Nickopolymer oligonucleotides containing phosphorodithioate internucleoside linkages

Abstract

The present invention relates to a nicked polymeric oligonucleotide comprising a phosphorothioate internucleoside bond of formula (I) as defined in the present specification and the claims. The oligonucleotides of the present invention can be used as medicaments.

Description

BACKGROUND OF THE INVENTION

[0002] The use of synthetic oligonucleotides as therapeutics has witnessed remarkable progress over the last few decades, leading to the development of molecules that act through diverse mechanisms, including gapmers that activate RNase H, splice-switching oligonucleotides, microRNA inhibitors, siRNAs or aptamers (S.T. Crooke, Antisense Drug Technology: Principles, Strategies, and Applications, 2nd Edition, Boca Raton, FL: CRC Press, 2008). However, oligonucleotides are inherently unstable in biological systems to the nuclease degradation process. Additionally, they display highly unfavorable pharmacokinetic behavior. To improve these drawbacks, various types of chemical modifications have been investigated over the last few decades. Arguably, one of the most successful modifications has been the introduction of phosphorothioate linkages, where one of the non-bridging phosphate oxygen atoms is replaced by a sulfur atom (F. Eckstein, Antisense and Nucleic Acid Drug Development 2009, 10, 117 - 121). Such phosphorothioate oligodeoxynucleotides display increased protein binding and significantly higher stability to nuclease degradation and thus significantly higher half-lives in plasma, tissues and cells compared to their unmodified phosphodiester analogs. These decisive features have allowed the development of first-generation oligonucleotide therapeutics and opened the door for their improvement through more recent modifications such as locked nucleic acids (LNA). However, the replacement of the phosphodiester bond with a phosphorothioate creates a chiral center at the phosphorus atom. Thus, all approved phosphorothioate oligonucleotide therapeutics are used as mixtures of a vast number of diastereomeric compounds, which may all have different (and possibly opposing) physicochemical and pharmacological properties.

[0003] Although it may now be possible to stereospecifically synthesize stereodefined single phosphorothioate oligonucleotides (N. Oka, M. Yamamoto, T. Sato, T. Wada, J. Am. Chem. Soc. 2008, 130, 16031-16037), it remains a challenge to identify the stereoisomers with optimal properties within the vast number of possible diastereoisomers. In this context, reducing the diastereoisomeric complexity by using achiral thiophosphate linkages is of great significance. For example, symmetric non-bridging dithioate modifications in which both of the non-bridging oxygen atoms within the phosphate linkage are replaced by sulfur (see, e.g., W. T. Wiesler, M. H. Caruthers, J. Org. Chem. 1996, 61, 4272-4281) have been applied to immunostimulatory oligonucleotides (A. M. Krieg, S. Matson, E. Fisher, Antisense Nucleic Acid Drug Dev. 1996, 6, 133-139), siRNA (e.g., X. Yang, M. Sierant, M. Janicka, L. Peczek, C. Martinez, T. Hassell, N. Li, X. Li, T. Wang, B. Nawrot, ACS Chem. Biol. 2012, 7, 1214-1220) and aptamers (e.g., X. Yang, S. Fennewald, B. A. Luxon, J. Aronson, N. K. Herzog, D. G. Gorenstein, Bioorg. Med. Chem. Lett. 1999, 9, 3357-3362). Intriguingly, attempts to utilize such achiral modifications in the context of antisense oligonucleotides have thus far met with limited success (see, e.g., M. K. Ghosh, K. Ghosh, O. Dahl, J. S. Cohen, Nucleic Acids Res. 1993, 21, 5761-5766; and J. P. Vaughn, J. Stekler, S. Demirdji, J. K. Mills, M. H. Caruthers, J. D. Iglehart, J. R. Marks, Nucleic Acids Res. 1996, 24, 4558-4564).

[0004] Surprisingly, we have now found that non-bridging dithiophosphates can be introduced into oligonucleotides, particularly into oligonucleotide gapmers or mixmers in general and specifically into LNA-DNA-LNA gapmers or LNA / DNA mixmers. Such modifications are well tolerated and the resulting molecules show great potential for therapeutic applications, while each non-bridging dithiophosphate modification reduces the size of the total library of possible diastereoisomers by 50%. When the modifications are placed in the LNA flanks of gapmers, the resulting oligonucleotides are generally more potent than the corresponding all-phosphorothioate parents. Typically, the modifications are additionally well tolerated within the gap region and, even more surprisingly, can lead to improved potency when appropriately placed.

[0005] Accordingly, we have surprisingly found that the present invention provides oligonucleotides having improved physicochemical and pharmacological properties (e.g., including improved potency). In some aspects, the oligonucleotides of the present invention retain activity or efficacy and may be as potent or more potent than the same compounds (phosphorothioate reference compounds) in which the dithiophosphate bond of formula ((IA) or (IB)IB) is replaced with a conventional atactic phosphorothioate bond. Each introduction of a non-bridging dithiophosphate modification removes one of the chiral centers at phosphorus and thus reduces the diastereoisomeric complexity of the compound by 50%. Additionally, whenever a dithioate modification is introduced, the oligonucleotide appears to be taken up by cells much better, particularly by cells such as hepatocytes, muscle cells, and heart cells.

[0006] Introducing non-bridging dithioate modifications into the LNA flanks of gapmers appears to be particularly beneficial, resulting in molecules showing higher target reduction and much better uptake behavior, higher stability, and a favorable safety profile.

[0007] The chemical synthesis of non-bridging phosphorodithioate linkages in oligonucleotides is preferably achieved by solid-phase oligonucleotide synthesis techniques using suitable thiophosphoramidite building blocks. The successful application of such thiophosphoramidites has been described for normal DNA (X. Yang, Curr Protoc Nucleic Acid Chem 2016, 66, 4.71.71-74.71.14.) and for RNA (X. Yang, Curr Protoc Nucleic Acid Chem 2017, 70, 4.77.71–74.77.13.), and the required building blocks are available from commercial sources. Interestingly, the synthesis of the more challenging corresponding LNA thiophosphoramidites has not been reported. In the present application, we also report the successful synthesis of all four LNA thiophosphoramidites and their incorporation into oligonucleotides.

[0008] BRIEF DESCRIPTION OF THE INVENTION

[0009] The present invention relates to an oligonucleotide comprising at least one phosphorodithioate internucleoside linkage of formula (I)

[0010]

[0011] wherein one of the two oxygen atoms is linked to the 3'-carbon atom of an adjacent nucleoside (A 1 ) and the other oxygen atom is linked to the 5'-carbon atom of another adjacent nucleoside (A 2 ), wherein at least one of the two nucleosides (A1) and (A2) is an LNA nucleoside and wherein R is hydrogen or a phosphate protecting group. The present invention also particularly relates to a gapmer oligonucleotide comprising a phosphorodithioate internucleoside linkage of formula (I). The present invention also relates to a method for manufacturing the oligonucleotides of the present invention and to LNA nucleoside monomers that can be particularly used for manufacturing the oligonucleotides of the present invention.

[0012] The present invention particularly relates to an oligonucleotide comprising at least one phosphorodithioate internucleoside linkage of (IA) or (IB)

[0013]

[0014] wherein one of the two oxygen atoms is linked to the 3'-carbon atom of an adjacent nucleoside (A 1 ) and the other oxygen atom is linked to the 5'-carbon atom of another adjacent nucleoside (A 2) is linked to the 5'-carbon atom, and wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as Na+ or K+ cation; or M+ is an ammonium cation.

[0015] In other words, M is a metal, such as an alkali metal, such as Na or K; or M is NH4.

[0016] The oligonucleotides of the present invention are preferably single-stranded antisense oligonucleotides, which contain one or more 2'-sugar modified nucleosides, such as one or more LNA nucleosides or one or more 2'-MOE nucleosides. The antisense oligonucleotides of the present invention are capable of regulating the expression of a target nucleic acid (such as, target pre-mRNA, mRNA, microRNA, long non-coding RNA or viral RNA) in cells expressing the target RNA in vivo or in vitro. In some embodiments, the single-stranded antisense oligonucleotides also contain phosphorothioate internucleoside linkages. The single-stranded antisense oligonucleotides can be in the form of, for example, gapmer oligonucleotides, mixmer oligonucleotides or all-mer oligonucleotides. The single-stranded antisense oligonucleotide mixmers can be used to regulate splicing events in target pre-mRNA. The single-stranded antisense oligonucleotide mixmers can be used to inhibit the expression of target microRNA. The single-stranded antisense oligonucleotide mixmers can be used to inhibit the interaction between long non-coding RNA and chromatin, thereby alleviating the repression of one or more mRNAs mediated by chromatin (such as PRC2). The single-stranded antisense oligonucleotide gapmers can be used to inhibit target pre-mRNA, target mRNA, target viral RNA, or target long non-coding RNA.

[0017] The present invention also relates to the use of the oligonucleotides of the present invention (such as single-stranded antisense oligonucleotides) as therapeutic agents.

[0018] The present invention also particularly relates to a gapmer oligonucleotide, which contains the phosphorodithioate internucleoside linkage of formula (I). The present invention also particularly relates to a mixmer oligonucleotide, which contains the phosphorodithioate internucleoside linkage of formula (I). The present invention also particularly relates to an all-mer oligonucleotide, which contains the phosphorodithioate internucleoside linkage of formula (I).

[0019] The present invention also relates to methods for manufacturing the oligonucleotides of the present invention and particularly to LNA nucleoside monomers that can be used for manufacturing the oligonucleotides of the present invention.

[0020] The present invention also relates to methods for manufacturing the oligonucleotides of the present invention and particularly to MOE nucleoside monomers that can be used for manufacturing the oligonucleotides of the present invention.

[0021] The present invention also provides new MOE monomers and LNA monomers that can be used for manufacturing the oligonucleotides of the present invention.

[0022] During oligonucleotide synthesis, the use of protective R groups is often employed. After oligonucleotide synthesis, the protecting groups are generally exchanged for a hydrogen atom or a cation such as an alkali metal or an ammonium cation, such as when the oligonucleotide is in a salt form. The salt generally contains a cation, such as a metal cation, for example, a sodium or potassium cation or an ammonium cation. In the case of an antisense oligonucleotide, preferably R is hydrogen, or the antisense oligonucleotide is in a salt form (as shown in IB).

[0023] The phosphorothioate internucleoside bond of formula (IB) can for example be selected from:

[0024]

[0025] wherein M+ is a cation, such as a metal cation, such as an alkali metal cation, such as Na+ or K+ cation; or M+ is an ammonium cation. The oligonucleotides of the present invention can thus be in the following forms: oligonucleosides salts, alkali metal salts, such as sodium salts, potassium salts or ammonium salts.

[0026] Alternatively shown, the oligonucleotides of the present invention can comprise a phosphorothioate internucleoside bond of formula IA’ or IB’

[0027]

[0028] The present invention also particularly relates to a gapmer oligonucleotide comprising a phosphorothioate internucleoside bond of formula (I) (for example, formula (IA) or (IB) or formula (IA’) or formula (IB’)).

[0029] The present invention also particularly relates to a mixmer oligonucleotide comprising a phosphorothioate internucleoside bond of formula (I) (for example, formula (IA) or (IB) or formula (IA’) or formula (IB’)).

[0030] The present invention also particularly relates to a homommer oligonucleotide comprising a phosphorothioate internucleoside bond of formula (I) (for example, formula (IA) or (IB) or formula (IA’) or formula (IB’)).

[0031] In a preferred embodiment of the oligonucleotides of the present invention, at least one of the two nucleosides (A 1 ) and (A 2 ) is an LNA nucleoside.

[0032] In a preferred embodiment of the oligonucleotides of the present invention, at least one of the two nucleosides (A 1 ) and (A 2 ) is a 2’-O-MOE nucleoside.

[0033] In a preferred embodiment of the oligonucleotides of the present invention, the oligonucleotide is a single-stranded antisense oligonucleotide, and at least one of the two nucleosides (A 1 ) and (A 2At least one of them is an LNA nucleoside.

[0034] In a preferred embodiment of the oligonucleotides of the present invention, the oligonucleotide is a single-stranded antisense oligonucleotide, and at least one of the two nucleosides (A 1 ) and (A 2 ) is a 2'-O-MOE nucleoside.

[0035] The present invention provides an antisense oligonucleotide for inhibiting a target RNA in a cell, wherein the antisense gapmer oligonucleotide comprises at least one phosphorothioate internucleoside bond of formula (IA) or (IB)

[0036]

[0037] wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as Na+ or K+ cation; or M+ is an ammonium cation, wherein the antisense oligonucleotide is or comprises an antisense gapmer oligonucleotide (referred to herein as a gapmer or a gapmer oligonucleotide),

[0038] The antisense oligonucleotides of the present invention can thus comprise a gapmer or consist thereof.

[0039] The present invention provides an antisense oligonucleotide comprising at least one phosphorothioate internucleoside bond of formula (IA) or (IB)

[0040]

[0041] wherein one of the two oxygen atoms is linked to the 3'-carbon atom of the adjacent nucleoside (A1) and the other oxygen atom is linked to the 5'-carbon atom of the other adjacent nucleoside (A2), wherein at least one of the two nucleosides (A1) and (A2) is an LNA nucleoside and wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as Na+ or K+ cation; or M+ is an ammonium cation, wherein A2 is the 3'-terminal nucleoside of the oligonucleotide.

[0042] The present invention provides an antisense oligonucleotide comprising at least one phosphorothioate internucleoside bond of formula (IA) or (IB)

[0043]

[0044] One of the two oxygen atoms is linked to the 3'-carbon atom of an adjacent nucleoside (A1) and the other oxygen atom is linked to the 5'-carbon atom of another adjacent nucleoside (A2), wherein at least one of the two nucleosides (A1) and (A2) is an LNA nucleoside and wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as a Na+ or K+ cation; or M+ is an ammonium cation, wherein A1 is the 5'-terminal nucleoside of the oligonucleotide.

[0045] The present invention provides an antisense oligonucleotide comprising at least one phosphorodithioate internucleoside bond of formula (IA) or (IB)

[0046]

[0047] One of the two oxygen atoms is linked to the 3'-carbon atom of an adjacent nucleoside (A1) and the other oxygen atom is linked to the 5'-carbon atom of another adjacent nucleoside (A2), wherein at least one of the two nucleosides (A1) and (A2) is a 2-O-MOE nucleoside and wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as a Na+ or K+ cation; or M+ is an ammonium cation, wherein A2 is the 3'-terminal nucleoside of the oligonucleotide.

[0048] The present invention provides an antisense oligonucleotide comprising at least one phosphorodithioate internucleoside bond of formula (IA) or (IB)

[0049]

[0050] One of the two oxygen atoms is linked to the 3'-carbon atom of an adjacent nucleoside (A1) and the other oxygen atom is linked to the 5'-carbon atom of another adjacent nucleoside (A2), wherein at least one of the two nucleosides (A1) and (A2) is a 2-O-MOE nucleoside and wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as a Na+ or K+ cation; or M+ is an ammonium cation, wherein A1 is the 5'-terminal nucleoside of the oligonucleotide.

[0051] The present invention provides an antisense oligonucleotide comprising at least one phosphorodithioate internucleoside bond of formula (IA) or (IB)

[0052]

[0053] One of the two oxygen atoms is linked to the 3'-carbon atom of an adjacent nucleoside (A1) and the other oxygen atom is linked to the 5'-carbon atom of another adjacent nucleoside (A2), wherein at least one of the two nucleosides (A1) and (A2) is a 2'-sugar modified nucleoside and wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as a Na+ or K+ cation; or M+ is an ammonium cation, and wherein A2 is the 3'-terminal nucleoside of the oligonucleotide.

[0054] The present invention provides an antisense oligonucleotide comprising at least one phosphorodithioate internucleoside bond of formula (IA) or (IB)

[0055]

[0056] One of the two oxygen atoms is linked to the 3'-carbon atom of an adjacent nucleoside (A1) and the other oxygen atom is linked to the 5'-carbon atom of another adjacent nucleoside (A2), wherein at least one of the two nucleosides (A1) and (A2) is a 2'-sugar modified nucleoside and wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as a Na+ or K+ cation; or M+ is an ammonium cation, and wherein A1 is the 5'-terminal nucleoside of the oligonucleotide.

[0057] The 2'-sugar modified nucleosides may independently be selected from 2'-sugar modified nucleosides selected from 2'-alkoxy-RNA, 2'-alkoxyalkoxy-RNA, 2'-amino-DNA, 2'-fluoro-RNA, 2'-fluoro-ANA and LNA nucleosides.

[0058] The present invention provides a single-stranded antisense oligonucleotide comprising at least one phosphorodithioate internucleoside bond of formula (IA) or (IB)

[0059]

[0060] One of the two oxygen atoms is linked to the 3'-carbon atom of an adjacent nucleoside (A1) and the other oxygen atom is linked to the 5'-carbon atom of another adjacent nucleoside (A2), and wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as a Na+ or K+ cation; or M+ is an ammonium cation, and wherein the single-stranded oligonucleotide further comprises at least one stereodefined phosphorothioate internucleoside bond, being (Sp,S) or (Rp,R)

[0061]

[0062] wherein N 1 and N 2is a nucleoside.

[0063] The present invention also provides single-stranded antisense oligonucleotides for modulating an RNA target in a cell, wherein the antisense oligonucleotide comprises or consists of a contiguous nucleotide sequence of 10–30 nucleotides in length, wherein the contiguous nucleotide sequence comprises one or more 2'-sugar modified nucleosides, and wherein at least one of the internucleoside linkages present between the nucleosides of the contiguous nucleotide sequence is a phosphorodithioate linkage of formula (IA) or (IB)

[0064]

[0065] wherein one of the two oxygen atoms is linked to the 3'-carbon atom of the adjacent nucleoside (A1) and the other oxygen atom is linked to the 5'-carbon atom of the other adjacent nucleoside (A2) and wherein R is hydrogen or a phosphate protecting group.

[0066] The present invention also provides single-stranded antisense oligonucleotides for modulating an RNA target in a cell, wherein the antisense oligonucleotide comprises or consists of a contiguous nucleotide sequence of 10–30 nucleotides in length, wherein the contiguous nucleotide sequence comprises one or more 2'-sugar modified nucleosides, and wherein at least one of the internucleoside linkages present between the nucleosides of the contiguous nucleotide sequence is a phosphorodithioate linkage of formula (IA) or (IB)

[0067]

[0068] wherein one of the two oxygen atoms is linked to the 3'-carbon atom of the adjacent nucleoside (A1) and the other oxygen atom is linked to the 5'-carbon atom of the other adjacent nucleoside (A2); and wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as a Na+ or K+ cation; or M+ is an ammonium cation, and wherein the single-stranded antisense oligonucleotide is for modulating the splicing of a pre-mRNA target RNA.

[0069] The present invention also provides single-stranded antisense oligonucleotides for modulating an RNA target in a cell, wherein the antisense oligonucleotide comprises or consists of a contiguous nucleotide sequence of 10–30 nucleotides in length, wherein the contiguous nucleotide sequence comprises one or more 2'-sugar modified nucleosides, and wherein at least one of the internucleoside linkages present between the nucleosides of the contiguous nucleotide sequence is a phosphorodithioate linkage of formula (IA) or (IB)

[0070]

[0071] One of the two oxygen atoms is linked to the 3'-carbon atom of an adjacent nucleoside (A1) and the other oxygen atom is linked to the 5'-carbon atom of another adjacent nucleoside (A2); and wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as a Na+ or K+ cation; or M+ is an ammonium cation, and wherein the single-stranded antisense oligonucleotide is used to inhibit the expression of non-coding long RNA. For examples of lncRNAs that can be targeted by the compounds of the present invention, see WO 2012 / 065143.

[0072] The present invention also provides single-stranded antisense oligonucleotides for modulating an RNA target in a cell, wherein the antisense oligonucleotide comprises or consists of a continuous nucleotide sequence of 10-30 nucleotides in length, wherein the continuous nucleotide sequence comprises one or more 2'-sugar modified nucleosides, and wherein at least one of the internucleoside linkages present between the nucleosides of the continuous nucleotide sequence is a phosphorodithioate linkage of formula (IA) or (IB)

[0073]

[0074] One of the two oxygen atoms is linked to the 3'-carbon atom of an adjacent nucleoside (A1) and the other oxygen atom is linked to the 5'-carbon atom of another adjacent nucleoside (A2); and wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as a Na+ or K+ cation; or M+ is an ammonium cation, and wherein the single-stranded antisense oligonucleotide is used to inhibit the expression of a human mRNA or pre-mRNA target.

[0075] The present invention also provides single-stranded antisense oligonucleotides for modulating an RNA target in a cell, wherein the antisense oligonucleotide comprises or consists of a continuous nucleotide sequence of 10-30 nucleotides in length, wherein the continuous nucleotide sequence comprises one or more 2'-sugar modified nucleosides, and wherein at least one of the internucleoside linkages present between the nucleosides of the continuous nucleotide sequence is a phosphorodithioate linkage of formula (IA) or (IB)

[0076]

[0077] One of the two oxygen atoms is linked to the 3'-carbon atom of an adjacent nucleoside (A1) and the other oxygen atom is linked to the 5'-carbon atom of another adjacent nucleoside (A2); and wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as a Na+ or K+ cation; or M+ is an ammonium cation, and wherein the single-stranded antisense oligonucleotide is used to inhibit the expression of a viral RNA target. Suitable viral RNA targets can be, for example, HCV or HBV.

[0078] The present invention also provides single-stranded antisense oligonucleotides for modulating an RNA target in a cell, wherein the antisense oligonucleotide comprises or consists of a continuous nucleotide sequence of 7–30 nucleotides in length, wherein the continuous nucleotide sequence comprises one or more 2'-sugar modified nucleosides, and wherein at least one of the internucleoside bonds present between the nucleosides of the continuous nucleotide sequence is a phosphorodithioate bond of formula (IA) or (IB).

[0079]

[0080] wherein one of the two oxygen atoms is linked to the 3'-carbon atom of the adjacent nucleoside (A1) and the other oxygen atom is linked to the 5'-carbon atom of the other adjacent nucleoside (A2); and wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as a Na+ or K+ cation; or M+ is an ammonium cation, and wherein the single-stranded antisense oligonucleotide is for inhibiting the expression of a microRNA.

[0081] For targeting an RNA target, such as a pre-mRNA target, an mRNA target, a viral RNA target, a microRNA or a long non-coding RNA target, the oligonucleotides of the present invention are suitably capable of inhibiting the expression of the target RNA. This is achieved by complementarity between the antisense oligonucleotide and the target RNA. Inhibition of the RNA target can be achieved by reducing the level of the RNA target or by blocking the function of the RNA target. RNA inhibition of the RNA target can suitably be achieved by recruiting a cellular ribonuclease, such as ribonuclease H (e.g., by using a gapmer), or can be achieved by a non-nuclease mediated mechanism, such as a steric hindrance mechanism (such as a steric hindrance mechanism for microRNA inhibition, for pre-mRNA splicing regulation, or for blocking the interaction between a long non-coding RNA and chromatin).

[0082] The present invention also relates to methods for manufacturing the oligonucleotides of the present invention and relates in particular to LNA or MOE nucleoside monomers which can be used for manufacturing the oligonucleotides of the present invention.

[0083] The present invention provides pharmaceutically acceptable salts of the oligonucleotides of the present invention, or conjugates thereof, in particular sodium salts, potassium salts or ammonium salts.

[0084] The present invention provides a conjugate comprising an oligonucleotide or a pharmaceutically acceptable salt thereof and at least one conjugate moiety covalently linked, optionally via a linker moiety, to the oligonucleotide or the pharmaceutically acceptable salt.

[0085] The present invention provides a pharmaceutical composition comprising an oligonucleotide, a pharmaceutically acceptable salt or a conjugate of the present invention and a therapeutically inert carrier.

[0086] The present invention provides for use of any oligonucleotide, pharmaceutically acceptable salt or conjugate of the present invention as a therapeutically active substance.

[0087] The present invention provides a method for modulating RNA in a cell expressing a target RNA, the method comprising the step of administering to the cell an effective amount of an oligonucleotide, pharmaceutically acceptable salt, conjugate or composition of the present invention, wherein the oligonucleotide is complementary to the target RNA.

[0088] The present invention provides a method for modulating splicing of a pre-RNA target in a cell expressing the pre-mRNA target, the method comprising the step of administering to the cell an effective amount of an oligonucleotide, pharmaceutically acceptable salt, conjugate or composition of the present invention, wherein the oligonucleotide is complementary to the target RNA and capable of modulating splicing events in the pre-mRNA.

[0089] The present invention provides for use of an oligonucleotide, pharmaceutical salt, conjugate or composition of the present invention to inhibit pre-mRNA, mRNA or long non-coding RNA in a cell (such as a human cell).

[0090] The above method or use can be an in vitro method or an in vivo method.

[0091] The present invention provides for use of an oligonucleotide, pharmaceutical salt, conjugate or composition of the present invention in the manufacture of a medicament.

[0092] The present invention provides for use of a phosphorothioate internucleoside bond of formula (IA) or (IB) for enhancing the in vitro or in vivo stability of a single-stranded phosphorothioate antisense oligonucleotide.

[0093] The present invention provides for use of a phosphorothioate internucleoside bond of formula (IA) or (IB) for enhancing the in vitro or in vivo duration of action of a single-stranded phosphorothioate antisense oligonucleotide.

[0094] The present invention provides for use of a phosphorothioate internucleoside bond of formula (IA) or (IB) for enhancing the cellular uptake or tissue distribution of a single-stranded phosphorothioate antisense oligonucleotide.

[0095] The present invention provides for use of a phosphorothioate internucleoside bond of formula (IA) or (IB) for enhancing the uptake of a single-stranded phosphorothioate antisense oligonucleotide into tissues selected from skeletal muscle, heart, epithelial cells including retinal epithelial cells (e.g., compounds targeting Htra1), liver, kidney or spleen.

[0096] For in vivo use, the single-stranded phosphorothioate antisense oligonucleotide can be a therapeutic oligonucleotide. Brief Description of the Drawings

[0098] Figures 1 - 4Shows the target mRNA levels in primary rat hepatocytes 24 hours and 74 hours after administration of the oligonucleotides of the present invention.

[0099] Figure 1 Shows the target mRNA levels in primary rat hepatocytes 24 hours and 74 hours after administration of an oligonucleotide gapmer having a single phosphorothioate internucleoside bond of the present invention in the gap.

[0100] Figure 2 Shows the target mRNA levels in primary rat hepatocytes 24 hours and 74 hours after administration of an oligonucleotide gapmer having multiple phosphorothioate internucleoside bonds of the present invention in the gap.

[0101] Figure 3 Shows the target mRNA levels in primary rat hepatocytes 24 hours and 74 hours after administration of an oligonucleotide gapmer having multiple phosphorothioate internucleoside bonds of the present invention in the gap.

[0102] Figure 4 Shows the target mRNA levels in primary rat hepatocytes 24 hours and 74 hours after administration of an oligonucleotide gapmer having phosphorothioate internucleoside bonds of the present invention in the flanks.

[0103] Figure 5 Shows the thermal melting (Tm) of an oligonucleotide containing a phosphorothioate internucleoside bond of the present invention that hybridizes to RNA and DNA.

[0104] Figure 6 Shows the stability of an oligonucleotide containing a phosphorothioate internucleoside bond of the present invention in rat serum.

[0105] Figure 7 : Explore the residual mRNA levels in primary rat hepatocytes after treatment with achiral phosphorothioates in the gap region and flanking regions of the gapmer.

[0106] Figure 8 : Explore the position dependence and optimization of achiral phosphorothioates in the gap region of the gapmer – residual mRNA levels after treatment of primary rat hepatocytes.

[0107] Figure 9A and Figure 9B : Explore the effect of achiral phosphorothioates in the gap region of the gapmer – on cellular uptake.

[0108] Figure 10A and Figure 10B : Introduction of achiral phosphorothioates in the flanking region of the gapmer provides increased potency, and the correlation between the phosphorothioate loading and the increased potency (4 bonds > 3 bonds > 2 bonds > 1 bond > no phosphorothioate bond in the flanks).

[0109] Figure 11 : IC in different cell types 50 value

[0110] Figure 12 : In vitro serum stability of 3'-end protected LNA oligonucleotides in rats

[0111] Figure 13 : In vivo evaluation of gapmers containing achiral phosphorothioate internucleotide linkages in flanking and gap regions - target inhibition

[0112] Figure 14A : In vivo evaluation of gapmers containing achiral phosphorothioate internucleotide linkages in flanking and gap regions - tissue uptake

[0113] Figure 14B : In vivo evaluation of gapmers containing achiral phosphorothioate internucleotide linkages in flanking and gap regions - liver / kidney ratio

[0114] Figure 15A and Figure 15B : In vivo evaluation of gapmers containing achiral phosphorothioate internucleotide linkages in flanking and gap regions - metabolite analysis

[0115] Figure 16 : The duration of action of antisense oligonucleotides containing achiral phosphorothioate internucleotide linkages can be further enhanced by combining with stereodefined phosphorothioate nucleoside internucleotide linkages

[0116] Figure 17A : In vitro EC of achiral phosphorothioate gapmers targeting MALAT-1 50 determination

[0117] Figure 17B : In vivo potency of achiral phosphorothioate gapmers targeting MALAT-1

[0118] Figure 17C : In vivo study of achiral phosphorothioate gapmers targeting MALAT-1 - tissue content

[0119] Figure 18A : In vitro study of achiral monophosphorothioate-modified gapmer oligonucleotides targeting ApoB. Activity data

[0120] Figure 18B : In vitro study of achiral monophosphorothioate-modified gapmer oligonucleotides targeting ApoB. Cell content data

[0121] Figure 19A: In vitro study of chiral dithiophosphate-modified gapmer oligonucleotides targeting ApoB. Activity data

[0122] Figure 19B : In vitro study of chiral dithiophosphate-modified gapmer oligonucleotides targeting ApoB. Cell content data.

[0123] Figure 20 : Effect of the achiral dithiophosphate (P2S) internucleoside bond present in a splicing-switching oligonucleotide targeting the 3' splice site of TNFRSF1B. Human Colo 205 cells were seeded in 96-well plates and treated with 5 μM (A) and 25 μM (B) oligomers, respectively. The percentage of exon 7 skipping was analyzed by droplet digital PCR using a probe targeting the exon 6-8 junction and compared to the total amount of TNFRSF1B by an assay targeting exons 2-3. SSO#26 is the parental oligomer and SSO#27 is a negative control that does not target TNFRSF1B.

[0124] Figure 21 : Stability assay using S1 nuclease. Oligomers containing dithioesters were incubated with S1 nuclease for 30 minutes and 120 minutes, respectively. Oligomers were visualized on a 15% TBE-urea gel. As a migration marker, intact oligomer (SSO#14) that did not undergo S1 nuclease treatment was included.

[0125] Definitions

[0126] In this specification, the term "alkyl", alone or in combination, refers to a straight-chain or branched-chain alkyl group having 1 to 8 carbon atoms, particularly a straight-chain or branched-chain alkyl group having 1 to 6 carbon atoms and more particularly a straight-chain or branched-chain alkyl group having 1 to 4 carbon atoms. Examples of straight-chain and branched-chain C1-C8 alkyl groups are methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tert-butyl, isopentyl, isohexyl, isoheptyl and isooctyl, specifically methyl, ethyl, propyl, butyl and pentyl. Specific examples of alkyl groups are methyl, ethyl and propyl.

[0127] The term "cycloalkyl", alone or in combination, refers to a cycloalkyl ring having 3 to 8 carbon atoms, particularly a cycloalkyl ring having 3 to 6 carbon atoms. Examples of cycloalkyl groups are cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and cyclooctyl, more specifically cyclopropyl and cyclobutyl. A specific example of "cycloalkyl" is cyclopropyl.

[0128] The term "alkoxy", alone or in combination, refers to a group of the formula alkyl-O-, where the term "alkyl" has the meaning given previously, such as methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, isobutoxy, sec-butoxy, and tert-butoxy. Specific "alkoxy" groups are methoxy and ethoxy. Methoxyethoxy is a specific example of an "alkoxyalkoxy".

[0129] The term "oxy", alone or in combination, refers to the -O- group.

[0130] The term "alkenyl", alone or in combination, refers to a straight-chain or branched hydrocarbon residue containing a carbon-carbon double bond and having up to 8, preferably up to 6, and particularly preferably up to 4 carbon atoms. Examples of alkenyl groups are vinyl, 1-propenyl, 2-propenyl, isopropenyl, 1-butenyl, 2-butenyl, 3-butenyl, and isobutenyl.

[0131] The term "alkynyl", alone or in combination, refers to a straight-chain or branched hydrocarbon residue containing a carbon-carbon triple bond and having up to 8, particularly 2 carbon atoms.

[0132] The term "halogen" or "halogens", alone or in combination, refers to fluorine, chlorine, bromine, or iodine, and specifically refers to fluorine, chlorine, or bromine, and more specifically fluorine. In combination with another group, the term "halogen" means that the group is substituted with at least one halogen, especially one to five halogens, specifically one to four halogens (i.e., one, two, three, or four halogens).

[0133] The term "haloalkyl", alone or in combination, refers to an alkyl group substituted with at least one halogen, especially one to five halogens, specifically one to three halogens. Examples of haloalkyl groups include monofluoro-, difluoro- or trifluoromethyl, ethyl or propyl, such as 3,3,3-trifluoropropyl, 2-difluoroethyl, 2,2,2-trifluoroethyl, fluoromethyl or trifluoromethyl. Fluoromethyl, difluoromethyl, and trifluoromethyl are specific "haloalkyl" groups.

[0134] The term "halocycloalkyl", alone or in combination, refers to a cycloalkyl group as defined above substituted with at least one halogen, especially one to five halogens, specifically one to three halogens. Specific examples of "halocycloalkyl" groups are halocyclopropyl, especially fluorocyclopropyl, difluorocyclopropyl, and trifluorocyclopropyl.

[0135] The terms "hydroxy" and "hydroxyl", alone or in combination, refer to the -OH group.

[0136] The terms "thiohydroxyl" and "mercapto", alone or in combination, refer to the -SH group.

[0137] The term "carbonyl", alone or in combination, refers to the -C(O)- group.

[0138] The term "carboxyl" or "carbox" alone or in combination refers to the -COOH group.

[0139] The term "amino" alone or in combination refers to a primary amino group (-NH2), a secondary amino group (-NH-), or a tertiary amino group (-N-).

[0140] The term "alkylamino" alone or in combination refers to an amino group as defined above substituted by one or two alkyl groups as defined above.

[0141] The term "sulfonyl" alone or in combination means the -SO2 group.

[0142] The term "sulfinyl" alone or in combination refers to the -SO- group.

[0143] The term "sulfanyl" alone or in combination refers to the -S- group.

[0144] The term "cyano" alone or in combination refers to the -CN group.

[0145] The term "azido" alone or in combination refers to the -N3 group.

[0146] The term "nitro" alone or in combination refers to the NO2 group.

[0147] The term "formyl" alone or in combination refers to the -C(O)H group.

[0148] The term "carbamoyl" alone or in combination refers to the -C(O)NH2 group.

[0149] The term "cabamido" alone or in combination refers to the -NH-C(O)-NH2 group.

[0150] The term "aryl" alone or in combination refers to a monovalent aromatic carbocyclic monocyclic or bicyclic system containing 6 to 10 carbon ring atoms, which system is optionally substituted by 1 to 3 substituents independently selected from: halogen, hydroxy, alkyl, alkenyl, alkynyl, alkoxy, alkoxyalkyl, alkenyloxy, carboxyl, alkoxycarbonyl, alkylcarbonyl, and formyl. Examples of aryl include phenyl and naphthyl, especially phenyl.

[0151] The term "heteroaryl", alone or in combination, refers to a monocyclic or bicyclic system of a monovalent aromatic heterocycle having 5 to 12 ring atoms, said system containing 1, 2, 3 or 4 heteroatoms selected from N, O and S, the remaining ring atoms being carbon, optionally substituted with 1 to 3 substituents independently selected from: halogen, hydroxy, alkyl, alkenyl, alkynyl, alkoxy, alkoxyalkyl, alkenyloxy, carboxy, alkoxycarbonyl, alkylcarbonyl and formyl. Examples of heteroaryl include pyrrolyl, furyl, thienyl, imidazolyl, oxazolyl, thiazolyl, triazolyl, oxadiazolyl, thiadiazolyl, tetrazolyl, pyridyl, pyrazinyl, pyrazolyl, pyridazinyl, pyrimidinyl, triazinyl, azepinyl, diazepinyl, isoxazolyl, benzofuryl, isothiazolyl, benzothienyl, indolyl, isoindolyl, isobenzofuryl, benzimidazolyl, benzoxazolyl, benzisoxazolyl, benzothiazolyl, benzisothiazolyl, benzoxadiazolyl, benzothiadiazolyl, benzotriazolyl, purinyl, quinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl, carbazolyl or acridinyl.

