A method for early identification of male and female ginkgo trees by using SCAR marker

Abstract

The application discloses a SCAR marker method for early identification of female and male ginkgo trees, and belongs to the technical field of biology. The SCAR marker method for early identification of female and male ginkgo trees is characterized in that DNA is extracted from any organ or tissue of a ginkgo seedling, leaf, ball flower and seed, and then the genders of the female and male ginkgo trees are accurately identified by means of PCR. The accuracy of the provided technology can reach 100%, and as low as 10 mg of fresh ginkgo tissue can meet the identification requirements, does not affect the growth and development of the ginkgo, and the sampling time is not limited.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biological technology, and particularly relates to a SCAR marker method for early identification of genders of ginkgo male and female plants. BACKGROUND

[0002] Ginkgo is a gymnosperm of Ginkgoaceae and is a special tree species in China and is listed as a national second-class protected plant. Ginkgo can be used for both fruits and wood, can be used for medicine, and can be used for ornamental, and has high economic value. Ginkgo is a very typical dioecious plant. Because the fallen fruits and seed coats of female plants have a foul odor and pollute the environment, male plants are often used in landscaping. The seeds of ginkgo, commonly known as white fruits, are food and medicine homologous products with extremely high economic value, so white fruit economic forests should mainly be female plants. Therefore, the production and cultivation of ginkgo seeds and the resource allocation in landscaping require that the male and female plants of ginkgo be distinguished and planted according to respective needs. However, ginkgo has a long juvenile period, and it takes about 20 years for a seedling to be planted to flower and distinguish genders, which cannot meet the special requirements of gender identification of immature trees at an early stage of planting. Therefore, early identification of the genders of male and female ginkgo plants has important practical application value in production.

[0003] At present, the existing technical methods such as morphological characteristics, physiological and biochemical characteristics, chromosome morphology, isozyme, specific protein, and chemical agent treatment can identify the genders of male and female ginkgo plants to a certain extent. However, these identification methods also have obvious shortcomings.

[0004] The method of identifying the genders of male and female ginkgo plants through morphological characteristics is relatively simple and easy to implement, but the identification results are often not stable and accurate due to large differences in morphological characteristics of different plants.

[0005] The physiological and biochemical identification method is easily affected by factors such as production location, tree age, and temperature, has strong volatility, and is analyzed and determined between adult plants of known genders, which cannot meet the requirements of early identification of male and female ginkgo plants.

[0006] The method of identifying the genders of male and female ginkgo plants through chromosome morphology is one of the important methods for identifying the genders of ginkgo plants, and there are reports on the composition and sex chromosomes of ginkgo at home and abroad. However, this method is not practical for large-scale identification of male and female ginkgo plants in production practice.

[0007] The method of identifying the genders of male and female ginkgo plants through isozyme is stable and reliable, but the scale is limited and is only suitable for laboratory research, and is not suitable for large-scale identification of male and female ginkgo plants in forestry production.

[0008] The method of identifying the genders of male and female ginkgo plants through specific protein is relatively accurate, but still requires high scientific and technological support, the experimental steps are complicated, the conditions are relatively high, and it is difficult to popularize.

[0009] The identification method through chemical treatment is simple and easy, but it is still in the qualitative stage and lacks accurate quantitative standards.

[0010] Molecular biology methods, which study the differences between male and female plants at the molecular level, enable accurate sex identification of plants. Currently, molecular markers such as RAPD, AFLP, ISSR, SSR, and SCAR are used in ginkgo genetic fingerprinting, variety identification, and genetic breeding research. However, there are no molecular markers that can be used for early sex identification of male and female ginkgo plants. Summary of the Invention

[0011] (1) Technical problems solved

[0012] In order to overcome the above-mentioned defects of the prior art, the present invention provides a SCAR marking method for early identification of the sex of male and female ginkgo plants, which solves the problem that the prior art methods can identify male and female ginkgo plants to a certain extent, but the shortcomings of these identification techniques are also quite obvious, such as the identification is not accurate enough, time-consuming and labor-intensive, and not suitable for large-scale identification.

