Gossypium barbadense gb cyp72a2 gene, its coding protein and application

Abstract

The application discloses a Gossypium barbadense L. GbCYP72A2 gene, a coding protein thereof and application. The gene has a transcription start site at the 1st base from the 5' end, and a transcription termination codon at the 1558-1560th base. The coding frame is 1557 bases, and the gene codes 519 amino acids. The gene has 97% similarity with a homologous gene GbCYP72A1, but 3% sequence difference can endow a plant with higher resistance to verticillium wilt. The gene can enrich disease-resistant gene resources, provide an effective new tool for cotton breeding against verticillium wilt, and the overexpression of the gene can reduce the sensitivity of a plant to ABA in the germination stage. The down-regulated expression of the gene can also promote the growth of the plant.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the GbCYP72A2 gene of sea island cotton, its encoded protein, and its application in plant resistance to Verticillium wilt. Background Technology

[0002] Cotton is an important economic crop, and cotton fiber is a major raw material for the textile industry. With the reduction of arable land and environmental degradation, cotton production is affected by various biotic and abiotic factors, especially the frequent occurrence of Verticillium wilt and other diseases, causing significant losses to cotton production in my country. Traditional breeding methods are no longer sufficient to meet the needs of modern agriculture; therefore, improving existing varieties through genetic engineering will be the main method for future breeding. Previous research has shown that the resistance mechanism of cotton Verticillium wilt involves multiple signaling pathways and substances. Existing research results indicate that terpenoids and phenylpropanoids are involved in the cotton resistance process. Results show that at least reactive oxygen species, salicylic acid, jasmonic acid, ethylene, brassinolide, spermine, and camalexin (Johansson et al., 2006; Gao et al., 2013; Mo et al., 2015, 2016) are involved in the cotton resistance process. To explore the resistance mechanism of cotton to Verticillium wilt, many researchers have cloned a large number of genes related to plant resistance to Verticillium wilt. The Ve1 gene in tomato is currently the most well-known cloned gene for resistance to Verticillium wilt (Kawchuk et al., 2001; Fradin et al., 2011). However, studies have shown that this gene does not provide resistance to Verticillium wilt in cotton, indicating that the resistance mechanism of cotton to Verticillium wilt differs significantly from that of tomatoes (Liu et al., 2014). Several Ve-related genes have also been cloned in cotton, and transgenic cotton has shown varying degrees of resistance to Verticillium wilt, but in-depth investigations into their resistance mechanisms have not yet been reported (Zhang et al., 2011; Zhang et al., 2012). Besides the Ve gene, researchers have cloned numerous other genes related to Verticillium wilt resistance from the cotton genome, including GbCAD1, GbSSI2 (Gao et al., 2013), GbRLK (Zhao et al., 2015), GbSTK (Zhang et al., 2013), GbTLP1 (Munis et al., 2010), GbERF1-like (Guo et al., 2016), GhPAO (Mo et al., 2015), GhSAMDC (Mo et al., 2016), and Gbvdr5 (Yang et al., 2015). Meanwhile, some researchers have also demonstrated that certain exogenous genes can enhance cotton's resistance to Verticillium wilt, such as GAFPs (Wang et al., 2015) and Hpal... Xoo(Miao et al., 2010), NaD1 (Gaspar et al., 2014), p35 (Tian et al., 2010), and Hcm1 (Zhang et al., 2016). These studies are still in the experimental stage, having only yielded engineered plants resistant to Verticillium wilt, but there are no reports of resistant varieties being bred through transgenic methods. Their commercial viability requires further investigation.

[0003] CYP450 is a family of proteins widely distributed in microorganisms, plants, and animals. These proteins possess monooxygenase activity and can catalyze a variety of reactions, but their primary catalytic mechanism involves inserting one oxygen atom from an oxygen molecule into the substrate, reducing the other oxygen atom to a water molecule (Werck-Reichhart & Feyereisen, 2000). CYP450 proteins are one of the largest protein families in plants; Arabidopsis thaliana alone has 272 CYP450 gene family members, participating in the synthesis of various substances, including not only macromolecules such as lignin, suberin, and cutin, but also small molecules such as hormones and signaling molecules (Werck-Reichhart et al., 2002). However, due to their large number, the functions of most CYP450 proteins remain unknown. Some CYP450 genes play important roles in plant disease resistance, and their disease resistance effects have been reported. For example, AtCYP76C2 can enhance the resistance of Arabidopsis thaliana to Sclerotinia sclerotiorum (Chen et al., 2011), and OsCYP71Z2 can enhance the resistance of rice to bacterial blight (Li et al., 2013). In recent years, studies have shown that some CYP450 genes also play an important role in plant resistance to Verticillium wilt. For example, the StoCYP77A2 gene in wild eggplant can enhance the resistance of tobacco to Verticillium wilt (Yang et al., 2015); the cotton GhCYP82D protein-coding gene SSN (SILENCE-INDUCED STEMNECROSIS) regulates systemic cell death through the 18-carbon fatty acid pathway, and its silencing expression can enhance the resistance of cotton to Verticillium wilt, while overexpression of the gene reduces the resistance of the strain (Sun et al., 2014). Lignin synthesis plays a crucial role in plant resistance to Verticillium wilt. Several CYP450 proteins are key catalytic enzymes in this pathway, such as AtCYP73A5, which functions as cinnamate 4-hydroxylase (C4H), and AtCYP98A3, which functions as p-coumaroyl shikimate 3'-hydroxylase (C3'H) (Fraser, Chapple, 2011). In Verticillium wilt-resistant cotton varieties, the expression levels of the C4H and C3'H encoding genes are significantly higher than in susceptible varieties (Xu et al., 2011).

