperature for 10min. MeOH was removed in vacuo. The residual mixture was diluted with DCM (300ml) and distributed with saturated NaHCO3. The aqueous phase was extracted twice with DCM, and the organic phase was then washed with saturated NaHCO3. MgSO4 was used for drying and concentrated in vacuo. The crude material was purified by column (Biotage, 100g Ultra-Si, PE / EtOAc) to obtain compound 3 (13.15g, 99%) of white foam. LC-MS(ES and CI):(-ve)m / z 479(MH + ),(+ve)m / z 481(M+H + ). 1 HNMR (d6 DMSO) δ 1.46 (s, 9H, tBu), 2.15 (s, 3H, Me), 2.35-2.53 (m, 2H, H2'), 3.57-3.67 (m, 1H, H5'), 3.77-3.87 (m, 1H, H5'), 4.30-4.36 (m, 1H, H4'), 4.80-4.86 (m, 1H, H3'), 5.41 (t, J = 5.2 Hz, 1H), 6.72 (dd, J = 8.7, 5.7 Hz, 1H), 7.82-7.94 (m, 6H, aromatic compound + CH), 8.00-8.05 (m, 5H, aromatic compound), 11.73 (s, 1H, NH).

[0331] Alternative synthesis of compound (3). 5'-O-Dimethoxytriphenylmethyl-thymine (140 g, 73.4 mmol) was treated with TBDPSCl (1.3 eq.) and imidazole (2.5 eq.) in DCM (0.127 M) for 2 h at room temperature, followed by PTSA (3 eq.) in methanol (0.097 M) for 1 h to provide compound (3) in 100% yield in a one-pot process. No workup was required after the silylation step, the solvent evaporation and overnight drying steps were removed, and the reaction was carried out under exposure to air. The use of PTSA instead of TFA reduces the acid-catalyzed rearrangement of the thymidine nucleoside ribose.

[0332] 3'-O-TBDPS-5'aldehyde-thymine (4). 3'-O-TBDPS thymine (3) (5.16 g, 1 eq, 10.75 mmol) was added to the high vacuum lane and Dry overnight under MS. Then, anhydrous DCM (250 ml) was added to compound 3 and MS and then cooled to 4°C with an ice batch. Dess-Martin periodinane was added portionwise under N2 (3×1.823 g, 1.2 eq, 12.9 mmol) and the reaction was stirred at 4°C under N2 for 1 hour and 30 minutes. The reaction was checked by LCMS. The reaction was allowed to warm at room temperature and the reaction was stirred under N2 for 4h, or until the reaction was complete. Once complete, Na2SO3 solution was added to the reaction (100 ml) and stirred at room temperature for 10 minutes. The two phases were separated and the aqueous phase was extracted twice with DCM. The organic phase was then washed with Na2CO3 and saturated NaHCO3, dried over MgSO4 and concentrated in vacuo. The crude material was dried under high vacuum overnight for use in the next step. It can also be co-evaporated with toluene to increase dryness. LC-MS (ES and CI): (-ve) m / z 477 (MH + ),(-ve)m / z513(M+Cl-),(+ve)m / z 479(M+H + ),(+ve)m / z 501(M+Na + ); (-ve) m / z 495 (hydrate-H + ),(+ve)m / z 519(hydrate+Na + ).

[0333] Alternative synthesis of aldehyde (4).Compound (3, 0.5 g) was treated with EDC (3 eq.) and DCA (0.5 eq.) in DMSO at room temperature for 6 h to provide compound (4) via Pfitzner-Moffat oxidation without over-oxidation to carboxylic acid observed with the Dess-Martin periodinane method (requiring the addition of a large excess of Grignard reagent in a subsequent step to quench carboxylic acid contaminants).

[0334] 3'-O-TBDPS-5' vinyl-thymine (5). 3'-O-TBDPS-5' aldehyde-thymine (4) (5.16g, 1eq, 10.75mmol) and 4A MS were dried under high vacuum overnight. Then anhydrous THF (150ml) was added to compound 3 and 4A MS under N2. A solution of 1M vinylmagnesium bromide in THF (21.5ml, 2eq, 21.5mmol) was added very slowly at room temperature over 30 minutes. The reactants were stirred at room temperature under N2 for 2h and checked by LCMS. If necessary, some additional vinylmagnesium bromide (0.3eq, 3.22ml) could be added dropwise and the reaction was stirred for another 1h. Once completed, a solution of 1M AcOH in water (60ml, pH=6) was added to the reaction and stirred at room temperature for 10 minutes. The reactants were diluted with DCM and the two phases were separated. The aqueous phase was extracted twice with DCM. The organic phase was then washed twice with saturated NaHCO3, dried over MgSO4, and concentrated under vacuum. The residue was purified by column (Biotage, 100 g kpSi, PE / EtOAc) to give compound 5 (2.01 g, 37% over 2 steps) as a milky white foam. LC-MS (ES and CI): (-ve) m / z 505 (MH + ),(-ve)m\z 541(M+Cl-),(+ve)m / z 507(M+H + ). 1H NMR (400MHz, chloroform-d) δ1.01 (d, J = 10.1Hz, 9H, tBu), 1.80 (s, 3H, Me), 2.02-2.22 (m, 2H, H2'), 3.48-3.54 (m, 0.6 H,H5'),3.81(t,J=2.2Hz,0.6H,H4'),3.97-4.02(m,0.4H,H4'),4.13-4.22(m,0.4H,H5'),4.33-4.50(dm,1 H,H3'),4.82-5.17(m,2H,CH2=CH-),5.24-5.43(m,0.4H,CH2=CH-),5.52-5.75(m,0.6H,CH2=CH-),6.04-6. 29(ddd,J=21.2,8.3,6.0Hz,1H,H1'),7.26-7.46(m,7H,Arom+CH),7.50-7.66(m,4H,Arom),8.23(s,1H,NH).

[0335] Alternative synthesis of allyl alcohol (5). Aldehyde (4) was treated with vinylmagnesium chloride (2.5 eq.) in THF at room temperature to provide compound (5). Using a chloride reagent instead of a bromide reduced the production of the bromide analog of the desired product (14% in the above method) without introducing the chloride variant of the desired product.

[0336] 3'-O-TBDPS-5'vinyl-5'DMT-thymine (6). 3'-O-TBDPS-5'vinyl-thymine (5) (2.01 g, 1 eq, 3.97 mmol) was dried overnight under a high vacuum lane. AgNO3 was added, and the solid was dried under high vacuum for another 30 minutes. Anhydrous DCM was added to the reaction under N2, followed by solid trimethylpyridine (1.05 ml, 2 eq, 7.94 mmol) and the last DMT-Cl (2.02 g, 1.5 eq, 5.96 mmol). The reactants were stirred at room temperature under N2 for 3 h; then stirred at room temperature for 3 hours. Completion was checked by TLC (PE / EtOAc, 6:4+1% NEt3). The reactants were then diluted with DCM and filtered onto diatomaceous earth, and the solids were washed with more DCM. The solution was then partitioned with 1% H2SO4 (60 ml) and extracted with DCM. The organic phase was washed twice with saturated NaHCO3, dried over MgSO4, and concentrated in vacuo to give a foamy crude product 6. It was used in the next step without further purification. LC-MS (ES and CI): (-ve) m / z 807 (MH + ),(+ve)m / z809(M+H + ).

[0337] Alternative process: A solution of compound (5, 6.7 g, 13.2 mmol) and 2,3,5-trimethylpyridine in anhydrous DCM was dried over molecular sieves for 30 minutes. The resulting solution was then added to a flask containing 4,4'-dimethoxytriphenylmethyl chloride (6.7 g) and molecular sieves. AgNO3 was added and the reaction was stirred for 1 hour. The resulting mixture was diluted with DCM (40 mL) and filtered through diatomaceous earth, rinsed with DCM (3×40 mL). MeOH (240 mL) was added to the filtrate, and the mixture was stirred for 10 minutes, then transferred to a separatory funnel, washed with saturated NaHCO3 aqueous solution (2x400 mL), dried (Na2SO4), and concentrated in vacuo to give the crude product as a yellow foam.

[0338] 5'vinyl-5'DMT-thymine (7). 3'-O-TBDPS-5'allyl-5'DMT-thymine (6) (1eq, 3.97mmol from the previous step) was dried under a high vacuum lane. Anhydrous THF (12ml) was added under N2 and cooled to 4°C. A solution of 1M TBAF in THF (4.37ml, 1.1eq, 4.37mmol) was added dropwise at 4°C. After 5 minutes at 4°C, the reaction mixture was heated at room temperature and stirred for 3h under N2. The reaction was followed to completion by TLC (PE / EtOAc, 3:7+1%NEt3). The reaction was diluted with EtOAc and distributed with saturated NaHCO3. The aqueous phase was extracted with EtOAc, then with saturated NaHCO3, then the organic phase was washed with brine, dried with MgSO4 and concentrated under vacuum. The residue was purified by column (Biotage, 25 g KpSi, PE / EtOAc + 1% NEt3) to give compound 7 as a white foam (1.81 g, 80% over 2 steps). LC-MS (ES and CI): (-ve) m / z 569 (MH + ),(+ve)m / z 571(M+H + ). 1H NMR(400MHz,DMSO-d6)δ1.46(s,1H,Me),1.65(s,2H,Me),1.97-2.13(m,2H,H2'),3.64(m,1H,H4'),3.8 5(dd,J=8.0,4Hz,0.4H,H5'),3.92(dd,J=8.0,4Hz,0.6H,H5'),4.31-4.45(m,1H,H3'),4.55-4.86(m,2H ,CH=CH2-),5.27(dd,J=7.4,4.8Hz,1H,OH),5.52-5.71(m,1H,CH=CH2-),6.11(dt,J=8.1,5.8Hz,1H,H1' ),6.86(dd,J=8,4Hz,4H,Arom.),7.13-7.35(m,7H,Arom.+CH),7.40-7.50(m,3H,Arom.),11.35(s,1H).

