Use of ribosomal RNA promoter in strongly promoting expression of non-RNA genes

Abstract

The present invention proposes a method for overexpressing a target gene. The method comprises: operably connecting a ribosomal RNA promoter to a target gene, wherein the ribosomal RNA (rRNA) promoter is set at the position of the original promoter of the target gene, and the target gene is a non-ribosomal RNA gene; introducing the target gene connected to the ribosomal RNA promoter into a recipient cell so as to achieve overexpression of the target gene in the recipient cell. The method achieves strong activation and significant overexpression of the target gene in the recipient cell, and the overexpression of the target gene is very stable, and it will not be recombined or lost as the recipient cell is passed down. The method according to an embodiment of the present invention is suitable for significantly strong expression of target genes in microorganisms, animals and plants.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to the use of a ribosomal RNA promoter in strongly promoting the expression of a non-RNA gene. Background Art

[0002] Gene overexpression is a common technique for increasing production in the field of metabolic engineering. Gene overexpression includes codon optimization, promoter replacement, and increased gene copy number. Among them, the effect of codon optimization is not particularly obvious. Increasing the number of gene copies can increase the expression of genes, but the modified microbial strains are prone to recombination during the passage process, leading to degeneration. Replacing a weak promoter with a strong promoter can increase the expression of a gene, but the strength of the promoter is limited, so finding a stronger promoter can be more conducive to increasing gene expression. Summary of the invention

[0003] This application is based on the inventor's discovery and understanding of the following facts and problems:

[0004] The applicant unexpectedly and pleasantly discovered in the scientific research work that by overexpressing the target gene through the ribosomal RNA (rRNA) promoter, the effect of overexpressing the target gene with ultra-high intensity can be achieved, and this method is significantly stronger than the existing commonly used promoters. The inventor found that for various microorganisms, as long as the whole genome information of the microorganism is available and the promoter of its rRNA is found, the promoter can be used to achieve the purpose of expressing any gene with the highest intensity in this microorganism and in microorganisms of the same genus. At the same time, the inventor found that the method of strongly expressing the target gene discovered by the inventor is also applicable to all animals and plants.

[0005] To this end, the present invention proposes a method for overexpressing a target gene. According to an embodiment of the present invention, the method includes: operably connecting a ribosomal RNA promoter to a target gene, wherein the ribosomal RNA (rRNA) promoter is set at the position of the original promoter of the target gene, and the target gene is a non-ribosomal RNA gene; introducing the target gene connected to the ribosomal RNA promoter into a recipient cell so as to achieve overexpression of the target gene in the recipient cell. According to the method of the embodiment of the present invention, strong activation and significant overexpression of the target gene in the recipient cell are achieved, which is a significant improvement compared to the level of overexpression of the target gene in the prior art, and the overexpression of the target gene achieved by the method according to the embodiment of the present invention is very stable, and it will not be recombined or lost with the passage of the recipient cell. The method according to the embodiment of the present invention is suitable for the significant strong expression of the target gene in microorganisms, animals and plants.

[0006] According to an embodiment of the present invention, the above method may further include at least one of the following additional technical features:

[0007] According to an embodiment of the present invention, the ribosomal RNA promoter and the recipient cell are derived from the same genus; preferably, the ribosomal RNA promoter and the recipient cell are derived from the same species. The recipient cell can successfully recognize the ribosomal RNA promoter, and then the ribosomal RNA promoter plays a function of initiating the expression of the target gene.

[0008] According to an embodiment of the present invention, the ribosomal RNA promoter and the recipient cell are derived from microorganisms of the same genus; preferably, the ribosomal RNA promoter and the recipient cell are derived from the same species of microorganism. The ribosomal RNA promoter is more effective in the promoter function in microorganisms of the same genus.