[0013] (2) Technical solution

[0014] To achieve the above object, the present invention provides the following technical solution: a SCAR marker method for early identification of the sex of male and female Ginkgo plants, wherein the SCAR molecular marker primer sequence is Ginkgo SexD-F5R5.

[0015] As a further solution of the present invention: the upstream primer sequence F5 in the SCAR molecular marker primer sequence is: GAGTTGATGTGATTCTTGGAGA, and the downstream primer sequence R5 is: CATTGGTTCAAACACCTTACT.

[0016] As a further embodiment of the present invention: the primer pair is used in early identification of the sex of male and female Ginkgo plants.

[0017] As a further solution of the present invention: in the application, the genomic DNA of the sample to be identified is firstly extracted, and then PCR amplification is performed.

[0018] As a further embodiment of the present invention, the method for extracting genomic DNA from the sample to be tested and identified comprises the following steps:

[0019] S1. Select 10 local male and female ginkgo trees of known sex, take their young leaves, and quickly freeze them in liquid nitrogen for later use.

[0020] S2. Extract DNA from Ginkgo leaves using the CTAB method.

[0021] As a further solution of the present invention: the PCR amplification reaction system is: a reaction volume of 20uL, including 10uL of 2×Mix Master, 2uL of Ginkgo DNA, 0.5uL each of the upstream and downstream primers of the SCAR molecular marker, and 7uL of ddH2O.

[0022] As a further solution of the present invention: the reaction procedure of PCR amplification in the application is: pre-denaturation at 94°C for 3 minutes; denaturation at 94°C for 30 seconds; annealing at 60°C for 30 seconds; extension at 72°C for 30 seconds; 30 cycles; extension at 72°C for 10 minutes; terminate the reaction, and store the amplified product in a refrigerator at 4°C.

[0023] As a further solution of the present invention: the PCR instrument model in the PCR amplification is not limited, and any PCR instrument can complete the process.

[0024] As a further solution of the present invention, in the application, electrophoresis was used to identify the amplified products. All 10 male ginkgo plants were able to amplify a specific band of 297 bp, while all 10 female plants had no amplified band, thereby enabling identification of male and female ginkgo plants.

[0025] As a further solution of the present invention: identification of the specific band of the male ginkgo plant: after sequencing, the DNA sequence of the specific band is:

[0026] GAGTTGATGTGATTCTTGGAGAGTAGTGGCTTAGAACACTAGAGACCTTCTCAATGAACTTAGAAGAGTTCTTCATTAAGTTTAATCTATAAGGAAAAGTGTATAAGTTGAGAGGATTGGTTGCACCACCACTAAATCAAGTAATTAAT TATCATATGATGGAGAAGTTGATTAAAAAGGGTGCTACTAGCATCATTATGAGGTGCTACTCTATTGAAGGGTGTGAAGAATAGGAATCAATCACACTATAGCTACAGGAAGTTATTTCTTAACATAGTAAGGTGTTTGAACCAAATG.

[0027] (3) Beneficial effects

[0028] Compared with the prior art, the present invention has the following beneficial effects:

[0029] The SCAR marking method for early identification of the sex of male and female ginkgo plants extracts DNA from any retrievable organ or tissue in the plant, such as ginkgo seedlings, leaves, cones, and seeds, and then accurately identifies the sex of male and female ginkgo plants through PCR. The technical accuracy provided by this invention can reach 100%, and as little as 10 mg of fresh ginkgo tissue can meet the identification requirements, without affecting the growth and development of ginkgo, and there is no limit on the time of sampling. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 The figure shows the electrophoresis results of PCR products of male and female Ginkgo plants of the present invention. M represents the gene ruler, ♀ represents female Ginkgo plants, and ♂ represents male Ginkgo plants. All 10 male Ginkgo plants can amplify a specific band of 297 bp, while all 10 female plants have no amplified band. DETAILED DESCRIPTION

[0031] The technical solution of this patent is further described in detail below in conjunction with specific implementation methods.