[0339] 5' Vinyl-5'DMT-thymine-phosphoramidite (8). 5' Vinyl-5'DMT-thymine (800 mg, 1.4 mmol) was dried under high vacuum. Anhydrous DCM (7 ml) was added under N2 and stirred with molecular sieves at room temperature for 10 minutes. To the solution was added Hunig's base (0.74 ml, 4.2 mmol) followed by 2-cyanoethyl N,N-diisopropylchlorophosphoramidite (407 ul, 0.52 mmol). The reaction was stirred at room temperature under N2 for 3 h. The completion of the reaction was followed by TLC (PE / EtOAc, 4:6). The reaction was concentrated in vacuo. The residue was purified by column (Biotage, 25 g KpSi, PE / EtOAc + 1% NEt3) to give compound 8 as a white foam (930 mg). LC-MS (ES and CI): (-ve) m / z 770 (MH + ),(+ve)m / z771(M+H + ). 1H NMR(400MHz, DMSO-d6)δ0.96-1.27(m,21H),1.50(d,J=5.9Hz,1H),1.66(s,3H),2.02-2.37(m,3H),2.58-2.7 4(m,2H),2.78(td,J=5.8,3.9Hz,1H),3.46-3.69(m,6H),3.76-3.93(m,2H),3.96-4.10(m,2H),4.61(ddd,J= 17.5,14.2,8.6Hz,2H),4.68-4.98(m,3H),5.43-5.79(m,1H),6.04(dt,J=9.6,5.1Hz,1H),6.13(dt,J=10.7, 6.9Hz,0H),6.85(ddt,J=8.2,5.2,2.4Hz,6H),7.09-7.34(m,11H),7.34-7.50(m,4H),11.37(d,J=6.1Hz,1H). 31 P NMR (162MHz, DMSO) δ147.94,147.16,147.03.

[0340] Analysis of lysis efficiency

[0341] Evaluation of cleavage efficiency on high primer density PAZAM (40-60k) surfaces. (Non-patterned) The flow cell was prepared according to standard procedures described herein. Norbornene-derivatized silane was deposited on the substrate surface by CVD method and then click-coupled to the substrate surface by polymer (PAZAM), followed by a second click-coupling process to graft the polymer surface with a modified P7 oligonucleotide containing an allyl T nucleoside analog (5'-alkyne-TTTTTTTTTTXCAAGCAGAAGACGGCATACGAGAT, where X represents the site of incorporation of the modified T nucleoside).

[0342] The modified P7 oligonucleotide was grafted to a PAZAM flow cell with a density similar to that of a standard P7 oligonucleotide. The grafting efficiency of the modified P7 oligonucleotide was similar to that of the standard 5'-functionalized P5 and P7 oligonucleotides. The flow cell surface was treated with 1 mM Na2PdCl4, 10 mM THP at 60 ° for 10 minutes in a 1x EA incorporation mixture (containing 50 mM ethanolamine-HCl (pH 9.9), 50 mM NaCl, and 0.05% Chaps). The TET-QC assay was used to demonstrate successful cleavage of the P5 oligonucleotide modified by the allyl T from the surface after treatment with an in situ generated palladium (0) complex.

[0343] Figure 2ATyphoon images of the flow cell surface before and after Pd(0) treatment are shown. Figure 2B The change in primer density before and after treatment with Pd(0) is shown, comparing the flow cell surface treated with the modified P5 oligonucleotide to the standard control. In both the low and high primer density ranges, the Pd(0) treated flow cell surface grafted with the modified P5 oligonucleotide showed substantial changes in fluorescence intensity. The results show very efficient cleavage using this method (-95%, fluorescence assay). In contrast, the flow cell surface grafted with the standard P5 oligonucleotide did not show much change in fluorescence intensity, indicating that the standard P5 oligonucleotide was not cleaved by the Pd(0) complex.

[0344] Analysis of sequencing run results

[0345] The ability of the modified allyl T nucleosides to perform efficient cleavage was further analyzed by implementing a short sequencing run. In this experiment, a flow cell was made in a similar manner as described above. Therefore, the allyl T modified P5 alkyne oligonucleotide and the standard P7 alkyne oligonucleotide were grafted onto a PAZAM coated flow cell at various surface primer densities. In order to ensure efficient resynthesis, the position of the allyl modification was further moved to the 3' end of the modified P5 oligonucleotide. The sequence of the grafted primer used for SBS flow cell manufacturing is as follows:

[0346] P5: 5'-Alkyne

[0347] -TTTTTTTTTTAATGATACGGCGACCACCGAGAXCTACAC

[0348] P7: 5'-Alkyne

[0349] -TTTTTTTTTTCAAGCAGAAGACGGCATACGA(8-oxoG)AT

[0350] X = Allyl modification as described in Scheme 1.

[0351] Typical cleavage conditions included incubating the allyl-P5 grafted surface with Na2PdCl4 / THP solution at 60°C for 10 minutes. The Pd(0) treated PAZAM surface was stable under these conditions and could continue to support several hundred cycles of sequencing. Furthermore, no other side reactions were detected, and subsequent indirect confirmation by PET resynthesis that P7 oligonucleotide cleavage remained unaffected confirmed the orthogonality and specificity of the allyl approach.

[0352] Figure 3Ais a bar graph showing the results of TET dye epifluorescence QC assay (TET-QC) from a non-patterned high primer density primed flow cell. In channels 1-4, the surface was grafted with allyl-modified P5 oligonucleotides and standard P7 oligonucleotides. In channels 5-8, the surface was grafted with standard P5 / P7 oligonucleotides. The results were comparable between modified and standard P5 oligonucleotides. Figure 3B Show Figure 3A Typhoon image of the flow cell surface after TET-QC as described in . Again, no visible differences between the channels were identified, as neither showed detectable signal. Preliminary data suggest that there are no particular differences between the modified P5 oligonucleotides and the standard P5 oligonucleotide in terms of cluster density.

[0353] It was also observed that the cleavage solution containing Na2PdCl4 / THP was stable when stored at room temperature for several days, and the aged mixture could still be used to cleave the allyl-modified P5 oligonucleotide.

[0354] Example 2

[0355] In this example, the palladium(0) linearization method and diol cleavage method described herein were tested on a novel flow cell grafted with P15 / P17 substrates, and Sequencing data on the 2-channel instrument were collected and compared with a standard flow cell grafted with P5 / P7 primers and used Figure 1 Enzymatic linearization was performed as described in . Both the new and standard flow cells were coated with PAZAM polymer, and the surface primer density was targeted to be approximately 200K for both types of primers.

[0356] Using NovaSeq TM Two flow cells were sequenced with spiked mixtures and imaged at 20°C. Before each linearization step (Read1 and Read2), the flow cell was exo-treated to remove excess unused surface primers. For the standard surface, primer (P5 / P7) linearization was completed using USER enzyme (LMX1) in Read1 for 20 minutes at 38°C and FpG enzyme in Read2 for 20 minutes at 40°C. For the new P15 / P17 surface, primer linearization was completed using a palladium mixture containing THF and sodium ascorbate (6mM / 60mM / 6mM) in Read1 for 2 minutes at 60°C and a sodium periodate mixture in Read2 for 10 minutes at 20°C. The sequencing library shown in these data is PhiX and the run was 2x151 cycles. The sequencing results are summarized in the table below.

[0357]

[0358] The sequencing data showed that the palladium (0) assisted chemical linearization worked well in sequencing and the main indicators were very similar compared to the standard. Cluster pass filter (%PF), phasing / prephasing, and % alignment were equivalent for both P5 / P7 and P15 / P17 surface primers. The % error was slightly higher in Read1 of the P15 / P17 grafted flow cell, but still quite good (e.g. Figure 4 ) and flow cell to flow cell variation may also occur. The % error rate in Read2 was comparable. In addition, the time required for linearization was reduced by 2-fold for Read2 and 10-fold for Read1 when using the new flow cell.

[0359] Example 3

[0360] In this example, the Allyl T nucleosides described in Example 1 can be further labeled with a detectable label (i.e., a fluorescent label) to further simplify the current Illumina production workflow. Once the dye-labeled Allyl T nucleosides are incorporated into the P5 oligonucleotide, the grafting reaction can be directly quantified immediately after completion. In the current method, this step is implemented as a separate hybridization assay.

[0361] Using synthetic methods similar to those described in previous examples, the Pd(0) cleavage reaction using dye-labeled modified T nucleotides is illustrated in Scheme 3.

[0362] Solution 3

[0363]

[0364] Example 4

[0365] In this example, a diol linker reagent was prepared as shown in Scheme 4. This method improves upon the synthesis described in U.S. Patent No. 8,715,966.