[0009] According to an embodiment of the present invention, the ribosomal RNA promoter contains at least a complete functional unit of the ribosomal RNA promoter, and the "complete functional unit of the ribosomal RNA promoter" refers to the minimum functional unit that can independently start the expression of the rRNA gene. According to an embodiment of the present invention, the ribosomal RNA promoter is a sequence that includes at least a complete functional unit of the ribosomal RNA promoter before the 5' end of the ribosomal RNA gene sequence. The length of the sequence can be adjusted accordingly according to the length of the sequence of the functional unit of the ribosomal RNA promoter, and it is necessary to cover at least one RNA promoter functional unit. For example, the ribosomal RNA promoter is a sequence of 50bp, 100bp, 200bp, 300bp, 400bp, 500bp, 600bp, 700bp, 800bp or 900bp before the 5' end of the ribosomal RNA gene sequence. Preferably, the ribosomal RNA promoter is a sequence of 700bp before the 5' end of the ribosomal RNA gene sequence. The "number of bp before the 5' end of the ribosomal RNA gene sequence" mentioned in this application refers to the sequence after the starting nucleotide of the ribosomal RNA gene sequence is moved forward to the 5' end by a certain number of bp. For example, if the coordinate at the starting nucleotide of the ribosomal RNA gene sequence is marked as 0, then the coordinate after moving forward 700bp to the 5' end can be marked as -700, then the sequence of 700bp before the 5' end of the ribosomal RNA gene sequence is the sequence between 700 and 0. For ease of understanding, the applicant represents the sequence of 700bp before the 5' end of the ribosomal RNA gene sequence as follows Figure 7 The inventors have experimentally verified that the 700 bp sequence before the 5' end of the ribosomal RNA gene sequence can effectively achieve significantly stronger activation and expression of non-rRNA target genes.

[0010] According to a specific embodiment of the present invention, the ribosomal RNA gene sequence is obtained through NCBI database or sequencing. According to a specific embodiment of the present invention, the target gene is pre-set in a plasmid vector.

[0011] According to a specific embodiment of the present invention, the plasmid vector is pLH1.

[0012] According to a specific embodiment of the present invention, the target gene is Gus.

[0013] According to a specific embodiment of the present invention, the ribosomal RNA (rRNA) promoter is set between the XbaI and NdeI restriction sites of the pLH1. In a specific experiment, the inventors took Streptomyces albidoflavus J1074, Actinomyces acarbose, Saccharopolyspora spinosa DSM44228, Bacillus subtilis, Micromonas or S. lividans TK24 as examples, searched for the DNA sequence of the rRNA of the above bacteria in the NCBI database, and used the 700 bp before the 5' end of its DNA sequence as the rRNA promoter of the above strains, and then connected the part of the rRNA promoter to the pLH1 plasmid vector through the XbaI and NdeI restriction sites, the pLH1 plasmid vector was pre-connected with the Gus gene, and was treated with XbaI and NdeI double restriction enzymes, and the obtained recombinant pLH1 plasmid was introduced into the cells of the above strains, achieving significant strong promotion and overexpression of the Gus gene in the above strains.

[0014] In summary, the present application proposes the use of ribosomal RNA promoters in strongly initiating the expression of non-RNA genes. For various microorganisms, animal and plant cells, as long as their whole genome information is available and their rRNA promoters are found, the rRNA promoter can achieve the purpose of expressing almost any gene with the highest intensity in such cells and cells of the same genus. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 It is the strength characterization of the rRNA promoter of S.albidoflavus J1074 according to the embodiment of the present invention and the existing commonly used promoters;

[0016] Figure 2 It is the strength characterization of the rRNA promoter of Actinomyces acarbose according to the embodiment of the present invention and the existing commonly used promoters;

[0017] Figure 3 It is the strength characterization of the rRNA promoter of Sa. spinosa NRRL18395 according to the embodiment of the present invention and the existing commonly used promoters;

[0018] Figure 4 It is a strength characterization of the rRNA promoter of Bacillus subtilis according to the embodiment of the present invention and the existing commonly used promoters;

[0019] Figure 5 It is a strength characterization of the rRNA promoter of Micromonas according to the embodiment of the present invention and the existing commonly used promoters;

[0020] Figure 6 is a strength characterization of the rRNA promoter of S. lividans TK24 according to an embodiment of the present invention and existing commonly used promoters; and

[0021] Figure 7 Schematic diagram of the sequence of a ribosomal RNA promoter according to an embodiment of the present invention. DETAILED DESCRIPTION

[0022] Embodiments of the present invention are described in detail below, and examples of the embodiments are shown in the accompanying drawings. The embodiments described below with reference to the accompanying drawings are exemplary and intended to be used to explain the present invention, but should not be understood as limiting the present invention.