[0032] like Figure 1 As shown, the present invention provides a technical solution: a SCAR marker method for early identification of the sex of male and female Ginkgo plants, and the SCAR molecular marker primer sequence is Ginkgo SexD-F5R5.

[0033] The upstream primer sequence F5 of the SCAR molecular marker primer sequence is: GAGTTGATGTGATTCTTGGAGA, and the downstream primer sequence R5 is: CATTGGTTCAAACACCTTACT.

[0034] Application of primer pairs in early sex identification of male and female Ginkgo plants.

[0035] In the application, the genomic DNA of the sample to be identified is first extracted and then PCR amplified.

[0036] The method for extracting genomic DNA from the sample to be tested and identified comprises the following steps:

[0037] S1. Select 10 local male and female ginkgo trees of known sex, take their tender leaves, and quickly freeze them in liquid nitrogen for later use;

[0038] S2. Extract DNA from Ginkgo leaves using the CTAB method.

[0039] The PCR amplification reaction system was as follows: reaction volume 20uL, including 10uL of 2×Mix Master, 2uL of Ginkgo DNA, 0.5uL each of the upstream and downstream primers of the SCAR molecular marker, and 7uL of ddH2O.

[0040] The PCR amplification reaction procedure in the application was as follows: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s; annealing at 60°C for 30 s; extension at 72°C for 30 s; 30 cycles; extension at 72°C for 10 min; the reaction was terminated and the amplified product was stored in a refrigerator at 4°C.

[0041] There is no restriction on the type of PCR instrument used in PCR amplification, and any PCR instrument can complete the process.

[0042] The amplified products were identified by electrophoresis. A specific band of 297 bp was amplified from all 10 male ginkgo plants, while no amplified band was found from all 10 female plants. Thus, male and female ginkgo plants could be identified.

[0043] Identification of the specific band of male Ginkgo biloba: After sequencing, the DNA sequence of the specific band is:

[0044] GAGTTGATGTGATTCTTGGAGAGTAGTGGCTTAGAACACTAGAGACCTTCTCAATGAACTTAGAAGAGTTCTTCATTAAGTTTAATCTATAAGGAAAAGTGTATAAGTTGAGAGGATTGGTTGCACCACCACTAAATCAAGTAATTAAT TATCATATGATGGAGAAGTTGATTAAAAAGGGTGCTACTAGCATCATTATGAGGTGCTACTCTATTGAAGGGTGTGAAGAATAGGAATCAATCACACTATAGCTACAGGAAGTTATTTCTTAACATAGTAAGGTGTTTGAACCAAATG.

[0045] By extracting DNA from any available organ or tissue in ginkgo plants, such as seedlings, leaves, cones, and seeds, and then accurately identifying the sex of male and female ginkgo plants through the PCR method, the invention provides a technical accuracy of 100%. As little as 10 mg of fresh ginkgo tissue can meet the identification requirements, without affecting the growth and development of ginkgo, and there is no limit on the time of sampling.

[0046] Explanation of terms:

[0047] Molecular markers: In a broad sense, molecular markers refer to heritable and detectable DNA sequences or proteins. In a narrow sense, molecular markers refer to specific DNA fragments that can reflect certain differences in the genome between biological individuals or populations.

[0048] DNA: deoxyribonucleic acid.

[0049] PCR: Polymerase chain reaction (PCR) is a molecular biology technique used to amplify specific DNA fragments. It can be regarded as a special DNA replication outside the body. The biggest feature of PCR is that it can significantly increase trace amounts of DNA.