[0366] Solution 4

[0367]

[0368]

[0369] Diol-1.The present method has removed DMF as solvent in synthetic diol-1.DMF can make aqueous extraction complicated due to the formation of emulsion and undesirable product distribution entering water phase, and in the method of previous report, it is very time-consuming to remove it before aftertreatment.Previous DMF / DCM mixture is replaced by EtOAc, and the processing time is reduced to 1-2 day (comprising chromatography) from 3 days.In addition, the formation of bis (triphenylmethyl) by-products reduces yield in the existing method.The addition order of reagent is changed from the mixture of hexylene glycol / DIPEA that the sub-portions of solid DMTr-Cl are added to liquid DIPEA drop-wise in the mixture of hexylene glycol / DMTr-Cl, which improves the reaction selectivity of required product by about 10%.In some embodiments, the product of this reaction can be used roughly, and DMTr-OH and bis (triphenylmethyl) by-products need not be removed by chromatography.

[0370] Diol-3. Previous oxidation methods using TPAP / cat. NMO resulted in over-oxidation to the corresponding carboxylic acids, requiring up to 3-4 days. Here, TPAP / NMO was replaced with TEMPO / bleach in a biphasic mixture of DCM and aqueous NaHCO3. The bleach was added dropwise to the mixture of remaining reagents, and the reaction was complete once the addition of bleach was complete. The product was isolated by aqueous extraction with minimal over-oxidation and 66-92% yield, and a faster overall process (1.5 days). In another embodiment, the syntheses of Dio-3 and Dio-4 can be staggered to eliminate the intermediate chromatography step. Excess tBuOK may be required to neutralize any carboxylic acid species in the starting materials.

[0371] Diol-2. The previous method for synthesizing diol-2 included 48 hours of reflux, and some operations were performed at 36 hours to ensure that the reaction was complete. Increasing the reaction concentration can reduce the reflux time from 48 hours to 12-24 hours. In the previous scheme, crude diol-2 was extracted into water. It is necessary to remove water (because the subsequent steps are sensitive to moisture), which is very time-consuming when scaled up. This step is improved by extracting diol-2 into DCM and washing with NaHCO3 aqueous solution to remove any acetic acid and minimize the solvent removal time. The entire processing time is reduced from 3 days to 2 days. The product is stored in DCM as a stock solution. Before diol-4 is reacted, the solution is stored overnight on 3A molecular sieves.

[0372] Alternatively, diol-2 can be hydrolyzed to the corresponding alcohol to simplify purification. This alcohol is then used in the subsequent step to directly provide diol-4.

[0373] Diol-5.The chromatographic purification step was eliminated, saving 1 day of processing time. Additionally, DMF could be switched to DCM to increase process efficiency by reducing solvent / wash volumes during aqueous workup.

[0374] Diol-6. Chromatographic purification steps can be eliminated.

[0375] Diol-7. The synthesis of diol-7 involves two staggered processes, namely, esterification and silylation with TBAF. In the previously reported method, a significant 1,4-acetyl migration was observed during the silylation with TBAF, resulting in the formation of a large amount of the undesired byproduct diol-7M:

[0376]

[0377] This material reduces the overall yield and purity of diol-7. In addition, carrying diol-7M to the subsequent step produces diol-8M, whose phosphoramidite is on the secondary alcohol rather than the primary alcohol. Incorporation into the primer will result in a linker that cannot be cleaved. In the present method, the TBAF step is buffered with AcOH to remove undesirable NaOH from commercial TBAF batches. Too much AcOH can lead to the loss of the DMTr protecting group. The reaction is carried out with 1.75 equivalents of AcOH and premixing TBAF and AcOH before exposing the starting material. In addition, the existing method includes evaporating THF before post-treatment; the current method removes this evaporation step and includes carefully neutralizing the aqueous phase to pH 7 to reduce base-induced product degradation. Finally, the chromatographic purification after the esterification step has been removed.

[0378] Alternatively, the diol-5 to diol-7 synthesis scheme can be staggered, thereby eliminating the additional chromatography step. In summary, the process can be run to include three chromatography steps instead of six, and the crude material will be purified at the diol-4, diol-7, and diol-8 stages.

[0379] Example 5

[0380] This example describes the synthesis of the A-TOM monomer, which is a modified 3' phosphate moiety used as a hydroxyl protecting group. (TOM = triisopropylsiloxymethyl)

[0381]

[0382] Step 1. Benzoylation of DMT adenosine (A-OBz).

[0383]

[0384] N6-Benzoyl-2'-deoxy-5'-ODMT-D-adenosine (11.2 g, 17 mmol) and solvent (pyridine / DCM mixture in a ratio of 1:3, 11 ml pyridine, 33 ml DCM) were mixed at room temperature to give a solution. The reaction flask was cooled to 0°C and DMAP (0.41 g, 3.41 mmol) and benzoyl chloride (3.9 g (3.2 ml), 34.1 mmol) were added thereto. Stirring while heating to room temperature overnight (TLC monitoring the progress of the reaction) gave a very light orange mixture with some white solid precipitate. The solvent was removed in vacuo at a temperature of <40°C. The residue was diluted with AcOEt (-500 mL), washed twice with saturated aqueous sodium bicarbonate solution (2×250 mL), water (250 mL) and dried over MgSO4. After evaporation of the solvent and co-evaporation with toluene, a white foam was obtained and dried in vacuo to constant weight. The material was used in the next step without purification.

[0385] Step 2. Detriphenylmethylation (A-OH).

[0386]

[0387] A-OBz (13.69 g, unpurified, 17 mmol) was dissolved in a dichloromethane / methanol mixture (1:1, 300 ml) and cooled to 0 °C under nitrogen. Trifluoroacetic acid (2.75 ml, 36 mmol) was added via a syringe. The reaction was stirred and warmed to room temperature for 1 hour. The progress of the reaction was monitored by TLC. The reaction was quenched at 0 °C by adding solid NaHCO3 (3 g, 36 mmol). The solvent was removed in vacuo at a temperature of <40 °C, and the residue was diluted with AcOEt (-800 mL) and washed five times with water (5x250 ml). The organic layer was dried over MgSO4, filtered and dried in vacuo to give a white foam. The target product was obtained by column chromatography (eluting with a 1:1 petroleum ether / ethyl acetate to ethyl acetate gradient) as a white powder. (5.0 g, 60% yield (2 steps), Rf=0.35 in 100% ethyl acetate) 1H NMR (400MHz, DMSO-d6) δ11.25(s,1H),8.78(s,1H),8.75(s,1H),8.07(ddt,J=10.1,7.0,1.4H z,4H),7.75-7.68(m,1H),7.68-7.62(m,1H),7.62-7.51(m,4H),6.64(dd,J=8.6,5.9Hz,1H),5 .68(dt,J=6.1,1.9Hz,1H),5.28(t,J=5.7Hz,1H),4.31(td,J=4.4,1.8Hz,1H),3.72(tdd,J=1 1.8, 6.4, 4.7Hz, 2H), 3.19 (ddd, J=14.4, 8.7, 6.1Hz, 1H), 2.75 (ddd, J=14.1, 5.9, 1.8Hz, 1H).

[0388] Step 3. Oxidation

[0389]

[0390] Under nitrogen, A-OH (1.0 g, 2.18 mmol) was stirred in a sieve containing The solution in dichloromethane (50ml) was cooled to 0°C. In another flask, Dess-Martin periodinane (1.11g, 2.61mmol) was dissolved in dichloromethane (10ml) through molecular sieves. The Dess-Martin solution was added to A-OH and allowed to warm to room temperature. The reaction was monitored by LCMS and after one hour, the reaction was quenched with saturated sodium bicarbonate solution. The quenched mixture was diluted with dichloromethane (-250ml) and washed with sodium bicarbonate solution (100ml) and water (2×100ml). The organic layer was dried with MgSO4, filtered and dried in vacuo to obtain a white foam which was used in the next step without further purification.

[0391] Step 4. Wittig reaction (A-CH=CH2).

[0392]

[0393] Methyltriphenylphosphonium bromide (5.83 g, 16 mmol) was mixed with dry THF (40 ml) in an oven dried two-necked round bottom flask containing a stirring bar, molecular sieves and a nitrogen line. One neck of the flask held potassium tert-butoxide in a solid addition tube. The solution was cooled to 0°C. Potassium tert-butoxide was added by turning the addition tube at the joint, allowing the solid to fall into the stirring solution without exposing it to air or opening the system for addition. The solution turned from cloudy white to yellow. Stir at 0°C for 1 hour. Note: All solid reagents in this step were dried under high vacuum overnight in the presence of phosphorus pentoxide. Syringes, needles, stirring bars, activated molecular sieves were also dried in the same jar.

[0394] The yellow solid was added to a solution of A-CHO (2.5 g, 5.44 mmol) in THF (15 ml) at 0°C via a wide needle and syringe. The color changed from yellow to orange. Stir at 0°C for 3 hours and monitor by LCMS.