[0004] Within the CYP450 gene family, some members of the CYP72 subfamily have been reported to participate in plant responses to and resistance to pathogens. In rice, the expression of seven CYP724 genes in the CYP72A gene cluster is induced by infection with *Bacillus oryzae* (Yaling et al., 2004). In *Arabidopsis thaliana*, the expression of CYP72A14 is induced by *Botrytis cinerea* and *Phytophthora indicum*, while its homologous gene EST sequence (TC145315) in upland cotton has also been detected to be induced by *Verticillium wilt* infection (Xu et al., 2014). In *Tobacco deciduous*, the NpCYP72A2 gene can enhance tobacco resistance to *Pseudomonas* (Smigocki & Wilson, 2004). However, the molecular functions and mechanisms of action of these CYP72A genes remain unknown. Summary of the Invention

[0005] The purpose of this invention is to provide a GbCYP72A2 gene for sea island cotton, which can significantly improve cotton's resistance to Verticillium wilt.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] A Sea Island cotton GbCYP72A2 gene, the DNA molecule of which is the nucleotide sequence shown in SEQ ID NO.1 of the sequence listing or a nucleotide sequence capable of hybridizing with the DNA sequence shown in SEQ ID NO.1 of the sequence listing. The Sea Island cotton GbCYP72A2 gene is derived from Sea Island cotton Hai7124 and is located on chromosome D4 of the cotton chromosome set.

[0008] The protein encoded by the GbCYP72A2 gene of the aforementioned sea island cotton has the amino acid sequence shown in SEQ ID No. 2.

[0009] The sequence SEQ ID NO.1 consists of 1560 bases, with the transcription start site at the 5' end and the transcription stop codons at positions 1558-1560. The coding frame is 1557 bases long, encoding 519 amino acids. The molecular weight is 127 kDa, and the isoelectric point is 5.0. This protein possesses one transmembrane domain and one P450 region.

[0010] Using DNA from the sea island cotton variety H7124 as a template, the genomic sequence of the GbCYP72A2 gene was amplified. Then, RNA was extracted from root tissues of sea island cotton variety H7124 at different stages after inoculation with Verticillium wilt, and cDNA was obtained by reverse transcription. Using the primer pair F:ATGGATTCAACAGCAAAGC, R:CTATAAAGGATGAAGCATTAC, the GbCYP72A2 gene sequence of sea island cotton H7124 was amplified.

[0011] A key objective of this invention is to provide an expression vector or host cell for the GbCYP72A2 gene (belonging to the cytochrome P450 gene of cotton sea island) in obtaining transgenic plants resistant to Verticillium wilt. Its most significant role is in the breeding of cotton for Verticillium wilt resistance. Besides enhancing the plant's resistance to Verticillium wilt, overexpression of this gene can reduce the plant's sensitivity to ABA during germination, while downregulation can promote plant growth.

[0012] The GbCYP72A2 gene involved in this invention shows a significant increase in expression after induction by the cotton Verticillium wilt pathogen strain V991. Silencing GbCYP72A2 significantly reduces the resistance of the sea island cotton Hai7124 to the cotton Verticillium wilt pathogen strain V991. Constructing an overexpression vector of the GbCYP72A2 gene and transforming it into Arabidopsis thaliana significantly enhances the transgenic Arabidopsis' resistance to the Verticillium wilt pathogen strain V991. Various plant expression vectors can be constructed using the gene of this invention to improve the disease resistance traits of Verticillium wilt-related host plants or to improve cotton's resistance to Verticillium wilt.

[0013] Expression vectors, recombinant vectors, recombinant strains, or transgenic cell lines containing the above-mentioned genes are all within the scope of protection of this invention.

[0014] Cloned genes containing the nucleotide sequence or at least a portion thereof provided by this invention can be expressed in exogenous hosts through a suitable expression system to enhance the disease resistance of Verticillium wilt-associated host plants.

[0015] Peptides containing the amino acid sequence or at least part of the sequence provided by the present invention may still have biological activity or even new biological activity after the removal or substitution of certain amino acids.

[0016] Genes containing the nucleotide sequences or at least a portion thereof provided by this invention can be expressed in a heterologous host and their function in the host metabolic chain can be understood through DNA microarray technology.

[0017] The invention includes proteins encoded by the nucleotide sequences provided in this invention, as well as nucleotide sequences and proteins that are functionally identical or similar to the GbCYP72A2 gene.

[0018] Genes containing the nucleotide sequence or at least a portion of the nucleotide sequence provided by this invention can be used to construct recombinant plasmids through genetic recombination to obtain novel biosynthetic pathways, or they can be used to obtain novel biosynthetic pathways through insertion, substitution, deletion or inactivation.

[0019] The nonribosomal peptide synthases provided in this invention can generate new polypeptide compounds by deleting, inserting, or inactivating one or more nonribosomal peptide synthase domains, modules, or genes from the same or different nonribosomal peptide synthase systems.

[0020] Fragments or genes containing the nucleotide sequences or at least a portion thereof provided by this invention can be used to construct non-ribosomal peptide synthase libraries, non-ribosomal peptide synthase-derived libraries, or combinatorial libraries.