[0152] The term "heterocyclyl", alone or in combination, refers to a monocyclic or bicyclic system of a monovalent saturated or partially unsaturated heterocycle having 4 to 12, especially 4 to 9, ring atoms, said system containing 1, 2, 3 or 4 ring heteroatoms selected from N, O and S, the remaining ring atoms being carbon, optionally substituted with 1 to 3 substituents independently selected from: halogen, hydroxy, alkyl, alkenyl, alkynyl, alkoxy, alkoxyalkyl, alkenyloxy, carboxy, alkoxycarbonyl, alkylcarbonyl and formyl. Examples of monocyclic saturated heterocyclyl are azetidinyl, pyrrolidinyl, tetrahydrofuryl, tetrahydro-thienyl, pyrazolidinyl, imidazolidinyl, oxazolinyl, isoxazolidinyl, thiazolidinyl, piperidinyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperazinyl, morpholinyl, thiomorpholinyl, 1,1-dioxo-thiomorpholin-4-yl, azepanyl, diazepanyl, homopiperazinyl or oxazepanyl. Examples of bicyclic saturated heterocycloalkyl are 8-aza-bicyclo[3.2.1]octyl, quinuclidinyl, 8-oxa-3-aza-bicyclo[3.2.1]octyl, 9-aza-bicyclo[3.3.1]nonyl, 3-oxa-9-aza-bicyclo[3.3.1]nonyl or 3-thia-9-aza-bicyclo[3.3.1]nonyl. Examples of partially unsaturated heterocycloalkyl are dihydrofuryl, imidazolinyl, dihydrooxazolyl, tetrahydropyridyl or dihydropyranyl.

[0153] The term "pharmaceutically acceptable salt" refers to those salts that retain the biological effects and properties of the free base or free acid, which are not biologically adverse or detrimental. Salts are formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, especially hydrochloric acid, and organic acids such as acetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, salicylic acid, N-acetylcysteine. In addition, these salts can be prepared by adding an inorganic base or an organic base to the free acid. Salts derived from inorganic bases include, but are not limited to, sodium salts, potassium salts, lithium salts, ammonium salts, calcium salts, magnesium salts. Salts derived from organic bases include, but are not limited to, salts of primary amines, secondary amines and tertiary amines, substituted amines, said amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, such as isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, lysine, arginine, N-ethylpiperidine, piperidine, polyamine resins. The oligonucleotides of the present invention may also exist in the form of zwitterionic surfactants. Particularly preferred pharmaceutically acceptable salts of the present invention are sodium salts, lithium salts, potassium salts and trialkylammonium salts.

[0154] The term "protecting group", alone or in combination, refers to a group that selectively blocks reactive sites in a polyfunctional compound so that a chemical reaction can be selectively carried out at another unprotected reactive site. The protecting group can be removed. Exemplary protecting groups are amino protecting groups, carboxyl protecting groups or hydroxyl protecting groups.

[0155] A "phosphate protecting group" is a protecting group for a phosphate group. Examples of phosphate protecting groups are 2-cyanoethyl and methyl. A specific example of a phosphate protecting group is 2-cyanoethyl.

[0156] A "hydroxyl protecting group" is a protecting group for a hydroxyl group and is also used to protect a thiol group. Examples of hydroxyl protecting groups are acetyl (Ac), benzoyl (Bz), benzyl (Bn), β-methoxyethoxymethyl ether (MEM), dimethoxytrityl (or bis-(4-methoxyphenyl)phenylmethyl) (DMT), trimethoxytrityl (or tris-(4-methoxyphenyl)phenylmethyl) (TMT), methoxymethyl ether (MOM), methoxytrityl [(4-methoxyphenyl)diphenylmethyl (MMT), p-methoxybenzyl ether (PMB), methylthiomethyl ether, pivaloyl (Piv), tetrahydropyranyl (THP), tetrahydrofuran (THF), trityl or triphenylmethyl (Tr), silyl ethers (such as trimethylsilylimidazole (TMS), tert-butyldimethylsilyl (TBDMS), triisobutylsilyloxymethyl (TOM) and triisopropylsilyl (TIPS) ethers), methyl ether and ethoxyethyl ether (EE). Specific examples of hydroxyl protecting groups are DMT and TMT, especially DMT.

[0157] "Thiol protecting group" is a protecting group for thiol. Examples of thiol protecting groups are those groups that are "hydroxyl protecting groups".

[0158] If one of the starting materials or compounds of the present invention contains one or more functional groups that are unstable or reactive under the reaction conditions of one or more reaction steps, then by methods well known in the art, suitable protecting groups can be introduced before the critical step (as described, for example, in "Protective Groups in Organic Chemistry" by T.W. Greene and P.G.M. Wuts, 3rd Edition, 1999, Wiley, New York). Standard methods described in the literature can be used to remove such protecting groups late in the synthesis. Examples of protecting groups are tert-butoxycarbonyl (Boc), 9-fluorenylmethyl carbamate (Fmoc), 2-trimethylsilylethyl carbamate (Teoc), benzyloxycarbonyl (Cbz), and p-methoxybenzyloxycarbonyl (Moz).

[0159] The compounds described herein can contain several asymmetric centers and can exist in the form of optically pure enantiomers, mixtures of enantiomers (such as, for example, racemates), mixtures of diastereomers, diastereomeric racemates, or mixtures of diastereomeric racemates.

[0160] Oligonucleotide

[0161] As used herein, the term "oligonucleotide" is defined as a molecule that contains two or more covalently linked nucleosides, as is commonly understood by those skilled in the art. Such covalently bound nucleosides can also be referred to as nucleic acid molecules or oligomers. Oligonucleotides are often produced in the laboratory by solid-phase chemical synthesis and are subsequently purified. When referring to the sequence of an oligonucleotide, it refers to the sequence or order of nucleobase moieties or their modifications, covalently linked nucleotides, or nucleosides. The oligonucleotides of the present invention are artificial, chemically synthesized, and are generally purified or isolated. The oligonucleotides of the present invention can contain one or more modified nucleosides or nucleotides.

[0162] Antisense oligonucleotide

[0163] As used herein, the term "antisense oligonucleotide" is defined as an oligonucleotide capable of regulating the expression of a target gene by hybridizing to a target nucleic acid, particularly to a contiguous sequence on the target nucleic acid. Antisense oligonucleotides are generally not double-stranded and are thus not siRNA or shRNA. Preferably, the antisense oligonucleotides of the present invention are single-stranded. It is understood that the single-stranded oligonucleotides of the present invention can form hairpin or intermolecular duplex structures (duplexes between two identical oligonucleotides) provided that the degree of internal or intermolecular self-complementarity is less than 50% across the entire length of the oligonucleotide.

[0164] Regulation of expression

[0165] As used herein, the term "regulation of expression" is to be understood as an umbrella term for the ability of an oligonucleotide to alter the expression of a target nucleic acid or to alter its level. The regulation of expression can be determined by comparing the expression of the target nucleic acid or its level before administration of the oligonucleotide, or can be determined by reference to a control experiment in which the oligonucleotide of the invention is not administered. It is generally understood that the control is an individual or target cell treated with a saline composition or an individual or target cell treated with a non-targeting oligonucleotide (mimic).

[0166] One type of regulation is the ability of an oligonucleotide to inhibit, downregulate, reduce, repress, remove, stop, block, prevent, attenuate, lower, avoid or terminate the expression of a target nucleic acid, for example by degrading the target nucleic acid (e.g., by RNase H1-mediated degradation) or blocking transcription. Another type of regulation is the ability of an oligonucleotide to restore, increase or enhance the expression of a target RNA, for example by modulating splicing events on the target pre-mRNA or by blocking inhibitory mechanisms such as microRNA repression of mRNA.

[0167] Contiguous nucleotide sequence

[0168] The term "contiguous nucleotide sequence" refers to a region of an oligonucleotide that is complementary (e.g., fully complementary) to a target nucleic acid. This term is used interchangeably herein with the terms "contiguous nucleobase sequence" and "oligonucleotide motif sequence". In some embodiments, all of the nucleotides of the oligonucleotide constitute a contiguous nucleotide sequence. In some embodiments, the oligonucleotide comprises a contiguous nucleotide sequence, such as an F-G-F' gapmer region, and may optionally comprise additional nucleotides, such as a nucleotide linker region that can be used to conjugate a functional group to the contiguous nucleotide sequence, such as region D or D'. The nucleotide linker region may or may not be complementary to the target nucleic acid. Antisense oligonucleotide hybrids as referred to herein may comprise a contiguous nucleotide sequence or may consist thereof.

[0169] Nucleotide

[0170] A "nucleotide" is the structural unit of an oligonucleotide and a polynucleotide and for the purposes of the present invention includes both naturally occurring and non-naturally occurring nucleotides. In nature, nucleotides such as DNA and RNA nucleotides contain a ribose sugar moiety, a nucleobase moiety, and one or more phosphate ester groups (which are not present in nucleosides). Nucleosides and nucleotides may also be referred to interchangeably as "units" or "monomers".

[0171] Modified nucleoside

[0172] As used herein, the term "modified nucleoside" or "nucleoside modification" refers to a nucleoside modified by, for example, introduction of one or more sugar moieties or (nucleo)base moieties as compared to an equivalent DNA nucleoside or RNA nucleoside. In a preferred embodiment, the modified nucleoside comprises a modified sugar moiety. The term "modified nucleoside" may also be used interchangeably herein with the term "nucleoside analogue" or modified "unit" or modified "monomer". Nucleosides having an unmodified DNA or RNA sugar moiety are referred to herein as DNA nucleosides or RNA nucleosides. A nucleoside having a modification in the base region of a DNA nucleoside or RNA nucleoside is generally still referred to as DNA or RNA if Watson Crick base pairing is permitted.

[0173] Modified internucleoside bond

[0174] The term "modified internucleoside bond" is defined as is commonly understood by one of ordinary skill in the art to be a bond other than a phosphodiester (PO) bond that covalently links two nucleosides. The oligonucleotides of the present invention can thus comprise modified internucleoside bonds. In some embodiments, the modified internucleoside bond increases the nuclease resistance of the oligonucleotide as compared to a phosphodiester bond. For naturally occurring oligonucleotides, the internucleoside bond comprises a phosphate group that creates a phosphodiester bond between adjacent nucleosides. Modified internucleoside bonds can be particularly useful for stabilizing oligonucleotides for in vivo use and can protect against nuclease cleavage in regions of DNA nucleosides or RNA nucleosides in the oligonucleotides of the present invention (e.g., inside the gap region of a gapmer oligonucleotide) as well as in regions of modified nucleosides (such as, regions F and F').

[0175] In one embodiment, the oligonucleotide comprises one or more internucleoside bonds modified from a native phosphodiester, such as one or more modified internucleoside bonds that are, for example, more resistant to nuclease attack. Nuclease resistance can be determined by incubating the oligonucleotide in serum or by using a nuclease resistance assay (such as snake venom phosphodiesterase (SVPD)), both of which are well known in the art. An internucleoside bond of an oligonucleotide that enhances nuclease resistance is referred to as an anti-nuclease internucleoside bond. In some embodiments, at least 50% of the internucleoside bonds in the oligonucleotide or its contiguous nucleotide sequence are modified, such as at least 60%, such as at least 70%, such as at least 80 or such as at least 90% of the internucleoside bonds in the oligonucleotide or its contiguous nucleotide sequence are anti-nuclease internucleoside bonds. In some embodiments, all of the internucleoside bonds in the oligonucleotide or its contiguous nucleotide sequence are anti-nuclease internucleoside bonds. It will be appreciated that in some embodiments, the nucleosides to which the oligonucleotides of the present invention are linked to non-nucleotide functional groups such as conjugates can be phosphodiesters.

[0176] A preferred modified internucleoside bond for use in the oligonucleotides of the present invention is phosphorothioate.

[0177] Phosphorothioate internucleoside linkages are particularly useful due to nuclease resistance, beneficial pharmacokinetics, and ease of production. In some embodiments, at least 50% of the internucleoside linkages in an oligonucleotide or a contiguous nucleotide sequence thereof are phosphorothioates, such as at least 60%, such as at least 70%, such as at least 80% or such as at least 90% of the internucleoside linkages in the oligonucleotide or a contiguous nucleotide sequence thereof are phosphorothioates. In some embodiments, all internucleoside linkages in the oligonucleotide or a contiguous nucleotide sequence thereof, except for dithiophosphorothioate internucleoside linkages, are phosphorothioates. In some embodiments, in addition to dithiophosphorothioate linkages, the oligonucleotides of the invention further comprise phosphorothioate internucleoside linkages and at least one phosphodiester linkage, such as 2, 3, or 4 phosphodiester linkages. In a gapmer oligonucleotide, when present, the phosphodiester linkage is suitably not between contiguous DNA nucleosides in the gap region G.

[0178] Anti-nuclease linkages (such as phosphorothioate linkages) are particularly useful in oligonucleotide regions that are capable of recruiting nucleases when forming duplexes with a target nucleic acid (such as region G of a gapmer). However, phosphorothioate linkages can also be used in regions without nuclease recruitment and / or regions for enhancing affinity (such as regions F and F' of a gapmer). In some embodiments, a gapmer oligonucleotide can comprise one or more phosphodiester linkages in region F and / or region F' or in both regions F and F', wherein the internucleoside linkages in region G can be all phosphorothioates.

[0179] Advantageously, all internucleoside linkages in a contiguous nucleotide sequence of an oligonucleotide or all internucleoside linkages of an oligonucleotide are phosphorothioate linkages.

[0180] It is recognized that, as disclosed in EP 2 742 135, antisense oligonucleotides can comprise other internucleoside linkages (in addition to phosphodiesters and phosphorothioates), such as alkyl phosphonate internucleoside linkages / methyl phosphonate internucleoside linkages, which, according to EP 2 742 135, can be tolerated, for example, in a gap region that is not a DNA phosphorothioate.

[0181] Atactic phosphorothioate linkages

[0182] A phosphorothioate linkage is an internucleoside phosphate linkage in which one of the non-bridging oxygens has been replaced by sulfur. The replacement of one of the non-bridging oxygens by sulfur introduces a chiral center and thus, within a single phosphorothioate oligonucleotide, each phosphorothioate internucleoside linkage will be in the S(Sp) or R(Rp) stereoisomer. Such internucleoside linkages are referred to as "chiral internucleoside linkages". By comparison, phosphodiester internucleoside linkages are achiral because they have two non-terminal oxygen atoms.

[0183] The naming of the chirality of a stereocenter is determined according to the standard Cahn-Ingold-Prelog rules (CIP priority rules) first published in the following literature: Cahn, R.S.; Ingold, C.K.; Prelog, V. (1966) "Specification of Molecular Chirality" Angewandte Chemie International Edition 5(4): 385–415. doi:10.1002 / anie.196603851.

[0184] During standard oligonucleotide synthesis, the stereoselectivity of coupling and subsequent sulfurization is uncontrolled. For this reason, the stereochemistry of each phosphorothioate internucleoside bond is randomly Sp or Rp, and thus phosphorothioate oligonucleotides produced by conventional oligonucleotide synthesis methods can actually exist in up to 2 X different phosphorothioate diastereoisomers, where X is the number of phosphorothioate internucleoside bonds. Such oligonucleotides are referred to herein as stereorandom phosphorothioate oligonucleotides and do not contain any stereodefined internucleoside bonds. Stereorandom phosphorothioate oligonucleotides are thus mixtures of diastereoisomers derived from non-stereochemically defined synthesis. In this case, the mixture is defined as up to 2 X different phosphorothioate diastereoisomers.

[0185] Stereodefined internucleoside bonds

[0186] A stereodefined internucleoside bond is a chiral internucleoside bond that has an enantiomeric excess of one of its two diastereomeric forms, Rp or Sp.

[0187] It should be appreciated that stereoselective oligonucleotide synthesis methods used in the art generally provide at least about 90% or at least about 95% diastereoselectivity at each chiral internucleoside bond, and thus up to about 10%, such as about 5%, of the oligonucleotide molecules can have the alternative diastereomeric form.

[0188] In some embodiments, the diastereomeric ratio of each stereodefined chiral internucleoside bond is at least about 90:10. In some embodiments, the diastereomeric ratio of each chiral internucleoside bond is at least about 95:5.

[0189] A stereodefined phosphorothioate bond is a specific instance of a stereodefined internucleoside bond.

[0190] Stereodefined phosphorothioate bond

[0191] A stereodefined phosphorothioate bond is a phosphorothioate bond having an enantiomeric excess of one of its two diastereomeric forms, Rp or Sp.

[0192] The Rp and Sp configurations of the phosphorothioate internucleoside bond are shown below.

[0193]

[0194] Wherein the 3’R group represents the 3’ position adjacent to the nucleoside (5’ nucleoside), and the 5’R group represents the 5’ position adjacent to the nucleoside (3’ nucleoside).

[0195] Herein, the Rp internucleoside bond can also be denoted as srP, and the Sp internucleoside bond can be denoted as ssP.

[0196] In one specific embodiment, the diastereomeric ratio of each stereodefined phosphorothioate bond is at least about 90:10 or at least 95:5.

[0197] In some embodiments, the diastereomeric ratio of each stereodefined phosphorothioate bond is at least about 97:3. In some embodiments, the diastereomeric ratio of each stereodefined phosphorothioate bond is at least about 98:2. In some embodiments, the diastereomeric ratio of each stereodefined phosphorothioate bond is at least about 99:1.

[0198] In some embodiments, the stereodefined internucleoside bonds are in the same diastereomeric form (Rp or Sp) in at least 97%, such as at least 98%, such as at least 99%, or (substantially) all of the oligonucleotide molecules present in a population of oligonucleotide molecules.

[0199] The enantiomeric purity can be measured in a model system having only an achiral backbone (i.e., phosphodiester). The enantiomeric purity of each monomer can be measured by coupling a monomer having a stereodefined internucleoside bond to the following model system “5’t-po-t-po-t-po3’”, for example. The result of such measurement will then give 5’DMTr-t-srp-t-po-t-po-t-po 3’ or 5’DMTr-t-ssp-t-po-t-po-t-po 3’ that can be separated by HPLC. The enantiomeric purity is determined by integrating the UV signals from the two possible diastereoisomers and obtaining the ratio of these diastereoisomers (e.g., 98:2, 99:1 or >99:1).

[0200] It should be understood that the diastereomeric purity of a specific single diastereomer (a single oligonucleotide molecule defining configuration) will vary with the coupling selectivity of the stereocenters defined at each internucleoside position and the number of stereodefined internucleoside bonds to be introduced. By way of example, if the coupling selectivity at each position is 97%, the resulting purity of a stereodefined oligonucleotide having 15 stereodefined internucleoside bonds will be 0.97 15 , i.e., the desired diastereomer is 63% as compared to 37% of other diastereomers. The purity of the defined diastereomer can be improved after synthesis by purification (e.g., by HPLC such as ion exchange chromatography or reverse phase chromatography).

[0201] In some embodiments, a stereodefined oligonucleotide refers to an oligonucleotide population in which at least about 40% (such as at least about 50%) of the population belongs to the desired diastereomer.

[0202] In other words, in some embodiments, a stereodefined oligonucleotide refers to an oligonucleotide population in which at least about 40% (such as at least about 50%) of the population is composed of the desired (specific) stereodefined internucleoside bond motif (also referred to as a stereodefined motif).

[0203] For a stereodefined oligonucleotide containing atactic internucleoside stereocenters and stereodefined internucleoside chiral centers, the purity of the stereodefined oligonucleotide is determined by reference to the % of the oligonucleotide population retaining the desired stereodefined internucleoside bond motif, without considering atactic bonds in the calculation.

[0204] Nucleobase

[0205] The term "nucleobase" includes the purine moieties (e.g., adenine and guanine) and pyrimidine moieties (e.g., uracil, thymine, and cytosine) in nucleosides and nucleotides that form hydrogen bonds in nucleic acid hybridization. In the context of the present invention, the term "nucleobase" also encompasses modified nucleobases that may be different from naturally occurring nucleobases but are functional during nucleic acid hybridization. In such cases, "nucleobase" refers to naturally occurring nucleobases such as adenine, guanine, cytosine, thymidine, uracil, xanthine, and hypoxanthine, as well as non-naturally occurring variants. Such variants are described, for example, in Hirao et al. (2012) Accounts of Chemical Research Vol. 45, page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1.

[0206] In some embodiments, the nucleobase moiety is modified by changing a purine or pyrimidine to a modified purine or pyrimidine, such as a substituted purine or a substituted pyrimidine, such as a nucleobase selected from isocytosine, pseudoisocytosine, 5-methylcytosine, 5-thiazolylcytosine, 5-propynyl-cytosine, 5-propynyl-uracil, 5-bromouracil, 5-thiazolyluracil, 2-thiouracil, 2'-thiothymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine, and 2-chloro-6-aminopurine.

[0207] The nucleobase moiety may be indicated by the letter code of each corresponding nucleobase (e.g., A, T, G, C, or U), where each letter may optionally include a functionally equivalent modified nucleobase. For example, in the exemplified oligonucleotide, the nucleobase moiety is selected from A, T, G, C, and 5-methylcytosine. Optionally, for LNA gapmers, 5-methylcytosine LNA nucleosides may be used.

[0208] Modified oligonucleotide

[0209] The term "modified oligonucleotide" describes an oligonucleotide that includes one or more sugar-modified nucleosides and / or modified internucleoside linkages. The term chimeric "oligonucleotide" is a term that has been used in the literature to describe an oligonucleotide having modified nucleosides.

[0210] Defines stereoisomeric oligonucleotides

[0211] A stereoisomeric oligonucleotide is an oligonucleotide in which at least one of the internucleoside linkages is a stereoisomeric internucleoside linkage.

[0212] A stereoisomeric phosphorothioate oligonucleotide is an oligonucleotide in which at least one of the internucleoside linkages is a stereoisomeric phosphorothioate internucleoside linkage.

[0213] Complementarity

[0214] The term "complementarity" describes the Watson-Crick base pairing ability of nucleosides / nucleotides. Watson-Crick base pairs are guanine (G)-cytosine (C) and adenine (A)-thymine (T) / uracil (U). It should be understood that oligonucleotides can contain nucleosides with modified nucleobases, such as 5-methylcytosine is often used in place of cytosine, and thus the term "complementarity" encompasses Watson Crick base pairing between unmodified and modified nucleobases (see, for example, Hirao et al. (2012) Accounts of Chemical Research Vol. 45 p. 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1).

[0215] As used herein, the term "% complementary" refers to the proportion of such nucleotides within a continuous nucleotide sequence in a nucleic acid molecule (e.g., an oligonucleotide), where at a given position, the nucleotide is complementary (i.e., forms a Watson Crick base pair) to the continuous nucleotide sequence at the given position in a separate nucleic acid molecule (e.g., a target nucleic acid). This percentage is calculated by: (when aligning the target sequence 5'-3' and the oligonucleotide sequence 3'-5') counting the number of aligned bases that form pairs between the two sequences, dividing by the total number of nucleotides in the oligonucleotide and multiplying by 100. In such a comparison, unaligned (forming base pairs) nucleobases / nucleotides are called mismatches. Preferably, insertions and deletions are not allowed when calculating the % complementarity of a continuous nucleotide sequence.

[0216] The term "fully complementary" refers to 100% complementarity.

[0217] Identity

[0218] The term "identity" as used herein refers to the number of nucleotides in a continuous nucleotide sequence in a nucleic acid molecule (e.g., an oligonucleotide) as a percentage, where at a given position, the nucleotide is the same as the continuous nucleotide sequence at the given position in a separate nucleic acid molecule (e.g., a target nucleic acid) (i.e., in terms of its ability to form Watson Crick base pairs with complementary nucleosides). This percentage is calculated by: counting the number of identical aligned bases between the two sequences, dividing by the total number of nucleotides in the oligonucleotide and multiplying by 100. Percent identity = (matches x 100) / length of the aligned region. Preferably, insertions and deletions are not allowed when calculating the % complementarity of a continuous nucleotide sequence.

[0219] Hybridization

[0220] As used herein, the term "hybridized" or "hybridization" will be understood to mean that two nucleic acid strands (e.g., an oligonucleotide and a target nucleic acid) form hydrogen bonds between base pairs on opposing strands, thereby forming a duplex. The affinity of the binding interaction between the two nucleic acid strands is the strength of the hybridization. It is often described in terms of the melting temperature (T m ), which is defined as the temperature at which half of the oligonucleotides are duplexed with the target nucleic acid. Under physiological conditions, T m is not strictly proportional to the affinity (Mergny and Lacroix, 2003, Oligonucleotides 13:515–537). The standard state Gibbs free energy ΔG° is a more precise measure of the binding affinity and is related to the dissociation constant (K d ) of the reaction by ΔG° = -RTln(K d) related, where R is the gas constant and T is the absolute temperature. Thus, a very low ΔG° for the reaction between the oligonucleotide and the target nucleic acid reflects strong hybridization between the oligonucleotide and the target nucleic acid. ΔG° is the energy associated with a reaction where the water concentration is 1 M, the pH is 7, and the temperature is 37 °C. Hybridization of the oligonucleotide to the target nucleic acid is a spontaneous reaction and for a spontaneous reaction, ΔG° is less than zero. For example, ΔG° can be experimentally measured by using an isothermal titration calorimetry (ITC) method as described in Hansen et al., 1965, Chem. Comm. 36–38 and Holdgate et al., 2005, Drug Discov Today. One of ordinary skill in the art will know that commercial equipment is available for measuring ΔG°. ΔG can also be numerically estimated by using the nearest neighbor model as described in Santa Lucia, 1998, Proc Natl Acad Sci USA. 95:1460–1465 and appropriately using the thermodynamic parameters described in Sugimoto et al., 1995, Biochemistry 34:11211–11216 and McTigue et al., 2004, Biochemistry 43:5388–5405. To obtain the possibility of modulating its intended nucleic acid target by hybridization, the oligonucleotides of the present invention hybridize with the target nucleic acid with a ΔG° estimated value of less than -10 kcal for oligonucleotides of length 10 - 30 nucleotides. In some embodiments, the degree or strength of hybridization is measured in terms of the standard state Gibbs free energy ΔG°. The oligonucleotide can hybridize with the target nucleic acid with a ΔG° estimated value of less than 10 kcal, such as less than -15 kcal, such as less than -20 kcal, and such as less than -25 kcal for oligonucleotides of length 8 - 30 nucleotides. In some embodiments, the oligonucleotide hybridizes with the target nucleic acid with a ΔG° estimated value of -10 to -60 kcal, such as -12 to -40 kcal, such as -15 to -30 kcal, or -16 to -27 kcal, such as -18 to -25 kcal.

[0221] Sugar modification

[0222] When compared to the ribose sugar moiety present in DNA and RNA, the oligomers of the present invention can include one or more nucleosides having a modified sugar moiety (i.e., sugar moiety modification).

[0223] Numerous nucleosides having ribose sugar moiety modifications have been generated, mainly for the purpose of improving certain properties of oligonucleotides, such as affinity and / or nuclease resistance.

[0224] Such modifications include modifications where, for example, the ribose ring structure is modified by replacement with: a hexose ring (HNA) or a bicyclic ring (LNA) generally having a double-base bridge between C2 and C4 carbons on the ribose ring or a non-linked ribose ring generally lacking a bond between C2 carbon and C3 carbon (e.g., UNA). Other sugar-modified nucleosides include, for example, bicyclohexose nucleic acid (WO2011 / 017521) or tricyclic nucleic acid (WO 2013 / 154798). Modified nucleosides also include nucleosides where the sugar moiety is replaced by a non-sugar moiety, such as in the case of peptide nucleic acid (PNA) or morpholino nucleic acid.

[0225] Sugar modifications also include modifications made by changing a substituent on the ribose ring to a group other than hydrogen or the 2'-OH group naturally present in DNA nucleosides and RNA nucleosides. Substituents can be introduced, for example, at the 2', 3', 4' or 5' positions.

[0226] 2'-sugar modified nucleosides

[0227] 2'-sugar modified nucleosides are nucleosides that have a substituent other than H or –OH at the 2' position (2'-substituted nucleosides) or contain a 2'-linked double-base capable of forming a bridge between the 2' carbon and a second carbon in the ribose ring, such as LNA (2'-4'-double-base bridged) nucleosides.

[0228] In fact, most attention has been devoted to the development of 2'-substituted nucleosides and numerous 2'-substituted nucleosides have been found to have beneficial properties when incorporated into oligonucleotides. For example, 2'-modified sugars can provide enhanced binding affinity and / or increased nuclease resistance to oligonucleotides. Examples of 2'-substituted modified nucleosides are 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA and 2'-F-ANA nucleosides. Other examples can be found, for example, in Freier and Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213 and Deleavey and Damha, Chemistry and Biology 2012, 19, 937. Some 2'-substituted modified nucleosides are shown below.

[0229]

[0230] In relation to the present invention, 2'-substitution does not include 2'-bridged molecules such as LNA.

[0231] Locked nucleic acid nucleosides (LNA nucleosides)

[0232] “LNA nucleoside” is a 2'-modified nucleoside that contains a C2'-C4' bivalent (also referred to as a “2'-4' bridge”) connecting the ribose sugar ring of the nucleoside, and the bivalent restricts or locks the conformation of the ribose ring. These nucleosides are also referred to in the literature as bridged nucleic acids or bicyclic nucleic acids (BNA). For complementary RNA or DNA molecules, when incorporating LNA into oligonucleotides, locking the conformation of the ribose is associated with enhanced hybridization affinity (duplex stabilization). This can be routinely determined by measuring the melting temperature of the oligonucleotide / complementary duplex.

[0233] Non-limiting exemplary LNA nucleosides are disclosed in the following documents: WO 99 / 014226, WO 00 / 66604, WO 98 / 039352, WO 2004 / 046160, WO 00 / 047599, WO 2007 / 134181, WO 2010 / 077578, WO 2010 / 036698, WO 2007 / 090071, WO 2009 / 006478, WO 2011 / 156202, WO 2008 / 154401, WO 2009 / 067647, WO 2008 / 150729; Morita et al., Bioorganic & Med. Chem. Lett. 12, 73-76; Seth et al. J. Org. Chem. 2010, Vol 75(5) pp. 1569-81 and Mitsuoka et al., Nucleic Acids Research 2009, 37(4), 1225-1238.

[0234] The 2'-4' bridge contains 2 to 4 bridging atoms and particularly has the formula -X-Y-, where X is connected to C4' and Y is connected to C2'.

[0235] where

[0236] X is oxygen, sulfur, -CR a R b -, -C(R a )=C(R b )-, -C(=CR a R b )-, -C(R a )=N-, -Si(R a )2-, -SO2-, -NR a -; -O-NR a -, -NR a -O-, -C(=J)-, Se, -O-NR a -, -NR a -CR aR b -, -N(R a )-O- or -O-CR a R b -;

[0237] Y is oxygen, sulfur, -(CR a R b ) n -, -CR a R b -O-CR a R b -, -C(R a )=C(R b )-, -C(R a )=N-, -Si(R a )2-, -SO2-, -NR a -, -C(=J)-, Se, -O-NR a -, -NR a -CR a R b -, -N(R a )-O- or -O-CR a R b -;

[0238] provided that -X-Y- is not -O-O-, Si(R a )2-Si(R a )2-, -SO2-SO2-, -C(R a )=C(R b )-C(R a )=C(R b ), -C(R a )=N-C(R a )=N-, -C(R a )=N-C(R a )=C(R b ), -C(R a )=C(R b )-C(R a )=N- or -Se-Se-;

[0239] J is oxygen, sulfur, =CH2 or =N(R a );

[0240] R a and R bindependently selected from hydrogen, halogen, hydroxy, cyano, sulfhydryl, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, alkoxy, substituted alkoxy, alkoxyalkyl, alkenyloxy, carboxyl, alkoxycarbonyl, alkylcarbonyl, formyl, aryl, heterocyclic, amino, alkylamino, carbamoyl, alkylaminocarbonyl, aminoalkylaminocarbonyl, alkylaminoalkylaminocarbonyl, alkylcarbonylamino, ureido, alkanoyloxy, sulfonyl, alkylsulfonyloxy, nitro, azido, thiohydroxylsulfidealkylsulfanyl, aryloxycarbonyl, aryloxy, arylcarbonyl, heteroaryl, heteroaryloxycarbonyl, heteroaryloxy, heteroarylcarbonyl, -OC(=X a )R c 、-OC(=X a )NR c R d and-NR e C(=X a )NR c R d ;

[0241] or two R a and R b together form an optionally substituted methylene group;

[0242] or two R a and R b Together with the carbon atom to which they are attached, they form a cycloalkyl or halocycloalkyl group having only one carbon atom of -XY-;

[0243] wherein substituted alkyl, substituted alkenyl, substituted alkynyl, substituted alkoxy and substituted methylene are alkyl, alkenyl, alkynyl and methylene substituted with 1 to 3 substituents independently selected from halogen, hydroxy, alkyl, alkenyl, alkynyl, alkoxy, alkoxyalkyl, alkenyloxy, carboxyl, alkoxycarbonyl, alkylcarbonyl, formyl, heterocyclyl, aryl and heteroaryl;

[0244] X a is oxygen, sulfur or -NR c ;

[0245] R c , R d and R e are independently selected from hydrogen and alkyl; and

[0246] n is 1, 2, or 3.

[0247] In yet another embodiment of the present invention, X is oxygen, sulfur, -NR a -、-CR a R b -or-C(=CRa R b )-, specifically oxygen, sulfur, -NH-, -CH2- or -C(=CH2)-, more specifically oxygen.

[0248] In another specific embodiment of the present invention, Y is -CR a R b -, -CR a R b -CR a R b - or -CR a R b- CR a R b- CR a R b -, especially -CH2-CHCH3-, -CHCH3-CH2-, -CH2-CH2- or -CH2-CH2-CH2-.

[0249] In a specific embodiment of the present invention, -X-Y- is -O-(CR a R b ) n -, -S-CR a R b -, -N(R a )CR a R b -, -CR a R b -CR a R b -, -O-CR a R b -O-CR a R b -, -CR a R b -O-CR a R b -, -C(=CR a R b )-CR a R b -, -N(R a )CR a R b -, -O-N(R a )-CR a R b - or -N(R a )-O-CR a R b -.

[0250] In a specific embodiment of the present invention, R a and R bIndependently selected from hydrogen, halogen, hydroxyl, alkyl, and alkoxyalkyl, especially hydrogen, halogen, alkyl, and alkoxyalkyl.

[0251] In another embodiment of the present invention, R a and R b Independently selected from hydrogen, fluorine, hydroxyl, methyl, and -CH2-O-CH3, especially hydrogen, fluorine, methyl, and -CH2-O-CH3.

[0252] Advantageously, one of the Rs of -X-Y- a and R b is defined as above and the remaining ones are all hydrogen at the same time.

[0253] In yet another specific embodiment of the present invention, R a is hydrogen or alkyl, especially hydrogen or methyl.

[0254] In another specific embodiment of the present invention, R b is hydrogen or alkyl, especially hydrogen or methyl.

[0255] In a specific embodiment of the present invention, R a and R b One or both of them are hydrogen.

[0256] In a specific embodiment of the present invention, R a and R b Only one of them is hydrogen.

[0257] In a specific embodiment of the present invention, R a and R b One of them is methyl and the other is hydrogen.

[0258] In a specific embodiment of the present invention, R a and R b Are both methyl at the same time.

[0259] In a specific embodiment of the present invention, -X-Y- is -O-CH2-, -S-CH2-, -S-CH(CH3)-, -NH-CH2-, -O-CH2CH2-, -O-CH(CH2-O-CH3)-, -O-CH(CH2CH3)-, -O-CH(CH3)-, -O-CH 2- O-CH2-, -O-CH2-O-CH2-, -CH2-O-CH2-, -C(=CH2)CH2-, -C(=CH2)CH(CH3)-, -N(OCH3)CH2- or -N(CH3)CH2-;

[0260] In a specific embodiment of the present invention, -X-Y- is -O-CR aR b -, wherein R a and R b are independently selected from hydrogen, alkyl, and alkoxyalkyl, especially hydrogen, methyl, and -CH2-O-CH3.

[0261] In a specific embodiment, -X-Y- is -O-CH2- or -O-CH(CH3)-, especially -O-CH2-.

[0262] The 2'-4' bridge can be located below the plane of the ribose ring (β-D-configuration) or above the plane of the ring (α-L-configuration), as shown in formula (A) and formula (B), respectively.