[0395] The post-treatment reaction was poured into a 1L beaker containing water (300ml) and AcOEt (300mL) at 0°C. Stir for ten minutes and then transfer to a separatory funnel. The organic layer was washed with saturated sodium bicarbonate solution (3×100ml) and brine (100ml). The organic layer was dried over MgSO4, filtered and dried under vacuum to give a brown-yellow foam. The target product was purified by column chromatography (gradient elution with dichloromethane to 5% methanol / DCM) to give a milky white foam. (2.59g, Rf=0.53 in 5% MeOH / DCM) 1 H NMR (400MHz, DMSO-d6) δ11.21(s,1H),8.77(s,1H),8.66(s,1H),8.05(d,J=7.2Hz,2H),7 .65(t,J=7.4Hz,1H),7.57(q,J=7.9,7.3Hz,3H),6.50(t,J=6.7Hz,1H),6.06(ddd,J=17.2 ,10.4,6.7Hz,1H),5.55(d,J=4.4Hz,1H),5.29-5.10(m,2H),4.42(p,J=4.2Hz,1H),4.30 (dd,J=6.7,3.6Hz,1H), 2.94 (dt,J=13.1,6.4Hz,1H), 2.40 (ddd,J=13.3,6.5,4.3Hz,1H).

[0396] Step 5. Diol oxidation (A-OHOH).

[0397]

[0398] Under nitrogen, a solution of A-CH2CH2 (0.68 g, 1.49 mmol) in THF (7 ml) was placed in a flask equipped with a stirring bar. Solid 4-methylmorpholine N-oxide (0.262 g, 2.235 mmol) was weighed out and added to the reaction flask. Water (7 ml) was also added. Osmium tetroxide (4% aqueous solution, 285 μl, 0.045 mmol) was added to the reaction flask. The reaction was heated at 40°C overnight. TLC and LCMS monitored the progress of the reaction. Solid sodium thiosulfate was added to quench the reaction. The mixture was stirred for 30 minutes and then post-treated in ethyl acetate (150 ml) and sodium bicarbonate solution. The organic layer was washed 3 times with saturated sodium bicarbonate solution (3×100 ml). The organic layer was dried over MgSO4, filtered and dried in vacuo to obtain an off-white, slowly crystallizing solid. Purification by column chromatography (gradient elution with dichloromethane to 10% methanol / DCM) gave the desired product as a colorless oil. (0.13 g, 19% yield, Rf=0.28 in 5% MeOH / DCM) 1 HNMR (400MHz, DMSO-d6) δ11.25(s,1H),8.78(s,1H),8.73(s,1H),8.07(ddt,J=9.6,7.2,1.4Hz,4H),7. 74-7.68(m,1H),7.68-7.62(m,1H),7.62-7.47(m,5H),6.62(dd,J=8.9,5.8Hz,1H),5.82(dt,J=5.8,1.5 Hz,1H),5.48(d,J=5.1Hz,1H),4.69(t,J=5.5Hz,1H),4.31(dd,J=5.0,1.5Hz,1H),3.81(p,J=5.3Hz,1H ), 3.48(dh,J=22.3,5.5Hz,2H), 3.18(ddd,J=14.4,9.0,5.9Hz,1H), 2.70(ddd,J=14.4,6.0,1.5Hz,1H).

[0399] Step 6. Silylation (A-OHTOM).

[0400]

[0401] A-OHOH (0.128g, 0.262mmol) in DCM solution was dissolved in DCM (1.5ml) in a flask containing a stirring bar and a nitrogen line. At room temperature, di-tert-butyltin dichloride (80mg, 0.262mmol) and N, N-diisopropylethylamine (182μl, 1.05mmol) were added within 30 minutes. Triisopropylsilyloxymethyl chloride (TOM-Cl, 79μl, 0.341mmol) was added via a micropipette. TLC and LCMS monitored the reaction process. The reaction was placed at room temperature overnight. Post-reaction treatment was carried out in ethyl acetate (200ml). Washed with saturated sodium bicarbonate solution (3×100ml). The organic layer was dried with MgSO4, filtered and dried in vacuo to obtain a yellow / brown oil. Purification by column chromatography (gradient elution with dichloromethane to 8% methanol / DCM) gave the desired product as an off-white foam (0.14 g, 79% yield, Rf=0.5 in 5% MeOH / DCM) 1 HNMR(400MHz,DMSO-d6)δ11.25(s,1H),8.76(s,1H),8.73-8.65(m,1H),8.06(tt,J=7.5,1.4Hz, 4H),7.76-7.62(m,2H),7.62-7.46(m,4H),6.61(dd,J=8.9,5.7Hz,1H),5.82(d,J=5.7Hz,1H),5. 65(d,J=5.3Hz,1H),4.84(s,2H),4.27(dd,J=5.4,1.5Hz,1H),4.06-3.93(m,1H),3.62(ddd,J=4 2.1,10.3,5.2Hz,2H),3.22(ddd,J=14.7,9.1,5.8Hz,1H),2.74-2.65(m,1H),0.94(m,21H,TOM).

[0402] Step 7. Triphenylmethylation (A-TOM-DMT).

[0403]

[0404] Dry A-OHTOM (0.14 g, 0.207 mmol), (4,4'-dimethoxytriphenylmethyl chloride (DMT-Cl, 0.105 g, 0.311 mmol) and silver nitrate (53 mg, 0.311 mmol) were placed in a flask with dry DCM (1.5 ml) and collidine (2,4,6-collidine) (55 μl, 0.414 mmol) and stirred at room temperature for 3 hours. The reaction progress was monitored by TLC and LCMS. , the reaction mixture was diluted with DCM (100 ml) and filtered through a sintered stripping funnel. The DCM solution was washed with saturated sodium bicarbonate solution (5×100 ml). The DCM layer was dried over MgSO4, filtered and dried in vacuo to give a yellow / brown oil. Purification by column chromatography (gradient elution). Elution with dichloromethane to 10% methanol / DCM) gave the desired product as a viscous yellow oil (0.17 g, 85% yield, Rf=0.46 in 5% MeOH / DCM).

[0405] Step 8 (A-3'OH).

[0406]

[0407] A solution of A-TOM-DMT (56mg, 56μmol) in a mixture of methanol and THF (4:5, a total of 0.9ml) is cooled to 0°C. Sodium hydroxide (4M, 0.1ml, excessive) is added and stirred at 0°C for 15 minutes. The reaction is monitored by TLC and LCMS. The reaction is quenched with acetic acid (1M, 0.5ml) to ensure that pH is not less than pH8. The reaction mixture is diluted with ethyl acetate (EA, 100ml), and the solution is washed with saturated sodium bicarbonate solution (3×50ml). The EA layer is dried with MgSO4, filtered and dried in vacuo. The residue is purified by column chromatography (eluted with the gradient of EA / petroleum ether (25%) to 100% EA) to obtain white foam (0.02g, 40% yield, Rf=0.38 in 100% EA).

[0408] Step 9. Formation of phosphoramidites (ATOM monomers).

[0409]

[0410] A-3'OH (92 mg, 105 μmol) was placed in a flask containing molecular sieves and a magnetic stirring bar, and THF (dry, 0.2 ml) was added under nitrogen at room temperature. N, N-diisopropylethylamine (110 μl, 630 μmol) was added to the THF solution. Finally, 2-cyanoethyl N, N-diisopropylchlorophosphoramidite (38 μl, 169 μmol) was added by micropipette. The reaction was stirred under nitrogen at room temperature. The reaction was monitored by TLC. After the reaction was completed, the solvent was removed in vacuo. The residue was washed with petroleum ether (3×20 ml) at room temperature. The residue was then dissolved in DCM and filtered to remove the molecular sieves. It was dried again under vacuum and then purified by column chromatography (eluted with EA / petroleum ether (20%) to 75% EA gradient) to provide a viscous colorless oil (80 mg, 70% yield) 1 H NMR(400MHz,DMSO-d6)δ11.17(s,1H),8.57(s,1H),8.39(s,1H),8.06-7.99(m ,2H),7.64(td,J=7.1,1.2Hz,1H),7.58-7.46(m,4H),7.36(ddd,J=15.4,9.0, 2.8Hz,4H),7.29(t,J=7.4Hz,2H),7.27-7.17(m,1H),6.92-6.83(m,4H),6.34 (dd,J=9.0,5.9Hz,1H),4.78-4.71(m,1H),4.68(q,J=6.6,4.6Hz,1H),4.52(dd ,J=8.5,4.9Hz,1H),4.27(d,J=7.1Hz,1H),3.85-3.69(m,8H),3.62(dp,J=10. 4,6.7Hz,1H),3.34-3.22(m,1H),2.78(td,J=5.8,1.9Hz,2H),2.64(td,J=8.8 ,4.7Hz,1H),2.26-2.16(m,1H),2.08(d,J=0.7Hz,6H),1.21(dd,J=15.4,5.6H z,9H),1.12(d,J=6.7Hz,6H),0.99-0.88(m,2H),0.83(dd,J=6.3,4.5Hz,18H).

[0411] Example 6

[0412] Synthesis of model dinucleotide (C-Tom-A).