[0050] SCAR markers: SCAR (specific sequence amplification of sequence characterized amplified regions) markers are typically derived from RAPD, SRAP, and SSR markers. SCAR markers are designed by recovering the specific marker fragment from a gel, cloning, and sequencing it. A pair of specific primers (18-24 bases) is then designed based on its base sequence. Alternatively, the RAPD marker ends can be sequenced, and approximately 14 bases are added to the end of the original 10-base RAPD primer to create a specific primer complementary to the end of the original RAPD fragment. SCAR markers are typically expressed as the presence or absence of the amplified fragment and are dominant markers. They have become the preferred molecular marker for direct application in breeding practices and are also a type of molecular marker that can be directly used in marker-assisted breeding.

[0051] The above describes in detail the preferred embodiments of this patent, but this patent is not limited to the above embodiments. Various changes can be made within the scope of knowledge possessed by ordinary technicians in this field without departing from the purpose of this patent. Sequence Listing <110> Linyi University <120> A SCAR marker method for early sex identification of male and female Ginkgo plants <160> 1 <170> SIPOSequenceListing 1.0 <210> 1 <211> 297 <212> DNA <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 1 gagttgatgt gattcttgga gagtagtggc ttagaacact agagaccttc tcaatgaact 60 tagaagagtt cttcattaag tttaatctat aaggaaaagt gtataagttg agaggattgg 120 ttgcaccacc actaaatcaa gtaattaatt atcatatgat ggagaagttg attaaaaagg 180 gtgctactag catcattatg aggtgctact ctattgaagg gtgtgaagaa taggaatcaa 240 tcacactata gctacaggaa gttatttctt aacatagtaa ggtgtttgaa ccaaatg 297

Claims

1. A SCAR marker method for early sex identification of male and female Ginkgo biloba plants, characterized by: The SCAR molecular marker primer sequence is Ginkgo SexD-F5R5; the upstream primer sequence F5 is: GAGTTGATGTGATTCTTGGAGA, the downstream primer sequence R5 is: CATTGGTTCAAACACCTTACT, and the primer pair is used to perform PCR amplification on genomic DNA. The PCR amplification product is identified by electrophoresis. A 297 bp specific band can be amplified from all 10 male ginkgo plants, while no amplified band is found from all 10 female plants, thereby identifying male and female ginkgo plants. The DNA sequence of the specific band is: GAGTTGATGTGATTCTTGGAGAGTAGTGGCTTAGAACACTAGAGACCTTCTCAATGAACTTAGAA GAGTTCTTCATTAAGTTTAATCTATAAGGAAAAGTGTATAAGTTGAGAGGATTGGTTGCACCACCACTAAATCAAGTAATTAATTATCATATGATGGAGAAGTTGATTAAAAAGGGTGCTACTAGCATCATTATGAGGTGCTACTCTATTGAAGGGTGTGAAGAATAGGAATCAATCACACTATAGCTACAGGAAGTTATTTCTTAACATAGTAAGGTGTTTGAACCAAATG.

2. The SCAR marking method for early sex identification of male and female Ginkgo biloba plants according to claim 1, characterized in that: First, extract the genomic DNA of the sample to be identified, and then perform PCR amplification.

3. The SCAR marking method for early sex identification of male and female Ginkgo biloba plants according to claim 2, characterized in that: The method for extracting genomic DNA from the sample to be tested and identified comprises the following steps: S1. Select 10 local male and female ginkgo trees of known sex, take their tender leaves, and quickly freeze them in liquid nitrogen for later use; S2. Extract DNA from Ginkgo leaves using the CTAB method.

4. The SCAR marking method for early sex identification of male and female Ginkgo biloba plants according to claim 3, characterized in that: The PCR amplification reaction system is as follows: the reaction volume is 20uL, including 10uL of 2×Mix Master, 2uL of Ginkgo DNA, 0.5uL each of the upstream and downstream primers of the SCAR molecular marker, and 7uL of ddH2O.

5. The SCAR marking method for early sex identification of male and female Ginkgo biloba plants according to claim 4, characterized in that: The PCR amplification reaction procedure is as follows: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s; annealing at 60°C for 30 s; extension at 72°C for 30 s; 30 cycles; extension at 72°C for 10 min; termination of the reaction, and storage of the amplified product in a refrigerator at 4°C.

Images