[0263] The LNA nucleosides of the present invention especially belong to formula (B1) or (B2)

[0264]

[0265] wherein

[0266] W is oxygen, sulfur, -N(R a )-, or -CR a R b -, especially oxygen;

[0267] B is a nucleobase or a modified nucleobase;

[0268] Z is an internucleoside bond to an adjacent nucleoside or a 5'-terminal group;

[0269] Z* is an internucleoside bond to an adjacent nucleoside or a 3'-terminal group;

[0270] R 1 、R 2 、R 3 、R 5 and R 5* are independently selected from hydrogen, halogen, alkyl, haloalkyl, alkenyl, alkynyl, hydroxy, alkoxy, alkoxyalkyl, azido, alkenyloxy, carboxy, alkoxycarbonyl, alkylcarbonyl, formyl, and aryl; and

[0271] X, Y, R a and R b are as defined above.

[0272] In a specific embodiment, in the definition of -X-Y-, R a is hydrogen or alkyl, especially hydrogen or methyl. In another specific embodiment, in the definition of -X-Y-, R b is hydrogen or alkyl, especially hydrogen or methyl. In yet another specific embodiment, in the definition of -X-Y-, R a and R bOne or both of them are hydrogen. In a specific embodiment, in the definition of -X-Y-, R a and R b Only one of them is hydrogen. In a specific embodiment, in the definition of -X-Y-, R a and R b One of them is methyl and the other is hydrogen. In a specific embodiment, in the definition of -X-Y-, R a and R b Both are methyl at the same time.

[0273] In yet another specific embodiment, in the definition of X, R a is hydrogen or alkyl, especially hydrogen or methyl. In another specific embodiment, in the definition of X, R b is hydrogen or alkyl, especially hydrogen or methyl. In a specific embodiment, in the definition of X, R a and R b One or both of them are hydrogen. In a specific embodiment, in the definition of X, R a and R b Only one of them is hydrogen. In a specific embodiment, in the definition of X, R a and R b One of them is methyl and the other is hydrogen. In a specific embodiment, in the definition of X, R a and R b Both are methyl at the same time.

[0274] In yet another specific embodiment, in the definition of Y, R a is hydrogen or alkyl, especially hydrogen or methyl. In another specific embodiment, in the definition of Y, R b is hydrogen or alkyl, especially hydrogen or methyl. In a specific embodiment, in the definition of Y, R a and R b One or both of them are hydrogen. In a specific embodiment, in the definition of Y, R a and R b Only one of them is hydrogen. In a specific embodiment, in the definition of Y, R a and R b One of them is methyl and the other is hydrogen. In a specific embodiment, in the definition of Y, R a and R b Both are methyl at the same time.

[0275] In a specific embodiment of the present invention, R 1 、R 2 、R 3 、R 5 and R 5*Independently selected from hydrogen and alkyl, especially hydrogen and methyl.

[0276] In yet another specific advantageous embodiment of the present invention, R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen at the same time.

[0277] In another specific embodiment of the present invention, R 1 , R 2 , R 3 are all hydrogen at the same time, one of R 5 and R 5* is hydrogen and the other is as defined above, specifically alkyl, more specifically methyl.

[0278] In a specific embodiment of the present invention, R 5 and R 5* are independently selected from hydrogen, halogen, alkyl, alkoxyalkyl and azido, especially selected from hydrogen, fluorine, methyl, methoxyethyl and azido. In a specific advantageous embodiment of the present invention, one of R 5 and R 5* is hydrogen and the other is alkyl, especially methyl, halogen, especially fluorine, alkoxyalkyl, especially methoxyethyl or azido; or R 5 and R 5* are all hydrogen or halogen at the same time, especially all hydrogen or fluorine at the same time. In such specific embodiments, W can advantageously be oxygen, and -X-Y- is advantageously -O-CH2-.

[0279] In a specific embodiment of the present invention, -X-Y- is -O-CH2-, W is oxygen and R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen at the same time. Such LNA nucleosides are disclosed in WO 99 / 014226, WO 00 / 66604, WO 98 / 039352 and WO2004 / 046160, all of which are hereby incorporated by reference herein and include β-D-oxy LNA nucleosides and α-L-oxy LNA nucleosides commonly known in the art.

[0280] In another specific embodiment of the present invention, -X-Y- is -S-CH2-, W is oxygen and R 1 , R 2 , R 3 , R 5 and R 5*At the same time, they are all hydrogen. Such thio-LNA nucleosides are disclosed in WO 99 / 014226 and WO 2004 / 046160, which are hereby incorporated by reference herein.

[0281] In another specific embodiment of the present invention, -X-Y- is -NH-CH2-, W is oxygen and R 1 、R 2 、R 3 、R 5 and R 5* are all hydrogen at the same time. Such amino-LNA nucleosides are disclosed in WO 99 / 014226 and WO 2004 / 046160, which are hereby incorporated by reference herein.

[0282] In another specific embodiment of the present invention, -X-Y- is -O-CH2CH2- or -OCH2CH2CH2-, W is oxygen, and R 1 、R 2 、R 3 、R 5 and R 5* are all hydrogen at the same time. Such LNA nucleosides are disclosed in WO 00 / 047599 and Morita et al., Bioorganic & Med. Chem. Lett. 12, 73-76, which are hereby incorporated by reference herein and include 2'-O-4'C-ethylene-bridged nucleic acids (ENA) commonly known in the art.

[0283] In another specific embodiment of the present invention, -X-Y- is -O-CH2-, W is oxygen, R 1 、R 2 、R3 are all hydrogen at the same time, one of R 5 and R 5* is hydrogen and the other is not hydrogen, such as an alkyl group, for example, a methyl group. Such 5'-substituted LNA nucleosides are disclosed in WO 2007 / 134181, which is hereby incorporated by reference herein.

[0284] In another specific embodiment of the present invention, -X-Y- is -O-CR a R b -, where one or both of R a and R b are not hydrogen, especially an alkyl group, for example, a methyl group, W is oxygen, R 1 、R 2 、R3 are all hydrogen at the same time, R 5 and R 5*One of them is hydrogen and the other is not hydrogen, especially an alkyl group, such as a methyl group. Such doubly modified LNA nucleosides are disclosed in WO 2010 / 077578, which is hereby incorporated by reference in its entirety.

[0285] In another specific embodiment of the present invention, -X-Y- is -O-CHR a -, W is oxygen and R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen at the same time. Such 6'-substituted LNA nucleosides are disclosed in WO 2010 / 036698 and WO 2007 / 090071, which are hereby incorporated by reference in their entirety. In such 6'-substituted LNA nucleosides, R a is especially a C1-C6 alkyl group, such as a methyl group.

[0286] In another specific embodiment of the present invention, -X-Y- is -O-CH(CH2-O-CH3)- ("2'-O-methoxyethyl bicyclic nucleic acid", Seth et al. J. Org. Chem. 2010, Vol 75(5) pp. 1569-81).

[0287] In another specific embodiment of the present invention, -X-Y- is -O-CH(CH2CH3)-;

[0288] In another specific embodiment of the present invention, -X-Y- is -O-CH(CH2-O-CH3)-, W is oxygen and R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen at the same time. In the art, such LNA nucleosides are also called cyclic MOE (cMOE) and are disclosed in WO 2007 / 090071.

[0289] In another specific embodiment of the present invention, -X-Y- is -O-CH(CH3)- ("2'-O-ethyl bicyclic nucleic acid", Seth et al. J. Org. Chem. 2010, Vol 75(5) pp. 1569-81).

[0290] In another specific embodiment of the present invention, -X-Y- is -O-CH 2- O-CH2- (Seth et al. J. Org. Chem. 2010, ibid.).

[0291] In another specific embodiment of the present invention, -X-Y- is -O-CH(CH3)-, W is oxygen and R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen at the same time. Such 6'-methyl LNA nucleosides are also referred to as cET nucleosides in the art and can be (S)-cET or (R)-cET diastereoisomers, as disclosed in WO 2007 / 090071 (β-D) and WO 2010 / 036698 (α-L), both of which are hereby incorporated by reference herein.

[0292] In another specific embodiment of the present invention, -X-Y- is -O-CR a R b ]-, where R a and R b are not hydrogen, W is oxygen and R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen at the same time. In a specific embodiment, R a and R b are both alkyl groups at the same time, especially both methyl groups at the same time. Such 6'-disubstituted LNA nucleosides are disclosed in WO 2009 / 006478, which is hereby incorporated by reference herein.

[0293] In another specific embodiment of the present invention, -X-Y- is -S-CHR a -, W is oxygen and R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen at the same time. Such 6'-substituted thio-LNA nucleosides are disclosed in WO 2011 / 156202, which is hereby incorporated by reference herein. In a specific embodiment of such 6'-substituted thio-LNA, R a is an alkyl group, especially methyl.

[0294] In a specific embodiment of the present invention, -X-Y- is -C(=CH2)C(R a R b )-, -C(=CHF)C(R a R b )- or -C(=CF2)C(R a R b )-, W is oxygen and R 1, R 2 , R 3 , R 5 and R 5* are all hydrogen at the same time. R a and R b are advantageously independently selected from hydrogen, halogen, alkyl and alkoxyalkyl, especially hydrogen, methyl, fluorine and methoxymethyl. R a and R b are especially all hydrogen or methyl at the same time or one of R a and R b is hydrogen and the other is methyl. Such vinyl carbon LNA nucleosides are disclosed in WO 2008 / 154401 and WO 2009 / 067647, which are hereby incorporated by reference in their entirety.

[0295] In a specific embodiment of the present invention, -X-Y- is -N(OR a ), -CH2-, W is oxygen and R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen at the same time. In a specific embodiment, R a is an alkyl group such as methyl. Such LNA nucleosides are also referred to as N-substituted LNA and are disclosed in WO 2008 / 150729, which is hereby incorporated by reference in its entirety.

[0296] In a specific embodiment of the present invention, -X-Y- is -O-N(R a ), -N(R a ), -O-, -NR a -CR a R b -CR a R b - or -NR a -CR a R b -, W is oxygen and R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen at the same time. R a and R b are advantageously independently selected from hydrogen, halogen, alkyl and alkoxyalkyl, especially hydrogen, methyl, fluorine and methoxymethyl. In a specific embodiment, R a is an alkyl group, such as methyl, R b is hydrogen or methyl, especially hydrogen. (Seth et al., J. Org. Chem 2010, ibid.).

[0297] In one specific embodiment of the present invention, -X-Y- is -O-N(CH3)- (Seth et al., J. Org. Chem 2010, ibid.).

[0298] In one specific embodiment of the present invention, R 5 and R 5* are both hydrogen at the same time. In another specific embodiment of the present invention, one of R 5 and R 5* is hydrogen and the other is an alkyl group, such as methyl. In such embodiments, R 1 , R 2 and R 3 can particularly be hydrogen and -X-Y- can particularly be -O-CH2- or -O-CHC(R a )3-, such as -O-CH(CH3)-.

[0299] In one specific embodiment of the present invention, -X-Y- is -CR a R b -O-CR a R b -, such as -CH2-O-CH2-, W is oxygen and R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen at the same time. In such specific embodiments, R a can particularly be an alkyl group such as methyl, R b can particularly be hydrogen or methyl, particularly hydrogen. Such LNA nucleotides are also referred to as conformationally restricted nucleotides (CRNs) and are disclosed in WO2013 / 036868, which is hereby incorporated by reference in its entirety.

[0300] In one specific embodiment of the present invention, -X-Y- is -O-CR a R b -O-CR a R b -, such as -O-CH2-O-CH2-, W is oxygen and R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen at the same time. R a and R b are advantageously independently selected from hydrogen, halogen, alkyl and alkoxyalkyl, particularly hydrogen, methyl, fluorine and methoxymethyl. In such a specific embodiment, R a can particularly be an alkyl group such as methyl, R bParticularly, it may be hydrogen or methyl, particularly hydrogen. Such LNA nucleosides are also referred to as COC nucleotides and are disclosed in Mitsuok et al., Nucleic Acids Research 2009, 37(4), 1225 - 1238, which is hereby incorporated by reference in its entirety.

[0301] It will be appreciated that, unless otherwise specified, LNA nucleosides can be in the β - D or α - L stereoisomers.

[0302] Specific examples of the LNA nucleosides of the present invention are shown in Scheme 1 (where B is defined as above).

[0303] Scheme 1

[0304]

[0305]

[0306]

[0307] Specific LNA nucleosides are β - D - oxy - LNA, 6’ - methyl - β - D - oxy LNA such as (S) - 6’ - methyl - β - D - oxy - LNA ((S) - cET) and ENA.

[0308] MOE nucleoside

[0309] The term "MOE" stands for "methoxy - ethyl" and, by abbreviation, refers to a nucleoside substituted at the 2’ position with a methoxy - ethoxy group as represented below.

[0310]

[0311] The above nucleosides can thus be named "MOE" or "2’ - O - MOE nucleoside".

[0312] RNase H activity and recruitment

[0313] The RNase H activity of an antisense oligonucleotide refers to its ability to recruit RNase H when forming a duplex with a complementary RNA molecule. WO01 / 23613 provides an in vitro method for determining RNase H activity, and this method can be used to determine the ability to recruit RNase H. An oligonucleotide is generally considered to be able to recruit RNase H if the following occurs: when a complementary target nucleic acid sequence is provided, it has such an initial rate measured in pmol / l / minute, and the initial rate is at least 5%, such as at least 10% or more than 20% of the initial rate determined using the following oligonucleotide and the method provided in Examples 91-95 of WO01 / 23613 (this document is hereby incorporated by reference in its entirety), where the oligonucleotide has the same base sequence as the test modified oligonucleotide but contains only DNA monomers, and all monomers of the oligonucleotide are phosphorothioate bonds. For use in determining RHase H activity, recombinant human RNase H1 is available from Lubio Science GmbH, Switzerland.

[0314] Gapmer

[0315] The antisense oligonucleotide of the present invention or its continuous nucleotide sequence can be a gapmer. Antisense gapmers are often used to inhibit target nucleic acids by RNase H-mediated degradation. A gapmer oligonucleotide contains at least three distinct structural regions in the '5->3' orientation: a 5'-flank, a gap, and a 3'-flank, designated as F-G-F'. The "gap" region (G) contains a continuous DNA nucleotide that enables the oligonucleotide to recruit RNase H. Flanking the gap region are a 5'-flank region (F) containing one or more sugar-modified nucleosides, advantageously sugar-modified high-affinity nucleosides, and a 3'-flank region (F') containing one or more sugar-modified nucleosides, advantageously sugar-modified high-affinity nucleosides. One or more sugar-modified nucleosides in regions F and F' enhance the affinity of the oligonucleotide for the target nucleic acid (i.e., are sugar-modified nucleosides that enhance affinity). In some embodiments, one or more sugar-modified nucleosides in regions F and F' are 2'-sugar-modified nucleosides independently selected from LNA and 2'-MOE, such as high-affinity 2'-sugar modifications.

[0316] In the gapmer layout, the 5' and 3' terminal nucleosides of the gap region are DNA nucleosides, and sugar-modified nucleosides are present adjacent to the 5' (F) region or the 3' (F') region, respectively. These flanking regions can be further defined by having at least one sugar-modified nucleoside at the end farthest from the gap region (i.e., at the 5' end of the 5'-flank region and at the 3' end of the 3'-flank region).

[0317] The region F-G-F' forms a continuous nucleotide sequence. The antisense oligonucleotide of the present invention or its continuous nucleotide sequence can contain a gapmer region of the formula F-G-F'.

[0318] The overall length of the nicked polymer layout F-G-F' can be, for example, 12 to 32 nucleotides, such as 13 to 24, such as 14 to 22 nucleotides, such as 14 to 17, such as 16 to 18 nucleotides.

[0319] By way of example, the nicked polymer oligonucleotides of the present invention can be represented by the following formula:

[0320] F 1-8 -G 5-16 -F’ 1-8 , such as

[0321] F 1-8 -G 7-16 -F’ 2-8

[0322] provided that the overall length of the nicked polymer region F-G-F' is at least 12, such as at least 14 nucleotide lengths.

[0323] Regions F, G, and F' are further defined below and can be incorporated into the F-G-F' formula.

[0324] Nicked polymer - region G

[0325] The region G (nick region) of the nicked polymer is the nucleotide region that enables the oligonucleotide to recruit RNase H, such as human RNase H1, and is generally DNA nucleotides. RNase H is a cellular enzyme that recognizes the duplex between DNA and RNA and enzymatically cleaves the RNA molecule. Suitable nicked polymers can have a nick region (G) of at least 5 or 6 consecutive DNA nucleotides, such as 5–16 consecutive DNA nucleotides, such as 6–15 consecutive DNA nucleotides, such as 7-14 consecutive DNA nucleotides, such as 8–12 consecutive DNA nucleotides, such as 8–12 consecutive DNA nucleotides. In some embodiments, the nick region G can consist of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive DNA nucleotides. In some cases, the cytosine (C) DNA in the nick region can be methylated, and such residues are annotated as 5-methyl-cytosine ( me C or having e in place of c). If a CG dinucleotide is present in the nick, methylation of the cytosine DNA in the nick helps to reduce potential toxicity, and this modification has no significant effect on the efficacy of the oligonucleotide.

[0326] In some embodiments, the nick region G can consist of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive phosphorothioate-linked DNA nucleotides. In some embodiments, all internucleoside bonds in the nick are phosphorothioate bonds.

[0327] Although conventional nicked polymers have DNA nicked regions, there are numerous instances of modified nucleosides that, when present within the nicked region, permit recruitment of RNase H. Modified nucleosides that have been reported to be capable of recruiting RNase H when incorporated within the nicked region include, for example, α-L-LNA, C4’-alkylated DNA (as described in PCT / EP2009 / 050349 and Vester et al., Bioorg. Med. Chem. Lett. 18 (2008) 2296–2300, both of which are incorporated herein by reference), arabinose-derived nucleosides such as ANA and 2'F-ANA (Mangosr et al. 2003 J. AM. CHEM. SOC. 125, 654-661), and UNA (unlocked nucleic acid) (as described in Fluiter et al., Mol. Biosyst., 2009, 10, 1039, which is incorporated herein by reference). UNA is an unlocked nucleic acid in which generally the bond between C2 and C3 of the ribose has been removed to form an unlocked “sugar” residue. The modified nucleosides used in such nicked polymers can be nucleosides that adopt a 2’-endo (DNA-like) conformation when introduced into the nicked region, i.e., nucleosides that permit recruitment of RNase H. In some embodiments, the DNA nicked region (G) described herein can optionally contain 1 to 3 sugar-modified nucleosides that adopt a 2’-endo (DNA-like) conformation when introduced into the nicked region.

[0328] Region G - “Gap-breaker”

[0329] Alternatively, there are numerous reports of inserting modified nucleosides that confer a 3'-endo conformation into the gap region of a gapped polymer while retaining some RNase H activity. Such gapped polymers with the following-described gap regions are referred to as "gap-breaker" or "gap-disrupted" gapped polymers, the gap regions of which contain one or more 3'-endo modified nucleosides, see, for example, WO2013 / 022984. Gap-breaker oligonucleotides retain a sufficient region of DNA nucleosides within the gap region to allow recruitment of RNase H. The ability of gap-breaker oligonucleotides to recruit RNase H generally has sequence specificity or even compound specificity - see Rukov et al., 2015 Nucl. Acids Res. Vol. 43 pp. 8476-8487, which discloses "gap-breaker" oligonucleotides that recruit RNase H and provide more specific cleavage of target RNA in some cases. Modified nucleosides within the gap region of gap-breaker oligonucleotides can be, for example, modified nucleosides that confer a 3'-endo conformation, such as 2'-O-methyl (OMe) or 2'-O-MOE (MOE) nucleosides, or β-D LNA nucleosides (the bridge between C2' and C4' of the ribose sugar ring of the nucleoside is in the β conformation), such as β-D-oxy-LNA or ScET nucleosides.

[0330] Like the gapped polymers containing the above-described region G, the gap regions of gap-breaker gapped polymers or gap-disrupted gapped polymers have DNA nucleosides at the 5'-end of the gap (adjacent to the 3'-nucleoside of region F) and DNA nucleosides at the 3'-end of the gap (adjacent to the 5'-nucleoside of region F'). Gapped polymers containing disrupted gaps generally retain a region of at least 3 or 4 consecutive DNA nucleosides at the 5'-end or 3'-end of the gap region.

[0331] Exemplary layouts of gap-breaker oligonucleotides include

[0332] F 1-8 -[D 3-4 -E1-D 3-4 -F’ 1-8

[0333] F 1-8 -[D 1-4 -E1-D 3-4 -F’ 1-8

[0334] F 1-8 -[D 3-4 -E1-D 1-4 -F’ 1-8

[0335] where region G is within the brackets [D n -Er -D m within the range, D is a continuous DNA nucleoside sequence, E is a modified nucleoside (a nick breaker or a nick-hindering nucleoside), and F and F’ are flanking regions as defined herein, provided that the overall length of the nicked polymer region F-G-F’ is at least 12, such as at least 14 nucleotide lengths.

[0336] In some embodiments, the region G of the nick-hindering nicked polymer comprises at least 6 DNA nucleosides, such as 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 DNA nucleosides. As described above, the DNA nucleosides can be continuous or can optionally be interspersed with one or more modified nucleosides, provided that the nick region G is capable of mediating RNase H recruitment.

[0337] Nicked polymer - flanking regions, F and F’

[0338] Region F is present adjacent to the 5’ DNA nucleoside of region G. The 3’ most terminal nucleoside of region F is a sugar-modified nucleoside, such as a sugar-modified high-affinity nucleoside, for example a 2’-substituted nucleoside, such as a MOE nucleoside, or a LNA nucleoside.

[0339] Region F’ is present adjacent to the 3’ DNA nucleoside of region G. The 5’ most terminal nucleoside of region F’ is a sugar-modified nucleoside, such as a sugar-modified high-affinity nucleoside, for example a 2’-substituted nucleoside, such as a MOE nucleoside, or a LNA nucleoside.

[0340] Region F has a length of 1 - 8 consecutive nucleotides, such as 2 - 6, such as 3 - 4 consecutive nucleotide lengths. Advantageously, the 5’ most terminal nucleoside of region F’ is a sugar-modified nucleoside. In some embodiments, the two 5’ most terminal nucleosides of region F are sugar-modified nucleosides. In some embodiments, the 5’ most terminal nucleoside of region F is a LNA nucleoside. In some embodiments, the two 5’ most terminal nucleosides of region F are LNA nucleosides. In some embodiments, the two 5’ most terminal nucleosides of region F are 2’-substituted nucleosides, such as two 3’ MOE nucleosides. In some embodiments, the 5’ most terminal nucleoside of region F is a 2’-substituted nucleoside, such as a MOE nucleoside.

[0341] Region F’ has a length of 2 - 8 consecutive nucleotides, such as 3 - 6, such as 4 - 5 consecutive nucleotides. Advantageously, in some embodiments, the 3'-terminal nucleoside of region F’ is a sugar-modified nucleoside. In some embodiments, the two 3'-terminal nucleosides of region F’ are sugar-modified nucleosides. In some embodiments, the two 3'-terminal nucleosides of region F’ are LNA nucleosides. In some embodiments, the 3'-terminal nucleoside of region F’ is an LNA nucleoside. In some embodiments, the two 3'-terminal nucleosides of region F’ are 2'-substituted nucleosides, such as two 3'-MOE nucleosides. In some embodiments, the 3'-terminal nucleoside of region F’ is a 2'-substituted nucleoside, such as a MOE nucleoside.

[0342] It should be noted that when the length of region F and / or region F’ is one, it is advantageously an LNA nucleoside.

[0343] In some embodiments, region F and region F’ independently consist of or comprise a continuous sequence of sugar-modified nucleosides. In some embodiments, the sugar-modified nucleosides of region F can independently be selected from 2'-O-alkyl-RNA units, 2'-O-methyl-RNA, 2'-amino-DNA units, 2'-fluoro-DNA units, 2'-alkoxy-RNA, MOE units, LNA units, arabinonucleic acid (ANA) units, and 2'-fluoro-ANA units.

[0344] In some embodiments, region F and region F’ independently comprise LNA and 2'-substituted modified nucleosides (hybrid flanking layout).

[0345] In some embodiments, region F and region F’ consist of only one type of sugar-modified nucleoside (such as only MOE or only β-D-oxy-LNA or only ScET). Such a design is also referred to as a uniform flanking design or a uniform gapmer design.

[0346] In some embodiments, all the nucleosides of region F or region F’ or F and F’ are LNA nucleosides, such as independently selected from β-D-oxy-LNA, ENA, or ScET nucleosides. In some embodiments, region F consists of 1 - 5, such as 2 - 4, such as 3 - 4, such as 1, 2, 3, 4, or 5 consecutive LNA nucleosides. In some embodiments, all the nucleosides of region F and region F’ are β-D-oxy-LNA nucleosides.

[0347] In some embodiments, all of the nucleosides in region F or region F' or both F and F' are 2'-substituted nucleosides, such as OMe or MOE nucleosides. In some embodiments, region F consists of 1, 2, 3, 4, 5, 6, 7, or 8 consecutive OMe or MOE nucleosides. In some embodiments, only one of the flanking regions may consist of 2'-substituted nucleosides (such as OMe or MOE nucleosides). In some embodiments, it is the 5' (F) flanking region that consists of 2'-substituted nucleosides (such as OMe or MOE nucleosides), while the 3' (F') flanking region contains at least one LNA nucleoside, such as β-D-oxy-LNA nucleoside or cET nucleoside. In some embodiments, it is the 3' (F') flanking region that consists of 2'-substituted nucleosides (such as OMe or MOE nucleosides), while the 5' (F) flanking region contains at least one LNA nucleoside, such as β-D-oxy-LNA nucleoside or cET nucleoside.

[0348] In some embodiments, all of the modified nucleosides in regions F and F' are LNA nucleosides, such as independently selected from β-D-oxy-LNA, ENA, or ScET nucleosides, where region F or region F' or both F and F' may optionally contain DNA nucleosides (alternating flanks, see the definition of these regions for more details). In some embodiments, all of the modified nucleosides in regions F and F' are β-D-oxy-LNA nucleosides, where region F or region F' or both F and F' may optionally contain DNA nucleosides (alternating flanks, see the definition of these regions for more details).

[0349] In some embodiments, the 5'-terminal and 3'-terminal nucleosides of regions F and F' are LNA nucleosides, such as β-D-oxy-LNA nucleosides or ScET nucleosides.

[0350] In some embodiments, the internucleoside bond between region F and region G is a phosphorothioate internucleoside bond. In some embodiments, the internucleoside bond between region F' and region G is a phosphorothioate internucleoside bond. In some embodiments, the internucleoside bond between the nucleosides in region F or region F' or both F and F' is a phosphorothioate internucleoside bond.

[0351] Other gapmer designs are disclosed in WO 2004 / 046160, WO 2007 / 146511, and WO 2008 / 113832, which are hereby incorporated by reference in their entirety.

[0352] LNA Gapmer

[0353] An LNA gapmer is a gapmer in which either or both of region F and region F' contain or consist of LNA nucleosides. A β-D-oxy gapmer is a gapmer in which either or both of region F and region F' contain or consist of β-D-oxy LNA nucleosides.

[0354] In some embodiments, the LNA gapmer has the formula: [LNA] 1–5 -[region G]-[LNA] 1-5 , where region G is defined as in the definition of the gapmer region G.

[0355] MOE gapmer

[0356] A MOE gapmer is a gapmer in which region F and region F' consist of MOE nucleosides. In some embodiments, the MOE gapmer has the following layout: [MOE] 1-8 -[region G]-[MOE] 1-8 , as in [MOE] 2-7 -[region G] 5-16 -[MOE] 2-7 , as in [MOE] 3-6 -[region G]-[MOE] 3-6 , where region G is defined as in the gapmer definition. MOE gapmers with a 5-10-5 layout (MOE-DNA-MOE) have been widely used in the art.

[0357] Hybrid flanking gapmer

[0358] A hybrid flanking gapmer is an LNA gapmer in which one or both of region F and region F' contain 2'-substituted nucleosides, such as 2'-substituted nucleosides independently selected from: 2'-O-alkyl-RNA units, 2'-O-methyl-RNA, 2'-amino-DNA units, 2'-fluoro-DNA units, 2'-alkoxy-RNA, MOE units, arabinonucleic acid (ANA) units, and 2'-fluoro-ANA units, such as MOE nucleosides. In some embodiments where at least one of region F and region F' or both of region F and region F' contain at least one LNA nucleoside, the remaining nucleosides of region F and region F' are independently selected from MOE and LNA. In some embodiments where at least one of region F and region F' or both of region F and region F' contain at least two LNA nucleosides, the remaining nucleosides of region F and region F' are independently selected from MOE and LNA. In some hybrid flanking embodiments, one or both of region F and region F' may further contain one or more DNA nucleosides.

[0359] Hybrid flanking gapmer layouts are disclosed in WO 2008 / 049085 and WO 2012 / 109395, which are hereby incorporated by reference in their entireties.

[0360] Alternating flanking gapmer

[0361] The flanking region can contain both LNA nucleotides and DNA nucleotides and is referred to as "alternating flanks" because they contain an alternating motif of LNA-DNA-LNA nucleotides. A gapmer containing such alternating flanks is referred to as an "alternating flanking gapmer". An "alternating flanking gapmer" is thus an LNA gapmer oligonucleotide in which at least one of the flanks (F or F') contains DNA nucleotides in addition to LNA nucleotides. In some embodiments, at least one of region F or region F', or both regions F and F', contain both LNA nucleotides and DNA nucleotides. In such embodiments, the flanking region F or F', or both F and F', contains at least three nucleotides, wherein the 5' and 3' terminal nucleotides of the F and / or F' region are LNA nucleotides.

[0362] Alternating flanking LNA gapmers are disclosed in WO 2016 / 127002.

[0363] The alternating flanking region can contain up to 3 consecutive DNA nucleotides, such as 1 to 2 or 1 or 2 or 3 consecutive DNA nucleotides.

[0364] The alternating flanks can be annotated as a series of integers that represent the number of LNA nucleotides (L), followed by the number of DNA nucleotides (D), e.g.

[0365] [L] 1-3 -[D] 1-4 -[L] 1-3

[0366] [L] 1-2 -[D] 1-2 -[L] 1-2 -[D] 1-2 -[L] 1-2

[0367] In an oligonucleotide layout, these will often be represented as numbers, so that 2-2-1 represents 5’[L]2-[D]2-[L]3’, and 1-1-1-1-1 represents 5’[L]-[D]-[L]-[D]-[L]3’. In oligonucleotides with alternating flanks, the lengths of the flanks (region F and region F’) can independently be from 3 to 10 nucleosides, such as from 4 to 8, such as from 5 to 6 nucleosides, such as 4, 5, 6 or 7 modified nucleosides. In some embodiments, only one of the flanks in a gapmer oligonucleotide has alternation, while the other is composed of LNA nucleotides. It can be advantageous to have at least two LNA nucleosides at the 3' end of the 3’ flank (F’) to confer additional exonuclease resistance. Some examples of oligonucleotides with alternating flanks are:

[0368] [L] 1-5 -[D] 1-4 -[L] 1-3 -[G] 5-16 -[L] 2-6

[0369] [L] 1-2 -[D] 1-2 -[L] 1-2 -[D] 1-2 -[L] 1-2 -[G] 5-16 -[L] 1-2 -[D] 1-3 -[L] 2-4

[0370] [L] 1-5 -[G] 5-16 -[L]-[D]-[L]-[D]-[L]2

[0371] Provided that the overall length of the gapmer is at least 12, such as at least 14 nucleotide lengths.

[0372] Region D’ or D” in the oligonucleotide

[0373] In some embodiments, the oligonucleotides of the invention can comprise a continuous nucleotide sequence (such as gapmer F-G-F’) complementary to a target nucleic acid and other 5’ and / or 3’ nucleosides or be composed of them. The other 5’ and / or 3’ nucleosides can be fully complementary or can be not fully complementary to the target nucleic acid. Such other 5’ and / or 3’ nucleosides herein can be referred to as regions D’ and D”.

[0374] To link a continuous nucleotide sequence, such as a nicked polymer, to a conjugate moiety or another functional group, regions D’ or D” can be added. When used for ligation, the continuous nucleotide sequence with the conjugate moiety can act as a biocleavable linker. Alternatively, it can be used to provide exonuclease protection or to facilitate synthesis or manufacture.

[0375] Regions D’ and D” can be linked to the 5’ end of region F or the 3’ end of region F’, respectively, to produce the following layouts: D’-F-G-F’, F-G-F’-D”, or D’-F-G-F’-D”.

[0376] In this example, F-G-F’ is the nicked polymer portion of the oligonucleotide and regions D’ or D” constitute separate portions of the oligonucleotide.

[0377] Regions D’ or D” can independently comprise or consist of 1, 2, 3, 4, or 5 additional nucleotides, which may or may not be complementary to the target nucleic acid. The nucleotides adjacent to the F or F’ regions are not sugar-modified nucleotides such as DNA or RNA or base-modified forms thereof. Regions D’ or D” can act as nuclease-labile biocleavable linkers (see definition of linker). In some embodiments, the additional 5’ and / or 3’ terminal nucleotides are joined by phosphodiester bonds and are DNA or RNA. Nucleotide-based biocleavable linkers suitable for use as regions D’ or D” are disclosed in WO 2014 / 076195, which includes, by way of example, phosphodiester-linked DNA dinucleotides. The use of biocleavable linkers in multi-oligonucleotide constructs is disclosed in WO 2015 / 113922, where they are used to link multiple antisense constructs (e.g., nicked polymer regions) within a single oligonucleotide.

[0378] In one embodiment, in addition to the continuous nucleotide sequence constituting the nicked polymer, the oligonucleotides of the invention further comprise regions D’ and / or D”.

[0379] In some embodiments, the oligonucleotides of the invention can be represented by the following formula:

[0380] F-G-F’; especially F 1-8 -G 5-16 -F’ 2-8

[0381] D’-F-G-F’; especially D’ 1-3 -F 1-8 -G 5-16 -F’ 2-8

[0382] F-G-F’-D”; especially F 1-8 -G 5-16 -F’2-8 -D” 1-3

[0383] D’-F-G-F’-D”; especially D’ 1-3 -F 1-8 -G 5-16 -F’ 2-8 -D” 1-3

[0384] In some embodiments, the internucleoside bond between region D’ and region F is a phosphodiester bond. In some embodiments, the internucleoside bond between region F’ and region D” is a phosphodiester bond.

[0385] Totalmers

[0386] In some embodiments, all of the nucleosides of an oligonucleotide or a contiguous nucleotide sequence thereof are sugar-modified nucleosides. Such oligonucleotides are referred to herein as totalmers.

[0387] In some embodiments, all of the sugar-modified nucleosides of a totalmer contain the same sugar modification. For example, they can all be LNA nucleosides, or they can all be 2’O-MOE nucleosides. In some embodiments, the sugar-modified nucleosides of a totalmer can be independently selected from LNA nucleosides and 2'-substituted nucleosides, such as 2'-substituted nucleosides selected from the following: 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA, and 2'-F-ANA nucleosides. In some embodiments, an oligonucleotide contains LNA nucleosides and 2'-substituted nucleosides, such as 2'-substituted nucleosides selected from the following: 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA, and 2'-F-ANA nucleosides. In some embodiments, an oligonucleotide contains LNA nucleosides and 2'-O-MOE nucleosides. In some embodiments, an oligonucleotide contains (S)cET LNA nucleosides and 2'-O-MOE nucleosides. In some embodiments, each nucleoside unit of an oligonucleotide is a 2'-substituted nucleoside. In some embodiments, each nucleoside unit of an oligonucleotide is 2'-O-MOE.

[0388] In some embodiments, all of the nucleosides of an oligonucleotide or its contiguous nucleotide sequence are LNA nucleosides, such as β-D-oxy-LNA nucleosides and / or (S)cET nucleosides. In some embodiments, such all-LNA oligonucleotides have a length between 7–12 nucleosides (see, e.g., WO 2009 / 043353). Such short, intact LNA oligonucleotides are particularly effective in inhibiting microRNAs.

[0389] A variety of all-polymer compounds are highly effective as therapeutic oligomers, especially when targeting microRNAs (anti-miR) or as splice-switching oligomers (SSO).

[0390] In some embodiments, the all-polymer comprises at least one XYX or YXY sequence motif, such as a repeating sequence XYX or YXY or consisting of the same, where X is an LNA and Y is an alternative (i.e., non-LNA) nucleotide analogue, such as a 2'-OMe RNA unit and a 2'-fluoro DNA unit. In some embodiments, the above sequence motifs can be, for example, XXY, XYX, YXY or YYX.