[0413]

[0414] Compound C-amidite (125mg, 0.15mmol) and A-OH-Tom (64mg, 0.1mmol) were dried overnight in vacuo with P2O5 and dissolved in anhydrous acetonitrile (1ml). Under N2, ethylthio tetrazole (ETT, 32.5mg, 0.25mmol) was added. The mixture was stirred at room temperature for 15 minutes. TLC and LC-MS showed that the raw material A-OH-Tom was completely consumed. A solution of t-BuOOH in decane (5M, 0.1ml) and DCM (1ml) was added to the reaction mixture and stirred at room temperature for 15 minutes. The reaction mixture was poured into a NaHCO3 aqueous solution and the aqueous phase was extracted with EtOAc. The combined organic phase was evaporated and treated with NaOH (0.1M, 1ml in H2O / THF / MeOH=1 / 4 / 5v / v) for 1 hour at room temperature. The mixture was then treated with a solution of HCl (1M) in THF / MeOH (5ml / 4ml) for 0.5 hour. The reaction mixture was concentrated and partitioned between H2O and EtOAc. The desired product was recovered from the aqueous solution and further purified by RPHPLC (TEAB 0.1M / CH3CN).

[0415] Study on the cleavage of the model compound C-TOM-A

[0416]

[0417] The stock solution of C-TOM-A was treated under various deprotection conditions. The reaction progress was monitored by RP HPLC. Intermediate CA is a compound in which the TOM group has been removed from C-TOM-A but the phosphate bond has not yet been cleaved. Table 1 below summarizes the deprotection results under various reaction conditions and deprotection reagents.

[0418] Table 1.

[0419] condition result <![CDATA[0.5mM C-TOM-A,0.5M TBAF,1:1THF / H2O,pH-7]]> 60% intermediate CA / 2.5 hours <![CDATA[0.5mM C-TOM-A,0.5M Et3N-3HF,Et3N,pH-7]]> 100% intermediate CA / 2.5 hours <![CDATA[0.5mM C-TOM-A,0.25M NH4F,pH-7]]> 80% intermediate CA / 2.5 hours 0.5mM C-TOM-A, 0.25M CsF, Tris-HCl, pH7.4 70% intermediate CA / 2.5 hours 0.5mM C-TOM-A, 0.25M CsF, Tris-HCl, pH9 70% intermediate CA / 2.5 hours <![CDATA[0.5mM C-TOM-A,0.5M Et3N-3HF,pH-1]]> 80% intermediate C-A + 20% product / 1 hour <![CDATA[0.33mM C-TOM-A,0.17M NH4F,0.33M NaOH、pH-14]]> 50% intermediate C-A + 50% product / 1 hour 0.33mM C-TOM-A, 0.33M CsF, 0.33MNaOH, pH-14 1 hour to complete 0.5mM C-TOM-A, 1M NaOH, pH14 20 minutes to complete

[0420] Example 7

[0421] In this example, alternative methods for generating Pd(0) complexes are described and their chemical cleavage activities are compared to the palladium(0) complexes generated in situ from allylpalladium(II) chloride dimer (Pd(C3H5)Cl)2 and THP as described in Example 1. In contrast to the in situ generated Pd(0) complexes, several palladium(II) procatalysts have been prepared and isolated prior to use in chemical linearization reactions, such as chemical cleavage of the P15 primer. These Pd(II) procatalysts are inactive in isolated form, but can be conveniently reduced in situ to active Pd(0) in the presence of THP. These alternative Pd procatalysts can improve product stability and extend shelf life.

[0422] Preparation method

[0423] (Pd(C3H5)Cl)2 was dissolved in dry, degassed tetrahydrofuran under nitrogen and treated with 1-10 equivalents of THP as a solution in tetrahydrofuran. Oiling was observed and separated by decanting the supernatant. The material was dried under vacuum to obtain a viscous oil of yellow to brown or orange color. These materials are highly soluble in water. When 1-2 equivalents of THP were added, a mixture of [Pd(C3H5)(THP)]Cl and [Pd(C3H5)(THP)2]Cl were isolated, both of which are Pd(II) complexes. When 5 equivalents of THP were added, a clean sample of [Pd(C3H5)(THP)2]Cl was obtained. These two Pd(II) complexes were separated and characterized. When 10 equivalents of THP were added, a Pd(0) material active for P15 linearization was obtained.

[0424] [Pd(C3H5)(THP)]Cl: 31 P NMR (162 MHz, D2O): d 14 (s) ppm. 13 CNMR (101MHz, D2O): d118.7 (d, J = 5.0Hz), 81.7 (d, J = 29Hz), 62.1 (d, J = 15Hz), 26.5 (s), 20.5 (d, J = 25.0Hz) ppm. LC-MS: [AllylPd (THP)] + ; Predicted value: 355Da, Found value: 355Da.

[0425] [Pd(C3H5)(THP)2]Cl: 31 P NMR (162 MHz, D2O): d 10 (s) ppm. 13 CNMR (101MHz, D2O): d122.7 (t, J = 5.3Hz), 71.2 (t, J = 14Hz), 61.8 (t, J = 7.6Hz), 26.7 (s), 22.1 (t, J = 13Hz) ppm. LC-MS: [AllylPd (THP) 2] + ; Predicted value: 563Da, Found value: 563Da.

[0426] For P15 lysis

[0427] Material was isolated from treatment of Pd (Pd(C3H5)Cl)2 with 1, 2, 5, and 10 equivalents of THP and formulated at 10 mg / mL in aqueous buffer. The activity of these preparations on P15 cleavage was evaluated using an HPLC-based assay. In this assay, solutions of P15 primers (10 μM) were treated with 10% v / v of each preparation, incubated at 38°C for 10 minutes, then quenched by dilution and spin column treatment, and analyzed by HPLC. The percentage of cleavage was calculated based on the ratio of the P15 to cleavage product peak areas.

[0428] Aqueous preparations of [Pd(C3H5)(THP)]Cl and [Pd(C3H5)(THP)2]Cl (prepared by mixing (Pd(C3H5)Cl)2 with 1 to 5 equivalents of THP) were inactive for P15 cleavage in the absence of other additives. However, aqueous preparations of material isolated from mixing (Pd(C3H5)Cl)2 with 10 equivalents of THP provided P15 cleavage activity comparable to that of a Pd mixture prepared in situ from (Pd(C3H5)Cl)2 (6 mM), THP (60 mM), and sodium ascorbate (6 mM). The results are shown in Figure 5A The palladium(II) procatalysts [Pd(C3H5)(THP)]Cl and [Pd(C3H5)(THP)2]Cl were observed to be conveniently activated in situ during preparation or at the point of use after treatment with additional aqueous THP solution. [Pd(C3H5)(THP)2]Cl was shown to become active when formulated as an aqueous solution (12 mM Pd) upon treatment with 1 or more equivalents of THF. The cleavage performance of P15 exceeded that of a reference sample, a Pd(0) mixture prepared in situ from a mixture of (Pd(C3H5)Cl)2 (6 mM), THP (60 mM) and sodium ascorbate (6 mM). Figure 5B ).

[0429] Example 8

[0430] In this example, an alternative isolatable Pd(0) complex, Pd(THM)4, was prepared by using the phosphine ligand tris(hydroxymethyl)phosphine (THM). Its cleavage activity was compared with that of a Pd(0) complex generated in situ from allylpalladium(II) chloride dimer (Pd(C3H5)Cl)2 and THP as described in Example 1.

[0431] Preparation: Pd(THM)4 was prepared and isolated using the protocol described by Ellis, et al., Inorg. Chem., 1992, 31, 14. Aqueous solutions were prepared at a concentration of 10 mM and their performance was evaluated relative to Pd(0) generated in situ using (Pd(C3H5)Cl)2 (10 mM) and THP (100 mM).

[0432] To demonstrate Pd(0)-induced linearization, NovaSeq TM Sequencing was performed on the instrument using an S4 flow cell (2x151 with dual index cycles) grafted with P15 / P7 surface primers. The Xp workflow was used with nano (lanes 1 and 3) and PCR-free (lanes 2 and 4) libraries (450 bp insert fragments). Linearization was performed prior to Read1 SBS chemistry using a Pd mixture consisting of (Pd(C3H5)Cl)2 (10 mM), THP (100 mM), and sodium ascorbate (10 mM) [in lanes 1-2]; or using an aqueous solution of Pd(THM)4 (10 mM) [in lanes 3-4]. Read2 linearization was performed using a reagent containing FpG enzyme. It was observed that sequencing metrics were generally comparable for both Pd linearization methods. High Read1 intensity and resynthesis percentage of Pd(THM)4 indicated that successful linearization was achieved ( Fig. 6A The human error rate and PhiX error rate of the two methods are comparable ( Figure 6B ). The sequencing results are summarized in the following table (Table 2).

[0433] Table 2

[0434]

[0435] Example 9

[0436] In this example, an alternative route for the preparation of active Pd(0) complexes is described. Preparation and Isolation of Pd(THP) by Reaction of Pd(PPh3)4 with THP in a Ligand Exchange Reaction 2-4 Its cleavage activity was compared with that of a Pd(0) complex generated in situ from allylpalladium(II) chloride dimer (Pd(C3H5)Cl)2 and THP as described in Example 1.

[0437] Preparation method

[0438] Under nitrogen, Pd(PPh3)4 was dissolved in dry, degassed dichloromethane to give a yellow solution. THP aqueous solution (4.1 eq.) was added to obtain a two-phase mixture, which was stirred for 2.5 hours. The yellow color was transferred from the organic layer to the aqueous layer. The reaction was post-processed by removing the organic layer by siphoning and rinsing the aqueous phase with additional DCM. The aqueous phase was dried under reduced pressure and co-evaporated with tetrahydrofuran, and the resulting orange oil was dried under high vacuum. The yield was almost quantitative. Product LC-MS analysis showed the presence of Pd(THP)2 [Pd(THP)2+H+. Predicted value: 523Da, measured value: 523Da].