[0023] Example 1 Streptomyces albidoflavus J1074 overexpression gene

[0024] The genome sequence of Streptomyces albidoflavus J1074 was downloaded from the NCBI database, and the ribosomal RNA (rRNA) was searched and predicted. The first 700 bp of the 16s rRNA gene was selected as the promoter (see Appendix). The promoter sequence was PCR-generated by adding the UTR sequence to the primers. A total of 7 promoters were obtained by PCR. The primer sequences are shown in Table 1. After being digested by the two restriction sites XbaI and NdeI, they were inserted into the corresponding restriction sites of the pLH1 plasmid carrying the Gus gene to form multiple single exchange plasmids that use ribosomal RNA promoters to control gene expression (see Table 2). The strength of the promoter was tested by the activity of GusA. Referring to the previously published article "Development of Streptomyces sp.FR-008 as an emerging chassis[J].Synthetic&Systems Biotechnology,2016,1(3):207-214", the plasmid was transferred into S.albidoflavus J1074 to characterize the activity detection method of rRNA promoter strength for GusA expression, and the SPL44, KasOP, ermE* promoters in the original literature were used as controls. Characterization method in the reference.

[0025] Table 1. Primers for amplifying the rRNA promoter of S. albidoflavus J1074

[0026]

[0027] Table 2. Plasmids for constructing the rRNA promoter of S.albidoflavus J1074

[0028]

[0029]

[0030] The results show Figure 1 As shown, the strength of the newly discovered rRNA promoter is about 1 times stronger than the strongest promoter reported so far.

[0031] Example 2 Characterization of the promoter of Acarbose Actinomycetes

[0032] From the sequenced genome sequence of Acarbose Actinomycetes, the ribosomal RNA (rRNA) was searched and predicted, and the first 700bp of the rRNA gene was selected as the promoter (see Appendix). The promoter sequence was PCR-generated by adding the UTR sequence to the primers. Five 16SrRNA promoters were obtained by PCR. After being digested by the two restriction sites XbaI and NdeI, they were inserted into the corresponding restriction sites of the pLH1 plasmid carrying the Gus gene to form multiple single exchange plasmids that controlled gene expression with the ribosomal RNA promoter (see Table 3). The strength of the promoter was tested by the activity of GusA. Referring to the previously published article "Development of Streptomyces sp.FR-008as an emerging chassis[J].Synthetic&Systems Biotechnology,2016,1(3):207-214", the plasmid was transferred into acarbose-producing actinomycetes to characterize the activity detection method of rRNA promoter strength for GusA expression, and the SPL44,KasOP,ermE* promoters in the original literature were used as controls. The transformed strain was divided on an AK plate containing 50μg / mL apramycin (3% potato soluble starch, 2% glucose, 1% peptone, 0.10% yeast extract, 2% soybean cake powder, 0.10% CaCO3, 2% agar, pH 7.0), and a single bacterium grew in 5 days. A single colony was dipped with a toothpick and inoculated on an AK plate containing 50μg / mL apramycin. After 7 days of growth, a single colony was scraped and placed in 50mL TSB, 28℃, 250rpm and cultured for 42h. The details are as follows: After each strain is cultured in TSBY for 2 days, 20 mL of bacterial solution is sampled into two tubes, one tube is dried at 65 degrees, and the dry weight is measured and recorded as DW; the other tube is used to determine the GusA enzyme activity, and after centrifugation, it is washed twice with an equal volume of ddH2O, and 20 mL of Buffer 1 (50 mM phosphate buffer [pH 7.0], 5 mM DTT, 0.1% TritonX-100) is added, and the high pressure homogenization is performed at 1200 bar for 8 minutes, and then diluted to 30 mL with Buffer 1. Centrifuge and take 100 μL of supernatant, add 100 μL of Buffer 3 (50 mM phosphate buffer [pH 7.0], 5 mM DTT, 0.1% TritonX-100, 2 mM p-nitrophenyl-β-d glucuronide), put it into the microplate reader, and measure at 415 nm and 37°C for 30 minutes. Calculate the slope of the absorbance curve and record it as A 415 / min , Enzyme activity calculation formula: U / g=90*A 415 / min / (14*DW). The result is Figure 2 .

[0033] Table 3. Plasmids of rRNA promoter of Actinomyces acarbose

[0034]

[0035]

[0036] The results are as follows Figure 2 As shown, the strength of the newly discovered rRNA promoter is about 2 times stronger than the strongest promoter reported so far.