[0391] In some embodiments, the all-polymer can comprise or consist of a contiguous nucleotide sequence between 7 and 24 nucleotides, such as 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23 nucleotides.

[0392] In some embodiments, the contiguous nucleotide sequence of the all-polymer comprises at least 30%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as 95%, such as 100% LNA units. For fully LNA compounds, it is advantageous that they have a length of less than 12 (such as 7–10) nucleotides.

[0393] The remaining units can be selected from the non-LNA nucleotide analogues mentioned herein, such as those selected from 2'-O-alkyl-RNA units, 2'-OMe-RNA units, 2'-amino-DNA units, 2'-fluoro-DNA units, LNA units, PNA units, HNA units, INA units and 2'-MOE RNA units or those selected from 2'-OMe RNA units and 2'-fluoro DNA units.

[0394] Heteropolymer

[0395] The term 'chimeromer' refers to an oligomer comprising both DNA nucleosides and sugar-modified nucleosides, where there is a sub-length of contiguous DNA nucleosides that recruits RNase H. Suitable chimeromers can contain up to 3 or up to 4 contiguous DNA nucleosides. In some embodiments, the chimeromer or its contiguous nucleotide sequence contains alternating regions of sugar-modified nucleosides and DNA nucleosides. By incorporating alternating regions of sugar-modified nucleosides that form an RNA-like (3'-endo) conformation with the short DNA nucleoside regions upon oligonucleotide incorporation, oligonucleotides that do not recruit RNase H can be prepared. Advantageously, the sugar-modified nucleosides are affinity-enhancing sugar-modified nucleosides.

[0396] Oligonucleotide chimeromers are often used to provide modulation based on occupancy of a target gene, such as a splicing regulator or a microRNA inhibitor.

[0397] In some embodiments, the sugar-modified nucleosides in the chimeromer or its contiguous nucleotide sequence comprise or are all LNA nucleosides, such as (S)cET or β-D-oxy-LNA nucleosides.

[0398] In some embodiments, all of the sugar-modified nucleosides of the chimeromer comprise the same sugar modification. For example, they can all be LNA nucleosides, or they can all be 2'-O-MOE nucleosides. In some embodiments, the sugar-modified nucleosides of the chimeromer can be independently selected from LNA nucleosides and 2'-substituted nucleosides, such as 2'-substituted nucleosides selected from: 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA, and 2'-F-ANA nucleosides. In some embodiments, the oligonucleotide comprises LNA nucleosides and 2'-substituted nucleosides, such as 2'-substituted nucleosides selected from: 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA, and 2'-F-ANA nucleosides. In some embodiments, the oligonucleotide comprises LNA nucleosides and 2'-O-MOE nucleosides. In some embodiments, the oligonucleotide comprises (S)cET LNA nucleosides and 2'-O-MOE nucleosides.

[0399] In some embodiments, the chimeromer or its contiguous nucleotide sequence contains only LNA and DNA nucleosides, and such LNA chimeromer oligonucleotides can be, for example, between 8 - 24 nucleosides in length (see, for example, WO2007112754, which discloses LNA antimiR inhibitors of microRNAs).

[0400] A variety of mixed polymer compounds are highly effective as therapeutic oligomers, particularly when targeting microRNAs (anti-miRs) or as splice-switching oligomers (SSOs).

[0401] In some embodiments, the mixed polymer comprises the following motifs

[0402] …[L]m[D]n[L]m[D]n[L]m… or

[0403] …[L]m[D]n[L]m[D]n[L]m[D]n[L]m… or

[0404] …[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m… or

[0405] …[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m…

[0406] …[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m… or

[0407] …[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m… or

[0408] …[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m… or

[0409] [L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m…

[0410] wherein L represents a sugar-modified nucleoside such as LNA or a 2'-substituted nucleoside (e.g., 2'-O-MOE), D represents a DNA nucleoside, and wherein each m is independently selected from 1–6, and each n is independently selected from 1, 2, 3, and 4, such as 1-3. In some embodiments, each L is an LNA nucleoside. In some embodiments, at least one L is an LNA nucleoside and at least one L is a 2'-O-MOE nucleoside. In some embodiments, each L is independently selected from LNA and 2'-O-MOE nucleosides.

[0411] In some embodiments, the copolymer can comprise or consist of a contiguous nucleotide sequence of between 10 and 24 nucleotides, such as 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides.

[0412] In some embodiments, the contiguous nucleotide sequence of the copolymer comprises at least 30%, such as at least 40%, such as at least 50% LNA units.

[0413] In some embodiments, the copolymer comprises or consists of a contiguous nucleotide sequence of nucleotide analogs and a repeating pattern of naturally occurring nucleotides, or a first type of nucleotide analog and a second type of nucleotide analog. The repeating pattern can be, for example, as follows: every second or every third nucleotide is a nucleotide analog, such as LNA, and the remaining nucleotides are naturally occurring nucleotides, such as DNA, or can be 2'-substituted nucleotide analogs such as 2'-MOE of the 2'-fluoro analog mentioned herein, or in some embodiments, can be selected from the group of nucleotide analogs mentioned herein. It is recognized that the repeating pattern of nucleotide analogs (such as LNA units) can be combined with nucleotide analogs at fixed positions, such as at the 5' or 3' termini.

[0414] In some embodiments, counting from the 3' terminus, the first nucleotide of the oligomer is a nucleotide analog, such as an LNA nucleotide or a 2'-O-MOE nucleoside.

[0415] In some embodiments, which can be the same or different, counting from the 3' terminus, the second nucleotide of the oligomer is a nucleotide analog, such as an LNA nucleotide or a 2'-O-MOE nucleoside.

[0416] In some embodiments, which can be the same or different, the 5' terminus of the oligomer is a nucleotide analog, such as an LNA nucleotide or a 2'-O-MOE nucleoside.

[0417] In some embodiments, the copolymer comprises at least one region that comprises at least two contiguous nucleotide analog units (such as at least two contiguous LNA units).

[0418] In some embodiments, the copolymer comprises at least one region that comprises at least three contiguous nucleotide analog units (such as at least three contiguous LNA units).

[0419] Exosomes

[0420] Exosomes are natural biological nanovesicles that participate in cell-cell communication by means of functionally active cargos (such as miRNA, mRNA, DNA, and proteins), generally in the range of 30 to 500 nm.

[0421] Exosomes are secreted by all types of cells and are also abundantly present in body fluids such as saliva, blood, urine, and milk. The main role of exosomes is to carry information by delivering various effector or signaling molecules between specific cells (Acta Pol Pharm. July - August 2014; 71(4):537 - 43). Such effector or signaling molecules can be, for example, proteins, miRNAs, or mRNAs. Exosomes are currently being explored as delivery vehicles for various drug molecules, including RNA therapeutic molecules, to expand the therapeutic and diagnostic applications of such molecules. There are disclosures in the art of exosomes loaded with synthetic molecules such as siRNAs, antisense oligonucleotides, and small molecules, where the exosomes have been shown or suggested to have advantages in terms of the delivery and efficacy of such molecules compared to free drug molecules (see, for example, Andaloussi et al. 2013 Advanced Drug Delivery Reviews 65:391 - 397, WO2014 / 168548, WO2016 / 172598, WO2017 / 173034, and WO2018 / 102397).

[0422] Exosomes can be isolated from biological sources such as milk (milk exosomes), and in particular, bovine milk is a rich source for isolating bovine milk exosomes. See, for example, Manca et al., Scientific Reports (2018) 8:11321.

[0423] In some embodiments of the present invention, single - stranded oligonucleotides are encapsulated in exosomes (exosome formulations), and examples of loading exosomes with single - stranded antisense oligonucleotides are described in EP application No. 18192614.8. In the methods of the present invention, antisense oligonucleotides can be administered to cells or subjects in the form of exosome formulations, and in particular, oral administration of exosome formulations is contemplated.

[0424] In some embodiments, the antisense oligonucleotides can be conjugated, for example, with a lipophilic conjugate such as cholesterol, and the lipophilic conjugate can be covalently linked to the antisense oligonucleotide via a biodegradable linker (e.g., a region of phosphodiester - linked DNA nucleotides). Such lipophilic conjugates can facilitate the entry of antisense oligonucleotide formulations into exosomes and can further enhance delivery to target cells.

[0425] Conjugate

[0426] As used herein, the term "conjugate" refers to an oligonucleotide covalently linked to a non - nucleotide moiety (conjugate moiety or region C or third region).

[0427] The conjugation of the oligonucleotides of the present invention with one or more non-nucleotide moieties can improve the pharmacology of the oligonucleotides, for example, by affecting the activity, cellular distribution, cellular uptake or stability of the oligonucleotides. In some embodiments, the conjugate moiety modulates or enhances the pharmacokinetic properties of the oligonucleotides by improving their cellular distribution, bioavailability, metabolism, excretion, permeability and / or cellular uptake. In particular, the conjugate can direct the oligonucleotide to a specific organ, tissue or cell type and thus enhance the effectiveness of the oligonucleotide in such organ, tissue or cell type. At the same time, the conjugate can serve to reduce the activity of the oligonucleotide in non-target cell types, tissues or organs (e.g., off-target activity or activity in non-target cell types, tissues or organs).

[0428] WO 93 / 07883 and WO 2013 / 033230 provide suitable conjugate moieties, which are hereby incorporated by reference in their entirety. Other suitable conjugate moieties are those capable of binding to the asialoglycoprotein receptor (ASGPR). In particular, trivalent N-acetylgalactosamine conjugate moieties are suitable for binding to ASGPR, see, for example, WO 2014 / 076196, WO 2014 / 207232 and WO 2014 / 179620 (which are hereby incorporated by reference in their entirety). Such conjugates are used to enhance the uptake of oligonucleotides into the liver while reducing their presence in the kidney, thus increasing the liver / kidney ratio of the conjugated oligonucleotides compared to the unconjugated form of the same oligonucleotide.

[0429] Oligonucleotide conjugates and their synthesis have also been reported in the following: the comprehensive review by Manoharan, cited in Antisense Drug Technology, Principles, Strategies, and Applications, edited by S.T. Crooke, Chapter 16, Marcel Dekker, Inc., 2001 and Manoharan, Antisense and Nucleic Acid Drug Development, 2002, 12, 103, each of which is hereby incorporated by reference in its entirety.

[0430] In one embodiment, the non-nucleotide moiety (conjugate moiety) is selected from sugars, cell surface receptor ligands, drugs, hormones, lipophilic substances, polymers, proteins, peptides, toxins (e.g., bacterial toxins), vitamins, viral proteins (e.g., capsids) or combinations thereof.

[0431] Linker

[0432] A bond or linker is a connection that joins one chemical group or segment of interest to another chemical group or segment of interest via one or more covalent bonds between two atoms. The conjugate moiety can be directly linked to the oligonucleotide or linked via a linking moiety (such as a linker or tether). The linker serves to covalently link a third region, such as a conjugate moiety (region C), to a first region, such as an oligonucleotide or contiguous nucleotide sequence (region A) complementary to the target nucleic acid.

[0433] In some embodiments of the invention, the conjugate or oligonucleotide conjugate of the invention may optionally comprise a linker region (second region or region B and / or region Y) located between the oligonucleotide or contiguous nucleotide sequence (region A or first region) complementary to the target nucleic acid and the conjugate moiety (region C or third region).

[0434] Region B refers to a biodegradable linker that comprises or consists of a physiologically labile bond that is cleavable under conditions normally encountered inside the mammalian body or conditions similar to those encountered inside the mammalian body. Conditions under which the physiologically labile linker undergoes chemical transformation (e.g., cleavage) include chemical conditions such as pH, temperature, oxidative or reductive conditions or substances, and salt concentration that are present or similar to those encountered in mammalian cells. Intracellular mammalian conditions also include the presence of enzyme activities normally present in mammalian cells, such as from proteolytic enzymes or hydrolases or nucleases. In one embodiment, the biodegradable linker is susceptible to cleavage by S1 nuclease. In a preferred embodiment, the nuclease-sensitive linker comprises between 1 and 10 nucleosides, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleosides, more preferably between 2 and 6 nucleosides, and most preferably between 2 and 4 linked nucleosides, the nucleosides comprising at least two contiguous phosphodiester bonds, such as at least 3 or 4 or 5 contiguous phosphodiester bonds. Preferably, the nucleosides are DNA or RNA. Biodegradable linkers containing phosphodiesters are described in more detail in WO 2014 / 076195 (which document is hereby incorporated by reference in its entirety).

[0435] Region Y refers to a linker that need not be biodegradable but mainly serves to covalently link the conjugate moiety (region C or third region) to the oligonucleotide (region A or first region). The region Y linker can comprise repeating units such as ethylene glycol units, amino acid units, or a chain structure or oligomer of aminoalkyls. The oligonucleotide conjugate of the invention can be composed of the following regional elements A-C, A-B-C, A-B-Y-C, A-Y-B-C, or A-Y-C. In some embodiments, the linker (region Y) is aminoalkyl, such as C2–C36 aminoalkyl, for example including C6 to C12 aminoalkyl. In a preferred embodiment, the linker (region Y) is C6 aminoalkyl.

[0436] Administration

[0437] The oligonucleotides or pharmaceutical compositions of the present invention can be administered locally (e.g., to the skin, by inhalation, ocular or otic), enterally (e.g., orally or via the gastrointestinal tract), or parenterally (e.g., intravenously, subcutaneously, intramuscularly, intracerebrally, intraventricularly or intrathecally).

[0438] In some embodiments, the oligonucleotides or pharmaceutical compositions of the present invention are administered by a parenteral route, which includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion, intrathecal or intracranial such as intracerebral or intraventricular, intravitreal administration. In one embodiment, an active oligonucleotide or oligonucleotide conjugate is administered intravenously. In another embodiment, an oligonucleotide or oligonucleotide conjugate having subcutaneous activity is administered subcutaneously.

[0439] In some embodiments, the oligonucleotides, oligonucleotide conjugates or pharmaceutical compositions of the present invention are administered at a dose of 0.1–15 mg / kg, such as 0.2–10 mg / kg, such as 0.25–5 mg / kg. The administration can be once a week, every 2 weeks, every three weeks or once or twice a month.

[0440] The present invention also provides the use of the oligonucleotides or oligonucleotide conjugates of the present invention as described for the manufacture of a medicament, wherein the medicament is in an ophthalmic dosage form such as an intravitreal injection dosage form. In some embodiments, the ophthalmic oligonucleotide is Htra-1.

[0441] The present invention also provides the use of the oligonucleotides or oligonucleotide conjugates of the present invention as described for the manufacture of a medicament, wherein the medicament is in an intravenous, subcutaneous, intramuscular, intracerebral, intraventricular or intrathecal administration dosage form (e.g., an injection).

[0442] Schematic advantages

[0443] As shown herein, the achiral phosphorothioate internucleoside bond used in the compounds of the present invention allows for a reduction in the complexity of the phosphorothioate oligonucleotides of undefined stereochemistry while maintaining the activity, efficacy or potency of the oligonucleotides.

[0444] In fact, as shown herein, when combined with stereodefined phosphorothioates, the compounds of the present invention provide unique benefits, thus providing the opportunity to further reduce the complexity of the phosphorothioate oligonucleotides while retaining or improving the activity, efficacy or potency of the oligonucleotides.

[0445] As shown herein, the achiral phosphorothioate internucleoside bond used in the compounds of the present invention allows for improved cellular uptake in vitro or in vivo.

[0446] As shown herein, the achiral phosphorothioate internucleoside linkages used in the compounds of the invention allow for the alteration or improvement of biodistribution in vitro (measured as tissue content or cellular content or activity / potency in a target tissue). Notably, we have seen improvements in tissue uptake, content, and / or potency in skeletal muscle, heart, spleen, liver, kidney, fibroblasts, and epithelial cells.

[0447] In the case of chimeric oligonucleotides, the inventors have identified that incorporation of phosphorothioate linkages (as shown in (IA) or (IB)) between or adjacent to one or more DNA nucleosides provides improvements such as enhanced stability and / or improved potency. In the case of gapmer oligonucleotides, the inventors have seen that incorporation of phosphorothioate linkages (as shown in (IA) or (IB)) between nucleosides in the flanking regions (such as between 2'-sugar modified nucleosides) also provides improvements such as enhanced stability and / or improved potency.

[0448] As shown herein, the achiral phosphorothioate internucleoside linkages used in the compounds of the invention allow for the improvement of oligonucleotide stability. Incorporation of achiral phosphorothioate internucleosides in the compounds of the invention provides enhanced resistance to serum and cellular exonucleases, particularly 3'-exonucleases and additionally 5'-exonucleases, and the apparent stability of the compounds of the invention further suggests resistance to endonucleases. Stabilizing oligonucleotides is particularly important in reducing or preventing the accumulation of toxic degradation products and prolonging the duration of action of antisense oligonucleotides. As shown in the examples, rat serum stability can be used to analyze improved stability. To evaluate cellular stability, tissue (e.g., liver) homogenate extracts can be used - see, for example, WO2014076195 which provides such methods. Other assays for measuring oligonucleotide stability include venom phosphodiesterase stability assays and S1 nuclease stability.

[0449] The reduced toxicity risk of the claimed oligonucleotides is tested using in vitro liver toxicity assays (e.g., as disclosed in WO 2017 / 067970) or in vitro kidney toxicity assays (e.g., as disclosed in WO 2017 / 216340) or in vitro neurotoxicity assays (e.g., as disclosed in WO2016127000). Alternatively, toxicity can be determined in vivo, for example, in mice or rats.

[0450] Enhanced stability can provide a benefit for the duration of action of the oligonucleotides of the invention, which is particularly beneficial when the route of administration is diffusive, such as parenteral administration, e.g., intravenous, subcutaneous, intramuscular, intracerebral, intraocular, intracerebroventricular, or intrathecal administration.

[0451] General oligonucleotide embodiments

[0452] 1. An antisense oligonucleotide comprising at least one phosphorothioate internucleoside bond of formula (IA) or (IB)

[0453]

[0454] wherein one of the two oxygen atoms is linked to the 3'-carbon atom of the adjacent nucleoside (A1) and the other oxygen atom is linked to the 5'-carbon atom of the other adjacent nucleoside (A2), wherein at least one of the two nucleosides (A1) and (A2) is an LNA nucleoside and wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as Na+ or K+ cation; or M+ is an ammonium cation.

[0455] 2. The oligonucleotide according to embodiment 1, wherein one of (A1) and (A2) is an LNA nucleoside and the other is a DNA nucleoside, an RNA nucleoside or a sugar-modified nucleoside.

[0456] 3. The oligonucleotide according to embodiment 1 or 2, wherein one of (A1) and (A2) is an LNA nucleoside and the other is a DNA nucleoside or a sugar-modified nucleoside.

[0457] 4. The oligonucleotide according to any one of embodiments 1 to 3, wherein one of (A1) and (A2) is an LNA nucleoside and the other is a DNA nucleoside.

[0458] 6. The oligonucleotide according to any one of embodiments 1 to 3, wherein one of (A1) and (A2) is an LNA nucleoside and the other is a sugar-modified nucleoside.

[0459] 7. The oligonucleotide according to any one of embodiments 2 to 6, wherein the sugar-modified nucleoside is a 2'-sugar-modified nucleoside.

[0460] 8. The oligonucleotide according to embodiment 7, wherein the 2'-sugar-modified nucleoside is 2'-alkoxy-RNA, 2'-alkoxyalkoxy-RNA, 2'-amino-DNA, 2'-fluoro-RNA, 2'-fluoro-ANA or an LNA nucleoside.

[0461] 9. The oligonucleotide according to embodiment 7 or 8, wherein the 2'-sugar-modified nucleoside is an LNA nucleoside.

[0462] 10. The oligonucleotide according to any one of embodiments 1 to 9, wherein the LNA nucleosides are independently selected from β-D-oxy-LNA, 6'-methyl-β-D-oxy-LNA and ENA.

[0463] 11. The oligonucleotide according to embodiment 9 or 10, wherein the LNA nucleosides are both β-D-oxy-LNA.

[0464] 12. The oligonucleotide according to embodiment 7 or 8, wherein the 2'-sugar-modified nucleoside is 2'-alkoxyalkoxy-RNA.

[0465] 13. The oligonucleotide according to embodiment 10, wherein the 2'-alkoxy-RNA is 2'-methoxy-RNA.

[0466] 14. The oligonucleotide according to any one of embodiments 1 to 12, wherein the 2'-alkoxyalkoxy-RNA is 2'-methoxyethoxy-RNA.

[0467] 15. The oligonucleotide according to any one of embodiments 1 to 14, comprising between 1 and 15, particularly between 1 and 5, more specifically 1, 2, 3, 4 or 5 phosphorodithioate nucleoside internucleotide linkages of formula (IA) or (IB) as defined in embodiment 1.

[0468] 16. The oligonucleotide according to any one of embodiments 1 to 15, comprising other internucleotide linkages independently selected from phosphodiester nucleoside internucleotide linkages, phosphorothioate nucleoside internucleotide linkages and phosphorodithioate nucleoside internucleotide linkages of formula (IA) or (IB) as defined in embodiment 1.

[0469] 17. The oligonucleotide according to embodiment 16, wherein the other internucleotide linkages are independently selected from phosphorothioate nucleoside internucleotide linkages and phosphorodithioate nucleoside internucleotide linkages of formula (IA) or (IB) as defined in embodiment 1.

[0470] 18. The oligonucleotide according to embodiment 16 or 17, wherein the other internucleotide linkages are all phosphorothioate nucleoside internucleotide linkages.

[0471] 19. The oligonucleotide according to embodiments 16 to 17, wherein the other internucleotide linkages are all phosphorodithioate nucleoside internucleotide linkages of formula (IA) or (IB) as defined in embodiment 1.

[0472] 20. The oligonucleotide according to any one of embodiments 1 to 19, wherein the oligonucleotide has a length of 7 to 30 nucleotides.

[0473] 21. The oligonucleotide according to any one of embodiments 1 to 20, wherein one or more nucleosides are nucleobase-modified nucleosides.

[0474] 22. The oligonucleotide according to any one of embodiments 1 to 21, wherein the oligonucleotide is an antisense oligonucleotide, siRNA, microRNA mimic or ribozyme.

[0475] 23. A pharmaceutically acceptable salt of the oligonucleotide according to any one of embodiments 1 to 22, in particular a sodium salt, a potassium salt or an ammonium salt.

[0476] 24. A conjugate comprising the oligonucleotide or pharmaceutically acceptable salt according to any one of embodiments 1 to 23 and at least one conjugate moiety covalently linked to the oligonucleotide or the pharmaceutically acceptable salt, optionally via a linker moiety.

[0477] 25. A pharmaceutical composition comprising the oligonucleotide, pharmaceutically acceptable salt or conjugate according to any one of embodiments 1 to 24 and a therapeutically inert carrier.

[0478] 26. The oligonucleotide, pharmaceutically acceptable salt or conjugate according to any one of embodiments 1 to 24 for use as a therapeutic active substance.

[0479] 27. A method for manufacturing an oligonucleotide according to any one of embodiments 1 to 24, the method comprising the steps of:

[0480] (a) coupling a phosphorothioamidite nucleoside to the terminal 5'-oxygen atom of a nucleotide or oligonucleotide to produce a thiophosphite triester intermediate;

[0481] (b) sulfurizing the thiophosphite triester intermediate obtained in step (a); and

[0482] (c) optionally further extending the oligonucleotide.

[0483] 28. An oligonucleotide produced by the method according to embodiment 27.

[0484] Gapmer Embodiments

[0485] 1. An antisense gapmer oligonucleotide for inhibiting a target RNA in a cell, wherein the antisense gapmer oligonucleotide comprises at least one phosphorodithioate internucleoside bond of formula (IA) or (IB)

[0486]

[0487] wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as a Na+ or K+ cation; or M+ is an ammonium cation.

[0488] 2. The antisense gapmer oligonucleotide according to embodiment 1, wherein at least one phosphorodithioate internucleoside bond has formula (IA) and R is hydrogen; or at least one phosphorodithioate internucleoside bond has formula (IB) and M + is Na +, K + or ammonium.

[0489] 3. The nicked polymer oligonucleotide according to embodiment 1 or 2, wherein one of the two oxygen atoms of the at least one internucleoside bond of formula (I) is connected to the 3'-carbon atom of the adjacent nucleoside (A 1 ) and the other oxygen atom is connected to the 5'-carbon atom of another nucleoside (A 2 ), wherein at least one of the two nucleosides (A 1 ) and (A 2 ) is a 2'-sugar modified nucleoside.

[0490] 4. The nicked polymer oligonucleotide according to any one of embodiments 1-3, wherein one of (A 1 ) and (A 2 ) is a 2'-sugar modified nucleoside and the other is a DNA nucleoside.

[0491] 5. The nicked polymer oligonucleotide according to any one of embodiments 1-3, wherein both (A 1 ) and (A 2 ) are 2'-modified nucleosides simultaneously.

[0492] 6. The nicked polymer oligonucleotide according to any one of embodiments 1-3, wherein both (A 1 ) and (A 2 ) are DNA nucleosides simultaneously.

[0493] 7. The nicked polymer oligonucleotide according to any one of embodiments 1 to 6, wherein the nicked polymer oligonucleotide comprises a continuous nucleotide sequence of formula 5'-F-G-F'-3', wherein G is a region having 5 to 18 nucleosides capable of recruiting RNase H, and the region G is flanked by flanking regions F and F' at the 5' and 3' sides respectively, wherein the regions F and F' independently comprise or consist of 1 to 7 2'-sugar modified nucleotides, wherein the nucleoside of region F adjacent to region G is a 2'-sugar modified nucleoside and the nucleoside of region F' adjacent to region G is a 2'-sugar modified nucleoside.

[0494] 8. The nicked polymer oligonucleotide according to any one of embodiments 1 to 7, wherein the 2'-sugar modified nucleosides are independently selected from 2'-alkoxy-RNA nucleosides, 2'-alkoxyalkoxy-RNA nucleosides, 2'-amino-DNA nucleosides, 2'-fluoro-RNA nucleosides, 2'-fluoro-ANA nucleosides and LNA nucleosides.

[0495] 9. The nicked polymer oligonucleotide according to embodiment 8, wherein the 2'-alkoxyalkoxy-RNA is 2'-methoxyethoxy-RNA (2'-O-MOE).

[0496] 10. A nicked polymer oligonucleotide according to any one of embodiments 7 to 8, wherein region F and region F' comprise or consist of 2'-methoxyethoxy-RNA nucleotides.

[0497] 11. A nicked polymer oligonucleotide according to any one of embodiments 7 to 10, wherein at least one or all of the 2'-sugar modified nucleosides in region F or region F' or both region F and region F' are LNA nucleosides.

[0498] 12. A nicked polymer oligonucleotide according to any one of embodiments 7 to 11, wherein region F or region F' or both region F and region F' comprise at least one LNA nucleoside and at least one DNA nucleoside.

[0499] 13. A nicked polymer oligonucleotide according to any one of embodiments 7 to 12, wherein region F or region F' or both region F and region F' comprise at least one LNA nucleoside and at least one non-LNA 2'-sugar modified nucleoside, such as at least one 2'-methoxyethoxy-RNA nucleoside.

[0500] 14. A nicked polymer oligonucleotide according to any one of embodiments 1 to 13, wherein the nicked region comprises 5 to 16, particularly 8 to 16, more specifically 8, 9, 10, 11, 12, 13 or 14 consecutive DNA nucleosides.

[0501] 15. A nicked polymer oligonucleotide according to any one of embodiments 1 to 14, wherein region F and region F' independently have a length of 1, 2, 3, 4, 5, 6, 7 or 8 nucleosides.

[0502] 16. A nicked polymer oligonucleotide according to any one of embodiments 1 to 15, wherein region F and region F' each independently comprise 1, 2, 3 or 4 LNA nucleosides.

[0503] 17. A nicked polymer oligonucleotide according to any one of embodiments 8 to 16, wherein the LNA nucleosides are independently selected from β-D-oxy-LNA, 6'-methyl-β-D-oxy-LNA and ENA.

[0504] 18. A nicked polymer oligonucleotide according to embodiments 8 - 18, wherein the LNA nucleoside is β-D-oxy-LNA.

[0505] 19. A nicked polymer oligonucleotide according to any one of embodiments 1 to 18, wherein the oligonucleotide or its consecutive nucleotide sequence (F - G - F') has a length of 10 to 30 nucleotides, particularly 12 to 22, more particularly 14 to 20 nucleotides.

[0506] 20. A nicked polymer oligonucleotide according to any one of embodiments 1–19, wherein at least one of the flanking regions, such as region F and region F’, comprises a phosphorodithioate bond of formula (IA) or (IB) as defined in any one of embodiments 1–19.

[0507] 21. A nicked polymer oligonucleotide according to any one of embodiments 1–19, wherein both flanking regions, such as region F and region F’, comprise a phosphorodithioate bond of formula (IA) or (IB) as defined in any one of embodiments 1–19.

[0508] 22. A nicked polymer oligonucleotide according to any one of embodiments 1–21, wherein at least one of the flanking regions, such as F or F’, comprises a phosphorodithioate bond of formula (IA) or (IB) as defined in any one of embodiments 1–19.

[0509] 23. A nicked polymer oligonucleotide according to any one of embodiments 1–21, wherein both flanking regions F and F’ comprise at least two phosphorodithioate bonds of formula (IA) or (IB) as defined in any one of embodiments 1–19.

[0510] 24. A nicked polymer oligonucleotide according to any one of embodiments 1–23, wherein one or both flanking regions each comprise an LNA nucleoside having a phosphorodithioate bond of formula (IA) or (IB) that links the LNA to a 3’ nucleoside.

[0511] 25. A nicked polymer oligonucleotide according to any one of embodiments 1–24, wherein one or both flanking regions each comprise two or more adjacent LNA nucleosides linked by a phosphorodithioate bond of formula (IA) or (IB), wherein the phosphorodithioate bond of formula (IA) or (IB) links the LNA to a 3’ nucleoside.

[0512] 26. A nicked polymer oligonucleotide according to any one of embodiments 1–25, wherein one or both flanking regions each comprise an MOE nucleoside having a phosphorodithioate bond of formula (IA) or (IB) that links the MOE to a 3’ nucleoside.

[0513] 27. A nicked polymer oligonucleotide according to any one of embodiments 1–26, wherein one or both flanking regions each comprise two or more adjacent MOE nucleosides linked by a phosphorodithioate bond of formula (IA) or (IB), wherein the phosphorodithioate bond of formula (IA) or (IB) links the MOE to a 3’ nucleoside.

[0514] 28. A nicked polymer oligonucleotide according to any one of embodiments 1–27, wherein the flanking regions F and F’ together contain 1, 2, 3, 4 or 5 phosphorothioate internucleoside linkages of formula (IA) or (IB), and wherein optionally, the internucleoside linkage between the 3’-terminal nucleoside of region F and the 5’-terminal nucleoside of region G is also a phosphorothioate internucleoside linkage of formula (IA) or (IB).

[0515] 29. A nicked polymer oligonucleotide according to any one of embodiments 1 to 28, which comprises phosphorothioate internucleoside linkages of formula (IA) or (IB) between adjacent nucleosides located in region F or region F’, between region F and region G, or between region G and region F’.

[0516] 30. A nicked polymer region according to any one of embodiments 1–29, wherein the nicked region contains 1, 2, 3 or 4 phosphorothioate internucleoside linkages of formula (IA) or (IB), and wherein the remaining internucleoside linkages are phosphorothioate internucleoside linkages.

[0517] 31. A nicked polymer according to any one of embodiments 1–30, wherein the nicked region contains a region having at least 5 consecutive DNA nucleotides, such as a region having 6–18 consecutive DNA nucleotides or 8–14 consecutive DNA nucleotides.

[0518] 32. A nicked polymer according to any one of embodiments 1–31, which further comprises one or more stereodefined phosphorothioate internucleoside linkages (Sp,S) or (Rp,R)

[0519]

[0520] wherein N 1 and N 2 are nucleosides.

[0521] 33. A nicked polymer according to embodiment 32, wherein the nicked polymer comprises at least one stereodefined internucleoside linkage (Sp,S) or (Rp,R) between two DNA nucleosides (such as between two DNA nucleosides in the nicked region).

[0522] 34. A nicked polymer oligonucleotide according to embodiment 32 or 33, wherein the nicked region contains 2, 3, 4, 5, 6, 7 or 8 stereodefined phosphorothioate internucleoside linkages independently selected from Rp and Sp internucleoside linkages.

[0523] 35. A nicked polymer oligonucleotide according to any one of embodiments 32-33, wherein region G further comprises at least 2, 3 or 4 internucleoside linkages of formula IB.

[0524] 34. A nicked polymer oligonucleotide according to embodiments 32–35, wherein (i) all remaining internucleoside linkages within region G (i.e., between the nucleosides in region G) are independently phosphorothioate internucleoside linkages defining configuration selected from Rp and Sp internucleoside linkages, or (ii) all internucleoside linkages within region G are independently phosphorothioate internucleoside linkages defining configuration selected from Rp and Sp internucleoside linkages.

[0525] 35. A nicked polymer oligonucleotide according to any one of embodiments 1–34, wherein all internucleoside linkages within the flanking regions are dithiophosphonate internucleoside linkages of formula (IA) or (IB), wherein optionally, the internucleoside linkage between the 3'-terminal nucleoside of region F and the 5'-terminal nucleoside of region G is also a dithiophosphonate internucleoside linkage of formula (IA) or (IB), and the internucleoside linkage between the 3'-terminal nucleoside of region G and the 5'-terminal nucleoside of region F' is a phosphorothioate internucleoside linkage defining configuration.

[0526] 36. A nicked polymer oligonucleotide according to any one of embodiments 6 to 35, wherein the internucleoside linkages between the nucleosides of region G are independently selected from phosphorothioate internucleoside linkages and dithiophosphonate internucleoside linkages of formula (I) as defined in embodiment 1.

[0527] 37. A nicked polymer oligonucleotide according to any one of embodiments 7 to 36, wherein the internucleoside linkages between the nucleosides of region G contain 0, 1, 2 or 3 dithiophosphonate internucleoside linkages of formula (I) as defined in embodiment 1, especially 0 dithiophosphonate internucleoside linkages of formula (I).

[0528] 38. A nicked polymer oligonucleotide according to any one of embodiments 1 to 37, wherein the remaining internucleoside linkages are independently selected from phosphorothioate internucleoside linkages, phosphodiester internucleoside linkages and dithiophosphonate internucleoside linkages of formula (I) as defined in embodiment 1.

[0529] 39. A nicked polymer oligonucleotide according to any one of embodiments 7 to 38, wherein the internucleoside linkages between the nucleosides of region F and the internucleoside linkages between the nucleosides of region F' are independently selected from phosphorothioate internucleoside linkages and dithiophosphonate internucleoside linkages of formula (I) as defined in embodiment 1.

[0530] 40. A nicked polymer oligonucleotide according to any one of embodiments 7 to 39, wherein each flanking region F and F' independently contains 1, 2, 3, 4, 5, 6 or 7 dithiophosphonate internucleoside linkages of formula (I) as defined in embodiment 1.

[0531] 41. A nicked polymer oligonucleotide according to any one of embodiments 7 to 40, wherein all internucleoside linkages in the flanking region F and / or F’ are phosphorothioate internucleoside linkages of formula (I) as defined in embodiment 1.

[0532] 42. A nicked polymer oligonucleotide according to any one of embodiments 1 to 41, wherein the nicked polymer oligonucleotide comprises at least one stereodefined internucleoside linkage, such as at least one phosphorothioate internucleoside linkage that defines stereochemistry.

[0533] 43. A nicked polymer oligonucleotide according to any one of embodiments 1 to 42, wherein the nicked region comprises 1, 2, 3, 4 or 5 phosphorothioate internucleoside linkages that define stereochemistry.

[0534] 44. A nicked polymer oligonucleotide according to any one of embodiments 1 to 43, wherein all internucleoside linkages between the nucleosides in the nicked region are phosphorothioate internucleoside linkages that define stereochemistry.

[0535] 45. A nicked polymer oligonucleotide according to any one of embodiments 7 to 44, wherein at least one phosphorothioate internucleoside linkage of formula (IA) or (IB) is located between the nucleosides in region F, or between the nucleosides in region F’, or between region F and region G, or between region G and region F’, and the remaining internucleoside linkages within region F and within region F’, between region F and region G, and between region G and region F’ are independently selected from phosphorothioate internucleoside linkages that define stereochemistry, stereorandom internucleoside linkages, phosphorothioate internucleoside linkages of formula (IA) or (IB), and phosphodiester internucleoside linkages.