[0439] For P15 linearization

[0440] Prepare Pd(THP) at 10 mg / mL in aqueous buffer 2-4 and assessed their P15 cleavage activity using a plate-based assay. The assay utilizes 96-well plates grafted with P15 / P17 surface primers. Intercalating fluorescent dyes can be used to quantify double-stranded DNA before and after Read1 linearization; the percentage of cleavage can be calculated from the amount of double-stranded DNA remaining. For Pd(THP) 2-4 The cleavage activity of P15 was comparable to that of a Pd mixture prepared in situ from (Pd(C3H5)Cl)2 (6 mM), THP (60 mM), and sodium ascorbate (6 mM). Figure 7 ). It was observed that both methods had comparable lysis performance.

[0441] Example 10

[0442] In this example, an alternative nickel-based chemical cleavage reagent was prepared and tested in the cleavage of DNA strands containing allyl dT nucleotides.

[0443] First, both THP and THM phosphine ligands were reacted with NiCl2 at various equivalents in the preparation of nickel complexes. Ni-THP (1:4 or 1:10 ratio) produced cleavage products identical to the palladium-containing reagents described in Example 1. Interestingly, the phosphine ligand of Ni-THM, which has a shorter alkyl chain (and therefore a smaller cone angle), did not show the same cleavage activity when complexed with nickel.

[0444] The cleavage activity of Ni-THP on the surface was tested and compared with that of Pd-THP. TMThe flow cell was performed. The tracer oligonucleotide had four allyl dTs in the sequence and a 3' fluorescent label. After cleavage of the allyl dT by Ni-THP or Pd-THP complex, the fluorescent signal from the flow cell would be eliminated. The flow cell was grafted with 1.1 μM P15 / P7 and an additional 5% to 40% of the tracer oligonucleotide, and then scanned on Typhoon to confirm the success of the grafting. Chemical linearization was performed at 60°C for 10 minutes. Lanes 1-4 were treated with Pd-THP complex (generated in situ by (Pd(C3H5)Cl)2 (6mM), THP (60mM) and sodium ascorbate (6mM)) as a control, and lanes 5-8 were treated with 10mM Ni-THP (1:10) complex. The fluorescence intensity was then obtained on Typhoon to evaluate the degree of chemical linearization. Lane layout: 5% tracer = 55 nM (lanes 1, 5); 10% tracer = 110 nM (lanes 2, 6); 20% tracer = 220 nM (lanes 3, 7); 40% tracer = 440 nM (lanes 4, 8). Figure 8 The normalized median fluorescence intensity before and after lysis is shown, and Ni-THP has shown effective lysis activity comparable to that of Pd-THP.

[0445] Embodiment 11

[0446] In this example, alternative azo-arene-based linkers are described as bioorthogonal cleavable linkers using chemical linearization with aqueous sodium dithionite (Na2S2O4) solution.

[0447] Schemes 5 and 6 illustrate the preparation of azo-phosphoramidites 1 and 2, respectively.

[0448] Solution 5

[0449]

[0450] Compound 5. In N2, a suspension of methyl 2-amino-5-iodobenzoate (4) (20.77 g, 10 mmol), Pd(PPh3)4 (1.159 mg, 1 mmol), CuI (381 mg, 2 mmol), Et3N (4.2 mL, 30 mmol) and propargyl alcohol (1.75 ml, 30 mmol) in DMF (20 mL) was stirred at room temperature for 15 h. TLC analysis (petroleum ether: ethyl acetate 1: 1) showed that the raw material was completely consumed. The reaction was quenched with 200 ml of saturated NaCl solution. Ethyl acetate: petroleum ether 1: 1 (200 ml) was added to the mixture, and the water layer was extracted three times with ethyl acetate: petroleum ether 1: 1. After drying the combined organic matter with MgSO4, the solution was concentrated and purified by silica gel chromatography (petroleum ether: ethyl acetate 80: 20 to ethyl acetate) to obtain compound 5 as a yellow oil (1.88 g, 92%). 1 H NMR(CDCl3)δ3.78(s,3H),4.25(s,2H,≡CCH2),7.27-7.36(m,2H,arom.H),7.58-7.65(m,1H,arom.H).

[0451] Compound 6. Under N2, tert-butyldiphenylsilyl chloride (1.06g, 12mmol) was added to a solution of compound 5 (1.88mg, 9.2mmol) and imidazole (1.83g, 27.6mmol) in dry DMF (25ml). The reaction was followed by TLC and completed after stirring at room temperature for 1 hour. The reaction was quenched with saturated NaHCO3 solution. Extracted with ethyl acetate: petroleum ether 1:1 (2x). After drying the combined organic matter with MgSO4, the solvent was removed under vacuum. The crude mixture was then dissolved in EtOH and treated with EtSiH and Pd-C (10%). The reaction mixture was refluxed under N2 for 16 hours. TLC analysis (petroleum ether: ethyl acetate 8:2) showed that the raw material was completely consumed. The reaction mixture was filtered, concentrated and purified by silica gel chromatography (petroleum ether to petroleum ether: ethyl acetate 1:1) to obtain compound 6 as a yellow oil (3.37g, 82%). 1 H NMR(CDCl3)δ1.04(s,9H,3xCH3),1.70-1.77(m,2H,CH2),2.56(t,2H,CH2),3.58(t,2H,OCH2),3.6 0(s,3H,OCH3),6.62-6.65(m,1H,arom.H),7.03-7.06(m,1H,arom.),7.27-7.63(m,11H,arom.H).

[0452] Compound 8. To a suspension of resorcinol (2.2 g, 20 mmol) and K2CO3 (2.76 g, 20 mmol) in DMF (40 ml) was added tert-butyl 4-bromobutyrate (2.2 g, 10 mmol) under N2. The reaction mixture was stirred at room temperature for 15 hours. TLC analysis (petroleum ether: ethyl acetate 7:3) showed that 90% of the raw material resorcinol was consumed. The reaction was quenched with 300 ml of saturated NaCl solution. Ethyl acetate: petroleum ether 1:1 (300 ml) was added to the reaction mixture, and the water layer was extracted 3 times with ethyl acetate: petroleum ether 1:1. After drying the combined organic matter with MgSO4, the solution was concentrated and purified by silica gel column chromatography (petroleum ether to petroleum ether: ethyl acetate 50:50) to obtain compound 8 as a yellow oil (2.2 g, 88%). 1 H NMR(CDCl3)δ1.27(s,9H),1.91-1.98(m,2H,CH2),2.22(t,2H,CH2),3.27(t,2H,OCH2),6.36-6.46(m,3arom.H),7.09(t,1arom.H)

[0453] Compound 9. Compound 5 (450 mg, 1 mmol) was dissolved in a solution of acetone / water (1: 1) (2.5 mL). The mixture was cooled to 0 ° C, and concentrated HCl (0.5 mL) was added. After 5 minutes, a solution of sodium nitrite (93 mg, 1.2 mmol) in water (1 mL) was added dropwise, and the mixture was stirred at 0 ° C for 1 hour. At the same time, compound 8 (252 mg, 1 mmol), Na2CO3 (210 mg, 2 mmol) and NaOH (160 mg, 4 mmol) were dissolved in a solution of acetone / water (1: 1) (3 ml). The first solution was added dropwise to the second solution at 0 ° C. After addition, the mixture was warmed to room temperature and stirred for another 1 hour. The reaction mixture was neutralized with 1M-HCl and then extracted with DCM (3x50 mL). The organic phase was dried with MgSO4, concentrated and purified by silica gel chromatography (petroleum ether to petroleum ether: ethyl acetate 1: 1). Compound 9 was obtained as an orange / red oil (400 mg, 56%). 1H NMR(400MHz,DMSO-d6)δ1.02(s,9H,3xCH3),1.27(s,9H),δ1.69-1.76(m,CH2),1.91-1.97(m,2H,CH2),2.20(t,2H,CH2),2.53(t,2H,CH2),3.34(t,2 H,OCH2),3.54(t,2H,OCH2),3.62(s,3H,OCH3),6.36-6.46(m,4arom.H),7.00-7.06(m,1H,arom.H),7.09(t,1arom.H),7.27-7.63(m,11H,arom.H).