[0021] This gene can also be used in genetic engineering, protein expression, enzyme catalysis, and other fields. It can also be used to find and discover compounds or genes for medicine, industry or agriculture to expand the source range of the GbCYP72A2 gene, and has high application prospects.

[0022] The present invention has the following advantages:

[0023] (1) The GbCYP72A2 gene obtained in this invention is a novel gene that can confer resistance to Verticillium wilt in plants. This gene and its function in plants have not been reported before. Significant differences exist in the coding region and expression pattern of this gene after inoculation among different resistant and susceptible cotton varieties. Constructing an overexpression vector for the GbCYP72A2 gene and introducing it into Arabidopsis thaliana significantly improved the disease resistance of the transgenic Arabidopsis. Comparison revealed sequence differences between this gene and its homolog, the GbCYP72A1 gene (disclosed in the invention patent CN108588041A, entitled "Cytochrome P450 gene of Cotton Island, its encoded protein and application"), and the GbCYP72A2 gene is more effective than the GbCYP72A1 gene in enhancing plant resistance to Verticillium wilt. Therefore, cloning the cytochrome GbCYP72A2 gene can enrich disease resistance gene resources and provide an effective new tool for breeding cotton resistant to Verticillium wilt.

[0024] (2) The GbCYP72A2 gene obtained in this invention can further elucidate the molecular mechanism of cotton resistance to Verticillium wilt. Whether the GbCYP72A2 gene is involved in the disease resistance-related signaling pathway, what its upstream and downstream genes are, what the proteins that interact with it are, and why a small difference in the sequence of the GbCYP72A1 gene can lead to a significant difference in resistance, further research on this gene can theoretically expand our understanding of the mechanism of cotton resistance to Verticillium wilt.

[0025] (3) The inventors conducted further research on it and found through experiments that in addition to improving the plant’s resistance to Verticillium wilt, the gene’s overexpression can reduce the plant’s sensitivity to ABA during the germination period, and its downregulation can also promote plant growth. Attached Figure Description

[0026] Figure 1 This invention relates to the expression pattern of the GbCYP72A2 gene after inoculation with Verticillium wilt in different cotton varieties. ** P < 0.01.

[0027] Figure 2 This is a cluster analysis of the proteins encoded by the GbCYP72A1 and GbCYP72A2 genes with the cytochrome P450 gene in Arabidopsis thaliana.

[0028] Figure 3 This is a comparative analysis of the protein sequences encoded by the GbCYP72A1 and GbCYP72A2 genes. A: Sequence alignment of the proteins encoded by the GbCYP72A1 and GbCYP72A2 genes; B: Domain alignment of the proteins encoded by the GbCYP72A1 and GbCYP72A2 genes; C: Three-dimensional structure alignment of the GbCYP72A1 and GbCYP72A2 genes.

[0029] Figure 4 The study utilized VIGS to silence the GbCYP72A2 gene in Sea Island cotton H7124, significantly reducing its resistance to Verticillium wilt. A: Phenotypic observation of leaves 14 days after injection of the negative control (CK) and positive control pTRV2::CLA1; B: RT-PCR verification of GbCYP72A2 gene expression in cotton seedlings after injection of pTRV2::00 and pTRV2::GbCYP72A2; C: Phenotypic observation of cotton plants injected with pTRV2::00 and pTRV2::GbCYP72A2 28 days after inoculation; D: Phenotypic observation of the non-negative control (CK), pTRV2::00, and pTRV2::CLA1-injected cotton plants. V2: Disease severity index of GbCYP72A2 cotton plants 21 days after inoculation; E: Comparison of longitudinal sections of stems from cotton plants injected with pTRV2:00 and pTRV2:GbCYP72A2 21 days after inoculation; F: Mycelial growth of stem segments from cotton plants injected with pTRV2:00 and pTRV2:GbCYP72A2 21 days after inoculation on PDA medium after 7 days of culture; Standard deviation was calculated with 3 replicates, 20 seedlings per replicate, **: P < 0.01.

[0030] Figure 5 This study identifies the resistance of transgenic Arabidopsis thaliana to Verticillium wilt. A: Target gene expression analysis in transgenic Arabidopsis thaliana; B: Phenotype of transgenic Arabidopsis thaliana 21 days after inoculation with Verticillium wilt pathogen; C: Statistical analysis of disease index, incidence rate, and percentage of each disease level in transgenic Arabidopsis thaliana 21 days after inoculation with Verticillium wilt pathogen. *: P < 0.05, **: P < 0.01.

[0031] Figure 6This study evaluated the germination of GbCYP72A2 transgenic Arabidopsis thaliana on 1 / 2 MS medium containing 2 μM ABA. A: Phenotype of GbCYP72A2 transgenic Arabidopsis thaliana after 8 days of germination on 1 / 2 MS medium containing 0 μM and 2 μM ABA; B: Germination rate statistics of GbCYP72A2 transgenic Arabidopsis thaliana on 1 / 2 MS medium containing 2 μM ABA within 8 days; C: Percentage of green cotyledons of GbCYP72A2 transgenic Arabidopsis thaliana after 8 days of germination on 1 / 2 MS medium containing 2 μM ABA. Standard deviation was calculated with three replicates of 50 seeds each. **: P < 0.01.