[0536] 46. The oligonucleotide nicked polymer according to embodiment 45, wherein the remaining internucleoside linkages within region F, within region F’ or within both region F and region F’ are phosphorothioate internucleoside linkages of formula (IA) or (IB).

[0537] 47. A nicked polymer oligonucleotide according to any one of embodiments 6 to 33, wherein the internucleoside linkages between the nucleosides in region G comprise 0, 1, 2 or 3 phosphorothioate internucleoside linkages of formula (I) as defined in embodiment 1 and the remaining internucleoside linkages within region G are independently selected from phosphorothioate internucleoside linkages that define stereochemistry, stereorandom internucleoside linkages, and phosphodiester internucleoside linkages.

[0538] 48. A nicked polymer oligonucleotide according to any one of embodiments 1 - 47, wherein the 3’-terminal nucleoside of the antisense oligonucleotide is an LNA nucleoside or a 2’-O-MOE nucleoside.

[0539] 49. A nicked polymer oligonucleotide according to any one of embodiments 1 - 48, wherein the 5'-terminal nucleoside of the antisense oligonucleotide is an LNA nucleoside or a 2'-O-MOE nucleoside.

[0540] 50. A nicked polymer oligonucleotide according to any one of embodiments 1–49, wherein the two 3'-terminal most nucleosides of the antisense oligonucleotide are independently selected from LNA nucleosides and 2'-O-MOE nucleosides.

[0541] 51. A nicked polymer oligonucleotide according to any one of embodiments 1 - 50, wherein the two 5'-terminal most nucleosides of the antisense oligonucleotide are independently selected from LNA nucleosides and 2'-O-MOE nucleosides.

[0542] 52. A nicked polymer oligonucleotide according to any one of embodiments 1 - 51, wherein the three 3'-terminal most nucleosides of the antisense oligonucleotide are independently selected from LNA nucleosides and 2'-O-MOE nucleosides.

[0543] 53. A nicked polymer oligonucleotide according to any one of embodiments 1 - 52, wherein the three 5'-terminal most nucleosides of the antisense oligonucleotide are independently selected from LNA nucleosides and 2'-O-MOE nucleosides.

[0544] 54. A nicked polymer oligonucleotide according to any one of embodiments 1–53, wherein the two 3'-terminal most nucleosides of the antisense oligonucleotide are LNA nucleosides.

[0545] 55. A nicked polymer oligonucleotide according to any one of embodiments 1–54, wherein the two 5'-terminal most nucleosides of the antisense oligonucleotide are LNA nucleosides.

[0546] 56. A nicked polymer oligonucleotide according to any one of embodiments 1–55, wherein the nucleoside (A 2 ) of formula (IA) or (IB) is the 3'-terminal nucleoside of the oligonucleotide.

[0547] 57. A nicked polymer oligonucleotide according to any one of embodiments 1–56, wherein the nucleoside (A 1 ) of formula (IA) or (IB) is the 5'-terminal nucleoside of the oligonucleotide.

[0548] 58. A nicked polymer oligonucleotide according to any one of embodiments 7–57, wherein the nicked polymer oligonucleotide comprises a continuous nucleotide sequence of formula 5’-D’-F-G-F’-D”-3’, wherein F, G, and F’ are as defined in any one of embodiments 7 to 45 and wherein regions D’ and D” each independently consist of from 0 to 5 nucleotides, in particular 2, 3, or 4 nucleotides, in particular DNA nucleotides (such as phosphodiester-linked DNA nucleosides).

[0549] 59. A nicked polymer oligonucleotide according to any one of embodiments 1 to 58, wherein the nicked polymer oligonucleotide is capable of recruiting human RNase H1.

[0550] 60. A nicked polymer oligonucleotide according to any one of embodiments 1 to 59, wherein the nicked polymer oligonucleotide is for in vitro or in vivo inhibition of a mammalian (such as human) mRNA or pre-mRNA target, or a viral target or a non-coding long RNA.

[0551] 61. A pharmaceutically acceptable salt of a nicked polymer oligonucleotide according to any one of embodiments 1 to 60, in particular a sodium or potassium salt.

[0552] 62. A conjugate comprising a nicked polymer oligonucleotide or a pharmaceutically acceptable salt according to any one of embodiments 1 to 61 and at least one conjugate moiety covalently linked to the oligonucleotide or the pharmaceutically acceptable salt, optionally via a linker moiety.

[0553] 63. A pharmaceutical composition comprising a nicked polymer oligonucleotide, a pharmaceutically acceptable salt or a conjugate according to any one of embodiments 1 to 62 and a therapeutically inert carrier.

[0554] 64. A nicked polymer oligonucleotide, a pharmaceutically acceptable salt or a conjugate according to any one of embodiments 1 to 63, for use as a therapeutic active substance.

[0555] Antisense oligonucleotide embodiments

[0556] The present invention relates to an oligonucleotide comprising at least one phosphorodithioate internucleoside bond of (IA) or (IB)

[0557]

[0558] wherein one of two oxygen atoms is linked to the 3’ carbon atom of an adjacent nucleoside (A 1 ) and the other oxygen atom is linked to the 3’ carbon atom of another adjacent nucleoside (A 2) is linked to the 5'-carbon atom, and wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as Na+ or K+ cation; or M+ is an ammonium cation.

[0559] In other words, M is a metal, such as an alkali metal, such as Na or K; or M is NH4.

[0560] The oligonucleotide can be, for example, a single-stranded antisense oligonucleotide capable of regulating the expression of a target nucleic acid (such as a target microRNA) or capable of regulating the splicing process of a target pre-mRNA comprising a continuous nucleotide sequence. The antisense oligonucleotide of the present invention comprises a continuous nucleotide sequence complementary to the target nucleic acid and capable of hybridizing with the target nucleic acid and regulating its expression. In a preferred embodiment, the antisense oligonucleotide or its continuous nucleotide sequence is a mixed polymer oligonucleotide, wherein (A1) or (A2) is a DNA nucleoside, or both (A1) and (A2) are DNA nucleosides.

[0561] In the context of the present invention, an antisense oligonucleotide is a single-stranded oligonucleotide complementary to a nucleic acid target (such as a target RNA) and capable of playing a regulatory role (such as splicing regulation of a pre-mRNA target) or inhibiting the expression of a nucleic acid target (such as an mRNA target, a pre-mRNA target, a viral RNA target or a non-coding long RNA target). Depending on the target, the length of the oligonucleotide or the length of the region thereof complementary to the target (i.e., antisense - preferably, the complementary region is fully complementary to the target) can be 7 - 30 nucleotides (referred to as the region of the continuous nucleotide sequence). For example, an LNA nucleotide inhibitor of a microRNA can be as short as 7 continuous complementary nucleotides (and can be up to 30 nucleotides), and oligonucleotides that recruit RNase H generally have a length of at least 12 continuous complementary nucleotides, such as a length of 12 - 26 nucleotides. Splicing-regulatory antisense oligonucleotides generally have a continuous nucleotide region of 10 - 30 complementary nucleotides.

[0562] Splicing regulatory oligonucleotides, also known as splicing-switching oligonucleotides (SSOs), are short, synthetic, antisense, modified nucleic acids that base pair with pre-mRNA and disrupt normal transcript splicing repertoires by blocking RNA–RNA base pairing or protein–RNA binding interactions that occur between components of the splicing apparatus and pre-mRNA. Splicing of pre-mRNA is required for proper expression of the vast majority of protein-coding genes, and thus, targeting this process provides a means to manipulate protein production from genes. Splicing regulation is particularly valuable in disease situations where mutations that disrupt normal splicing processes occur or when interfering with the normal splicing process of gene transcripts may be therapeutically useful. SSOs provide an effective and specific means to target and alter the splicing process in a therapeutic manner. See Haven’s and Hasting NAR (2016) 44, 6549-6563. SSOs can be complementary to exon / intron junctions in the target pre-mRNA or can target splicing enhancer or silencer elements (collectively referred to as cis-acting splicing elements) within the pre-mRNA that regulate the pre-mRNA splicing process. Splicing regulation can result in exon skipping or exon inclusion and thus regulate the alternative splicing process of pre-mRNA. SSOs function through non-nuclease-mediated regulation of the target pre-mRNA and thus are unable to recruit RNases. They are often highly modified oligonucleotides, i.e., each nucleoside contains a modified sugar moiety, such as a 2'-sugar substituted sugar moiety (e.g., based on a phosphorothioate backbone, fully incorporating, for example, 2'-O-MOE oligonucleotides that are 15–25 nucleotides in length, often 18–22 or 20 nucleotides in length), or LNA-mixed oligonucleotides (oligonucleotides 10–30 nucleotides in length that contain DNA nucleosides and LNA nucleosides, and optionally other 2'-sugar modified nucleosides, such as 2'-O-MOE). LNA oligonucleotides that do not contain DNA nucleosides but contain LNA and other 2'-sugar modified nucleosides (such as 2'-O-MOE nucleosides) are also contemplated. Table 1 of Haven’s and Hasting NAR (2016) 44, 6549-6563, which is hereby incorporated by reference, shows a series of SSO targets and the chemistries of the oligonucleotides used with reported in vivo activity and is reproduced in Table A below:

[0563] Table A

[0564]

[0565]

[0566]

[0567] In some embodiments of the present invention, the antisense oligonucleotide is a splicing regulatory oligonucleotide complementary to a pre-mRNA selected from the following: HBB, FKTN, LMNA, CEP290, CLCN1, USH1C, BTK, LRP8, CTLA4, BCL2L1, ERBB4, MDM4, STAT3, IL1RAP, TNFRSF1B, FLT1, KDR, SMN2, MYBPC3, TTN, DMD, NBN, IL10, HTT, APOB, MSTN, GYS2, and ATXN3. Exemplary diseases that can be treated with the SSOs of the present invention are provided on a target-by-target basis in Table A.

[0568] The following embodiments generally relate to the single-stranded antisense oligonucleotides of the present invention, and particularly to splicing regulatory antisense oligonucleotides (SSOs):

[0569] 1. A single-stranded antisense oligonucleotide for regulating an RNA target in a cell, wherein the antisense oligonucleotide comprises or consists of a continuous nucleotide sequence 10–30 nucleotides in length, wherein the continuous nucleotide sequence comprises one or more 2'-sugar modified nucleosides, and wherein at least one of the internucleoside linkages present between the nucleosides of the continuous nucleotide sequence is a phosphorodithioate bond of formula (IA) or (IB)

[0570]

[0571] wherein one of the two oxygen atoms is attached to the 3'-carbon atom of the adjacent nucleoside (A1) and the other oxygen atom is attached to the 5'-carbon atom of the other adjacent nucleoside (A2), and wherein R is hydrogen or a phosphate protecting group.

[0572] 2. The antisense oligonucleotide according to embodiment 1, wherein at least one of the two nucleosides (A 1 ) and (A 2 ) is a 2'-sugar modified nucleoside.

[0573] 3. The antisense oligonucleotide according to embodiment 1, wherein both of the two nucleosides (A 1 ) and (A 2 ) are 2'-sugar modified nucleosides.

[0574] 4. The antisense oligonucleotide according to any one of embodiments 1-3, wherein at least one of the two nucleosides (A 1 ) and (A 2 ) or both of the two nucleosides (A 1 ) and (A 2 ) are DNA nucleosides.

[0575] 5. The antisense oligonucleotide according to any one of embodiments 1-4, wherein at least one of the two nucleosides (A 1 ) and (A2 ) at least one of them is a 2'-sugar modified nucleoside or the nucleosides are independently selected from 2'-alkoxy-RNA, 2'-alkoxyalkoxy-RNA, 2'-amino-DNA, 2'-fluoro-RNA, 2'-fluoro-ANA or LNA nucleosides.

[0576] 6. The antisense oligonucleotide according to any one of embodiments 1-5, wherein (A 1 ) and (A 2 ) at least one of them is an LNA nucleoside.

[0577] 7. The antisense oligonucleotide according to any one of embodiments 1-5, wherein both (A 1 ) and (A 2 ) are LNA nucleosides.

[0578] 8. The antisense oligonucleotide according to any one of embodiments 1-6, wherein (A 1 ) and (A 2 ) at least one of them is a 2'-O-methoxyethyl nucleoside.

[0579] 9. The antisense oligonucleotide according to any one of embodiments 1-5, wherein both (A 1 ) and (A 2 ) are 2'-O-methoxyethyl nucleosides.

[0580] 10. The antisense oligonucleotide according to any one of embodiments 1–8, wherein the LNA nucleosides are selected from β-D-oxy-LNA, 6'-methyl-β-D-oxy-LNA and ENA.

[0581] 11. The antisense oligonucleotide according to any one of embodiments 1–8, wherein the LNA nucleoside is β-D-oxy-LNA.

[0582] 12. The antisense oligonucleotide according to any one of embodiments 1–11, wherein the continuous nucleotide sequence contains one or more other 2'-sugar modified nucleosides, such as one or more other 2'-sugar modified nucleosides selected from 2'-alkoxy-RNA, 2'-alkoxyalkoxy-RNA, 2'-amino-DNA, 2'-fluoro-RNA, 2'-fluoro-ANA or LNA nucleosides.

[0583] 13. The antisense oligonucleotide according to any one of embodiments 1-12, wherein the continuous nucleotide sequence contains LNA nucleosides and DNA nucleosides.

[0584] 14. The antisense oligonucleotide according to any one of embodiments 1-12, wherein the continuous nucleotide sequence contains LNA nucleosides and 2'-O-methoxyethyl nucleosides.

[0585] 15. An antisense oligonucleotide according to any one of embodiments 1-13, wherein the continuous nucleotide sequence comprises LNA nucleosides and 2'-fluoro RNA nucleosides.

[0586] 16. An antisense oligonucleotide according to any one of embodiments 1-13, wherein the continuous nucleotide sequence comprises any of the following

[0587] (i) only LNA and DNA nucleosides

[0588] (ii) only LNA and 2'-O-methoxyethyl nucleosides

[0589] (iii) only LNA, DNA and 2'-O-methoxyethyl nucleosides

[0590] (iv) only LNA, 2'-fluoro RNA and 2'-O-methoxyethyl nucleosides

[0591] (v) only LNA, DNA, 2'-fluoro RNA and 2'-O-methoxyethyl nucleosides or only LNA, 2'-fluoro RNA and 2'-O-methoxyethyl nucleosides

[0592] (vi) only 2'-O-methoxyethyl nucleosides

[0593] 17. An antisense oligonucleotide according to any one of embodiments 1-16, wherein the continuous nucleotide sequence does not comprise a sequence of 4 or more consecutive DNA nucleosides, or does not comprise a sequence of three or more consecutive DNA nucleosides.

[0594] 18. An antisense oligonucleotide according to any one of embodiments 1–17, wherein the antisense oligonucleotide or its continuous nucleotide sequence is a mixed polymer oligonucleotide or a homopolymer oligonucleotide.

[0595] 19. An antisense oligonucleotide according to any one of embodiments 1-18, wherein the antisense oligonucleotide is not capable of recruiting human RNase H1.

[0596] 20. An antisense oligonucleotide according to any one of embodiments 1–19, wherein the nucleoside (A 2 ) is the 3'-terminal nucleoside of the continuous nucleotide sequence or the oligonucleotide.

[0597] 21. An antisense oligonucleotide according to any one of embodiments 1–20, wherein the nucleoside (A1) is the 5'-terminal nucleoside of the continuous nucleotide sequence or the oligonucleotide.

[0598] 22. An antisense oligonucleotide according to any one of embodiments 1–21, comprising at least two phosphorodithioate internucleoside linkages of formula I, such as 2, 3, 4, 5 or 6 phosphorodithioate internucleoside linkages of formula I.

[0599] 23. An antisense oligonucleotide according to any one of embodiments 1–22, wherein the internucleoside linkage between the 2 3'-terminal nucleosides of the continuous nucleotide sequence is a phosphorodithioate internucleoside linkage of formula I, and wherein the internucleoside linkage between the 2 5'-terminal nucleosides of the continuous nucleotide sequence is a phosphorodithioate internucleoside linkage of formula I.

[0600] 24. An antisense oligonucleotide according to any one of embodiments 1-23, further comprising phosphorothioate internucleoside linkages.

[0601] 25. An antisense oligonucleotide according to any one of embodiments 1-24, further comprising stereodefined phosphorothioate internucleoside linkages.

[0602] 26. An antisense oligonucleotide according to any one of embodiments 1-25, wherein the remaining internucleoside linkages are independently selected from phosphorodithioate internucleoside linkages, phosphorothioate internucleoside linkages, and phosphodiester internucleoside linkages.

[0603] 27. An antisense oligonucleotide according to any one of embodiments 1-26, wherein the remaining internucleoside linkages are phosphorothioate internucleoside linkages.

[0604] 28. An antisense oligonucleotide according to any one of embodiments 1-27, wherein the continuous nucleotide sequence is complementary to, such as 100% complementary to, a mammalian pre-mRNA, a mammalian mature mRNA target, a viral RNA target, or a mammalian non-coding long RNA.

[0605] 29. An antisense oligonucleotide according to any one of embodiments 28, wherein the RNA target is a human RNA target.

[0606] 30. An antisense oligonucleotide according to any one of embodiments 1–29, wherein the antisense oligonucleotide modulates the splicing of a mammalian (such as human) pre-mRNA target, for example, is a splicing-switching or splicing-regulatory antisense oligonucleotide.

[0607] 31. An antisense oligonucleotide according to any one of embodiments 1–30, wherein the antisense oligonucleotide is complementary to, such as 100% complementary to, an intron / exon splicing site of a human pre-mRNA or a human pre-mRNA splicing regulatory region.

[0608] 32. An antisense oligonucleotide according to any one of embodiments 1–30, wherein the antisense oligonucleotide or its consecutive nucleotide sequence is complementary to, such as fully complementary to, a human pre-mRNA sequence selected from the following: TNFR2, HBB, FKTN, LMNA, CEP290, CLCN1, USH1C, BTK, LRP8, CTLA4, BCL2L1, ERBB4, MDM4, STAT3, IL1RAP, TNFRSF1B, FLT1, KDR, SMN2, MYBPC3, TTN, DMD, NBN, IL10, HTT, APOB, MSTN, GYS2, and ATXN3.

[0609] 33. An antisense oligonucleotide according to any one of embodiments 1–32, wherein the antisense oligonucleotide consists of or comprises a consecutive nucleotide sequence selected from SSO#1–SSO#25.

[0610] 34. An antisense oligonucleotide according to any one of embodiments 1–33, wherein the cell is a human cell.

[0611] 35. An antisense oligonucleotide according to any one of embodiments 1–34, wherein the length of the antisense oligonucleotide is 10–30 nucleotide lengths.

[0612] 36. An antisense oligonucleotide according to any one of embodiments 1–34, wherein the length of the antisense oligonucleotide is 12–24 nucleotide lengths.

[0613] 37. An antisense oligonucleotide according to any one of embodiments 1–36, wherein the 3'-terminal nucleoside of the antisense oligonucleotide or its consecutive nucleotide sequence is an LNA nucleoside or a 2-O-methoxyethyl nucleoside.

[0614] 38. An antisense oligonucleotide according to any one of embodiments 1–27, wherein the 5'-terminal nucleoside of the antisense oligonucleotide or its consecutive nucleotide sequence is an LNA nucleoside or a 2-O-methoxyethyl nucleoside.

[0615] 39. An antisense oligonucleotide according to any one of embodiments 1–38, wherein both the 5'-terminal nucleoside and the 3'-terminal nucleoside of the antisense oligonucleotide or its consecutive nucleotide sequence are LNA nucleosides.

[0616] 40. An antisense oligonucleotide according to any one of embodiments 1–39, wherein the consecutive nucleotide sequence comprises at least one region having two or three consecutive LNA nucleotides and / or at least one region having two or three consecutive 2'-O-methoxyethyl nucleotides.

[0617] 41. A pharmaceutically acceptable salt of the oligonucleotide according to any one of embodiments 1 to 40, in particular a sodium salt, a potassium salt or an ammonium salt.

[0618] 42. A conjugate comprising an oligonucleotide or a pharmaceutically acceptable salt according to any one of embodiments 1 to 41 and at least one conjugate moiety covalently linked to the oligonucleotide or the pharmaceutically acceptable salt, optionally via a linker moiety.

[0619] 43. A pharmaceutical composition comprising an oligonucleotide, a pharmaceutically acceptable salt or a conjugate according to any one of embodiments 1 to 42 and a therapeutically inert carrier.

[0620] 44. Use of an oligonucleotide, a pharmaceutically acceptable salt or a conjugate according to any one of embodiments 1 to 43 as a therapeutically active substance.

[0621] 45. A method for modulating the RNA in a cell that is expressing a target RNA, the method comprising the step of administering to the cell an effective amount of an oligonucleotide, a pharmaceutically acceptable salt, a conjugate or a composition according to any one of embodiments 1–44.

[0622] 46. A method for modulating the splicing of a target pre-RNA in a cell that is expressing the target pre-RNA, the method comprising the step of administering to the cell an effective amount of an oligonucleotide, a pharmaceutically acceptable salt, a conjugate or a composition according to any one of embodiments 1–44.

[0623] 47. The method according to embodiment 45 or 46, wherein the method is an in vitro method or an in vivo method.

[0624] 48. Use of an oligonucleotide, a pharmaceutical salt, a conjugate or a composition according to any one of embodiments 1–44 for inhibiting RNA in a cell (such as in a human cell), wherein the use is in vitro or in vivo.

[0625] Certain hetero-polymer embodiments

[0626] 1. A single-stranded antisense oligonucleotide for modulating an RNA target in a cell, wherein the antisense oligonucleotide comprises or consists of a continuous nucleotide sequence having a length of 10–30 nucleotides, wherein the continuous nucleotide sequence comprises an alternating region of nucleosides having one or more 2'-sugar modifications, wherein the maximum length of consecutive DNA nucleosides having the continuous nucleotide sequence is 3 or 4, and wherein at least one of the internucleoside bonds present between the nucleosides of the continuous nucleotide sequence is a phosphorodithioate bond of formula (IA) or (IB)

[0627]

[0628] One of the two oxygen atoms is linked to the 3'-carbon atom of the adjacent nucleoside (A1) and the other oxygen atom is linked to the 5'-carbon atom of the other adjacent nucleoside (A2), and wherein R is hydrogen or a phosphate protecting group.

[0629] 2. The antisense oligonucleotide according to embodiment 1, wherein at least one of the two nucleosides (A 1 ) and (A 2 ) is a 2'-sugar modified nucleoside.

[0630] 3. The antisense oligonucleotide according to embodiment 1, wherein both of the two nucleosides (A 1 ) and (A 2 ) are 2'-sugar modified nucleosides.

[0631] 4. The antisense oligonucleotide according to any one of embodiments 1-3, wherein at least one of the two nucleosides (A 1 ) and (A 2 ) or both of the two nucleosides (A 1 ) and (A 2 ) are DNA nucleosides.

[0632] 5. The antisense oligonucleotide according to any one of embodiments 1-4, wherein at least one of the two nucleosides (A 1 ) and (A 2 ) is a 2'-sugar modified nucleoside or the nucleosides are independently selected from 2'-alkoxy-RNA, 2'-alkoxyalkoxy-RNA, 2'-amino-DNA, 2'-fluoro-RNA, 2'-fluoro-ANA or LNA nucleosides.

[0633] 6. The antisense oligonucleotide according to any one of embodiments 1-5, wherein at least one of (A 1 ) and (A 2 ) is an LNA nucleoside.

[0634] 7. The antisense oligonucleotide according to any one of embodiments 1-5, wherein both of (A 1 ) and (A 2 ) are LNA nucleosides.

[0635] 8. The antisense oligonucleotide according to any one of embodiments 1-6, wherein at least one of (A 1 ) and (A 2 ) is a 2'-O-methoxyethyl nucleoside.

[0636] 9. The antisense oligonucleotide according to any one of embodiments 1-5, wherein both of (A 1 ) and (A 2 ) are 2'-O-methoxyethyl nucleosides.

[0637] 10. An antisense oligonucleotide according to any one of embodiments 1–8, wherein the LNA nucleosides are selected from β-D-oxy-LNA, 6’-methyl-β-D-oxy-LNA, and ENA.

[0638] 11. An antisense oligonucleotide according to any one of embodiments 1–8, wherein the LNA nucleoside is β-D-oxy-LNA.

[0639] 12. An antisense oligonucleotide according to any one of embodiments 1–11, wherein the contiguous nucleotide sequence comprises one or more other 2’-sugar modified nucleosides, such as one or more other 2’-sugar modified nucleosides selected from 2’-alkoxy-RNA, 2’-alkoxyalkoxy-RNA, 2’-amino-DNA, 2'-fluoro-RNA, 2'-fluoro-ANA, or LNA nucleosides.

[0640] 13. An antisense oligonucleotide according to any one of embodiments 1-12, wherein the contiguous nucleotide sequence comprises LNA nucleosides and DNA nucleosides.

[0641] 14. An antisense oligonucleotide according to any one of embodiments 1-12, wherein the contiguous nucleotide sequence comprises LNA nucleosides and 2’-O-methoxyethyl nucleosides.

[0642] 15. An antisense oligonucleotide according to any one of embodiments 1-13, wherein the contiguous nucleotide sequence comprises LNA nucleosides and 2’-fluoro-RNA nucleosides.

[0643] 16. An antisense oligonucleotide according to any one of embodiments 1-13, wherein the contiguous nucleotide sequence comprises any one of the following

[0644] (i) LNA and DNA nucleosides

[0645] (ii) LNA, DNA, and 2’-O-methoxyethyl nucleosides

[0646] (iii) LNA, DNA, 2’-fluoro-RNA, and 2’-O-methoxyethyl nucleosides

[0647] 17. An antisense oligonucleotide according to any one of embodiments 1-16, wherein the contiguous nucleotide sequence does not comprise a sequence of 3 or more contiguous DNA nucleosides, or does not comprise a sequence of 2 or more contiguous DNA nucleosides.

[0648] 18. An antisense oligonucleotide according to any one of embodiments 1–17, wherein the antisense oligonucleotide or its contiguous nucleotide sequence is a mixed polymer oligonucleotide, such as a splicing regulatory oligonucleotide or a microRNA inhibitor oligonucleotide.

[0649] 19. The antisense oligonucleotide according to embodiment 18, wherein the copolymer consists of the following alternating region motifs or comprises the foregoing motifs

[0650] [L]m[D]n[L]m[D]n[L]m or

[0651] [L]m[D]n[L]m[D]n[L]m[D]n[L]m or

[0652] [L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m or

[0653] [L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m or

[0654] [L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m or

[0655] [L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m or

[0656] [L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m or

[0657] [L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m

[0658] wherein L represents a 2'-sugar modified nucleoside, D represents a DNA nucleoside, and wherein each m is independently selected from 1-6, and each n is independently selected from 1, 2, 3, and 4, as 1-3.

[0659] 20. The antisense oligonucleotide according to embodiment 19, wherein each L nucleoside is independently selected from LNA, 2'-O-MOE, or 2'-fluoro nucleoside, or each L is independently LNA or 2'-O-MOE.

[0660] 21. The antisense oligonucleotide according to embodiment 20, wherein each L is LNA.

[0661] 22. The antisense oligonucleotide according to any one of embodiments 1-21, wherein the antisense oligonucleotide is unable to recruit human RNase H1.

[0662] 23. An antisense oligonucleotide according to any one of embodiments 1–22, wherein the nucleoside (A 2 ) is the 3'-terminal nucleoside of a continuous nucleotide sequence or of the oligonucleotide.

[0663] 24. An antisense oligonucleotide according to any one of embodiments 1–23, wherein the nucleoside (A 1 ) is the 5'-terminal nucleoside of a continuous nucleotide sequence or of the oligonucleotide.

[0664] 25. An antisense oligonucleotide according to any one of embodiments 1–24, which comprises at least two phosphorodithioate internucleoside linkages of formula I, such as 2, 3, 4, 5 or 6 phosphorodithioate internucleoside linkages of formula I.

[0665] 26. An antisense oligonucleotide according to any one of embodiments 1–25, wherein the continuous nucleotide sequence comprises two consecutive DNA nucleotides, and the internucleoside bond between the two consecutive DNA nucleotides is a phosphorodithioate internucleoside linkage of formula (IA) or (IB), i.e., a P2S-linked DNA nucleotide pair.

[0666] 27. An antisense oligonucleotide according to any one of embodiments 1–26, wherein the continuous nucleotide sequence comprises more than one P2S-linked DNA nucleotide pair.

[0667] 28. An antisense oligonucleotide according to any one of embodiments 1–26, wherein all of the internucleoside bonds between two consecutive DNA nucleotides present in the continuous nucleotide sequence are phosphorodithioate internucleoside linkages of formula (IA) or (IB).

[0668] 29. An antisense oligonucleotide according to any one of embodiments 1–27, wherein at least one internucleoside bond between a 2'-sugar-modified nucleoside and a DNA nucleoside is a phosphorodithioate internucleoside linkage of formula (IA) or (IB).

[0669] 30. An antisense oligonucleotide according to any one of embodiments 1–27, wherein more than one internucleoside bond between a 2'-sugar-modified nucleoside and a DNA nucleoside is a phosphorodithioate internucleoside linkage of formula (IA) or (IB).

[0670] 31. An antisense oligonucleotide according to any one of embodiments 1–27, wherein all of the more than one internucleoside bonds between a 2'-sugar-modified nucleoside and a DNA nucleoside are phosphorodithioate internucleoside linkages of formula (IA) or (IB).

[0671] 32. An antisense oligonucleotide according to any one of embodiments 1–27, wherein at least one of the internucleoside linkages between two 2'-sugar-modified nucleosides is not a phosphorodithioate internucleoside linkage of formula (IA) or (IB), e.g., is a phosphorothioate internucleoside linkage.

[0672] 33. An antisense oligonucleotide according to any one of embodiments 1–27, wherein all of the internucleoside linkages between two 2'-sugar-modified nucleosides are not phosphorodithioate internucleoside linkages of formula (IA) or (IB), e.g., are phosphorothioate internucleoside linkages.

[0673] 34. An antisense oligonucleotide according to any one of embodiments 1–33, wherein the internucleoside linkage between the two 3'-terminal nucleosides of a continuous nucleotide sequence is a phosphorodithioate internucleoside linkage of formula I, and wherein the internucleoside linkage between the two 5'-terminal nucleosides of the continuous nucleotide sequence is a phosphorodithioate internucleoside linkage of formula I.

[0674] 35. An antisense oligonucleotide according to any one of embodiments 1-34, which further comprises a phosphorothioate internucleoside linkage.

[0675] 36. An antisense oligonucleotide according to any one of embodiments 1-35, which further comprises a stereodefined phosphorothioate internucleoside linkage.

[0676] 37. An antisense oligonucleotide according to any one of embodiments 1-35, wherein the remaining internucleoside linkages are independently selected from phosphorodithioate internucleoside linkages, phosphorothioate internucleoside linkages, and phosphodiester internucleoside linkages.

[0677] 38. An antisense oligonucleotide according to any one of embodiments 1-36, wherein the remaining internucleoside linkages are phosphorothioate internucleoside linkages.

[0678] 39. An antisense oligonucleotide according to any one of embodiments 1-37, wherein the continuous nucleotide sequence is complementary to, e.g., 100% complementary to, mammalian (e.g., human) pre-mRNA.

[0679] 40. An antisense oligonucleotide according to any one of embodiments 1–38, wherein the antisense oligonucleotide regulates the splicing of a mammalian (e.g., human) pre-mRNA target, e.g., is a splicing-switching or splicing-modulating antisense oligonucleotide.

[0680] 41. An antisense oligonucleotide according to any one of embodiments 1–39, wherein the antisense oligonucleotide is complementary to, e.g., 100% complementary to, an intron / exon splicing site of human pre-mRNA or a human pre-mRNA splicing regulatory region.

[0681] 42. An antisense oligonucleotide according to any one of embodiments 1 - 41, wherein the antisense oligonucleotide or its contiguous nucleotide sequence is complementary to, such as fully complementary to, a human pre-mRNA sequence selected from the group consisting of: TNFR2, HBB, FKTN, LMNA, CEP290, CLCN1, USH1C, BTK, LRP8, CTLA4, BCL2L1, ERBB4, MDM4, STAT3, IL1RAP, TNFRSF1B, FLT1, KDR, SMN2, MYBPC3, TTN, DMD, NBN, IL10, HTT, APOB, MSTN, GYS2, and ATXN3.

[0682] 43. An antisense oligonucleotide according to any one of embodiments 1 - 42, wherein the antisense oligonucleotide consists of or comprises a contiguous nucleotide sequence selected from SSO#1 - SSO#25.

[0683] 44. An antisense oligonucleotide according to any one of embodiments 1 - 43, wherein the cell is a mammalian cell.

[0684] 45. An antisense oligonucleotide according to any one of embodiments 1 - 44, wherein the antisense oligonucleotide has a length of 10 - 30 nucleotide lengths.

[0685] 46. An antisense oligonucleotide according to any one of embodiments 1 - 44, wherein the antisense oligonucleotide has a length of 12 - 24 nucleotide lengths.

[0686] 47. An antisense oligonucleotide according to any one of embodiments 1 - 46, wherein the 3'-terminal nucleoside of the antisense oligonucleotide or its contiguous nucleotide sequence is an LNA nucleoside or a 2'-O-methoxyethyl nucleoside.

[0687] 48. An antisense oligonucleotide according to any one of embodiments 1 - 47, wherein the 5'-terminal nucleoside of the antisense oligonucleotide or its contiguous nucleotide sequence is an LNA nucleoside or a 2'-O-methoxyethyl nucleoside.

[0688] 49. An antisense oligonucleotide according to any one of embodiments 1 - 48, wherein both the 5'-terminal nucleoside and the 3'-terminal nucleoside of the antisense oligonucleotide or its contiguous nucleotide sequence are LNA nucleosides.

[0689] 50. An antisense oligonucleotide according to any one of embodiments 1 - 49, wherein the contiguous nucleotide sequence comprises at least one region having two or three contiguous LNA nucleotides and / or at least one region having two or three contiguous 2'-O-methoxyethyl nucleotides.

[0690] 51. A pharmaceutically acceptable salt of an oligonucleotide according to any one of embodiments 1 to 50, in particular a sodium salt, a potassium salt or an ammonium salt.

[0691] 52. A conjugate comprising an oligonucleotide or a pharmaceutically acceptable salt according to any one of embodiments 1 to 51 and at least one conjugate moiety covalently linked to the oligonucleotide or the pharmaceutically acceptable salt, optionally via a linker moiety.

[0692] 53. A pharmaceutical composition comprising an oligonucleotide, a pharmaceutically acceptable salt or a conjugate according to any one of embodiments 1 to 52 and a therapeutically inert carrier.

[0693] 54. An oligonucleotide, a pharmaceutically acceptable salt or a conjugate according to any one of embodiments 1 to 53 for use as a therapeutically active substance.

[0694] 55. A method for modulating said RNA in a cell that is expressing a target RNA, said method comprising the step of administering to the cell an effective amount of an oligonucleotide, a pharmaceutically acceptable salt, a conjugate or a composition according to any one of embodiments 1–54.

[0695] 56. A method for modulating the splicing process of a precursor RNA in a cell that is expressing a target precursor RNA, said method comprising the step of administering to the cell an effective amount of an oligonucleotide, a pharmaceutically acceptable salt, a conjugate or a composition according to any one of embodiments 1–54.

[0696] 57. The method according to embodiment 55 or 56, wherein the method is an in vitro method or an in vivo method.

[0697] 58. Use of an oligonucleotide, a pharmaceutical salt, a conjugate or a composition according to any one of embodiments 1–54 for inhibiting RNA in a cell (such as a mammalian cell), wherein the use is in vitro or in vivo.

[0698] Certain embodiments related to 3'-end protection

[0699] 1. A single-stranded antisense oligonucleotide comprising at least one phosphorodithioate internucleoside bond of formula (IA) or (IB)

[0700]

[0701] One of the two oxygen atoms is linked to the 3'-carbon atom of the adjacent nucleoside (A1) and the other oxygen atom is linked to the 5'-carbon atom of the other adjacent nucleoside (A2), and wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as a Na+ or K+ cation; or M+ is an ammonium cation, and wherein at least one of the two nucleosides (A1) and (A2) is a 2'-sugar modified nucleoside, such as an LNA nucleoside or a 2'-O-MOE nucleoside, and wherein R is hydrogen or a phosphate protecting group, wherein A2 is the 3'-terminal nucleoside of the oligonucleotide.