[0037] Example 3 Characterization of the promoter of Saccharopolyspora spinosa

[0038] The genome sequence of Saccharopolyspora spinosa DSM44228 was downloaded from the NCBI database, and the ribosomal RNA (rRNA) was searched and predicted. The first 700 bp of the 16srRNA gene was selected as the promoter (see Appendix). The promoter sequence was PCR-generated by adding the UTR sequence to the primers. A total of 5 promoters were obtained by PCR. The primer sequences are shown in Table 4. After being digested by the two restriction sites XbaI and NdeI, they were inserted into the corresponding restriction sites of the pLH1 plasmid carrying the Gus gene to form multiple single exchange plasmids that use ribosomal RNA promoters to control gene expression (see Table 5). The strength of the promoter was tested by the activity of GusA. The conjugative transfer strain was constructed according to the method of the reference (Jha AK, Pokhrel AR, Chaudhary A K, et al. Metabolic Engineering of Rational Screened Saccharopolysporaspinosa for the Enhancement of Spinosyns A and D Production [J]. Molecules & Cells, 2014, 37 (10): 727-33.). At the same time, SPL44, KasOP, ermE* promoters were used as controls. After culturing these mutant strains in TSB medium for 3 days, GUS activity was detected according to the method of Example 1. The results are as follows Figure 3 shown.

[0039] Table 4. Primers for amplifying the rRNA promoter of Sa. spinosa NRRL18395

[0040]

[0041]

[0042] Table 5. Plasmids for constructing the rRNA promoter of Sa. spinosa NRRL18395

[0043]

[0044] The results are as follows Figure 3 As shown, the strength of the newly discovered rRNA promoter is about 1 times stronger than the strongest promoter reported so far.

[0045] Example 4 Characterization of promoters of Bacillus subtilis

[0046] GUS gene was PCR-generated using GUS-F and GUS-R primers, plasmid pHT01 was digested by XbaI and SmaI, and the digested plasmid and PCR fragment were assembled by Gibson method to construct pHT01-GUS, which can control GusA expression with Pgrac promoter. The genome sequence of Bacillus subtilis 168 was downloaded from NCBI database, ribosomal RNA (rRNA) was searched and predicted, and the first 700bp of 16s rRNA gene was selected as the promoter (see Appendix), and PCR-generated 10 promoters in total. The promoter sequence was PCR-generated by adding UTR sequence to the primer, and KpnI and BamHI sites were added at both ends of the primer. The primer sequence is shown in Table 4. The plasmid pHT01-GUS was digested with KpnI and BamHI, and then ligated with the 16s rRNA promoter PCR fragment to form multiple plasmids that use ribosomal RNA promoters to control gene expression (see Table 6). The strength of the promoter was tested by the activity of GusA.

[0047] From the Bacillus subtilis WB800N plate (LB medium: 10g / L tryptone, 5g / L yeast powder, 10g / L NaCl), pick a single colony and inoculate it into 3mL LB liquid medium, and culture it overnight at 37 degrees. The next day, take 500Ul of the overnight cultured WB800N bacterial solution and transfer it to 50mL electroporation medium A (LB + 0.5% sorbitol), and culture it in a water bath at 37 degrees for 4 hours, until the OD value reaches between 0.85-0.95. In the clean bench, transfer the above bacterial solution to a sterile pre-cooled 50mL centrifuge tube, ice bath for 10 minutes, centrifuge at 4 degrees (5000rpm, 10 minutes), collect the precipitate, add pre-cooled electroporation medium B (0.5M sorbitol, 0.5M mannitol, 0.5M trehalose, 10% glycerol) to the precipitate, resuspend the bacteria, centrifuge at 4 degrees (5000rpm, 5 minutes), collect the bacteria, repeat the pre-rinsing with electroporation medium B 4 times, and then collect the precipitate. Resuspend the washed bacteria with 1mL electroporation medium B, and dispense 60uL per tube. Add 8uL of the recombinant plasmid to 1 tube of WB800N competent cells, mix gently, incubate on ice for 2 minutes, add to the pre-cooled electroporation cup (diameter 2mm), and immediately electroporate (2000V, 5ms). After the electroporation, immediately add 1 mL of electroporation recovery medium (LB + 0.5 M sorbitol + 0.38 M mannitol), mix gently, and culture at 220 rpm in a 37-degree shaker for 3 hours. After centrifugation at 4000 rpm for 5 minutes, discard 800 uL of the supernatant, resuspend the cells, apply to chloramphenicol-resistant LB plates, and culture overnight.