[0032] Figure 7 This study analyzed the effects of VIGS-silenced GbCYP72A2 gene in Sea Island cotton H7124 on plant growth. A: Phenotypic observation of cotton plants injected with pTRV2:00 and pTRV2:GbCYP72A2 14 days later; B: Leaf phenotype observation of the positive control pTRV2:CLA1 14 days later; C: Statistical analysis of cotyledon height and cotyledon to first true leaf length of cotton plants injected with pTRV2:00 and pTRV2:GbCYP72A2 14 days later. Standard deviation was calculated with three replicates of 20 seedlings each time. For different lowercase letters: 0.01 < P < 0.05; for different uppercase letters: P < 0.01. Detailed Implementation

[0033] The present invention will now be described in detail through specific embodiments. These embodiments are provided so that this invention will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art.

[0034] As used throughout the specification and claims, the terms "comprising" or "including" are open-ended and should be interpreted as "comprising but not limited to". The following descriptions are preferred embodiments for carrying out the invention; however, these descriptions are for the purpose of understanding the general principles of the specification and are not intended to limit the scope of the invention. The scope of protection of this invention is determined by the appended claims.

[0035] 1. Test materials

[0036] The upland cotton variety Su-mian 8 and the island cotton variety H7124 used in this experiment were introduced from the Jiangsu Academy of Agricultural Sciences and have been rigorously self-pollinated for many years to maintain their purity. The upland cotton introduction line Su-yan VR025 described in this invention is a disease-resistant material bred by our laboratory over many years (this material is disclosed in invention patent publication number CN 105713976 A, entitled "Island cotton chromosome fragment and molecular marker that can improve the resistance of upland cotton to Verticillium wilt"). It is based on upland cotton Su-mian 8, carrying the chromosome fragment of island cotton H7124. After two years of disease resistance evaluation in disease nurseries and greenhouses, its resistance to Verticillium wilt is significantly higher than that of upland cotton Su-mian 8. The Arabidopsis thaliana variety is Columbia type (col-0), which is susceptible to Verticillium wilt. All materials used in this invention can be purchased from the market or obtained according to methods disclosed in existing technologies. Unless otherwise specified, the methods used in this experiment are conventional methods. The primers used were synthesized by Nanjing GenScript Biotech Co., Ltd.

[0037] 2. Test Methods

[0038] 2.2 Obtaining the GbCYP72A2 gene

[0039] Using 3100 pairs of SSR primers distributed across the 26 chromosomes of cotton, whole-genome scanning was performed on SuMian 8 and SuVR025, identifying polymorphic markers NAU3392, NAU6992, NAU6993, NAU3791, cgr6409, JESPR220, NAU5294, NAU7290, ZHX1, ZHX6, and ZHX29 (these primers are disclosed in invention patent publication number CN 105713976 A, entitled "Chromosomal fragments and molecular markers of sea island cotton that can improve resistance to Verticillium wilt in upland cotton"). Using the published cotton D genome sequence and primer sequences, the introduced fragment was anchored to chromosome D4. Based on the genome database of diploid cotton D genome *Gossypium raymondii*, target region sequences were extracted, and SSR markers were developed. SSR information mining was performed using the SSRlocator I package. The criteria for identifying SSRs were: dinucleotide repeats ≥ 9; trinucleotide repeats ≥ 6; tetranucleotide repeats ≥ 5; pentanucleotide repeats ≥ 4; hexanucleotide repeats ≥ 3; and the overall length of a complex SSR was not less than 24 bp. Primers for SSR labeling were designed using the Primer3 program. The main parameters for primer design were: primer length 18-20 bp, optimal 20 bp; PCR product length 100-280 bp; Tm value 55-65℃, optimal 60℃; and GC content 45%-65%, optimal 50%. All primers were synthesized by Nanjing Genscript Biotech Co., Ltd.

[0040] Linkage groups were constructed using an F2 population (SuVR025 × Sumian 8) containing 1100 individual plants, while F2 plants were simultaneously subjected to further testing in a greenhouse. 2:3 Inoculation with non-deciduous Verticillium wilt pathogen Bp2 was performed, and resistance genes or resistance QTLs were located using composite interval mapping. Resistance identification was conducted three times in three different environments, and QTLs were detected in all markers ZHX57-ZXH70, with an average explained phenotypic variation of 22.4% and LOD values ​​ranging from 4.9 to 9.6 (Table 1).

[0041] Table 1. QTLs associated with Verticillium wilt resistance detected in three independent replicate experiments using the composite interval plotting (CIM) method.

[0042]

[0043] Note: E1, E2 and E3 represent three different environments.