[0702] 2. The single-stranded antisense oligonucleotide according to embodiment 1, wherein (A 2 ) is an LNA nucleoside, or both (A 1 ) and (A 2 ) are LNA nucleosides.

[0703] 3. The single-stranded antisense oligonucleotide according to embodiment 1, wherein (A 2 ) is an LNA nucleoside and (A 1 ) is a sugar-modified nucleotide.

[0704] 4. The single-stranded antisense oligonucleotide according to embodiment 1, wherein (A 2 ) is an LNA nucleoside and (A 1 ) is a DNA nucleotide.

[0705] 5. The single-stranded antisense oligonucleotide according to embodiment 1, wherein (A 1 ) is an LNA nucleoside and (A 2 ) is a sugar-modified nucleotide.

[0706] 6. The single-stranded antisense oligonucleotide according to embodiment 1, wherein (A 1 ) is an LNA nucleoside and (A 2 ) is a DNA nucleotide.

[0707] 7. The single-stranded antisense oligonucleotide according to any one of embodiments 3 or 5, wherein the sugar-modified nucleoside is a 2'-sugar modified nucleoside.

[0708] 8. The single-stranded antisense oligonucleotide according to embodiment 7, wherein the 2'-sugar modified nucleoside is 2'-alkoxy-RNA, 2'-alkoxyalkoxy-RNA, 2'-amino-DNA, 2'-fluoro-RNA, 2'-fluoro-ANA or an LNA nucleoside.

[0709] 9. The single-stranded antisense oligonucleotide according to embodiment 7 or 8, wherein the 2'-sugar modified nucleoside is 2'-O-methoxyethyl nucleoside.

[0710] 10. A single-stranded antisense oligonucleotide according to any one of embodiments 1-9, wherein the LNA nucleoside or nucleotide is in the β-D configuration.

[0711] 11. A single-stranded antisense oligonucleotide according to any one of embodiments 1 to 10, wherein the LNA nucleosides are independently selected from β-D-oxy-LNA, 6'-methyl-β-D-oxy-LNA, and ENA.

[0712] 12. A single-stranded antisense oligonucleotide according to any one of embodiments 1 to 11, wherein the LNA is β-D-oxy-LNA.

[0713] 13. A single-stranded antisense oligonucleotide according to any one of embodiments 1–12, wherein the single-stranded antisense oligonucleotide consists of or comprises 7–30 consecutive nucleotides complementary to a target nucleic acid (such as a target nucleic acid selected from pre-mRNA, mRNA, microRNA, viral RNA, and non-coding long RNA) [termed the consecutive nucleotide sequence of the single-stranded oligonucleotide].

[0714] 14. A single-stranded antisense oligonucleotide according to any one of embodiments 1 to 13, wherein the consecutive nucleotide sequence comprises a gapmer region of the formula 5'-F-G-F'-3', wherein G is a region of 5 to 18 nucleosides capable of recruiting RNase H, and said region G is flanked on the 5' and 3' sides by flanking regions F and F', respectively, wherein regions F and F' independently comprise or consist of 1 to 7 2'-sugar-modified nucleotides, and wherein the nucleosides of region F adjacent to region G are 2'-sugar-modified nucleosides and the nucleosides of region F' adjacent to region G are 2'-sugar-modified nucleosides.

[0715] 14. A single-stranded antisense oligonucleotide according to any one of embodiments 1 to 13, wherein the consecutive nucleotide sequence is a mixed polymer oligonucleotide, wherein the mixed polymer oligonucleotide comprises LNA nucleosides and DNA nucleosides, and optionally 2'-sugar-modified nucleosides [such as those according to embodiments 8–9], wherein the single-stranded antisense oligonucleotide does not comprise a region of 4 or more consecutive DNA nucleosides.

[0716] 15. A single-stranded antisense oligonucleotide according to any one of embodiments 1 to 13, wherein the consecutive nucleotide sequence consists only of sugar-modified nucleosides.

[0717] 16. The oligonucleotide according to embodiment 14 or 15, wherein the oligonucleotide is a splicing regulatory oligonucleotide [capable of regulating the splicing of pre-mRNA splicing events].

[0718] 17. The oligonucleotide according to embodiment 14 or 15, wherein the oligonucleotide is complementary to a microRNA, e.g., is a microRNA inhibitor.

[0719] 18. An oligonucleotide according to any one of embodiments 1 to 17, comprising internucleoside linkages other than phosphodiester internucleoside linkages, phosphorothioate internucleoside linkages, and dithiophosphonate internucleoside linkages, independently selected therefrom; or wherein the other internucleoside linkages within the oligonucleotide or within its contiguous nucleotide sequence are independently selected from phosphorothioate internucleoside linkages and dithiophosphonate internucleoside linkages.

[0720] 18. An oligonucleotide according to any one of embodiments 1 - 18, wherein the other internucleoside linkages of the oligonucleotide or its contiguous nucleotide sequence are all phosphorothioate internucleoside linkages.

[0721] 19. An oligonucleotide according to any one of embodiments 1–18, wherein the oligonucleotide comprises a 5' region that is position 5' relative to the contiguous nucleotide sequence, and wherein the 5' nucleoside region comprises at least one phosphodiester bond.

[0722] 20. The oligonucleotide according to embodiment 19, wherein the 5' region comprises 1–5 phosphodiester-linked DNA nucleosides, and optionally the oligonucleotide or its contiguous nucleotide sequence can be linked to a conjugate moiety.

[0723] 21. An oligonucleotide according to any one of embodiments 1 to 20, wherein one or more nucleosides are nucleobase-modified nucleosides.

[0724] 22. An oligonucleotide according to any one of embodiments 1 to 21, wherein one or more nucleosides are 5-methylcytosines, such as LNA 5-methylcytosine or DNA 5-methylcytosine.

[0725] 23. A pharmaceutically acceptable salt of an oligonucleotide according to any one of embodiments 1 to 22, especially a sodium salt, a potassium salt, or an ammonium salt.

[0726] 24. A conjugate comprising an oligonucleotide or a pharmaceutically acceptable salt according to any one of embodiments 1 to 23 and at least one conjugate moiety covalently linked to the oligonucleotide or the pharmaceutically acceptable salt, optionally via a linker moiety.

[0727] 25. A pharmaceutical composition comprising an oligonucleotide, a pharmaceutically acceptable salt, or a conjugate according to any one of embodiments 1 to 24 and a therapeutically inert carrier.

[0728] 26. An oligonucleotide, a pharmaceutically acceptable salt, or a conjugate according to any one of embodiments 1 to 25 for use as a therapeutically active substance.

[0729] 27. An oligonucleotide, pharmaceutically acceptable salt or conjugate according to any one of embodiments 1 to 24 for use in therapy, for administration to a subject by parenteral administration (such as intravenous, subcutaneous, intramuscular, intracerebral, intraocular, intracerebroventricular or intrathecal administration).

[0730] Embodiments relating to oligonucleotides having achiral phosphorothioate and stereodefined phosphorothioate linkages

[0731] 1. A single-stranded antisense oligonucleotide comprising at least one phosphorothioate internucleoside linkage of formula (IA) or (IB)

[0732]

[0733] wherein one of the two oxygen atoms is linked to the 3'-carbon atom of the adjacent nucleoside (A1) and the other oxygen atom is linked to the 5'-carbon atom of the other adjacent nucleoside (A2), and wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as a Na+ or K+ cation; or M+ is an ammonium cation, and wherein the single-stranded oligonucleotide further comprises at least one stereodefined phosphorothioate internucleoside linkage, being (Sp,S) or (Rp,R)

[0734]

[0735] wherein N 1 and N 2 are nucleosides. (Note: In some non-limiting embodiments, N 1 and / or N 2 are DNA nucleotides).

[0736] 2. The single-stranded antisense oligonucleotide according to embodiment 1, wherein A2 is the 3'-terminal nucleoside of the oligonucleotide.

[0737] 3. The single-stranded antisense oligonucleotide according to embodiment 1, wherein A1 is the 5'-terminal nucleoside of the oligonucleotide.

[0738] 4. The single-stranded antisense oligonucleotide according to any one of embodiments 1 - 3, wherein the single-stranded oligonucleotide comprises 1, 2, 3, 4, 5 or 6 internucleoside linkages of formula IB.

[0739] 5. The single-stranded antisense oligonucleotide according to any one of embodiments 1 - 4, wherein both the 5'-terminal internucleoside linkage and the 3'-terminal internucleoside linkage of the antisense oligonucleotide are internucleoside linkages of formula IB.

[0740] 6. A single-stranded antisense oligonucleotide according to any one of embodiments 1-5, wherein in at least one of the internucleoside linkages of formula IB, at least one of the two nucleosides (A1) and (A2) is a 2'-sugar modified nucleoside, such as a 2'-sugar modified nucleoside selected from 2'-alkoxy-RNA, 2'-alkoxyalkoxy-RNA, 2'-amino-DNA, 2'-fluoro-RNA, 2'-fluoro-ANA, and LNA nucleosides.

[0741] 7. A single-stranded antisense oligonucleotide according to any one of embodiments 1-6, wherein in at least one of the internucleoside linkages of formula IB, at least one of the two nucleosides (A1) and (A2) is an LNA nucleoside.

[0742] 8. A single-stranded antisense oligonucleotide according to any one of embodiments 1-6, wherein in at least one of the internucleoside linkages of formula IB, at least one of the two nucleosides (A1) and (A2) is a 2'-O-MOE nucleoside.

[0743] 9. A single-stranded antisense oligonucleotide according to any one of embodiments 1-8, wherein the 3'-terminal nucleoside of the antisense oligonucleotide is an LNA nucleoside or a 2'-O-MOE nucleoside.

[0744] 10. A single-stranded antisense oligonucleotide according to any one of embodiments 1-9, wherein the 5'-terminal nucleoside of the antisense oligonucleotide is an LNA nucleoside or a 2'-O-MOE nucleoside.

[0745] 11. A single-stranded antisense oligonucleotide according to any one of embodiments 1–10, wherein the two 3'-most terminal nucleosides of the antisense oligonucleotide are independently selected from LNA nucleosides and 2'-O-MOE nucleosides.

[0746] 12. A single-stranded antisense oligonucleotide according to any one of embodiments 1–11, wherein the two 5'-most terminal nucleosides of the antisense oligonucleotide are independently selected from LNA nucleosides and 2'-O-MOE nucleosides.

[0747] 13. A single-stranded antisense oligonucleotide according to any one of embodiments 1–12, wherein the three 3'-most terminal nucleosides of the antisense oligonucleotide are independently selected from LNA nucleosides and 2'-O-MOE nucleosides.

[0748] 14. A single-stranded antisense oligonucleotide according to any one of embodiments 1–13, wherein the three 5'-most terminal nucleosides of the antisense oligonucleotide are independently selected from LNA nucleosides and 2'-O-MOE nucleosides.

[0749] 15. A single-stranded antisense oligonucleotide according to any one of embodiments 1–14, wherein the two 3'-most terminal nucleosides of the antisense oligonucleotide are LNA nucleosides.

[0750] 16. A single-stranded antisense oligonucleotide according to any one of embodiments 1–15, wherein the two 5'-most terminal nucleosides of the antisense oligonucleotide are LNA nucleosides.

[0751] 17. A single-stranded antisense oligonucleotide according to any one of embodiments 1–16, wherein the antisense oligonucleotide further comprises a region of 2–16 DNA nucleotides, wherein the internucleoside bond between the DNA nucleotides is a stereodefined phosphorothioate internucleoside bond.

[0752] 18. A single-stranded antisense oligonucleotide according to any one of embodiments 1 to 17, wherein the LNA nucleosides are independently selected from β-D-oxy-LNA, 6'-methyl-β-D-oxy-LNA, and ENA.

[0753] 19. A single-stranded antisense oligonucleotide according to any one of embodiments 1 to 17, wherein the LNA nucleoside is β-D-oxy-LNA.

[0754] 20. A single-stranded antisense oligonucleotide according to any one of embodiments 1–19, wherein the oligonucleotide consists of or comprises 7–30 consecutive nucleotides complementary to a target nucleic acid (such as being fully complementary to a target nucleic acid selected from pre-mRNA, mRNA, microRNA, viral RNA, and non-coding long RNA) [antisense oligonucleotide].

[0755] 21. A single-stranded antisense oligonucleotide according to any one of embodiments 1–20, wherein the single-stranded oligonucleotide is capable of modulating an RNA target.

[0756] 22. A single-stranded antisense oligonucleotide according to any one of embodiments 1–20, wherein the single-stranded antisense oligonucleotide is capable of inhibiting an RNA target, such as by RNAse H1 recruitment.

[0757] 23. A single-stranded antisense oligonucleotide according to any one of embodiments 1 to 22, wherein the consecutive nucleotide sequence of the oligonucleotide comprises a gapmer region of the formula 5'-F-G-F'-3', wherein G is a region of 5 to 18 nucleosides capable of recruiting RNAse H1, and the region G is flanked on the 5' and 3' sides by flanking regions F and F' respectively, wherein the regions F and F' independently comprise or consist of 1 to 7 2'-sugar-modified nucleotides, and the nucleoside of region F adjacent to region G is a 2'-sugar-modified nucleoside and the nucleoside of region F' adjacent to region G is a 2'-sugar-modified nucleoside.

[0758] 24. The single-stranded antisense oligonucleotide according to embodiment 23, wherein region F or region F' comprises an internucleoside bond of formula IB according to any one of embodiments 1-19.

[0759] 25. The single-stranded antisense oligonucleotide according to embodiment 24, wherein both region F and region F' comprise an internucleoside bond of formula IB according to any one of embodiments 1-19.

[0760] 26. The single-stranded antisense oligonucleotide according to embodiments 23-25, wherein all internucleoside bonds within region F and / or region F' are internucleoside bonds of formula IB according to any one of embodiments 1-19.

[0761] 27. The single-stranded antisense oligonucleotide according to embodiments 23–26, wherein both region F and region F' comprise or consist of LNA nucleosides.

[0762] 28. The single-stranded antisense oligonucleotide according to embodiments 23–27, wherein both region F and region F' comprise or consist of MOE nucleosides.

[0763] 29. The single-stranded antisense oligonucleotide according to embodiments 23–28, wherein region F comprises LNA nucleosides and F' comprises or consists of MOE nucleosides.

[0764] 30. The single-stranded antisense oligonucleotide according to embodiments 23–29, wherein region G further comprises at least one internucleoside bond of formula IB between the 3'-terminal nucleoside of region F and the 5'-terminal nucleoside of region G.

[0765] 31. The single-stranded antisense oligonucleotide according to embodiments 23–30, wherein region G comprises at least one stereodefined phosphorothioate bond between two DNA nucleosides.

[0766] 32. The single-stranded antisense oligonucleotide according to embodiments 23–31, wherein region G comprises at least one internucleoside bond of formula IB between two DNA nucleosides.

[0767] 33. The single-stranded antisense oligonucleotide according to embodiments 23–32, wherein region G further comprises at least 2, 3, or 4 internucleoside bonds of formula IB.

[0768] 34. The single-stranded antisense oligonucleotide according to embodiments 23–31, wherein all remaining internucleoside bonds within region G are stereodefined phosphorothioate internucleoside bonds, independently selected from Rp and Sp internucleoside bonds.

[0769] 35. A single-stranded antisense oligonucleotide according to embodiments 23–31, wherein all internucleoside linkages within region G are stereodefined phosphorothioate internucleoside linkages, independently selected from Rp and Sp internucleoside linkages, optionally except for the internucleoside linkage between the 3'-terminal nucleoside of region F and the 5'-terminal nucleoside of region G.

[0770] 36. A single-stranded antisense oligonucleotide according to any one of embodiments 1 to 22, wherein the antisense oligonucleotide comprises fewer than 4 consecutive DNA nucleotides.

[0771] 37. A single-stranded antisense oligonucleotide according to any one of embodiments 1 to 22 or 36, wherein the antisense oligonucleotide is a mixed polymer or a homopolymer oligonucleotide.

[0772] 38. A single-stranded oligonucleotide according to embodiment 37, wherein the mixed polymer oligonucleotide comprises LNA nucleosides and DNA nucleosides, and optionally 2'-sugar modified nucleosides (e.g., see the list in embodiment 6), such as 2'-O-MOE nucleosides.

[0773] 39. A single-stranded antisense oligonucleotide according to any one of embodiments 1 to 38, wherein the antisense oligonucleotide comprises a region of 3 or more consecutive MOE nucleosides, and optionally wherein all nucleosides of the oligonucleotide are 2'-MOE nucleosides.

[0774] 40. A single-stranded antisense oligonucleotide according to any one of embodiments 1–39, wherein the target is an mRNA or a pre-mRNA target.

[0775] 41. A single-stranded antisense oligonucleotide according to any one of embodiments 1–40, wherein the oligonucleotide targets a pre-mRNA splicing site or a pre-mRNA region that regulates splicing events at the pre-mRNA splicing site.

[0776] 42. A single-stranded antisense oligonucleotide according to any one of embodiments 1–41, which is a splicing regulatory oligonucleotide capable of regulating the pre-mRNA target splicing process.

[0777] 43. A single-stranded antisense oligonucleotide according to any one of embodiments 1–42, wherein the target is a microRNA.

[0778] 44. A single-stranded antisense oligonucleotide according to any one of embodiments 1–42, wherein the antisense oligonucleotide has a length of 10–20 nucleotides, such as 12–24 nucleotides.

[0779] 45. A single-stranded antisense oligonucleotide according to embodiment 43, wherein the length of the antisense oligonucleotide is 7–30, such as 8–12 or 12 to 23 nucleotides.

[0780] 46. A single-stranded antisense oligonucleotide comprising an antisense oligonucleotide according to any one of embodiments 1–45, wherein the oligonucleotide also has a 5′ region that is 5′ relative to a contiguous nucleotide sequence, and wherein the 5′ nucleoside region comprises at least one phosphodiester bond.

[0781] 47. The single-stranded antisense oligonucleotide according to embodiment 46, wherein the 5′ region comprises 1–5 phosphodiester-linked DNA nucleosides, and optionally the oligonucleotide or its contiguous nucleotide sequence can be linked to a conjugate moiety.

[0782] 48. The single-stranded antisense oligonucleotide according to any one of embodiments 1 to 47, wherein one or more nucleosides are nucleobase-modified nucleosides.

[0783] 49. The single-stranded antisense oligonucleotide according to any one of embodiments 1 to 48, wherein one or more nucleosides are 5-methylcytosines, such as LNA 5-methylcytosine or DNA 5-methylcytosine.

[0784] 50. A pharmaceutically acceptable salt of the single-stranded antisense oligonucleotide according to any one of embodiments 1 to 49, in particular a sodium salt, a potassium salt or an ammonium salt.

[0785] 51. A conjugate comprising a single-stranded antisense oligonucleotide or a pharmaceutically acceptable salt according to any one of embodiments 1 to 49 and at least one conjugate moiety covalently linked, optionally via a linker moiety, to the oligonucleotide or the pharmaceutically acceptable salt.

[0786] 52. A pharmaceutical composition comprising a single-stranded antisense oligonucleotide, a pharmaceutically acceptable salt or a conjugate according to any one of embodiments 1 to 51 and a therapeutically inert carrier.

[0787] 53. A single-stranded antisense oligonucleotide, a pharmaceutically acceptable salt or a conjugate according to any one of embodiments 1 to 52, for use as a therapeutic active substance.

[0788] 54. A single-stranded antisense oligonucleotide, a pharmaceutically acceptable salt or a conjugate according to any one of embodiments 1 to 53, for administration to a subject by parenteral administration (such as intravenous, subcutaneous, intramuscular, intracerebral, intraocular, intracerebroventricular or intrathecal administration).

[0789] 55. Use in vitro of a single-stranded antisense oligonucleotide, a salt or a composition according to any of the foregoing embodiments for inhibiting a target RNA in a cell, wherein the single-stranded antisense oligonucleotide is complementary to, such as fully complementary to, the target RNA.

[0790] 56. A method, in vivo or in vitro, for inhibiting a target RNA in a cell that is positively expressing the target RNA, the method comprising: administering to the cell an effective amount of an antisense oligonucleotide, pharmaceutically acceptable salt, conjugate, or composition according to any of the preceding embodiments, thereby aiming to inhibit the target RNA.

[0791] 57. Use, in vitro or in vivo, of a single-stranded antisense oligonucleotide, salt, or composition according to any of the preceding embodiments to regulate the splicing of a target pre-mRNA in a cell.

[0792] 58. A method, in vivo or in vitro, for regulating the splicing of a target pre-RNA in a cell that is positively expressing the target pre-RNA, the method comprising: administering to the cell an effective amount of an antisense oligonucleotide, salt, conjugate, or composition according to any of the preceding embodiments, thereby aiming to regulate the splicing process of the target RNA.

[0793] The antisense oligonucleotide of the present invention that targets Htra-1

[0794] In some embodiments, the antisense oligonucleotide of the present invention is complementary, for example, to the mRNA or pre-mRNA encoding human high temperature requirement A1 Serine protease (Htra1) – see WO 2018 / 002105. Inhibiting Htra1 expression using the antisense oligonucleotide of the present invention that targets Htra1 mRNA or pre-mRNA is beneficial for treating a series of medical conditions, such as macular degeneration, for example, age-related macular degeneration (geographic atrophy). The human Htra1 pre-mRNA and mRNA target sequences are available as follows:

[0795]

[0796] Listed as Htra1#1–38 in the examples are the compounds of the present invention that target Htra-1.

[0797] 1. An antisense oligonucleotide of the present invention having a length of 10–30 nucleotides, wherein the antisense oligonucleotide targets human HTRA1 mRNA or pre-mRNA, and wherein the antisense oligonucleotide comprises a continuous nucleotide region of 10–22 nucleotides that is at least 90% to 100% complementary to SEQ ID NO 1 or 2 of WO 2018 / 002105, which are disclosed as SEQ ID NO 9 and 10 in the sequence listing, and wherein the antisense oligonucleotide comprises at least one phosphorodithioate internucleoside bond of formula IA or formula IB.

[0798] 2. The antisense oligonucleotide according to embodiment 1 or 2, wherein the continuous nucleotide region is identical to a sequence present in a sequence selected from the following

[0799] SEQ ID NOs 11, 12, 13, 14, 15, 16, 17, and 18:

[0800] SEQ ID NO 11: CAAATATTTACCTGGTTG

[0801] SEQ ID NO 12: TTTACCTGGTTGTTGG

[0802] SEQ ID NO 13: CCAAATATTTACCTGGTT

[0803] SEQ ID NO 14: CCAAATATTTACCTGGTTGT

[0804] SEQ ID NO 15: ATATTTACCTGGTTGTTG

[0805] SEQ ID NO 16: TATTTACCTGGTTGTT

[0806] SEQ ID NO 17: ATATTTACCTGGTTGT

[0807] SEQ ID NO 18: ATATTTACCTGGTTGTT

[0808] 3. An antisense oligonucleotide according to any one of embodiments 1 - 3, wherein the contiguous nucleotide region comprises the sequence

[0809] SEQ ID NO 19: TTTACCTGGTT

[0810] 4. An antisense oligonucleotide according to any one of embodiments 1 - 4, wherein the contiguous nucleotide region of the oligonucleotide consists of or comprises a sequence selected from any one of SEQ ID NOs 11, 12, 13, 14, 15, 16, 17, and 18.

[0811] 5. An antisense oligonucleotide according to any one of embodiments 1 - 5, wherein the contiguous nucleotide region of the oligonucleotide comprises one or more 2'-sugar modified nucleosides, such as one or more 2'-sugar modified nucleosides independently selected from 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, arabinonucleic acid (ANA), 2'-fluoro-ANA, and LNA nucleosides.

[0812] 6. An antisense oligonucleotide according to any one of embodiments 1-5, wherein the contiguous nucleotide region of the oligonucleotide comprises at least one modified internucleoside bond, such as one or more phosphorothioate internucleoside bonds, or such that all internucleoside bonds within the contiguous nucleotide region are phosphorothioate internucleoside bonds.

[0813] 7. An antisense oligonucleotide according to any one of embodiments 1-6, wherein the oligonucleotide or its contiguous nucleotide sequence is or comprises a gapmer, such as a gapmer of formula 5'-F-G-F'-3', wherein regions F and F' independently comprise 1-7 sugar-modified nucleosides and G is a region of 6-16 nucleosides capable of recruiting RNase H, wherein the nucleosides in regions F and F' adjacent to region G are sugar-modified nucleosides.

[0814] 8. An antisense oligonucleotide according to embodiment 7, wherein at least one or both of regions F and F' each comprise at least one LNA nucleoside.

[0815] 9. An antisense oligonucleotide according to any one of embodiments 1–8, selected from: Htra1#1–38, wherein capital letters represent β-D-oxy-LNA nucleoside units, lowercase letters represent DNA nucleoside units, subscript s represents a phosphorothioate internucleoside bond, wherein all LNA cytosines are 5-methylcytosines, P represents a dithiophosphonate internucleoside bond of formula IB, S represents a Sp-defined stereogenic phosphorothioate internucleoside bond, R represents a Rp-defined stereogenic phosphorothioate internucleoside bond, and X represents a stereorandom phosphorothioate bond.

[0816] 10. An antisense oligonucleotide according to any of the foregoing embodiments, which is in salt form, such as sodium salt, potassium salt or ammonium salt (e.g., a pharmaceutically acceptable salt).

[0817] 11. A conjugate comprising an oligonucleotide according to any one of embodiments 1–10 and at least one conjugate moiety covalently linked to the oligonucleotide, or a salt thereof.

[0818] 12. A pharmaceutical composition comprising an oligonucleotide of embodiments 1-10 or a conjugate of embodiment 11 and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

[0819] 13. An in vivo or in vitro method of modulating HTRA1 expression in a target cell that positively expresses HTRA1, the method comprising administering to the cell, in an effective amount, an oligonucleotide according to any one of embodiments 1–10 or a conjugate according to embodiment 11 or a pharmaceutical composition according to embodiment 12.

[0820] 14. A method for treating or preventing a disease, comprising administering to a subject suffering from or susceptible to a disease a therapeutically effective amount or a prophylactically effective amount of an oligonucleotide of any one of embodiments 1–10, or a conjugate according to embodiment 11, or a pharmaceutical composition according to embodiment 12.

[0821] 15. An oligonucleotide of any one of embodiments 1–10, or a conjugate according to embodiment 11, or a pharmaceutical composition according to embodiment 12, for use in a medicament.

[0822] 16. An oligonucleotide of any one of embodiments 1–10, or a conjugate according to embodiment 11, or a pharmaceutical composition according to embodiment 12, for treating or preventing a disease selected from macular degeneration (such as wet AMD, dry AMD, geographic atrophy, intermediate dAMD, diabetic retinopathy), Parkinson's disease, Alzheimer's disease, Duchenne muscular dystrophy, arthritis (such as osteoarthritis), and familial ischemic cerebral small vessel disease.

[0823] 17. Use of an oligonucleotide of embodiments 1–10, or a conjugate according to embodiment 11, or a pharmaceutical composition according to embodiment 12, for the preparation of a medicament for treating or preventing a disease selected from macular degeneration (such as wet AMD, dry AMD, geographic atrophy, intermediate dAMD, diabetic retinopathy), Parkinson's disease, Alzheimer's disease, Duchenne muscular dystrophy, arthritis (such as osteoarthritis), and familial ischemic cerebral small vessel disease.

[0824] 18. An oligonucleotide, conjugate, salt or composition or use according to any of the foregoing embodiments, for treating geographic atrophy.

[0825] Other embodiments of the present invention

[0826] The present invention thus particularly relates to:

[0827] An oligonucleotide of the present invention, wherein the oligonucleotide is an antisense oligonucleotide capable of regulating the expression of a target RNA in a cell expressing the target RNA;

[0828] An oligonucleotide of the present invention, wherein the oligonucleotide is an antisense oligonucleotide capable of inhibiting the expression of a target RNA in a cell expressing the target RNA;

[0829] An oligonucleotide of the present invention, wherein one of (A 1 ) and (A 2 ) is an LNA nucleoside and the other is a DNA nucleoside, an RNA nucleoside or a sugar-modified nucleoside;

[0830] An oligonucleotide of the present invention, wherein one of (A 1 ) and (A 2)One of them is an LNA nucleoside and the other is a DNA nucleoside or a sugar-modified nucleoside;

[0831] The oligonucleotide of the present invention, wherein (A 1 ) and (A 2 )One of them is an LNA nucleoside and the other is a DNA nucleoside;

[0832] The oligonucleotide of the present invention, wherein (A 1 ) and (A 2 )One of them is an LNA nucleoside and the other is a sugar-modified nucleoside;

[0833] The oligonucleotide of the present invention, wherein the sugar-modified nucleoside is a 2'-sugar-modified nucleoside;

[0834] The oligonucleotide of the present invention, wherein the 2'-sugar-modified nucleoside is 2'-alkoxy-RNA, 2'-alkoxyalkoxy-RNA, 2'-amino-DNA, 2'-fluoro-RNA, 2'-fluoro-ANA or an LNA nucleoside;

[0835] The oligonucleotide of the present invention, wherein the 2'-sugar-modified nucleoside is an LNA nucleoside;

[0836] The oligonucleotide of the present invention, wherein the LNA nucleosides are independently selected from β-D-oxy-LNA, 6'-methyl-β-D-oxy-LNA and ENA;

[0837] The oligonucleotide of the present invention, wherein the LNA nucleosides are all β-D-oxy-LNA;

[0838] The oligonucleotide of the present invention, wherein the 2'-sugar-modified nucleoside is 2'-alkoxyalkoxy-RNA;

[0839] The oligonucleotide of the present invention, wherein 2'-alkoxy-RNA is 2'-methoxy-RNA;

[0840] The oligonucleotide of the present invention, wherein 2'-alkoxyalkoxy-RNA is 2'-methoxyethoxy-RNA;

[0841] The oligonucleotide of the present invention comprises between 1 and 15, in particular between 1 and 5, more specifically 1, 2, 3, 4 or 5 phosphorodithioate nucleoside internucleotide linkages of formula (I) as defined above.

[0842] The oligonucleotide of the present invention comprises other nucleoside internucleotide linkages independently selected from phosphodiester nucleoside internucleotide linkages, phosphorothioate nucleoside internucleotide linkages and phosphorodithioate nucleoside internucleotide linkages of formula (I) as defined above;

[0843] The oligonucleotides of the present invention, wherein the other internucleoside linkages are independently selected from phosphorothioate internucleoside linkages and dithiophosphonate internucleoside linkages of formula (I) as defined above.

[0844] The oligonucleotides of the present invention, wherein the other internucleoside linkages are all phosphorothioate internucleoside linkages;

[0845] The oligonucleotides of the present invention, wherein the other internucleoside linkages are all dithiophosphonate internucleoside linkages of formula (I) as defined above;

[0846] The oligonucleotides of the present invention, wherein the oligonucleotide is a gapmer, in particular an LNA gapmer, a hybrid flank gapmer, an alternating flank gapmer, a splice-switching oligomer, a chimeramer or a homomer;

[0847] The oligonucleotides of the present invention, which are gapmers and wherein at least one dithiophosphonate internucleoside linkage of formula (I) is comprised in the gap region of the gapmer and / or in one or more flank regions;

[0848] The oligonucleotides of the present invention, wherein a continuous nucleotide sequence, such as the gapmer region F-G-F', is flanked by flank regions D' or D'' or D' and D'', said flank regions comprising one or more DNA nucleotides linked to the remainder of the oligonucleotide by phosphodiester internucleoside linkages;

[0849] The oligonucleotides of the present invention, which are gapmers, wherein one or both of the flank regions F and F', in particular one of them, are further flanked by phosphodiester-linked DNA nucleotides, in particular 1 to 5 phosphodiester-linked DNA nucleotides (regions D' and D''); and

[0850] The oligonucleotides of the present invention, wherein the oligonucleotide has a length of 7 to 30 nucleotides.

[0851] When the oligonucleotides of the present invention are gapmers, they advantageously have a length of 12 to 26 nucleotides. 16 nucleotides is a particularly advantageous gapmer oligonucleotide length.

[0852] When the oligonucleotide is a fully LNA oligonucleotide, it advantageously has a length of 7 to 10 nucleotides.

[0853] When the oligonucleotide is a chimeramer oligonucleotide, it advantageously has a length of 8 to 30 nucleotides.

[0854] The present invention particularly relates to:

[0855] The oligonucleotides of the present invention, wherein one or more nucleotides are nucleobase-modified nucleotides;

[0856] The oligonucleotides of the present invention, wherein the oligonucleotide is an antisense oligonucleotide, siRNA, microRNA mimic or ribozyme;

[0857] Pharmaceutically acceptable salts of the oligonucleotides of the invention, in particular sodium or potassium salts;

[0858] Conjugates comprising an oligonucleotide or a pharmaceutically acceptable salt of the invention and at least one conjugate moiety covalently linked to the oligonucleotide or the pharmaceutically acceptable salt, optionally via a linker moiety;

[0859] Pharmaceutical compositions comprising an oligonucleotide, a pharmaceutically acceptable salt or a conjugate of the invention and a therapeutically inert carrier;

[0860] The oligonucleotides, pharmaceutically acceptable salts or conjugates of the invention, for use as therapeutically active substances; and

[0861] Use of the oligonucleotides, pharmaceutically acceptable salts or conjugates of the invention as medicaments.

[0862] In some embodiments, the oligonucleotides of the invention have higher activity in modulating their target nucleic acids as compared to corresponding fully phosphorothioate-linked oligonucleotides. In some embodiments, the invention provides oligonucleotides with enhanced activity, enhanced potency, enhanced specific activity or enhanced cellular uptake. In some embodiments, the invention provides oligonucleotides with an altered duration of action in vitro or in vivo, such as an extended duration of action in vitro or in vivo. In some embodiments, higher activity in modulating a target nucleic acid is determined in vitro or in vivo in cells expressing the target nucleic acid.

[0863] In some embodiments, the oligonucleotides of the invention have altered pharmacological properties, such as reduced toxicity, e.g. reduced nephrotoxicity, reduced hepatotoxicity or reduced immunostimulatory effects. Hepatotoxicity can be determined, for example, in vivo or by using the in vitro assay disclosed in WO2017 / 067970, which document is hereby incorporated by reference. Nephrotoxicity can be determined, for example, in vitro or by using the assay disclosed in PCT / EP2017 / 064770, which document is hereby incorporated by reference. In some embodiments, the oligonucleotides of the invention comprise a 5’CG3’ dinucleotide, such as a DNA 5’CG 3’ dinucleotide, wherein the internucleoside bond between C and G is a phosphorodithioate internucleoside bond of formula (I) as defined above.

[0864] In some embodiments, the oligonucleotides of the invention have improved nuclease resistance, such as improved biostability in serum. In some embodiments, the 3’-terminal nucleoside of the oligonucleotide of the invention has an A or G base, such as a 3’-terminal LNA-A or LNA-G nucleoside. Suitably, the internucleoside bond between the two 3’-terminal most nucleosides of the oligonucleotide can be a phosphorodithioate internucleoside bond according to formula (I) as defined above.

[0865] In some embodiments, the oligonucleotides of the invention have enhanced bioavailability. In some embodiments, the oligonucleotides of the invention have greater blood exposure, such as a longer retention time in blood.

[0866] Using the phosphoramidite method, non-bridging phosphorothioate modifications are introduced into the oligonucleotides by solid-phase synthesis. The synthesis is carried out using controlled pore glass (CPG) equipped with a universal linker as the support. On this solid support, the oligonucleotides are generally built in the 3' to 5' direction by sequential cycles, which consist of coupling 5'-O-DMT protected nucleoside phosphoramidite building blocks, followed by (thio)oxidation, capping, and deprotection of the DMT group. The introduction of non-bridging phosphorothioate is achieved by using a suitable phosphorothioamidite building block and subsequent sulfur oxidation of the main intermediate.

[0867] Although the corresponding DNA phosphorothioamidite is commercially available, the corresponding LNA building blocks have not been described previously. They can be prepared, for example, from 5'-O-DMT-protected nucleoside 3'-ol by reaction with monobenzoyl-protected ethanedithiol and tripyrrolidin-1-ylphosphane.

[0868] The oligonucleotides of the invention can thus be manufactured, for example, according to Scheme 2, where R 1 、R 2a 、R 2b 、R 4a 、R 4b 、R 5 、R x 、R y and V are defined below.