[0454] Compound 11. Compound 9 (3.55 g, 5 mmol) was dissolved in DCM (50 ml). The solution was treated with TFA (10 ml) at room temperature and stirred overnight. The mixture of TFA was then removed under reduced pressure and co-evaporation with toluene. The residue was distributed between NaCl and DCM. The aqueous layer was extracted 3 times with DCM. The combined organic layers were dried and concentrated with MgSO4. The crude product was dissolved in THF (15 ml) and treated with TBAF (1 M, 5 ml). The reaction was monitored by TLC (DCM / MeOH 90:10). The solvent was removed under reduced pressure, and the residue was distributed between NaCl and DCM (+10% MeOH). The aqueous layer was extracted 3 times with DCM (+10% MeOH). The combined organic layers were dried and concentrated with MgSO4. The residue was co-evaporated 3 times with pyridine. The residue was dissolved in Py / CH3CN (10 / 10ml), and Hunig's base (3.7ml, 15mmol), DMT-Cl (5.07g, 15mmol) were added. The mixture was stirred at room temperature for 2 hours. TLC (DCM: MeOH 95: 5) showed that the reaction was complete. The mixture was concentrated, dissolved in DCM, and washed with Na2CO3. The combined organic layer was dried with MgSO4, concentrated and purified by silica gel chromatography (petroleum ether: ethyl acetate 8: 2 to ethyl acetate + 1% NEt3). Compound 11 was obtained as an orange / red oil (2.37g, 66%). 1H NMR(400MHz,DMSO-d6)δ1.70-1.79(m,2H,CH2),1.90-1.97(m,2H,CH2),2.24(t,2H,CH2),2.54(t,2H,CH2),3.26(t,2H,OCH2),3.58(t,2H,OCH2) ,3.63(s,3H,OCH3),3.71(s,6H,OMe),6.79-6.89(m,4H,arom.H),7.03-7.06(m,1H,arom.H),7.10(t,1arom.H),7.13-7.63(m,13H,arom.H).

[0455] Compound 12. Compound 11 (1.05 g, 1.46 mmol) and DMAP (18 mg, 0.15 mmol) were dissolved in 7 ml of anhydrous pyridine under N2. The reaction mixture was then cooled to 0 ° C, and benzoyl chloride (0.5 ml, 4.4 mmol) was added dropwise. The reaction mixture was slowly heated to room temperature and stirred for 1 hour, during which the solution became turbid. TLC analysis showed that the raw material was completely consumed. The reaction was quenched with saturated NaHCO3 solution. The water layer was extracted 3 times with DCM. The combined organic layer was dried with MgSO4, concentrated and purified by silica gel chromatography (petroleum ether: ethyl acetate 8: 2 to ethyl acetate + 1% NEt3) to obtain compound 12 as a yellow oil (930 mg, 78%). 1 H NMR(400MHz,DMSO-d6)δ1.69-1.76(m,2H,CH2),1.91-1.97(m,2H,CH2),2.20(t ,2H,CH2),2.53(t,2H,CH2),3.24(t,2H,OCH2),3.54(t,2H,OCH2),3.62(s,3H, OCH3),3.71(s,6H,OMe),6.79-6.86(m,4H,aromatics),7.01(t,1arom.H),7.0 4-7.11(m,3H,arom.H),7.13-7.63(m,13H,arom.H),7.94-8.36(m,3H,arom.H).

[0456] Compound 13. Under N2, compound 12 (340mg, 0.5mmol) was dissolved in 3ml anhydrous DMF, and Hunig base (0.26ml, 1.5mmol) was added. Then the reaction mixture was treated with TSTU (196mg, 0.65mmol) and kept at room temperature for 30 minutes, and TLC analysis (EtOAc) showed that the reaction was complete. Then 3-aminopropanol (38μl, 0.5mol) was added to the reaction mixture and stirred at room temperature for 4h. TLC analysis showed that the raw material was completely consumed. The reaction was quenched with saturated NaHCO3 solution. The water layer was extracted 3 times with DCM. The combined organic layer was dried with MgSO4, concentrated, co-evaporated with xylene (3×), and purified by silica gel chromatography (petroleum ether: ethyl acetate 8:2 to ethyl acetate + 1% EtN3), to obtain compound 13, as an orange oil (320mg, 73%). 1 H NMR(400MHz,DMSO-d6)δ1.67-1.79(m,4H,CH2),1.91-1.97(m,2H,CH2),2.20(t,2H,CH2) ,2.53(t,2H,CH2),3.24(t,2H,OCH2),3.45(t,2H,OCH2),3.51(t,2H,NCH2),3.54(t,2H, OCH2),3.69(s,3H,OCH3),3.71(s,6H,OMe),6.79-6.86(m,4H,aromatics),7.01(t,1aro m.H),7.04-7.11(m,3H,arom.H),7.13-7.69(m,13H,arom.H),7.94-8.40(m,3H,arom.H).

[0457] Compound 1. Compound 13 (320mg, 0.36mmol) was dried under high vacuum. Anhydrous DCM (2ml) was added under N2 and stirred at room temperature for 10 minutes with molecular sieves. To the solution, Hunig base (0.19ml, 1.1mmol) was added, and then 2-cyanoethyl N, N-diisopropyl chlorophosphoramidite (102mg, 0.43mmol) was added. The reaction was stirred for 3h at room temperature under N2. The reaction was tracked with TLC (petroleum ether / ethyl acetate, 8:2). The reaction was concentrated into syrup under vacuum. The residue was purified by column (petroleum ether: ethyl acetate 8:2 to ethyl acetate, PE / EtOAc+1%NEt3) to obtain compound 1 as an orange oil (190mg, 50%). The product was partially decomposed on the column. 1H NMR(400MHz,DMSO-d6)δ0.96-1.27(m,12H),1.68-1.79(m,4H,CH2),1.91-1.97(m,2H,CH2),2.20 (t,2H,CH2),2.53(t,2H,CH2),2.58-2.74(m,2H,CH2CN),3.24(t,2H,OCH2),2.93(m,2H,NCH),3. 44(t,2H,NCH2),3.42-3.54(m,4H,OCH2),3.69(s,3H,OCH3),3.71(s,6H,OMe),6.79-7.01(m,5H, aromatics),7.04-7.11(m,3H,arom.H),7.13-7.69(m,13H,arom.H),7.94-8.40(m,3H,arom.H).

[0458] Solution 6

[0459]

[0460] Compound 15. Under N2, to anhydrous DMF (25ml) solution of compound 14 (3.6g, 20mmol) and imidazole (3.72g, 60mmol), tert-butyldiphenylsilyl chloride (2.3g, 26mmol) was added. The reaction was tracked by TLC, and completed after stirring at room temperature for 1 hour. The reaction was quenched with saturated NaHCO3 solution, and extracted with ethyl acetate: petroleum ether 1:1 (2x). After drying the combined organic layer with MgSO4, the reaction mixture was filtered, concentrated and purified by silica gel chromatography (petroleum ether to petroleum ether: ethyl acetate 1:1), to obtain compound 15, which is a beige oil (7.19g, 86%). 1 H NMR(DMSO-d6)δ0.99(s,9H,3xCH3),3.38-3.46(m,2H,NCH2),3.92(t,2H,OCH2),5.59 (s,2H,NH2),6.50-6.54(d,2H,arom.H),7.37-7.66(m,13H,arom.H),8.05(d,1H,NH).

[0461] Compound 16. Under N2, at 0 ℃, to a solution of compound 15 (840mg, 2mmol) in anhydrous DCM (10ml), tetrafluoroborate nitrosyl ester (234mg, 2mmol) was added. After tracking the reaction by TLC, the raw material disappeared after stirring at 0 ℃ for 1 hour. Then compound 8 (756mg, 3mmol) was added to the reaction mixture. The reaction mixture was slowly heated to room temperature and stirred for 4 hours. The reaction was tracked by TLC. After completion, the reaction was quenched with saturated NaHCO3 solution, and extracted with DCM (2x). After drying the combined organic layer with MgSO4, the reaction mixture was filtered, concentrated and obtained by silica gel chromatography (petroleum ether was purified to petroleum ether: ethyl acetate 1: 1), as an orange oil (1.12g, 82%). 1 H NMR(DMSO-d6)δ0.99(s,9H,3xCH3),1.27(s,9H,3x CH3),1.91-1.98(m,2H,CH2),2.22(t,2H,CH2),3.27(t,2H,OCH2),3.38-3.46(m,2H,NCH2),3.92(t,2H,OCH2),6. 36-6.46(m,3arom.H),6.50-6.56(d,2H,arom.H),7.10(t,1arom.H),7.37-7.66(m,13H,arom.H),8.06(d,1H,NH).

[0462] Compound 17. Under N2, compound 16 (1.1 g, 1.64 mmol) and DMAP (20 mg, 0.16 mmol) were dissolved in 8 ml of anhydrous pyridine. The mixture was then cooled to 0 ° C, and benzoyl chloride (0.17 ml, 1.5 mmol) was added dropwise. The reaction mixture was slowly heated to room temperature and stirred for 1 hour, during which the solution became turbid. TLC analysis showed that the raw material was completely consumed. The reaction was quenched with saturated NaHCO3 solution. The water layer was extracted 3 times with DCM. The combined organic layer was washed with H2SO4, dried with MgSO4, and concentrated. The obtained crude mixture was dissolved in DCM (14 ml). The solution was treated with TFA (1.4 ml) at room temperature and stirred overnight. The reaction was monitored by TLC (petroleum ether: ethyl acetate 1: 1). TFA was removed under reduced pressure and co-evaporated with toluene. The residue was distributed between NaCl and DCM. The water layer was extracted 3 times with DCM. The combined organic layer was dried over MgSO4 and concentrated. The crude product was dissolved in THF (8ml) and treated with TBAF (1M, 1.6ml). The reaction was monitored by TLC (DCM / MeOH 9:11). The solvent was removed under reduced pressure, and the residue was distributed between NaCl and DCM (+10% MeOH). The aqueous layer was extracted 3 times with DCM (+10% MeOH). The combined organic layers were dried over MgSO4, concentrated and purified by silica gel chromatography (DCM to DCM: MeOH 9:1). Compound 17 was obtained as an orange / red oil (515g, 64%). 1 H NMR(400MHz,DMSO-d6)δ1.56-1.64(m,2H,CH2),2.01(t,2H,CH2),3.24(t,2H,NCH2),3.52(t,2H,OCH2),4.25(t ,2H,OCH2),6.79-6.89(m,1H,arom.H),7.03-7.06(m,1H,arom.H),7.13-7.63(m,10H,arom.H),8.56(t,1H,NH).