[0044] Based on the cotton genome sequencing results, the target region sequences of the island cotton variety Xin Hai 21 and the upland cotton variety TM-1 were analyzed, and the genes contained in the target regions were predicted. The results showed that Xin Hai 21 contained 20 genes in the ZHX57-ZXH70 marker region (Table 2). To narrow down the range of selected genes, based on Gene Ontology (GO) enrichment results and existing research, four genes were selected for expression analysis after inoculation: Cytochrome P450, Probable receptor-like protein kinase, 6-phosphogluconate decarboxylating 3, and ZZ-type zinc finger-containing protein. Three-leaf stage seedlings of cotton varieties SuVR025, Hai 7124, and Su Mian 8 were inoculated with Verticillium wilt Bp2 at treatment times of 0h, 24h, 48h, 96h, and 144h. Water treatment at the same time stage served as a control. 1 μg of total RNA was collected and processed according to the TAKARA reverse transcription kit instructions. First-strand cDNA was synthesized. The reverse transcription product was diluted 10-fold, and 1 μL was used for qRT-PCR. A parallel PCR reaction was performed as an internal control using a pair of primers specifically amplifying the constitutive expression gene EF1α (GenBank accession number AF120093) in eukaryotes. The primer sequences were F: AGACCACCAAGTACTACTGCAC, R: CCACCAATCTTGTACACATCC. Real-time quantitative PCR was performed using an ABI Prism 7500 real-time PCR instrument (ABI, USA) using the SYBR Green I dye method. The reaction mixture consisted of 20 μl: cDNA, 1 μl; Primer F (10 μM), 1 μl; Primer R (10 μM), 1 μl; SYBR green I mix, 10 μl; and water added to a final volume of 20 μl. The program was as follows: 95℃, 10 min; 95℃, 10 s; annealing: 58℃, 20 s; 72℃, 30 s; 40 cycles; 72℃, 10 min; finally, run the dissolution program. The relative expression level of the target gene = 2 - △△△ CT , △△△CT=[(Ct 目的基因 -Ct 内参基因 ) 指定时间的处理 -(Ct 目的基因 -Ct 内参基因 ) 0h ] V.D -[(Ct 目的基因 -Ct 内参基因 ) 指定时间的处理 -(Ct 目的基因 -Ct 内参基因 )0h ] CK The primers used to detect GbCYP72A2 gene expression were F: CCCTTTTCGATGGGACCTCG, R: TCAGAACTTCAGGCATCACCC. The results showed that GbCYP72A2 gene expression differed significantly between resistant and susceptible varieties. In SuVR025 and Hai7124, GbCYP72A2 gene expression was continuously upregulated from 24 to 96 hours post-inoculation. In SuMian 8, the expression level of this gene decreased after 48 hours. Figure 1 Therefore, we hypothesize that this gene may play a key role in cotton's resistance to Verticillium wilt and have named it GbCYP72A2.

[0045] Table 2 Genetic information contained in the target segment of Xinhai 21

[0046]

[0047] 2.2 Sequence analysis of the GbCYP72A2 gene

[0048] Based on the genomic sequence of the GbCYP72A2 gene, specific primers were designed, and the genomic sequence was amplified using DNA from *Agrostis spp.* 7124 as a template. RNA was extracted from the roots of *Agrostis spp.* 7124 inoculated with *Verticillium wilt*, and the open reading frame (ORF) of the GbCYP72A2 gene in *Agrostis spp.* 7124 was amplified using cDNA obtained by reverse transcription. The results showed that the GbCYP72A2 gene sequence in *Agrostis spp.* 7124 was 3678 bp in length. The ORF length was 1560 bp (SEQ ID NO.1). Further analysis of the GbCYP72A2 gene sequence in *Agrostis spp.* 7124 revealed that the gene encodes 519 amino acids (SEQ ID NO.2), has a molecular weight of 127 kDa, and an isoelectric point of 5.0. This protein has one transmembrane domain and one P450 domain. Cluster analysis with *Arabidopsis thaliana* CYP450 genes indicated that this gene belongs to the CYP72A subgroup (…). Figure 2 ).

[0049] Further comparison of the amino acid sequences of the proteins encoded by the GbCYP72A2 gene and the GbCYP72A1 gene (disclosed in invention patent CN108588041A, entitled "Cytochrome P450 gene of cotton island, its encoded protein and application") revealed 11 amino acid differences between the protein sequences encoded by the two genes. Figure 3 A). Analysis of the two protein domains revealed that they are highly similar, both containing a transmembrane domain and a P450 domain of the same size. Figure 3B). However, after analyzing the three-dimensional structures of the two proteins using homology modeling in the Swiss-model database, it was found that the protein encoded by the GbCYP72A2 gene has a significant protrusion structure compared to the protein encoded by the GbCYP72A1 gene. Figure 3 C). Although the two genes are quite similar, they are located in different places and have different structures. Will this difference affect their disease resistance? Does the GbCYP72A1 gene have an unknown function? Furthermore, the inventors compared the disease resistance of the two genes (see 2.3) and conducted further analysis on other functions (see 2.4 and 2.5).

[0050] 2.3 Analysis of disease resistance to the GbCYP72A2 gene

[0051] In this invention, we used the following two methods to analyze the resistance of the GbCYP72A2 gene to cotton Verticillium wilt.