[0869] Scheme 2

[0870]

[0871] The invention thus also relates to a method for manufacturing the oligonucleotides of the invention, the method comprising the following steps:

[0872] (a) coupling a phosphorothioamidite nucleoside to the terminal 5'-oxygen atom of a nucleotide or oligonucleotide to produce a phosphorothioate triester intermediate;

[0873] (b) sulfur oxidizing the phosphorothioate triester intermediate obtained in step (a); and

[0874] (c) optionally further extending the oligonucleotide.

[0875] The invention particularly relates to a method for manufacturing the oligonucleotides of the invention, the method comprising the following steps:

[0876] (a1) Coupling a compound of formula (A)

[0877]

[0878] to the 5'-oxygen atom of a nucleotide or oligonucleotide of formula (B)

[0879]

[0880] (b1) Thio-oxidizing the thiophosphite triester intermediate obtained in step (a1); and

[0881] (c1) Optionally further extending the oligonucleotide;

[0882] wherein

[0883] R 2a and R 4a together form -X-Y- as defined above; or

[0884] R 4a is hydrogen and R 2a is selected from alkoxy, especially methoxy, halogen, especially fluorine, alkoxyalkoxy, especially methoxyethoxy, alkenyloxy, especially allyloxy, and aminoalkoxy, especially aminoethoxy;

[0885] R 2b and R 4b together form -X-Y- as defined above; or

[0886] R 2b and R 4b are both hydrogen at the same time; or

[0887] R 4b is hydrogen and R 2b is selected from alkoxy, especially methoxy, halogen, especially fluorine, alkoxyalkoxy, especially methoxyethoxy, alkenyloxy, especially allyloxy, and aminoalkoxy, especially aminoethoxy;

[0888] V is oxygen or sulfur; and

[0889] wherein R 5 , R x , R y and Nu are as defined below.

[0890] The present invention particularly relates to a method for manufacturing the oligonucleotides of the present invention, the method comprising the following steps:

[0891] (a2) Coupling a compound of formula (II)

[0892]

[0893] the 5'-oxygen atom of the nucleotide or oligonucleotide of formula (IV)

[0894]

[0895] (b2) sulfur-oxidizing the phosphorothioate triester intermediate obtained in step (a2); and

[0896] (c2) optionally further extending the oligonucleotide;

[0897] wherein

[0898] R 2b and R 4b together form -X-Y- as defined above; or

[0899] R 2b and R 4b are both hydrogen at the same time; or

[0900] R 4b is hydrogen and R 2b is selected from alkoxy, especially methoxy, halogen, especially fluorine, alkoxyalkoxy, especially methoxyethoxy, alkenyloxy, especially allyloxy, and aminoalkoxy, especially aminoethoxy; and

[0901] wherein R 5 、R x 、R y and Nu are as defined below.

[0902] The present invention also relates to an oligonucleotide prepared by the method according to the present invention.

[0903] The present invention also relates to:

[0904] A nicked oligonucleotide comprising at least one phosphorodithioate internucleoside bond of formula (I)

[0905]

[0906] wherein R is hydrogen or a phosphate protecting group;

[0907] The nicked oligonucleotide as defined above, wherein the oligonucleotide is an antisense oligonucleotide capable of regulating the expression of a target RNA in a cell expressing the target RNA;

[0908] The nicked oligonucleotide as defined above, wherein the oligonucleotide is an antisense oligonucleotide capable of inhibiting the expression of a target RNA in a cell expressing the target RNA;

[0909] The nicked oligonucleotide as defined above, capable of recruiting ribonucleases, such as human ribonuclease H1;

[0910] The nicked polymeric oligonucleotide of the present invention, wherein one of the two oxygen atoms of the at least one internucleoside bond of formula (I) is connected to the 3'-carbon atom of the adjacent nucleoside (A 1 ) and the other oxygen atom is connected to the 5'-carbon atom of another nucleoside (A 2 ), wherein at least one of the two nucleosides (A 1 ) and (A 2 ) is a 2'-sugar modified nucleoside;

[0911] The nicked polymeric oligonucleotide of the present invention, wherein one of (A 1 ) and (A 2 ) is a 2'-sugar modified nucleoside and the other is a DNA nucleoside;

[0912] The nicked polymeric oligonucleotide of the present invention, wherein both of (A 1 ) and (A 2 ) are 2'-modified nucleosides simultaneously;

[0913] The nicked polymeric oligonucleotide of the present invention, wherein both of (A 1 ) and (A 2 ) are DNA nucleosides simultaneously;

[0914] The nicked polymeric oligonucleotide of the present invention, wherein the nicked polymeric oligonucleotide comprises a continuous nucleotide sequence of formula 5'-F-G-F'-3', wherein G is a region having 5 to 18 nucleosides capable of recruiting RNase H, and the region G is flanked by flanking regions F and F' at the 5' and 3' sides respectively, wherein the regions F and F' independently comprise or consist of 1 to 7 2'-sugar modified nucleotides, wherein the nucleoside of region F adjacent to region G is a 2'-sugar modified nucleoside and the nucleoside of region F' adjacent to region G is a 2'-sugar modified nucleoside;

[0915] The nicked polymeric oligonucleotide of the present invention, wherein the 2'-sugar modified nucleosides are independently selected from 2'-alkoxy-RNA nucleosides, 2'-alkoxyalkoxy-RNA nucleosides, 2'-amino-DNA nucleosides, 2'-fluoro-RNA nucleosides, 2'-fluoro-ANA nucleosides and LNA nucleosides;

[0916] The nicked polymeric oligonucleotide of the present invention, wherein 2'-alkoxyalkoxy-RNA is 2'-methoxyethoxy-RNA (2'-O-MOE);

[0917] The nicked polymeric oligonucleotide of the present invention, wherein the regions F and F' comprise or consist of 2'-methoxyethoxy-RNA nucleotides;

[0918] The nicked polymer oligonucleotide of the present invention, wherein both region F and region F' are composed of 2'-methoxyethoxy-RNA nucleotides, such as those containing the formula [MOE] 3-8 [DNA] 8-16 [MOE] 3-8 of the nicked polymer (e.g., [MOE]5[DNA] 10 [MOE]5), i.e., wherein region F and region F' each consist of five 2'-methoxyethoxy-RNA nucleotides, and region G consists of 10 DNA nucleotides;

[0919] The nicked polymer oligonucleotide of the present invention, wherein at least one or all of the 2'-sugar modified nucleosides in region F or region F' or both regions F and F' are LNA nucleosides;

[0920] The nicked polymer oligonucleotide of the present invention, wherein region F or region F' or both regions F and F' contain at least one LNA nucleoside and at least one DNA nucleoside;

[0921] The nicked polymer oligonucleotide of the present invention, wherein region F or region F' or both regions F and F' contain at least one LNA nucleoside and at least one non-LNA 2'-sugar modified nucleoside, such as at least one 2'-methoxyethoxy-RNA nucleoside;

[0922] The nicked polymer oligonucleotide of the present invention, wherein the nicked region contains 5 to 16, particularly 8 to 16, more specifically 8, 9, 10, 11, 12, 13 or 14 consecutive DNA nucleotides;

[0923] The nicked polymer oligonucleotide of the present invention, wherein regions F and F' independently have a length of 1, 2, 3, 4, 5, 6, 7 or 8 nucleosides;

[0924] The nicked polymer oligonucleotide of the present invention, wherein regions F and F' each independently contain 1, 2, 3 or 4 LNA nucleosides;

[0925] The nicked polymer oligonucleotide of the present invention, wherein the LNA nucleosides are independently selected from β-D-oxy-LNA, 6'-methyl-β-D-oxy-LNA and ENA;

[0926] The nicked polymer oligonucleotide of the present invention, wherein the LNA nucleoside is β-D-oxy-LNA;

[0927] The nicked polymer oligonucleotide of the present invention, wherein the oligonucleotide or its consecutive nucleotide sequence (F-G-F') has a length of 10 to 30 nucleotides, particularly 12 to 22, more particularly 14 to 20 oligonucleotide lengths;

[0928] The nicked polymeric oligonucleotide of the present invention, wherein the nicked polymeric oligonucleotide comprises a continuous nucleotide sequence of formula 5'-D'-F-G-F'-D''-3', wherein F, G and F' are as defined in any one of claims 4 to 17 and wherein the regions D' and D'' each independently consist of from 0 to 5 nucleotides, in particular 2, 3 or 4 nucleotides, in particular DNA nucleotides (such as phosphodiester-linked DNA nucleosides);

[0929] The nicked polymeric oligonucleotide of the present invention, wherein the nicked polymeric oligonucleotide is capable of recruiting human RNase H1;

[0930] The nicked polymeric oligonucleotide of the present invention, wherein at least one phosphorodithioate internucleoside bond of formula (I) as defined above is located between adjacent nucleosides in region F or region F', between region F and region G or between region G and region F';

[0931] The nicked polymeric oligonucleotide of the present invention, which further comprises a phosphorothioate internucleoside bond;

[0932] The nicked polymeric oligonucleotide of the present invention, wherein the internucleoside bonds between the nucleosides in region G are independently selected from phosphorothioate internucleoside bonds and phosphorodithioate internucleoside bonds of formula (I) as defined above;

[0933] The nicked polymeric oligonucleotide of the present invention, wherein the internucleoside bonds between the nucleosides in region G comprise 0, 1, 2 or 3 phosphorodithioate internucleoside bonds of formula (I) as defined above;

[0934] The nicked polymeric oligonucleotide of the present invention, wherein the remaining internucleoside bonds are independently selected from phosphorothioate internucleoside bonds, phosphodiester internucleoside bonds and phosphorodithioate internucleoside bonds of formula (I) as defined above;

[0935] The nicked polymeric oligonucleotide of the present invention, wherein the internucleoside bonds between the nucleosides in region F and the internucleoside bonds between the nucleosides in region F' are independently selected from phosphorothioate internucleoside bonds and phosphorodithioate internucleoside bonds of formula (I) as defined above;

[0936] The nicked polymeric oligonucleotide of the present invention, wherein each of the flanking regions F and F' independently comprises 1, 2, 3, 4, 5, 6 or 7 phosphorodithioate internucleoside bonds of formula (I) as defined above.

[0937] The nicked polymeric oligonucleotide of the present invention, wherein the flanking regions F and F' together or individually comprise 1, 2, 3, 4, 5 or 6 phosphorodithioate internucleoside bonds of formula (I) as defined above, or all of the internucleoside bonds in region F and / or region F' are phosphorodithioate internucleoside bonds of formula (I) as defined above;

[0938] The nicked polymeric oligonucleotide of the present invention, wherein the flanking regions F and F' together contain 1, 2, 3 or 4 phosphorothioate internucleoside linkages of formula (I) as defined above;

[0939] The nicked polymeric oligonucleotide of the present invention, wherein each of the flanking regions F and F' contains 2 phosphorothioate internucleoside linkages of formula (I) as defined above;

[0940] The nicked polymeric oligonucleotide of the present invention, wherein all of the internucleoside linkages in the flanking region F and / or F' are phosphorothioate internucleoside linkages of formula (I) as defined above;

[0941] The nicked polymeric oligonucleotide of the present invention, wherein the nicked polymeric oligonucleotide contains at least one stereodefined internucleoside linkage, such as at least one stereodefined phosphorothioate internucleoside linkage;

[0942] The nicked polymeric oligonucleotide of the present invention, wherein the nicked region contains 1, 2, 3, 4 or 5 stereodefined phosphorothioate internucleoside linkages;

[0943] The nicked polymeric oligonucleotide of the present invention, wherein all of the internucleoside linkages between the nucleotides in the nicked region are stereodefined phosphorothioate internucleoside linkages;

[0944] The nicked polymeric oligonucleotide of the present invention, wherein at least one phosphorothioate internucleoside linkage of formula (I) as defined above is located between the nucleotides of region F, or between the nucleotides of region F', or between region F and region G, or between region G and region F', and the remaining internucleoside linkages within regions F and F', between region F and region G, and between region G and region F' are independently selected from stereodefined phosphorothioate internucleoside linkages, stereorandom internucleoside linkages, phosphorothioate internucleoside linkages of formula (I), and phosphodiester internucleoside linkages;

[0945] The nicked polymeric oligonucleotide of the present invention, wherein at least one phosphorothioate internucleoside linkage of formula (I) as defined above is located between at least two adjacent nucleotides of region F, or between two adjacent nucleotides of region F', or between region F and region G, or between region G and region F', and the remaining internucleoside linkages between the nucleotides of regions F and F' are independently selected from phosphorothioate internucleoside linkages, phosphorothioate internucleoside linkages of formula (I), and phosphodiester internucleoside linkages. The phosphorothioate internucleoside linkages in regions F and F' can be stereorandom or stereodefined, or can be independently selected from stereorandom and stereochemically defined;

[0946] The nicked polymer oligonucleotide of the present invention, wherein at least one phosphorothioate internucleoside bond of formula (I) as defined above is located between at least two adjacent nucleosides in region F, or between at least two adjacent nucleosides in region F', or between region F and region G, or between region G and region F', and the remaining internucleoside bonds between the nucleotides in regions F and F' are independently selected from phosphorothioate internucleoside bonds and phosphorothioate internucleoside bonds of formula (I). The phosphorothioate internucleoside bonds in regions F and F' can be atactic or stereodefined, or can be independently selected from atactic and stereochemically defined;

[0947] The nicked polymer oligonucleotide of the present invention, wherein at least one phosphorothioate internucleoside bond of formula (I) as defined above is located between at least two adjacent nucleosides in region F, or between at least two adjacent nucleosides in region F', or between region F and region G, or between region G and region F', and the remaining internucleoside bonds between the nucleotides in regions F and F', between region F and region G, and between region G and region F' are independently selected from phosphorothioate internucleoside bonds and phosphorothioate internucleoside bonds of formula (I); the phosphorothioate internucleoside bonds in regions F and F' can be atactic or stereodefined, or can be independently selected from atactic and stereodefined;

[0948] The nicked polymer oligonucleotide of the present invention, wherein at least one phosphorothioate internucleoside bond of formula (I) as defined above is located between at least two adjacent nucleosides in region F, or between at least two adjacent nucleosides in region F', or between region F and region G, or between region G and region F', and the remaining internucleoside bonds between the nucleotides in regions F and F', between region F and region G, and between region G and region F' are independently selected from stereodefined phosphorothioate internucleoside bonds and phosphorothioate internucleoside bonds of formula (I);

[0949] The nicked polymer oligonucleotide of the present invention, wherein at least one phosphorothioate internucleoside bond of formula (I) as defined above is located between at least two adjacent nucleosides in region F, or between at least two adjacent nucleosides in region F', or between region F and region G, or between region G and region F', and the remaining internucleoside bonds within regions F and F', between region F and region G, and between region G and region F' are phosphorothioate internucleoside bonds, which can be all atactic phosphorothioate internucleoside bonds, all stereodefined phosphorothioate internucleoside bonds, or can be independently selected from atactic phosphorothioate internucleoside bonds and stereodefined phosphorothioate internucleoside bonds;

[0950] The nicked polymeric oligonucleotide of the present invention, wherein the remaining internucleoside linkages inside region F, inside region F', or inside both region F and region F' are all phosphorothioate internucleoside linkages of formula (I) as defined above;

[0951] The nicked polymeric oligonucleotide of the present invention, wherein the internucleoside linkages between the nucleosides in region G contain 0, 1, 2, or 3 phosphorothioate internucleoside linkages of formula (I) as defined above and the remaining internucleoside linkages inside region G are independently selected from the stereodefined phosphorothioate internucleoside linkages and the stereorandom phosphorothioate internucleoside linkages;

[0952] The nicked polymeric oligonucleotide of the present invention, wherein the internucleoside linkages between the nucleosides in region G contain 0, 1, 2, or 3 phosphorothioate internucleoside linkages of formula (I) as defined above and at least one or all of the remaining internucleoside linkages inside region G are stereodefined phosphorothioate internucleoside linkages;

[0953] The nicked polymeric oligonucleotide of the present invention, wherein the internucleoside linkages between the nucleosides in region G contain 0, 1, 2, or 3 phosphorothioate internucleoside linkages of formula (I) as defined above and the remaining internucleoside linkages inside region G are phosphorothioate internucleoside linkages, such as stereorandom phosphorothioate internucleoside linkages;

[0954] The nicked polymeric oligonucleotide of the present invention, wherein at least one of region F or region F' contains at least one phosphorothioate internucleoside linkage of formula (I) as defined above and all of the internucleoside linkages inside region G are phosphorothioate internucleoside linkages, such as stereorandom phosphorothioate internucleoside linkages;

[0955] The nicked polymeric oligonucleotide of the present invention, wherein at least one of region F or region F' contains at least one phosphorothioate internucleoside linkage of formula (I) as defined above and all of the internucleoside linkages inside region G are phosphorothioate internucleoside linkages, wherein at least one of the phosphorothioate internucleoside linkages inside region G is a stereodefined phosphorothioate internucleoside linkage;

[0956] The nicked polymeric oligonucleotide of the present invention, wherein at least one of region F or region F' contains at least one phosphorothioate internucleoside linkage of formula (I) as defined above and all of the internucleoside linkages inside region G are stereodefined phosphorothioate internucleoside linkages;

[0957] The nicked polymer oligonucleotide of the present invention, wherein the internucleoside bond between regions F and G, or the internucleoside bond between regions G and F', or the internucleoside bonds between regions F and G and between regions G and F' are phosphorodithioate internucleoside bonds of formula (I) as defined above, and wherein if only one of the internucleoside bonds between regions F and G and between regions G and F' is a phosphorodithioate internucleoside bond of formula (I) as defined above, then the other internucleoside bond between regions F and G or between regions G and F' is a phosphorothioate internucleoside bond;

[0958] The nicked polymer oligonucleotide of the present invention, wherein at least one of regions F or F' contains at least one phosphorodithioate internucleoside bond of formula (I) as defined above, wherein the internucleoside bond between regions F and G, or the internucleoside bond between regions G and F', or the internucleoside bonds between regions F and G and between regions G and F' are phosphorodithioate internucleoside bonds of formula (I) as defined above and wherein if only one of the internucleoside bonds between regions F and G and between regions G and F' is a phosphorodithioate internucleoside bond of formula (I) as defined above, then the other internucleoside bond between regions F and G or between regions G and F' is a phosphorothioate internucleoside bond;

[0959] The nicked polymer oligonucleotide of the present invention, wherein the internucleoside bonds between the nucleosides of region G contain 0, 1, 2 or 3 phosphorodithioate internucleoside bonds of formula (I) as defined above and the remaining internucleoside bonds within region G are phosphorothioate internucleoside bonds, wherein the internucleoside bond between regions F and G, or the internucleoside bond between regions G and F', or the internucleoside bonds between regions F and G and between regions G and F' are phosphorodithioate internucleoside bonds of formula (I) as defined above and wherein if only one of the internucleoside bonds between regions F and G and between regions G and F' is a phosphorodithioate internucleoside bond of formula (I) as defined above, then the other internucleoside bond between regions F and G or between regions G and F' is a phosphorothioate internucleoside bond;

[0960] The nicked polymer oligonucleotide of the present invention, wherein at least one of region F or region F' contains at least one phosphorothioate internucleoside bond of formula (I) as defined above, wherein the internucleoside bonds between the nucleosides in region G contain 0, 1, 2 or 3 phosphorothioate internucleoside bonds of formula (I) as defined above and the remaining internucleoside bonds within region G are phosphorothioate internucleoside bonds, wherein the internucleoside bond between region F and G, or between region G and F', or between region F and G and between region G and F' is a phosphorothioate internucleoside bond of formula (I) as defined above, and wherein, if only one of the internucleoside bonds between region F and G and between region G and F' is a phosphorothioate internucleoside bond of formula (I) as defined above, the other internucleoside bond between region F and G or between region G and F' is a phosphorothioate internucleoside bond;

[0961] The nicked polymer oligonucleotide of the present invention, wherein region F or region F' contains at least one phosphorothioate internucleoside bond of formula (I) as defined above, or wherein the internucleoside bond between region F and region G or between region G and region F' contains at least one phosphorothioate internucleoside bond of formula (I) as defined above, region G contains 1, 2 or 3 phosphorothioate internucleoside bonds of formula (I) as defined above, and the remaining internucleoside bonds within region G are phosphorothioate internucleoside bonds;

[0962] The nicked polymer oligonucleotide of the present invention, wherein region F or region F' contains at least one phosphorothioate internucleoside bond of formula (I) as defined above, or wherein the internucleoside bond between region F and region G or between region G and region F' contains at least one phosphorothioate internucleoside bond of formula (I) as defined above, all the internucleoside bonds within region G are phosphorothioate internucleoside bonds, and at least one of the phosphorothioate internucleoside bonds within region G is a stereodefined phosphorothioate internucleoside bond;

[0963] The nicked polymer oligonucleotide of the present invention, wherein region F or region F' contains at least one phosphorothioate internucleoside bond of formula (I) as defined above, or wherein the internucleoside bond between region F and region G or between region G and region F' contains at least one phosphorothioate internucleoside bond of formula (I) as defined above, all the internucleoside bonds within region G are phosphorothioate internucleoside bonds, and all the phosphorothioate internucleoside bonds within region G are stereodefined phosphorothioate internucleoside bonds;

[0964] The nicked polymer oligonucleotide of the present invention, wherein all the remaining internucleoside bonds within the nicked polymer region F-G-F' are phosphorothioate internucleoside bonds except for at least one phosphorothioate internucleoside bond of formula (I) as defined above;

[0965] The nicked polymer oligonucleotide of the present invention, wherein at least one of region F or region F' contains at least one phosphorothioate internucleoside bond of formula (I) as defined above and all internucleoside bonds within region G are stereodefined phosphorothioate internucleoside bonds;

[0966] The nicked polymer oligonucleotide of the present invention, wherein, in addition to at least one phosphorothioate internucleoside bond of formula (I), all remaining internucleoside bonds within the nicked polymer region F-G-F' are stereodefined phosphorothioate internucleoside bonds;

[0967] The nicked polymer oligonucleotide of the present invention, which is an LNA nicked polymer, a hybrid flanking nicked polymer, an alternating flanking nicked polymer or a nicked breaker nicked polymer.

[0968] A pharmaceutically acceptable salt of the nicked polymer oligonucleotide of the present invention, especially a sodium salt or a potassium salt;

[0969] A conjugate comprising the nicked polymer oligonucleotide or pharmaceutically acceptable salt of the present invention and at least one conjugate moiety covalently linked to the oligonucleotide or the pharmaceutically acceptable salt, optionally via a linker moiety, especially via a biocleavable linker, particularly via 2 to 4 phosphodiester-linked DNA nucleosides (such as region D' or D") covalently linked;

[0970] A pharmaceutical composition comprising the nicked polymer oligonucleotide, pharmaceutically acceptable salt or conjugate of the present invention and a therapeutically inert carrier;

[0971] The nicked polymer oligonucleotide, pharmaceutically acceptable salt or conjugate of the present invention, used as a therapeutic active substance;

[0972] Use of the nicked polymer oligonucleotide, pharmaceutically acceptable salt or conjugate as a medicament;

[0973] A method for regulating the expression of a target RNA in a cell, the method comprising administering the oligonucleotide or nicked polymer oligonucleotide of the present invention to a cell expressing the target RNA, thereby regulating the expression of the target RNA;

[0974] A method for inhibiting the expression of a target RNA in a cell, the method comprising administering the oligonucleotide or nicked polymer oligonucleotide of the present invention to a cell expressing the target RNA, thereby inhibiting the expression of the target RNA; and

[0975] An in vitro method for regulating or inhibiting a target RNA in a cell, the method comprising administering the oligonucleotide or nicked polymer oligonucleotide of the present invention to a cell expressing the target RNA, thereby regulating or inhibiting the target RNA in the cell.

[0976] The target RNA can be, for example, mammalian mRNA, such as pre-mRNA or mature mRNA, human mRNA, viral RNA or non-coding RNA, such as microRNA or long non-coding RNA.

[0977] In some embodiments, the modulation is pre-mRNA splicing modulation that results in an altered splicing pattern of the target pre-mRNA.

[0978] In some embodiments, the modulation is an inhibition that can occur through a target degradation process (e.g., by recruiting RNase H, such as RNase H1 or RISC), or the inhibition can occur through an occupancy-mediated mechanism that inhibits the normal biological function of the target RNA (e.g., inhibition of microRNA or long non-coding RNA by a mixmer or a phosphorothioate).

[0979] The human mRNA can be mature RNA or pre-mRNA.

[0980] The present invention further relates to a compound of formula (II)

[0981]

[0982] wherein

[0983] X is oxygen, sulfur, -CR a R b -, -C(R a )=C(R b )-, -C(=CR a R b )-, -C(R a )=N-, -Si(R a )2-, -SO2-, -NR a -; -O-NR a -, -NR a -O-, -C(=J)-, Se, -O-NR a -, -NR a -CR a R b -, -N(R a )-O- or -O-CR a R b -;

[0984] Y is oxygen, sulfur, -(CR a R b ) n -, -CR a R b -O-CR a R b -, -C(R a )=C(R b)-, -C(R a )=N-, -Si(R a )2-, -SO2-, -NR a -, -C(=J)-, Se, -O-NR a -, -NR a -CR a R b -, -N(R a )-O- or -O-CR a R b -;

[0985] provided that -X-Y- is not -O-O-, Si(R a )2-Si(R a )2-, -SO2-SO2-, -C(R a )=C(R b )-C(R a )=C(R b )-, -C(R a )=N-C(R a )=N-, -C(R a )=N-C(R a )=C(R b )-, -C(R a )=C(R b )-C(R a )=N- or -Se-Se-;

[0986] J is oxygen, sulfur, =CH2 or =N(R a );

[0987] R a and R b are independently selected from hydrogen, halogen, hydroxy, cyano, mercapto, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, alkoxy, substituted alkoxy, alkoxyalkyl, alkenyloxy, carboxyl, alkoxycarbonyl, alkylcarbonyl, formyl, aryl, heterocyclic group, amino, alkylamino, carbamoyl, alkylcarbamoyl, aminoalkylcarbamoyl, alkylaminoalkylcarbamoyl, alkylcarbamoylamino, ureido, alkanoyloxy, sulfonyl, alkylsulfonyloxy, nitro, azido, mercaptoalkylthio, aryloxycarbonyl, aryloxy, arylcarbonyl, heteroaryl, heteroaryloxycarbonyl, heteroaryloxy, heteroarylcarbonyl, -OC(=X a )R c -, -OC(=X a )NR c R d and -NR e C(=X a )NR c R d ;

[0988] or two geminal Rs a and R b together form an optionally substituted methylene;

[0989] or two geminal Rs a and R b together with the carbon atom to which they are attached form a cycloalkyl or halo-cycloalkyl having only one -X-Y- carbon atom;

[0990] wherein the substituted alkyl, substituted alkenyl, substituted alkynyl, substituted alkoxy and substituted methylene are alkyl, alkenyl, alkynyl and methylene substituted with 1 to 3 substituents independently selected from halogen, hydroxy, alkyl, alkenyl, alkynyl, alkoxy, alkoxyalkyl, alkenyloxy, carboxyl, alkoxycarbonyl, alkylcarbonyl, formyl, heterocyclic group, aryl and heteroaryl;

[0991] X a is oxygen, sulfur or -NR c ;

[0992] R c 、R d and R e are independently selected from hydrogen and alkyl;

[0993] n is 1, 2 or 3.

[0994] R 5 is a hydroxy protecting group;

[0995] R x is phenyl, nitrophenyl, phenylalkyl, halophenylalkyl, cyanoalkyl, phenylcarbonylthioalkyl, halophenylcarbonylthioalkyl, alkylcarbonylthioalkyl or alkylcarbonylcarbonylthioalkyl;

[0996] R y is dialkylamino or pyrrolidino; and

[0997] Nu is a nucleobase or a protected nucleobase.

[0998] The present invention also relates to:

[0999] a compound of formula (II) wherein -X-Y- is -CH2-O-, -CH(CH3)-O- or -CH2CH2-O-;

[1000] The present invention also provides a compound of formula (IIb)

[1001]

[1002] wherein

[1003] R5 is a hydroxyl protecting group,

[1004] R x is phenyl, nitrophenyl, phenylalkyl, halophenylalkyl, cyanoalkyl, phenylcarbonylthioalkylalkyl, halophenylcarbonylthioalkylalkyl, alkylcarbonylthioalkylalkyl or alkylcarbonylcarbonylthioalkylalkyl;

[1005] R y is dialkylamino or pyrrolidino; and

[1006] Nu is a nucleobase or a protected nucleobase;

[1007] A compound of formula (II) having formula (III) or (IV)

[1008]

[1009] wherein R 5 , R x , R y and Nu are as defined above.

[1010] A compound of formula (II), (IIb), (III) or (IV), wherein R x is phenyl, nitrophenyl, phenylmethyl, dichlorophenylmethyl, cyanoethyl, methylcarbonylthioethyl, ethylcarbonylthioethyl, isopropylcarbonylthioethyl, tert-butylcarbonylthioethyl, methylcarbonylcarbonylthioethyl or difluorophenylcarbonylthioethyl;

[1011] A compound of formula (II), (IIb), (III) or (IV), wherein R x is phenyl, 4-nitrophenyl, 2,4-dichlorophenylmethyl, cyanoethyl, methylcarbonylthioethyl, ethylcarbonylthioethyl, isopropylcarbonylthioethyl, tert-butylcarbonylthioethyl, methylcarbonylcarbonylthioethyl or 2,4-difluorophenylcarbonylthioethyl;

[1012] A compound of formula (II), (IIb), (III) or (IV), wherein R x is phenylcarbonylthioalkyl;

[1013] A compound of formula (II), (IIb), (III) or (IV), wherein R x is phenylcarbonylthioethyl;

[1014] A compound of formula (II), (IIb), (III) or (IV), wherein R y is diisopropylamino or pyrrolidino;

[1015] A compound of formula (II), (IIb), (III) or (IV), wherein R y is pyrrolidinyl;

[1016] A compound of formula (II) having formula (V)

[1017]

[1018] wherein R 5 and Nu are as defined above;

[1019] A compound of formula (IIb) having formula (Vb)

[1020]

[1021] wherein R 5 and Nu are as defined above;

[1022] A compound of formula (II), (IIb), (III), (IV) or (V) or (Vb), wherein Nu is thymine, protected thymine, adenosine, protected adenosine, cytosine, protected cytosine, 5-methylcytosine, protected 5-methylcytosine, guanine, protected guanine, uracil or protected uracil;

[1023] A compound of formula (IIb), wherein Nu is thymine, protected thymine, adenosine, protected adenosine, cytosine, protected cytosine, 5-methylcytosine, protected 5-methylcytosine, guanine, protected guanine, uracil or protected uracil;

[1024] A compound of formula (Vb), wherein Nu is thymine, protected thymine, adenosine, protected adenosine, cytosine, protected cytosine, 5-methylcytosine, protected 5-methylcytosine, guanine, protected guanine, uracil or protected uracil;

[1025] A compound of formula (II) selected from

[1026]

[1027]

[1028] A compound of formula (IIb) selected from

[1029]

[1030]

[1031] The presence of impurities in the compounds of formula (II) and (IIb) results in by-products during the manufacture of oligonucleotides and hinders the success of the synthesis. Additionally, in the presence of impurities, the compounds of formula (II) or (IIb) are unstable upon storage.

[1032] Compounds of formula (X1), (X2), X(11) and (X21)

[1033]

[1034] along with others are examples of such impurities.

[1035] Therefore, for storage and oligonucleotide manufacturing purposes, compounds of formula (II) or (IIb) in a sufficiently pure form are required.

[1036] The present invention thus also relates to compounds of formula (II)(IIb) having a purity of at least 98%, specifically 99%, more specifically 100%.

[1037] The present invention thus particularly relates to compounds of formula (II) which contain less than 1%, specifically 0% of compounds of formula (X1) and / or (X2) as impurities.

[1038] The present invention also relates to a method for manufacturing a compound of formula (II), the method comprising reacting a 5'-protected LNA nucleoside with a phosphine and a mono-protected dithiol in the presence of an acidic coupling agent and a silylating agent.

[1039] The present invention also relates to a method for manufacturing a compound of formula (IIb), the method comprising reacting a 5'-protected MOE nucleoside with a phosphine and a mono-protected dithiol in the presence of an acidic coupling agent and a silylating agent.

[1040] The present invention relates to a method for manufacturing a compound of formula (II), the method comprising reacting a compound of formula (C)

[1041]

[1042] with a compound of formula P(R y )3 and a compound of formula HSR x in the presence of an acidic coupling agent and a silylating agent, wherein X, Y, R 5 , Nu, R x and R y are as defined above.

[1043] The present invention also relates to a method for manufacturing a compound of formula (II) as defined above, the method comprising reacting a compound of formula (C1)

[1044]

[1045] A compound of formula P(R y )3 and a compound of formula HSR x are reacted in the presence of an acidic coupling agent and a silylating agent, where R 5 , Nu, R x and R y are as defined above.

[1046] The present invention also relates to a process for preparing a compound of formula (IIb) as defined above, said process comprising reacting a compound of formula (Cb)

[1047]

[1048] with a compound of formula P(R y )3 and a compound of formula HSR x in the presence of an acidic coupling agent and a silylating agent, where R 5 , Nu, R x and R y are as defined above.

[1049] Examples of acidic coupling agents (also referred to as acidic activators) are azole-based activators such as tetrazole, 5-nitrophenyl-1H-tetrazole (NPT), 5-ethylthio-1H-tetrazole (ETT), 5-benzylthio-1H-tetrazole (BTT), 5-methylthio-1H-tetrazole (MTT), 5-mercapto-tetrazoles (MCT), 5-(3,5-bis(trifluoromethyl)phenyl)-1H-tetrazole and 4,5-dicyanoimidazole (DCI), or acidic salts such as pyridinium chloride, triflimidazolium, trifluorobenzoimidazolium, trifluoro-5-nitrobenzoimidazolium, or weak acids such as 2,4-dinitrobenzoic acid or 2,4-dinitrophenol. Tetrazole is a specific acidic coupling agent.

[1050] Examples of silylating agents (also known as hydroxyl quenchers) are bis(dimethylamino)dimethylsilane, N,O-bis(trimethylsilyl)acetamide (BSA), N,O-bis(trimethylsilyl)carbamate (BSC), N,N-bis(trimethylsilyl)methylamine, N,O-bis(trimethylsilyl)trifluoroacetamide (BSTFA), N,N′-bis(trimethylsilyl)urea (BSU), bromotrimethylsilane (TMBS), N-tert-butyldimethylsilyl-N-methyltrifluoroacetamide (MTBSTFA), chlorodimethyl(pentafluorophenyl)silane, chlorotriethylsilane (TESCI), chlorotrimethylsilane (TMCS), 1,3-dimethyl-1,1,3,3-tetraphenyldisilazane (TPDMDS), N,N-dimethyltrimethylsilylamine (TMSDMA), hexamethyldisilazane (HMDS), hexamethyldisiloxane (HMDSO), N-methyl-N-trimethylsilylacetamide (MSA), N-methyl-N-trimethylsilylheptafluorobutamide (MSHFA), N-methyl-N-(trimethylsilyl)trifluoroacetamide (MSTFA), 1,1,3,3-tetramethyl-1,3-diphenyldisilazane (DPTMDS), 4-(trimethylsiloxy)-3-pentan-2-one (TMS acac), 1-(trimethylsilyl)imidazole (TMSI) or trimethylsilylmethallylsulfinate (SILMAS-TMS). 1-(Trimethylsilyl)imidazole is a specific silylating agent.

[1051] The present invention also relates to a method for manufacturing a compound of formula (II), (IIb) or (III), wherein the crude compound of formula (II) or (IIb) is purified by preparative HPLC.

[1052] The present invention also relates to a method for manufacturing a compound of formula (II), (IIb) or (III), wherein the crude compound of formula (II), (IIb) or (III) is purified by preparative HPLC and gradient elution with ammonium hydroxide in water with acetonitrile.

[1053] The ammonium hydroxide content in water is in particular at least about 0.05% v / v, in particular between about 0.05% and 1% v / v, more specifically between about 0.05% and 0.5% v / v, more specifically about 0.05% v / v.

[1054] The acetonitrile gradient is in particular between 0% and 25% to between 75% and 100% acetonitrile, in particular in the range of 20 minutes to 120 minutes, more specifically between 10% and 20% to between 75% and 90% acetonitrile, in particular in the range of 25 minutes to 60 minutes, more specifically about 25% to 75% acetonitrile, in particular in the range of 30 minutes.

[1055] The present invention also relates to the use of a compound of formula (II), (IIb) or (III) in the manufacture of oligonucleotides, in particular oligonucleotides of the present invention or nicked oligonucleotide polymers.