[0463] Compound 18. Compound 17 (500mg, 1mmol) was dissolved in py / CH3CN (5 / 5ml), and Hunig's base (0.87ml, 5mmol), DMT-Cl (1g, 3mmol) were added. The mixture was stirred at room temperature for 2 hours. TLC (DCM: MeOH 95: 5) showed that the reaction was complete. The mixture was concentrated, dissolved in DCM, and washed with Na2CO3. The combined organic layer was dried over MgSO4, concentrated and purified by silica gel chromatography (petroleum ether: ethyl acetate 8: 2 to ethyl acetate + 1% NEt3). Compound 18 was obtained as an orange / red oil (653mg, 83%).1 H NMR (400MHz, DMSO-d6) δ1.16-1.24(m,2H,CH2),2.01(t,2H,CH2),3.24(t,2H,NCH2),3.52(t,2H,OCH2),3. 69(s,6H,OMe),4.25(t,2H,OCH2),6.76-6.89(m,4H,arom.H),7.03-8.23(m,21H,arom.H),8.86(t,1H,NH).

[0464] Compound 19. Under N2, compound 18 (350mg, 0.5mmol) was dissolved in 3ml of anhydrous DMF, and Hunig base (0.26ml, 1.5mmol) was added. The reaction mixture was then treated with TSTU (196mg, 0.65mmol) and kept at room temperature. After 30 minutes, TLC analysis (petroleum ether: EtOAc 2:8) showed that the reaction was complete. Then 3-aminopropanol (38μl, 0.5mol) was added to the reaction mixture and stirred at room temperature for 4 hours. TLC analysis showed that the raw material was completely consumed. The reaction was quenched with saturated NaHCO3 solution. The aqueous layer was extracted 3 times with DCM. The combined organic layer was dried with MgSO4, concentrated, co-evaporated with xylene (3×), and purified by silica gel chromatography (petroleum ether: ethyl acetate 8:2 to ethyl acetate + 1% NEt3), compound 19 was obtained as an orange oil (223mg, 52%). 1 H NMR(400MHz,DMSO-d6)δ1.67-1.79(m,4H,CH2),1.91-1.97(m,2H,CH2),2.05(t,2H,CH2 ),2.53(t,2H,CH2),3.24(t,2H,OCH2),3.45(t,2H,OCH2),3.51(t,2H,NCH2),3.57(t,2H ,OCH2),3.71(s,6H,OMe),6.79-6.86(m,4H,aromatics),7.01(t,1arom.H),7.04-7.11( m,3H,arom.H),7.13-7.69(m,13H,arom.H),7.74-8.40(m,4H,arom.H),8.76(t,1H,NH).

[0465] Compound 2. Compound 19 (223 mg, 0.26 mmol) was dried under high vacuum. Anhydrous DCM (1.5 ml) was added under N2 and stirred at room temperature for 10 minutes with molecular sieves. Hunig base (0.14 ml, 0.78 mmol) was added to the solution, followed by 2-cyanoethyl N, N-diisopropyl chlorophosphoramidite (76 ul, 0.34 mmol). The reaction was stirred at room temperature under N2 for 3 h. The reaction was tracked with TLC (petroleum ether / ethyl acetate, 2: 8). The reaction was concentrated to syrup under vacuum. The residue was purified by column (petroleum ether: ethyl acetate 8: 2 to ethyl acetate + 1% NEt3) to give compound 2 as an orange oil (152 mg, 56%). The product was partially decomposed on the column. 1 H NMR (400MHz, DMSO-d6) δ0.96-1.27(m,12H),1.68-1.79(m,4H,CH2),1.91-1.97(m,2H,CH2),2.19-2. 22(m,2H,CH2),2.51-2.54(m,2H,CH2),2.58-2.74(m,2H,CH2CN),3.22-3.26(m,2H,OCH2),2.93(m,2 H,NCH),3.44(t,2H,NCH2),3.42-3.54(m,4H,OCH2),3.71(s,6H,OMe),6.79-7.01(m,5H,aromatics) ,7.04-7.11(m,3H,arom.H),7.13-7.69(m,13H,arom.H),7.94-8.40(m,3H,arom.H),8.76(t,1H,NH).

[0466] Then, two short oligonucleotides (oligonucleotide azo-1 and oligonucleotide azo-2) respectively mixed with two kinds of azo-phosphoramidite compounds 1 and 2 were synthesized to evaluate the cleavage efficiency. Oligonucleotide azo-1 has absorption at 450nm and is orange. After cleavage, the azo bond is destroyed, resulting in the loss of orange. After adding 0.1M Na2S2O4 solution at room temperature, the orange color of the oligomer solution disappears immediately, which shows that the cleavage of the azo bond is very effective. The HPLC analysis of oligonucleotide azo-1 and cleavage products also confirmed the same result. The HPLC analysis of the oligonucleotide azo-2 cleavage test shows that the azo bond treated with 0.1MNa2S2O4 solution at room temperature is clean and cleaved immediately.

[0467] Oligonucleotide Azo-1: 5'-GAX 1 CTA-3'

[0468]

[0469] Oligonucleotide Azo-2:5'-GAX 2 CTA-3'

[0470]

[0471] In addition, the compatibility of oligonucleotide azo-1 with SBS sequencing reagents was also tested. First, 10 μM oligonucleotide azo-1 (10 μL) was incubated at 60 ° C for 60 minutes in 90 μL of incorporation mixture (IMX), cleavage mixture (CMS) and scanning mixture (USM). HPLC analysis showed that oligonucleotide azo-1 was completely stable in IMX, 90% oligonucleotide azo-1 was decomposed in CMS, and 50% oligonucleotide azo-1 was retained in USM. Small improvements were observed for oligonucleotide azo-2. When the two oligonucleotides were incubated in CMS solution (10 μL) at 60 ° C for 60 minutes, the degradation of oligonucleotide azo-2 was reduced to 44%, relative to the 66% degradation of oligonucleotide azo-1.

Claims

1. A solid support comprising a double-stranded polynucleotide, each double-stranded polynucleotide comprising a first strand and a second strand fixed thereon, each first strand comprising a first cleavage site capable of chemical cleavage by a palladium complex or a nickel complex, wherein the first cleavage site comprises a modified nucleoside or nucleotide portion having a structure of formula (II'): in, The bases are adenine, guanine, cytosine, thymine, or uracil. wherein the first strand and the second strand are fixed at their 5' ends to a solid support, And wherein each second strand polynucleotide comprises a second cleavage site, wherein the second cleavage site is not chemically cleavable by a palladium complex or a nickel complex.

2. The solid support of claim 1, wherein each first strand polynucleotide comprises a first extension primer immobilized on the solid support.

3. The solid support of claim 2, wherein the first extension primer comprises a first cleavage site. The solid support of claim 2 or 3 , wherein the first extension primer comprises a P5 sequence, or a modified P5 sequence.

5. A method for linearizing a plurality of fixed double-stranded polynucleotides, comprising: Providing a solid support according to any one of claims 1 to 4, contacting the double-stranded polynucleotide with an aqueous solution of a transition metal complex, thereby cleaving one or more first strands at a first cleavage site and producing one or more cleaved first nucleic acids and a cleaved immobilized first strand; and, removing the cleaved first nucleic acid from the solid support.

6. The method of claim 5, wherein the palladium complex is a palladium (0) complex.

7. The method of claim 6, wherein the palladium complex is generated in situ by mixing one or more palladium (II) compounds with tris (hydroxypropyl) phosphine (THP), and wherein the palladium (II) compound is selected from the group consisting of Na2PdCl4, (PdAllylCl)2, [PdAllyl (THP)]Cl and [PdAllyl(THP)2]Cl.

8. The method of claim 6, wherein the palladium (0) complex is produced by mixing Pd (PPh3) 4 with tris (hydroxypropyl) phosphine.

9. The method of claim 5, wherein the transition metal complex is a nickel (0) complex.

10. The method of claim 9, wherein the nickel(0) complex is generated in situ from a nickel(II) compound.

11. The solid support of any one of claims 1 to 3, wherein the first cleavage site produces a 3' blocking moiety upon chemical cleavage.

12. The solid support of claim 11, wherein the 3'-capping moiety comprises a phosphate moiety represented by formula (V): in: R 1 -NH2, -OH, -NHC(O)OR a or -OCH2OSi(R b )3; R a C 1-4 Alkyl, allyl, benzyl or 9-fluorenylmethyl; Each R b Independently selected from C 1-4 alkyl and phenyl; and The base is optionally protected adenine, guanine, cytosine, thymine or uracil.

13. The solid support of claim 1, wherein each second strand polynucleotide comprises a second extension primer immobilized to the solid support.

14. The solid support of claim 13, wherein the second extended primer comprises a second cleavage site.

15. The solid support of claim 1, wherein the second cleavage site is cleaved by chemical cleavage, and wherein the second cleavage site comprises a diol linker or an azobenzene linker.

Images