[0052] First, we used a virus-mediated gene silencing method to verify the resistance of cotton to Verticillium wilt after silencing the GbCYP72A2 gene. The vectors used for virus-mediated gene silencing were pTRV1 and pTRV2, with the cotton albino gene (GhCLA1) used as a control (Wang et al., 2014). Primers were designed at the 3' end of the GbCYP72A2 gene to amplify a 398 bp fragment, which was then subcloned into the pTRV2 vector. Positive pTRV1, pTRV2 (negative control), and pTRV2::CLA1 (positive control), as well as Agrobacterium GV3101 colonies containing the pTRV2 plasmid of the GbCYP72A2 gene, were picked and cultured until the OD600 of the bacterial culture reached approximately 0.5. Bacterial cells were collected by centrifugation at 4,000 rpm for 10 minutes at room temperature. The cells were resuspended in an appropriate volume of resuspension (10 mM MgCl2, 10 mM MES, and 200 μM hexanoyl eugenol) to a final concentration of 2.0. The resuspension was allowed to stand at room temperature for 3 hours. The recovery solutions of TRV1 and TRV2 were mixed at a 1:1 volume ratio. Agrobacterium inoculation experiments were conducted after the two cotyledons of cotton seedlings were fully expanded. The bacterial suspension was injected into the cotyledons using a leaf syringe injection method. pTRV1 / pTRV2 and pTRV1 / pTRV2::CLA1 were used as negative and positive controls for silencing treatment, respectively. When the cotton seedlings injected with TRV::CLA1 showed an albino phenotype (…),… Figure 4 A) To detect the expression of the GbCYP72A2 gene in cotton with a silenced GbCYP72A2 gene, using cotton EF-1α as an internal reference gene. Figure 4B). Simultaneously, Verticillium wilt pathogens were inoculated, and the disease resistance of cotton after silencing was investigated. Results showed that 28 days after inoculation with Verticillium wilt pathogens, the disease index of H7124 plants with silenced GbCYP72A2 genes reached 49.3%, significantly higher than the control group (uninoculated H7124, CK, 19.8%) or H7124 injected with empty vector (pTRV2::00, 21.4%). Figure 4 C, D). Twenty-eight days after inoculation, longitudinal sections of seedling stems revealed that H7124 plants with silenced GbCYP72A2 genes showed significant infection symptoms in their stems. Figure 4 E). Further culturing of stem segments on PDA medium revealed that the infection rate of H7124 plant stem segments with silenced GbCYP72A2 gene was significantly increased. Figure 4 F).

[0053] Second, we used transgenic Arabidopsis thaliana to verify the resistance of the GbCYP72A2 gene to Verticillium wilt in cotton, and at the same time compared the resistance of the GbCYP72A1 and GbCYP72A2 genes to Verticillium wilt. Overexpression vectors for the GbCYP72A1 and GbCYP72A2 genes were constructed separately. The plant expression vector used was 35S-pCAMBIA2301-NORs. Primers carrying XmaI and SacI restriction sites were designed to amplify and recover the target fragments. These fragments were then ligated into the pMD-19 (sample) vector, transformed into Top10 competent cells, and sequenced to obtain positive clones with correct sequences. The cloning vectors carrying the target genes and the plant expression vectors were digested with enzymes, and the 2.3kb and 13kb target fragments were recovered, respectively. These fragments were ligated using T4 ligase and transformed into Top10 competent cells to obtain positive clones. These were recombinant vectors containing the CaMV35S promoter and the target gene fragments of GbCYP72A1 and GbCYP72A2, named pCAMBIA2301-35S-GbCYP72A1 and pCAMBIA2301-35S-GbCYP72A2, respectively. The recombinant vector was transformed into Agrobacterium GV3101 using the freeze-thaw method, and Arabidopsis thaliana was transformed using the flower immersion method. Seeds were harvested together. After sterilization, positive plants were screened on MS medium containing 50 mg / L kanamycin and transplanted into a nutrient substrate for growth. DNA and RNA were extracted from leaves to detect whether the target gene was successfully transformed and expressed. After two generations of self-pollination, homozygous lines were obtained. PCR detection yielded three lines each of GbCYP72A1 and GbCYP72A2 gene transformation. Figure 5A) To identify resistance to Verticillium wilt, Arabidopsis thaliana plants that had been growing in sterilized soil for four weeks were dug up. The roots were first washed with sterile water to remove the growing medium, and then the roots were immersed in a suspension of conidia of the Verticillium wilt pathogen for 2 minutes before being transplanted into sterilized substrate. Water was used as a control; fresh sterile water and Verticillium wilt pathogen were added after every 20 inoculated plants. Forty plants were inoculated into each family. After inoculation, the ambient temperature was maintained at 23-25℃, and soil moisture was kept to promote disease development.

[0054] The results showed that transgenic Arabidopsis significantly improved resistance to Verticillium wilt, the causal agent of cotton wilt. Twenty-one days after inoculation with Verticillium wilt V991, the disease indices of the GbCYP72A1 transgenic Arabidopsis lines OE1, OE2, and OE3 were 61.1%, 56.9%, and 55.6%, respectively, with disease rates of 88.9%, 83.3%, and 83.4%. The disease indices of the GbCYP72A2 transgenic Arabidopsis lines OE1, OE2, and OE3 were 33.3%, 34.7%, and 33.4%, respectively, with disease rates of 61.1%, 61.2%, and 66.7%. In contrast, the disease indices of the non-transgenic control were 91.7%, and the disease rate was 100%. Figure 5 (B, C). The above results indicate that, compared to the GbCYP72A1 gene, the GbCYP72A2 gene can confer higher resistance to Verticillium wilt in recipient plants.

[0055] The Verticillium dauricum pathogen used in this invention is V991, which can be introduced from research institutions and cultured using the following method: At 25°C, Verticillium dauricum V991 is spread onto the surface of a solid potato culture medium (200g potato, 17g agar, 20g sucrose, 1000ml distilled water). After two weeks, it is transferred to a liquid potato culture medium (200g potato, 20g sucrose, 1000ml distilled water) and cultured at room temperature with shaking for 5 days. The cultured pathogen solution is filtered, and the spore concentration is measured using a hemocytometer. The concentration is then diluted to 6 × 10⁻⁶. 7 spores / ml.