[1056] Other nicked oligonucleotide polymer embodiments

[1057] 1. A nicked oligonucleotide polymer comprising at least one phosphorothioate internucleoside bond of formula (I)

[1058]

[1059] wherein R is hydrogen or a phosphate protecting group.

[1060] 2. The nicked oligonucleotide polymer according to embodiment 1, wherein one of the two oxygen atoms of the at least one internucleoside bond of formula (I) is linked to the 3'-carbon atom of an adjacent nucleoside (A 1 ) and the other oxygen atom is linked to the 5'-carbon atom of another nucleoside (A 2 ), wherein at least one of the two nucleosides (A 1 ) and (A 2 ) is a 2'-sugar modified nucleoside.

[1061] 3. The nicked oligonucleotide polymer according to embodiment 1 or 2, wherein one of (A 1 ) and (A 2 ) is a 2'-sugar modified nucleoside and the other is a DNA nucleoside.

[1062] 4. The nicked oligonucleotide polymer according to embodiment 1 or 2, wherein both (A 1 ) and (A 2 ) are 2'-modified nucleosides simultaneously.

[1063] 5. The nicked oligonucleotide polymer according to embodiment 1, wherein both (A 1 ) and (A 2 ) are DNA nucleosides simultaneously.

[1064] 6. The nicked oligonucleotide polymer according to any one of embodiments 1 to 5, wherein the nicked oligonucleotide polymer comprises a continuous nucleotide sequence of formula 5'-F-G-F'-3', wherein G is a region of 5 to 18 nucleosides capable of recruiting RNase H, and the region G is flanked by flanking regions F and F' at the 5' and 3' sides respectively, wherein the regions F and F' independently comprise or consist of 1 to 7 2'-sugar modified nucleotides, and the nucleoside of region F adjacent to region G is a 2'-sugar modified nucleoside and the nucleoside of region F' adjacent to region G is a 2'-sugar modified nucleoside.

[1065] 7. The nicked polymeric oligonucleotide according to any one of embodiments 1 to 6, wherein the 2'-sugar modified nucleosides are independently selected from 2'-alkoxy-RNA nucleosides, 2'-alkoxyalkoxy-RNA nucleosides, 2'-amino-DNA nucleosides, 2'-fluoro-RNA nucleosides, 2'-fluoro-ANA nucleosides, and LNA nucleosides.

[1066] 8. The nicked polymeric oligonucleotide according to embodiment 7, wherein the 2'-alkoxyalkoxy-RNA is 2'-methoxyethoxy-RNA (2'-O-MOE).

[1067] 9. The nicked polymeric oligonucleotide according to any one of embodiments 6 to 8, wherein regions F and F' comprise or consist of 2'-methoxyethoxy-RNA nucleotides.

[1068] 10. The nicked polymeric oligonucleotide according to any one of embodiments 6 to 9, wherein at least one or all of the 2'-sugar modified nucleosides in region F or region F' or both regions F and F' are LNA nucleosides.

[1069] 11. The nicked polymeric oligonucleotide according to any one of embodiments 6 to 10, wherein region F or region F' or both regions F and F' comprise at least one LNA nucleoside and at least one DNA nucleoside.

[1070] 12. The nicked polymeric oligonucleotide according to any one of embodiments 6 to 11, wherein region F or region F' or both regions F and F' comprise at least one LNA nucleoside and at least one non-LNA 2'-sugar modified nucleoside, such as at least one 2'-methoxyethoxy-RNA nucleoside.

[1071] 13. The nicked polymeric oligonucleotide according to any one of embodiments 1 to 12, wherein the nicked region comprises 5 to 16, particularly 8 to 16, more specifically 8, 9, 10, 11, 12, 13, or 14 consecutive DNA nucleosides.

[1072] 14. The nicked polymeric oligonucleotide according to any one of embodiments 1 to 13, wherein regions F and F' independently have a length of 1, 2, 3, 4, 5, 6, 7, or 8 nucleosides.

[1073] 15. The nicked polymeric oligonucleotide according to any one of embodiments 1 to 14, wherein regions F and F' each independently comprise 1, 2, 3, or 4 LNA nucleosides.

[1074] 16. A nicked polymer oligonucleotide according to any one of embodiments 7 to 17, wherein the LNA nucleosides are independently selected from β-D-oxy-LNA, 6'-methyl-β-D-oxy-LNA, and ENA.

[1075] 17. A nicked polymer oligonucleotide according to embodiment 7 or 10, wherein the LNA nucleoside is β-D-oxy-LNA.

[1076] 18. A nicked polymer oligonucleotide according to any one of embodiments 1 to 17, wherein the oligonucleotide or its contiguous nucleotide sequence (F-G-F') has a length of 10 to 30 nucleotides, particularly 12 to 22 nucleotides, more particularly 14 to 20 nucleotides.

[1077] 19. A nicked polymer oligonucleotide according to any one of embodiments 1 to 18, wherein the nicked polymer oligonucleotide comprises a contiguous nucleotide sequence of formula 5'-D'-F-G-F'-D''-3', wherein F, G, and F' are as defined in any one of embodiments 4 to 17 and wherein regions D' and D'' each independently consist of 0 to 5 nucleotides, particularly 2, 3, or 4 nucleotides, particularly DNA nucleotides (such as phosphodiester-linked DNA nucleosides).

[1078] 20. A nicked polymer oligonucleotide according to any one of embodiments 1 to 19, wherein the nicked polymer oligonucleotide is capable of recruiting human RNase H1.

[1079] 21. A nicked polymer oligonucleotide according to any one of embodiments 6 to 20, wherein at least one phosphorodithioate internucleoside bond of formula (I) as defined in embodiment 1 is located between adjacent nucleosides in region F or region F', between region F and region G, or between region G and region F'.

[1080] 22. A nicked polymer oligonucleotide according to any one of embodiments 1 to 21, which further comprises a phosphorothioate internucleoside bond.

[1081] 23. A nicked polymer oligonucleotide according to any one of embodiments 6 to 22, wherein the internucleoside bonds between the nucleosides in region G are independently selected from phosphorothioate internucleoside bonds and phosphorodithioate internucleoside bonds of formula (I) as defined in embodiment 1.

[1082] 24. A nicked polymer oligonucleotide according to any one of embodiments 6 to 23, wherein the internucleoside bonds between the nucleosides in region G comprise 0, 1, 2, or 3 phosphorodithioate internucleoside bonds of formula (I) as defined in embodiment 1, particularly 0 phosphorodithioate internucleoside bonds of formula (I).

[1083] 25. A nicked polymer oligonucleotide according to any one of embodiments 1 to 24, wherein the remaining internucleoside linkages are independently selected from phosphorothioate internucleoside linkages, phosphodiester internucleoside linkages, and dithiophosphonate internucleoside linkages of formula (I) as defined in embodiment 1.

[1084] 26. A nicked polymer oligonucleotide according to any one of embodiments 6 to 25, wherein the internucleoside linkages between the nucleosides in region F and the internucleoside linkages between the nucleosides in region F' are independently selected from phosphorothioate internucleoside linkages and dithiophosphonate internucleoside linkages of formula (I) as defined in embodiment 1.

[1085] 27. A nicked polymer oligonucleotide according to any one of embodiments 6 to 26, wherein each of the flanking regions F and F' independently comprises 1, 2, 3, 4, 5, 6, or 7 dithiophosphonate internucleoside linkages of formula (I) as defined in embodiment 1.

[1086] 28. A nicked polymer oligonucleotide according to any one of embodiments 6 to 27, wherein all of the internucleoside linkages in the flanking region F and / or F' are dithiophosphonate internucleoside linkages of formula (I) as defined in embodiment 1.

[1087] 29. A nicked polymer oligonucleotide according to any one of embodiments 1 to 28, wherein the nicked polymer oligonucleotide comprises at least one stereodefined internucleoside linkage, such as at least one stereodefined phosphorothioate internucleoside linkage.

[1088] 30. A nicked polymer oligonucleotide according to any one of embodiments 1 to 29, wherein the nicked region comprises 1, 2, 3, 4, or 5 stereodefined phosphorothioate internucleoside linkages.

[1089] 31. A nicked polymer oligonucleotide according to any one of embodiments 1 to 30, wherein all of the internucleoside linkages between the nucleosides in the nicked region are stereodefined phosphorothioate internucleoside linkages.

[1090] 32. A nicked polymer oligonucleotide according to any one of embodiments 6 to 27, wherein at least one dithiophosphonate internucleoside linkage of formula (I) as defined in embodiment 1 is located between the nucleosides in region F, or between the nucleosides in region F', or between region F and region G, or between region G and region F', and the remaining internucleoside linkages within region F and region F', between region F and region G, and between region G and region F' are independently selected from stereodefined phosphorothioate internucleoside linkages, stereorandom internucleoside linkages, dithiophosphonate internucleoside linkages of formula (I), and phosphodiester internucleoside linkages.

[1091] 33. The oligonucleotide nicked polymer according to embodiment 32, wherein the remaining internucleoside linkages inside region F, inside region F', or inside both region F and region F' are phosphorodithioate internucleoside linkages of formula (I) as defined in embodiment 1.

[1092] 34. The nicked polymer oligonucleotide according to any one of embodiments 6 to 33, wherein the internucleoside linkages between the nucleosides in region G comprise 0, 1, 2, or 3 phosphorodithioate internucleoside linkages of formula (I) as defined in embodiment 1 and the remaining internucleoside linkages inside region G are independently selected from stereodefined phosphorothioate internucleoside linkages, stereorandom internucleoside linkages, and phosphodiester internucleoside linkages.

[1093] 35. A pharmaceutically acceptable salt of the nicked polymer oligonucleotide according to any one of embodiments 1 to 34, in particular a sodium salt or a potassium salt.

[1094] 36. A conjugate comprising a nicked polymer oligonucleotide or a pharmaceutically acceptable salt according to any one of embodiments 1 to 35 and at least one conjugate moiety covalently linked to the oligonucleotide or the pharmaceutically acceptable salt, optionally via a linker moiety.

[1095] 37. A pharmaceutical composition comprising a nicked polymer oligonucleotide, a pharmaceutically acceptable salt, or a conjugate according to any one of embodiments 1 to 36 and a therapeutically inert carrier.

[1096] 38. A nicked polymer oligonucleotide, a pharmaceutically acceptable salt, or a conjugate according to any one of embodiments 1 to 36, for use as a therapeutic active substance.

[1097] 39. The present invention as described above.

[1098] The present invention will now be illustrated by the following examples, which have no limiting character. Examples

[1099] Example 1: Monomer synthesis

[1100] 1.1: S-(2-Thioethyl) phenylthiolcarboxylate

[1101]

[1102] To a solution of 1,2-ethanedithiol (133.57 mL, 1592 mmol, 1 equiv) and pyridine (64.4 mL, 796 mmol, 0.5 equiv) in chloroform (200 mL) was added dropwise benzoyl chloride (92.4 mL, 796 mmol, 0.5 equiv) in chloroform (200 mL) over 1 h, and the reaction was stirred at 0 °C for 1 h. The mixture was washed with water (300 mL) and brine (300 mL). The organic phase was dried over Na2SO4 and concentrated to a yellow oil. The oil was distilled (135 - 145 °C) to afford S-(2-thioethyl) benzenecarbothioate as a colorless oil (40 g, 202 mmol, 13% yield). 1 H NMR (400 MHz, CDCl3) δ 7.97 (d, J = 7.34 Hz, 2H), 7.53 - 7.64 (m, 1H), 7.47 (t, J = 7.58 Hz, 2H), 3.31 (t, J = 7.34 Hz, 2H), 2.77 - 2.86 (m, 2H), 1.70 (t, J = 8.56 Hz, 1H).

[1103] 1.2: S-[2-[[(1R,3R,4R,7S)-1-[[bis(4-methoxyphenyl)phenylmethoxy]methyl]-3-(5-methyl-2,4-dioxo-pyrimidin-1-yl)-2,5-dioxabicyclo[2.2.1]hept-7-yl]oxy-pyrrolidin-1-yl-phosphanyl]thioethyl] benzenecarbothioate

[1104]

[1105] 1-[(1R,4R,6R,7S)-4-[[bis(4-methoxyphenyl)phenylmethoxy]methyl]-7-hydroxy-2,5-dioxabicyclo[2.2.1]hept-6-yl]-5-methyl-pyrimidine-2,4-dione (2.29 g, 4.00 mmol, 1.0 equiv) was dissolved in 60 mL of anhydrous dichloromethane, to which was added a spatula tip of molecular sieves. Tripyrrolidin-1-ylphosphane (960 mg, 3.98 mmol, 0.99 equiv) was added via syringe, followed by the addition of seven equal portions of 0.1 mmol of tetrazole at 2 min intervals (in 7 * 0.4 mL of a 0.5 M solution in anhydrous acetonitrile stored on the molecular sieve). Subsequently, N-trimethylsilylimidazole (56.0 mg, 0.400 mmol, 0.1 eq) was added to the reaction. After 5 minutes, tetrazole (21.6 mL of a 0.5 M solution in anhydrous acetonitrile) was added, and immediately thereafter, S-(2-thioethyl) phenylthiolate (1.04 g, 5.24 mmol, 1.31 eq) was added. The reaction was allowed to proceed for 120 seconds. Four identical batches of the reaction were combined and quenched by pouring the solution into 600 mL of dichloromethane containing 40 mL of triethylamine. The mixture was immediately washed with saturated sodium bicarbonate (800 mL), followed by washing with 10% sodium carbonate (2 * 800 mL) and brine (800 mL). The organic layer was dried over Na2SO4. After 10 - 15 minutes, the drying agent was removed by filtration. Triethylamine (40 mL) was added to the solution, and the solution was concentrated to a slurry using a rotary evaporator. The slurry was dissolved in toluene (200 mL) and triethylamine (40 mL), and this solution was suctioned into 4500 mL of vigorously stirred heptane to precipitate a fluffy white product. After decanting most of the heptane, the white precipitate was collected by filtration through a medium sintered glass funnel and then dried under vacuum to give a white solid. The solid was purified by preparative HPLC (Phenomenex Gemini C18, 250x50 mm, 10 mm column, 0.05% ammonium hydroxide in water / CH3CN) and lyophilized to give 4.58 g of the target compound as a white solid. 31 P NMR (162 MHz, CD3CN) δ 167.6, 164.2. 1 H NMR (400 MHz, CD3CN) δ 9.16 (br s, 1H), 7.93 (t, J = 7.41 Hz, 2H), 7.60 - 7.71 (m, 1H), 7.45 - 7.57 (m, 4H), 7.24 - 7.45 (m, 7H), 6.90 (d, J = 8.93 Hz, 4H), 5.53 - 5.63 (m, 1H), 4.41 - 4.64 (m, 2H), 3.74 - 3.88 (m, 8H), 3.39 - 3.63 (m, 2H), 3.03 - 3.32 (m, 5H), 2.77 - 2.94 (m, 2H), 1.66 - 1.84 (m, 4H), 1.54 - 1.66 (m, 3H).

[1106] 1.3: S-[2-[[(1R,3R,4R,7S)-3-(6-Benzamidopurin-9-yl)-1-[[bis(4-methoxyphenyl)-phenyl-methoxy]methyl]-2,5-dioxabicyclo[2.2.1]hept-7-yl]oxy-pyrrolidin-1-yl-phosphanyl]thioethyl] phenylthiolate

[1107] Dissolve N-[9-[(1R,4R,6R,7S)-4-[[bis(4-methoxyphenyl)phenylmethoxy]methyl]-7-hydroxy-2,5-dioxabicyclo[2.2.1]hept-6-yl]purin-6-yl]benzamide (2.74 g, 4.00 mmol, 1.0 eq) in 60 mL of anhydrous dichloromethane and add to it a spatula tip of molecular sieve. Add tripyrrolidin-1-ylphosphane (960 mg, 3.98 mmol, 0.99 eq) via syringe, and then add seven equal portions of 0.1 mmol of tetrazole at 2-minute intervals (7 * 0.4 mL of a 0.5 M solution in anhydrous acetonitrile stored on molecular sieve). Subsequently add 1-(trimethylsilyl)-1H-imidazole (56.0 mg, 0.400 mmol, 0.1 eq) to the reaction. After 5 minutes, add tetrazole (21.6 mL of a 0.5 M solution in anhydrous acetonitrile), and then immediately add S-(2-sulfanylethyl) benzenecarbothioate (1.04 g, 5.24 mmol, 1.31 eq). Allow the reaction to proceed for 120 seconds. Quench four identical batches of the reaction by pouring the solution into 600 mL of dichloromethane containing 40 mL of triethylamine. Wash the mixture immediately with saturated sodium bicarbonate (800 mL), then with 10% sodium carbonate (2 * 800 mL) and brine (800 mL). Dry the organic layer over Na2SO4. After 10 - 15 minutes, remove the desiccant by filtration. Add triethylamine (10 mL) to the solution and concentrate the solution to a slurry using a rotary evaporator. Dissolve the slurry in toluene (100 mL) and triethylamine (20 mL), and suck this solution into 4500 mL of vigorously stirred heptane to precipitate a fluffy white product. After decanting most of the heptane, filter through a medium sintered glass funnel, collect the white precipitate and then dry it under vacuum to give a white solid. Purify the solid by preparative HPLC (Phenomenex Gemini C18, 250 x 50 mm, 10 mm column, 0.05% ammonium hydroxide in water / CH3CN) and lyophilize to afford 5.26 g of the title compound as a white solid. 31 P NMR (162 MHz, CD3CN) δ 165.6, 164.7. 11H NMR (400 MHz, CD3CN) δ 8.56 (d, J = 10.76 Hz, 1H), 8.24 (d, J = 10.27 Hz, 1H), 7.82 - 7.93 (m, 2H), 7.71 - 7.80 (m, 2H), 6.92 - 7.54 (m, 14H), 6.68 - 6.83 (m, 4H), 6.03 (d, J = 6.48 Hz, 1H), 4.70 - 4.90 (m, 2H), 3.81 - 3.98 (m, 2H), 3.59 - 3.68 (m, 7H), 3.25 - 3.47 (m, 2H), 2.81 - 3.02 (m, 6H), 2.56 - 2.81 (m, 2H), 1.44 - 1.72 (m, 4H).

[1108] 1.4: S - [2 - [[(1R,3R,4R,7S) - 3 - (4 - benzamido - 5 - methyl - 2 - oxo - pyrimidin - 1 - yl) - 1 - [[bis(4 - methoxyphenyl)phenylmethoxy]methyl] - 2,5 - dioxabicyclo[2.2.1]hept - 7 - yl]oxy - pyrrolidin - 1 - yl - phosphanyl]sulfanyl]ethyl] benzenecarbothioate

[1109]

[1110] Dissolve N - [1 - [(1R,4R,6R,7S) - 4 - [[bis(4 - methoxyphenyl)phenylmethoxy]methyl] - 7 - hydroxy - 2,5 - dioxabicyclo[2.2.1]hept - 6 - yl] - 5 - methyl - 2 - oxo - pyrimidin - 4 - yl]benzamide (2.70 g, 4.00 mmol, 1.0 equivalent) in 60 mL of anhydrous dichloromethane, and add a spatula tip of molecular sieve. Add tri - pyrrolidin - 1 - ylphosphane (965 mg, 4.00 mmol, 1.0 equivalent) by syringe, and then add seven equal portions of 0.1 mmol of tetrazole at 2 - minute intervals (in 7 * 0.4 mL of a 0.5 M solution in anhydrous acetonitrile stored on a molecular sieve). Subsequently, 1-(trimethylsilyl)-1H-imidazole (56.0 mg, 0.400 mmol, 0.1 equivalent) was added to the reaction. After 5 minutes, tetrazole (21.6 mL of a 0.5 M solution in anhydrous acetonitrile) was added, and immediately thereafter, S-(2-thioethyl) phenylthiolcarboxylate (1.04 g, 5.24 mmol, 1.31 equivalents) was added. The reaction was allowed to proceed for 120 seconds. The reaction of four identical batches was quenched and combined by pouring the solution into 600 mL of dichloromethane containing 40 mL of triethylamine. The mixture was immediately washed with saturated sodium bicarbonate (800 mL), followed by washing with 10% sodium carbonate (2 * 800 mL) and brine (800 mL). The organic layer was dried over Na2SO4. After 10 - 15 minutes, the desiccant was removed by filtration. Triethylamine (40 mL) was added to the solution, and the solution was concentrated to a slurry using a rotary evaporator. The slurry was dissolved in toluene (100 mL) and triethylamine (30 mL), and this solution was suctioned into 4500 mL of vigorously stirred heptane to precipitate a fluffy white product. After decanting most of the heptane, the white precipitate was collected by filtration through a medium sintered glass funnel and then dried under vacuum to yield a white solid. The solid was purified by preparative HPLC (Phenomenex Gemini C18, 250x50 mm, 10 mm column, 0.05% ammonium hydroxide in water / CH3CN) and lyophilized to afford 2.05 g of the target compound as a white solid. 31 31P NMR (162 MHz, CD3CN) δ 171.2, 167.4. 1 1H NMR (400 MHz, CD3CN) δ 8.18 - 8.32 (m, 2H), 7.81 - 7.93 (m, 3H), 7.35 - 7.60 (m, 14H), 7.17 - 7.35 (m, 2H), 6.93 (d, J = 8.93 Hz, 4H), 5.65 (d, J = 15.04 Hz, 1H), 4.56 - 4.72 (m, 2H), 3.69 - 3.90 (m, 8H), 3.45 - 3.61 (m, 2H), 3.03 - 3.26 (m, 6H), 2.76 - 3.02 (m, 2H), 1.65 - 1.93 (m, 7H).

[1111] 1.5: S-[2-[[(1R,3R,4R,7S)-1-[[bis(4-methoxyphenyl)-phenyl-methoxy]methyl]-3-[2-[(E)-dimethylaminomethyleneamino]-6-oxo-1H-purin-9-yl]-2,5-dioxabicyclo[2.2.1]hept-7-yl]oxy-pyrrolidin-1-yl-phosphanyl]thioethyl] phenylthiolcarboxylate

[1112]

[1113] Dissolve N'-[9-[(1R,4R,6R,7S)-4-[[bis(4-methoxyphenyl)phenylmethoxy]methyl]-7-hydroxy-2,5-dioxabicyclo[2.2.1]hept-6-yl]-6-oxo-1H-purin-2-yl]-N,N-dimethylformamidine (2.62 mg, 4.00 mmol, 1.0 equiv) in 200 mL of anhydrous dichloromethane, and add a spatula tip of molecular sieve. Add tripyrrolidin-1-ylphosphine (965 mg, 4.00 mmol, 1.0 equiv) via syringe, and then add seven equal portions of 0.1 mmol of tetrazole at 2-minute intervals (7 * 0.4 mL of a 0.5 M solution in anhydrous acetonitrile stored on molecular sieve). Subsequently, add 1-(trimethylsilyl)-1H-imidazole (56.0 mg, 0.400 mmol, 0.1 equiv) to the reaction. After 5 minutes, add tetrazole (21.6 mL of a 0.5 M solution in anhydrous acetonitrile), and then immediately add S-(2-thioethyl) phenylthiolcarboxylate (1.04 g, 5.24 mmol, 1.31 equiv). Allow the reaction to proceed for 180 seconds.

[1114] Combine and quench four identical batches by pouring the solution into 600 mL of dichloromethane containing 40 mL of triethylamine. Wash the mixture immediately with saturated sodium bicarbonate (800 mL), then with 10% sodium carbonate (2 * 800 mL) and brine (800 mL). Dry the organic layer over Na2SO4. After 10 - 15 minutes, remove the desiccant by filtration. Add triethylamine (40 mL) to the solution, and concentrate the solution to a slurry using a rotary evaporator. Dissolve the slurry in toluene (100 mL) and triethylamine (30 mL), and suck this solution into 4500 mL of vigorously stirred heptane to precipitate a fluffy white product. After decanting most of the heptane, filter through a medium sintered glass funnel, collect the white precipitate and then dry it under vacuum to give a white solid. Purify the solid by preparative HPLC (Phenomenex Gemini C18, 250x50 mm, 10 mm column, 0.05% ammonium hydroxide in water / CH3CN) and lyophilize to afford 3.82 g of the target compound as a yellow solid. 31 13C NMR (162 MHz, CD3CN) δ 167.1, 162.2. 11H NMR (400 MHz, CD3CN) δ 9.36 (br s, 1H), 8.63 (d, J = 16.51 Hz, 1H), 7.78 - 8.00 (m, 3H), 7.66 (t, J = 7.62 Hz, 1H), 7.42 - 7.57 (m, 4H), 7.24 - 7.40 (m, 7H), 6.89 (d, J = 8.68 Hz, 4H), 5.92 - 5.98 (m, 1H), 4.72 - 4.97 (m, 2H), 3.86 - 4.05 (m, 2H), 3.78 (2s, 6H), 3.27 - 3.70 (m, 3H), 2.87 - 3.20 (m, 12H), 2.67 - 2.82 (m, 2H), 1.54 - 1.79 (m, 4H).

[1115] Example 2: Oligonucleotide Synthesis

[1116] Oligonucleotides were synthesized by Bioautomation using a MerMade 12 automated DNA synthesizer. Controlled pore glass supports carrying universal linkers were used Synthesis was carried out on a 1 μmol scale.

[1117] In the standard cycle program for coupling DNA and LNA phosphoramidites, DMT deprotection was carried out by applying 3% (w / v) trichloroacetic acid in CH2Cl2 three times for 30 s in 200 μL. 100 μL of a 0.1 M solution in acetonitrile (or for LNA- Me C building blocks, a solution in acetonitrile / CH2Cl2 1:1) and 110 μL of a 0.1 M 5-(3,5-bis(trifluoromethyl)phenyl)-1H-tetrazole solution in acetonitrile were used as activators and the coupling time was 180 s, coupling the corresponding phosphoramidites three times. For sulfurization, a 0.1 m solution of 3-amino-1,2,4-dithiazole-5-thione in acetonitrile / pyridine 1:1 (3 x 190 μL, 55 s) was used. Capping was carried out using THF / collidine / Ac2O 8:1:1 (CapA, 75 μmol) and THF / N-methylimidazole 8:2 (CapB, 75 μmol) for 55 s.

[1118] The synthetic cycle for introducing phosphorothioamidates includes: Deprotecting DMT by applying 3% (w / v) trichloroacetic acid in CH2Cl2 three times for 30 seconds each at 200 μL. Using 100 μL of a 0.15 M solution in 10% (v / v) CH2Cl2 in acetonitrile and 110 μL of a 0.1 M 5-(3,5-bis(trifluoromethyl)phenyl)-1H-tetrazole solution in acetonitrile as activators and coupling for 600 seconds each time, coupling commercially available DNA phosphorothioamidates or freshly prepared LNA phosphorothioamidates three times. Performing sulfur oxidation by applying a solution of 0.1 M 3-amino-1,2,4-dithiazole-5-thione in acetonitrile / pyridine three times for 55 seconds each. Performing capping using THF / collidine / Ac2O 8:1:1 (CapA, 75 μmol) and THF / N-methylimidazole 8:2 (CapB, 75 μmol) for 55 seconds.

[1119] Once automated synthesis is complete, nucleobase protecting group removal and cleavage from the solid support are carried out using a mixture of ammonia (32%):ethanol (3:1, v:v) containing 20 mM DTT at 55 °C for 15 - 16 hours.

[1120] The crude DMT-bearing oligonucleotide is purified using a solid-phase extraction cartridge column and further purified by ion-exchange chromatography or by RP-HPLC purification method using a C18 column, followed by removal of DMT by precipitation with 80% aqueous acetic acid and ethanol.

[1121] In the following examples, we have used the following phosphorothioate chemistries

[1122]

[1123]

[1124] In the following examples, unless otherwise stated, the achiral phosphorodithioate bond (also referred to as P2S) is a non-bridging dithioester (as shown in formula (IA) or (IB)) and is labeled with *. Compounds used in the examples include compounds having the following nucleobase sequences:

[1125] SEQ ID NO 1: GCATTGGTATTCA

[1126] SEQ ID NO 2: TCTCCCAGCGTGCGCCAT

[1127] SEQ ID NO 3: GAGTTACTTGCCAACT

[1128] SEQ ID NO 4: TATTTACCTGGTTGTT

[1129] SEQ ID NO 5: CAATCAGTCCTAG

[1130] The following molecules have been prepared according to the above procedure.

[1131]

[1132]

[1133] * Dithioester modification between adjacent nucleotides

[1134] A, G, m C, T represent LNA nucleotides

[1135] a, g, c, t represent DNA nucleot...

Claims

1. An antisense gapmer oligonucleotide for inhibiting a target RNA in a cell, wherein the antisense gapmer oligonucleotide comprises at least one phosphorothioate internucleoside bond of formula (IA) or (IB). Wherein in formula (IA), R is hydrogen or a phosphate protecting group, and in formula (IB), M+ is a metal cation or M+ is an ammonium cation, wherein the gapmer oligonucleotide has a continuous nucleotide sequence of formula 5'-F-G-F'-3', wherein the gap region G is a region of 5 to 18 nucleosides capable of recruiting RNase H, and flanking regions F and F' are respectively distributed on the 5' and 3' sides of the region G, wherein all the nucleosides in both the region F and the region F' are LNA nucleosides, and all the nucleosides in the gap region G are DNA nucleosides, and all the internucleoside bonds between the nucleosides in the gap region are phosphorothioate bonds.

2. The antisense gapmer oligonucleotide according to claim 1, which comprises 1, 2, 3, 4 or 5 phosphorothioate internucleoside bonds of formula (IA) or formula (IB).

3. The antisense gapmer oligonucleotide according to any one of claims 1 to 2, wherein the regions F and F' independently comprise 1 to 7 LNA nucleosides.

4. The antisense gapmer oligonucleotide according to any one of claims 1 to 3, wherein the gap region G comprises 5 to 16 consecutive DNA nucleosides.

5. The antisense gapmer oligonucleotide according to claim 1, wherein the regions F and F' are independently 1, 2, 3, 4, 5, 6, 7 or 8 nucleosides in length.

6. The antisense gapmer oligonucleotide according to any one of claims 1 to 5, wherein the regions F and F' each independently comprise 1, 2, 3 or 4 LNA nucleosides.

7. The antisense gapmer oligonucleotide according to any one of claims 1 to 6, wherein the oligonucleotide has a length of 10 to 30 nucleotides.

8. The antisense gapmer oligonucleotide according to any one of claims 1-7, wherein at least one of the flanking regions comprises a phosphorothioate bond of formula (IA) or (IB) as defined in any one of claims 1-7.

9. The antisense gapmer oligonucleotide according to any one of claims 1-7, wherein both flanking regions comprise a phosphorothioate bond of formula (IA) or (IB) as defined in any one of claims 1-7.

10. The antisense gapmer oligonucleotide according to any one of claims 1-7, wherein at least one of the flanking regions comprises at least two phosphorothioate bonds of formula (IA) or (IB) as defined in any one of claims 1-7.

11. The antisense gapmer oligonucleotide according to any one of claims 1-7, wherein both flanking regions F and F' comprise at least two phosphorothioate bonds of formula (IA) or (IB) as defined in any one of claims 1-7.

12. The antisense gapmer oligonucleotide according to any one of claims 1-11, wherein one or both of the flanking regions have a phosphorothioate bond of formula (IA) or (IB) that links the LNA to the 3'-nucleoside.

13. The antisense gapmer oligonucleotide according to any one of claims 1-12, wherein one or both of the flanking regions each comprise two or more contiguous LNA nucleosides linked by a phosphorodithioate bond of formula (IA) or (IB), wherein the phosphorodithioate bond of formula (IA) or (IB) links the LNA to the 3'-nucleoside.

14. The antisense gapmer oligonucleotide according to any one of claims 1–13, wherein the flanking regions F and F' together comprise 1, 2, 3, 4 or 5 phosphorodithioate internucleoside bonds of formula (IA) or (IB).

15. The antisense gapmer oligonucleotide according to claim 14, wherein the internucleoside bond between the 3'-terminal nucleoside of region F and the 5'-terminal nucleoside of region G is also a phosphorodithioate internucleoside bond of formula (IA) or (IB).

16. The antisense gapmer oligonucleotide according to any one of claims 1-15, wherein the gap region comprises a region of at least 5 consecutive DNA nucleotides.

17. The antisense gapmer oligonucleotide according to any one of claims 1-16, which further comprises one or more stereoisomeric phosphorothioate internucleoside bonds, the stereoisomeric phosphorothioate internucleoside bonds being of the Sp or Rp type Wherein N 1 and N 2 are nucleosides.

18. The antisense gapmer oligonucleotide according to claim 17, wherein the gapmer comprises at least one stereoisomeric phosphorothioate internucleoside bond between two DNA nucleosides in the gap region, the stereoisomeric internucleoside bond being of the Sp or Rp type.

19. The antisense gapmer oligonucleotide according to claim 17 or 18, wherein the gap region comprises 2, 3, 4, 5, 6, 7 or 8 stereoisomeric phosphorothioate internucleoside bonds independently selected from Rp and Sp types.

20. The antisense gapmer oligonucleotide according to any one of claims 17-19, wherein all internucleoside bonds within region G are independently selected from stereoisomeric phosphorothioate internucleoside bonds of the Rp and Sp types.

21. The antisense gapmer oligonucleotide according to any one of claims 17-20, wherein all internucleoside bonds within the flanking regions are phosphorodithioate internucleoside bonds of formula (IA) or (IB).

22. The antisense gapmer oligonucleotide according to any one of claims 17-21, wherein the internucleoside bond between the 3'-terminal nucleoside of region F and the 5'-terminal nucleoside of region G is a phosphorodithioate internucleoside bond of formula (IA) or (IB), and the internucleoside bond between the 3'-terminal nucleoside of region G and the 5'-terminal nucleoside of region F' is a stereoisomeric phosphorothioate internucleoside bond.

23. The antisense gapmer oligonucleotide according to any one of claims 1 to 22, wherein the remaining internucleoside bonds are independently selected from phosphorothioate internucleoside bonds, phosphodiester internucleoside bonds and phosphorodithioate internucleoside bonds of formula (IA) or (IB) as defined in claim 1.

24. The antisense gapmer oligonucleotide according to any one of claims 1 to 23, wherein the internucleoside bonds between the nucleosides in region F and the internucleoside bonds between the nucleosides in region F' are independently selected from phosphorothioate internucleoside bonds and dithiophosphorothioate internucleoside bonds of formula (IA) or formula (IB) as defined in claim 1.

25. The antisense gapmer oligonucleotide according to any one of claims 1 to 24, wherein each of the flanking regions F and F' independently comprises 1, 2, 3, 4, 5, 6 or 7 dithiophosphorothioate internucleoside bonds of formula (IA) or formula (IB) as defined in claim 1.

26. The antisense gapmer oligonucleotide according to any one of claims 1-25, wherein all of the internucleoside bonds in the flanking region F and / or F' are dithiophosphorothioate internucleoside bonds of formula (IA) or formula (IB) as defined in claim 1.

27. The antisense gapmer oligonucleotide according to any one of claims 17 to 26, wherein all of the internucleoside bonds between the nucleosides in the gap region are stereoisomeric phosphorothioate internucleoside bonds.

28. The antisense gapmer oligonucleotide according to any one of claims 1 to 27, wherein the gapmer oligonucleotide is capable of recruiting human RNase H1.

29. The antisense gapmer oligonucleotide according to any one of claims 1 to 28, wherein the gapmer oligonucleotide is used for in vitro or in vivo inhibition of mammalian mRNA or pre-mRNA targets, or viral targets or non-coding long RNAs.

30. A pharmaceutically acceptable salt of the antisense gapmer oligonucleotide according to any one of claims 1 to 29.

31. The pharmaceutically acceptable salt of the antisense gapmer oligonucleotide according to claim 30, which is a sodium salt or a potassium salt.

32. A conjugate comprising the antisense gapmer oligonucleotide according to any one of claims 1 to 29 or the pharmaceutically acceptable salt according to claim 30 or 31 and at least one conjugate moiety covalently linked to the antisense gapmer oligonucleotide or the pharmaceutically acceptable salt of the antisense gapmer oligonucleotide.

33. A conjugate comprising the antisense gapmer oligonucleotide according to any one of claims 1 to 29 or the pharmaceutically acceptable salt according to claim 30 or 31 and at least one conjugate moiety covalently linked to the antisense gapmer oligonucleotide or the pharmaceutically acceptable salt of the antisense gapmer oligonucleotide via a linker moiety.

34. A pharmaceutical composition comprising the antisense gapmer oligonucleotide according to any one of claims 1 to 29, the pharmaceutically acceptable salt of the antisense gapmer oligonucleotide according to claim 30 or 31, or the conjugate according to claim 32 or 33.

Images