[0056] The disease severity classification of Verticillium wilt in this invention was conducted according to the following standards: Level 0: Healthy plant, no diseased leaves, normal growth; Level 1: Less than one-quarter of the plant's leaves are diseased, turning yellow and wilting; Level 2: More than one-quarter but less than one-half of the plant's leaves are diseased, turning yellow and wilting; Level 3: More than one-half but less than three-quarters of the plant's leaves are diseased, turning yellow and wilting; Level 4: More than three-quarters of the plant's leaves are diseased, or the plant dies. The disease severity index (DI) for each strain was calculated based on the survey results.

[0057] DI=[∑(Ni×i) / (N×4)]×100; i=0~4, Ni=plant number of reaction i

[0058] 2.4 Functional analysis of the GbCYP72A2 gene in the ABA signaling pathway

[0059] Three transgenic Arabidopsis thaliana lines carrying the GbCYP72A2 gene were sown on 1 / 2 MS medium containing 0 μM and 2 μM ABA, respectively, with wild-type Arabidopsis thaliana col-0 as a negative control. Each line was sown with 100 seeds in triplicate. After sowing, the plants were incubated in the dark at 4°C for 3 days, then placed in a plant light incubator (24°C, 16 h light / 8 h dark). Germination rates were recorded. The results showed that the germination rate of the transgenic lines on 1 / 2 MS medium containing 2 μM ABA was higher than that of the wild-type control, with a significantly increased germination rate at 9-11 days. Figure 6 A, B). The number of cotyledons that turned green 14 days after germination was counted. The results showed that the greening rate of cotyledons in the transgenic lines was significantly higher than that in the wild-type control. Figure 6 (A, C). The results indicate that overexpression of the GbCYP72A2 gene can reduce the plant's sensitivity to ABA during germination.

[0060] 2.5 Functional analysis of the GbCYP72A2 gene in plant growth

[0061] Following the VIGS silencing method in section 2.3, the GbCYP72A2 gene in H7124 was silenced. Seven days after cotton seedlings injected with TRV::CLA1 developed an albino phenotype, the cotyledon height and cotyledon-to-first true leaf length were measured in H7124 plants with the GbCYP72A2 gene silenced (pTRV2::GbCYP72A2), uninjected H7124 (Mock), and H7124 plants injected with an empty vector (pTRV2::00). The results showed no significant difference in cotyledon height among the treatments; however, after cotyledon injection damage, the cotyledon-to-first true leaf length was significantly shortened; the cotyledon-to-first true leaf length of the GbCYP72A2 gene-silenced plant was significantly longer than that of the control plant injected with an empty vector (pTRV2::00). Figure 7 The results showed that downregulation of the GbCYP72A2 gene could promote plant growth.

[0062] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention. sequence list <110> Jiangsu Academy of Agricultural Sciences <120> The GbCYP72A2 gene of sea island cotton, its encoded protein and applications <130> 2020 <160> 2 <170> SIPOSequenceListing 1.0 <210> 1 <211> 1560 <212> DNA <213> Gossypium barbadense Linn. <400> 1 atggattcaa cagcaaagct tttaatcttt ctggcaagtt cttaacctt atttctactg 60 aaattccttc ataagtactg gtggatacct ttcaaaatac aaagagcact gagtttacaa 120 ggaatcaaag gacctccata tgagttcatc catggcaaca acaaagcctc cacccgtttc 180 agatacgaag ctttaagcaa acccatggct tccttaactc ataatatagt ccccagagtt 240 attcctcaga ttcattcatg gatcaacact tatgggaaga attatcttac gtgggagggg 300 aatcgagctc aactggtgat atccgaaccc gaattaatca aagagatact gaaaaccaac 360 gacggatctt ttccgaaaag gaaggatgat tcgagtatta ttcataagat cgtcggggaa 420 ggcctcgtga cctccgaagg tgcgaaatgg gcgaagcaaa ggaagttggc gaatcatgct 480 ttccatggag agagcttgaa aaatatgaat ccagcagtga ttgctagcgt tgagacgatg 540 ttggagaagt ggaaaggtcg agaaggcgaa gagatcgaag tgtttaacga gttcaggttg 600 ttgacttcgg aagttatatc gagaacggct ttcggtagta attacttgga agggaagaag attttcgaca tgttgacga attggcgata ctagttagtc gaattattt caaaactccg attcctggca tcagcaagat atggaaaact gcggatgaaa tagaatcgga gaaacttgcc aatggaattc atgattgtgt gatggaaatg gttaagaga gggaaaaga agtagagaca ggagaatctg acggttttgg caatgatttt ctaggattac ttaaatgc ttatcgcgat ttcgacgaga aaaatcgatt ttccatcgag gatctagtgg atgagtgcaa aacattctac tttgccggtc aagaaacaac caactccttg cttgcgtgga cgatccttgt tttagcaatt catactaaat ggcaagaaaa aacaaggcaa gaggtgtttg aggtatttgg ggaccaaaat cctaattctg aaggcattgc caaattaaaa attachment tggtcgtcaa tgaaaccttg agttgtatt ctcctgtagc tgccgtgatc cgaaagatca aaaaagaagt tcgattggga aagctcgttt tgcctgcaaa tctggagata ttgatcccaa tcatagcact tcaccatgac cctcaactat ggggagacga tgtacatctt ttcaaaccgg agagattcgt tgaaggcatc gctagtgcta ccaaatacaa ccctgcagca ttcattccct ttcgatggg acctcgatct 1380 tgcgttggca tgagctttgc aaccacagaa aaaggttg ctctctcaat gattctccaa 1440 cgctacgcct ttactctc cccgacctac gttcatgcgc cattccctgt aatcacgctt 1500 caccacaac acggaattca agtaatgctt catcctttac accaccaccaccaccactag 1560 <210> 2 <211> 519 <212> PRT <213> Barbadian gossypium Linn. <400> 2 Met Asp Ser Thr Ala Lys Leu Leu Ile Phe Leu Ala Ser Leu Thr 1 5 10 15 Leu Phe Leu Leu Lys Phe Leu His Lys Tyr Trp Trp Ile Pro Phe Lys 20 25 30 The Gln Arg Ala Served Leu Gln Gly and Lys Gly Pro Pro Tyr Glu 35 40 45 Phe Ile His Gly Asn Asn Lys Ala Served Thr Arg Phe Arg Tyr Glu Ala 50 55 60 Leu Ser Lys Pro Met Ala Ser Leu Thr His Asn Ile Val Pro Arg Val 65 70 75 80 Ile Pro Gln Ile His Ser Trp Ile Asn Thr Tyr Gly Lys Asn Tyr Leu 85 90 95 Thr Trp Glu Gly Asn Arg Ala Gln Leu Val Ile Ser Glu Pro Glu Leu 100 105 110 Ile Lys Glu Ile Leu Lys Thr Asn Asp Gly Ser Phe Pro Lys Arg Lys 115 120 125 Asp Asp Ser Ser Ile Ile His Lys Ile Val Gly Glu Gly Leu Val Thr 130 135 140 Ser Glu Gly Ala Lys Trp Ala Lys Gln Arg Lys Leu Ala Asn His Ala 145 150 155 160 Phe His Gly Glu Ser Leu Lys Asn Met Asn Pro Ala Val Ile Ala Ser 165 170 175 Val Glu Thr Met Leu Glu Lys Trp Lys Gly Arg Glu Gly Glu Glu Ile 180 185 190 Glu Val Phe Asn Glu Phe Arg Leu Leu Thr Ser Glu Val Ile Ser Arg 195 200 205 Thr Ala Phe Gly Ser Asn Tyr Leu Glu Gly Lys Lys Ile Phe Asp Met 210 215 220 Leu Thr Lys Leu Ala Ile Leu Val Ser Arg Asn Tyr Phe Lys Thr Pro 225 230 235 240 Ile Pro Gly Ile Ser Lys Ile Trp Lys Thr Ala Asp Glu Ile Glu Ser 245 250 255 Glu Lys Leu Ala Asn Gly Ile His Asp Cys Val Met Glu Met Val Lys 260 265 270 Arg Arg Glu Lys Lys Val Glu Thr Gly Glu Ser Asp Gly Phe Gly Asn 275 280 285 Asp Phe Leu Gly Leu Leu Ile Asn Ala Tyr Arg Asp Phe Asp Glu Lys 290 295 300 Asn Arg Phe Ser Ile Glu Asp Leu Val Asp Glu Cys Lys Thr Phe Tyr 305 310 315 320 Phe Ala Gly Gln Glu Thr Thr Asn Ser Leu Leu Ala Trp Thr Ile Leu 325 330 335 Val Leu Ala Ile His Thr Lys Trp Gln Glu Lys Thr Arg Gln Glu Val 340 345 350 Phe Glu Val Phe Gly Asp Gln Asn Pro Asn Ser Glu Gly Ile Ala Lys 355 360 365 Leu Lys Ile Met Asn Met Val Val Asn Glu Thr Leu Arg Leu Tyr Ser 370 375 380 Pro Val Ala Ala Val Ile Arg Lys Ile Lys Lys Glu Val Arg Leu Gly 385 390 395 400 Lys Leu Val Leu Pro Ala Asn Leu Glu Ile Leu Ile Pro Ile Ile Ala 405 410 415 Leu His His Asp Pro Gln Leu Trp Gly Asp Asp Val His Leu Phe Lys 420 425 430 Pro Glu Arg Phe Val Glu Gly Ile Ala Ser Ala Thr Lys Tyr Asn Pro 435 440 445 Ala Ala Phe Ile Pro Phe Ser Met Gly Pro Arg Ser Cys Val Gly Met 450 455 460 Ser Phe Ala Thr Thr Glu Thr Lys Val Ala Leu Ser Met Ile Leu Gln 465 470 475 480 Arg Tyr Ala Phe Thr Leu Ser Pro Thr Tyr Val His Ala Pro Phe Pro 485 490 495 Val Ile Thr Leu Gln Pro Gln His Gly Ile Gln Val Met Leu His Pro 500 505 510 Leo His His His His His His 515

Claims

1. Gossypium barbadense GbCYP72A2 Use of overexpression of a gene in reducing the sensitivity of a plant to ABA during germination, characterized in that, The gossypium barbadense GbCYP72A2 The nucleotide sequence of the gene is shown as SEQ ID NO.

1.

2. Gossypium barbadense GbCYP72A2 The use of down-regulated expression of a gene in promoting the growth of a plant, characterized in that, The gossypium barbadense GbCYP72A2 The nucleotide sequence of the gene is shown as SEQ ID NO. 1.

Images