[0048] At the same time, pHT01-GUS was used as a control. After these recombinant strains were cultured overnight in LB medium containing chloramphenicol resistance, they were transferred to 40 mL LB medium containing chloramphenicol resistance at a ratio of 1:500. After culturing at 37 degrees and 220 rpm for 8 hours, 1 mM IPTG was added to the pHT01 group, while the rRNA promoter group was not changed. After continuing to culture for 8 hours, the bacteria were collected and GUS activity was detected according to the method of Example 1. The results are as follows: Figure 4 shown.

[0049] Table 6. Amplification primers

[0050]

[0051]

[0052]

[0053] Table 7. Construction of expression plasmids for Bacillus subtilis

[0054]

[0055]

[0056] Figure 4 The results demonstrated that the promoter of ribosomal RNA of Bacillus subtilis is stronger than commonly used strong promoters.

[0057] Example 5 Characterization of Micromonas promoter strength

[0058] From the sequenced Micromonas genome sequence, the ribosomal RNA (rRNA) was searched and predicted, and the first 700bp of the rRNA gene was selected as the promoter (see Appendix). The promoter sequence was PCR-generated by adding the UTR sequence to the primer. A 16S rRNA promoter was obtained by PCR, which was digested by the XbaI and NdeI restriction sites and inserted into the corresponding restriction sites of the pLH1 plasmid carrying the Gus gene to form multiple single exchange plasmids that controlled gene expression with the ribosomal RNA promoter (see Table 8). The strength of the promoter was tested by the activity of GusA. Referring to the previously published article "Development of Streptomyces sp.FR-008 as an emerging chassis[J].Synthetic&Systems Biotechnology,2016,1(3):207-214", the plasmid was transferred into acarbose-producing actinomycetes to characterize the activity detection method of rRNA promoter strength for GusA expression, and the SPL44, KasOP, and ermE* promoters in the original literature were used as controls.

[0059] The promoter strain was divided on a plate medium containing 50 μg / mL apramycin (1.5% corn starch, 1% soluble starch, 0.2% mannitol, 0.2% glucose, 1.5% soybean meal, 0.5% peptone, 0.5% gluten powder, 0.2% yeast extract, 0.002% asparagine, 0.05% sodium chloride, 0.05% magnesium sulfate, 0.03% dipotassium hydrogen phosphate, 0.1% potassium nitrate, 0.1% calcium carbonate, 2.0% agar, pH 7.2), and a single bacterium was grown in 3 days. A single colony was streaked on a plate medium containing 50 μg / mL apramycin with a toothpick, and after 3 days of growth, the colony was scraped and cultured in 100 mL TSB at 34°C and 250 rpm for 42 hours.

[0060] Take two tubes of 40mL bacterial solution for each sample, one tube is dried at 65 degrees, and the dry weight is measured and recorded as DW; the other tube is used to determine the GusA enzyme activity, and after centrifugation, it is washed twice with equal volumes of ddH2O, and 20mL of Buffer 1 (50mM phosphate buffer [pH7.0], 5mM DTT, 0.1% TritonX-100) is added, and the high pressure homogenization is performed at 1200bar for 8 minutes, and then diluted to 45mL with Buffer 1. Centrifuge and take 100μL of supernatant, add 100μL of Buffer 3 (50mM phosphate buffer [pH7.0], 5mM DTT, 0.1% TritonX-100, 2mM p-nitrophenyl-β-d glucuronide), put it into the microplate reader, and measure at 415nm and 37℃ for 30min. Calculate the slope of the absorbance curve and record it as A 415 / min , Enzyme activity calculation formula: U / g=90*A 415 / min / (14*DW).

[0061] Table 8. Plasmids of Micromonas rRNA promoters

[0062]

[0063]

[0064] Example 6 Characterization of the rRNA promoter from S. albidoflavus J1074 in S. lividans TK24

[0065] The constructed plasmid containing the rRNA promoter of S.albidoflavus J1074 was transferred into S.lividans TK24 according to the method of Example 1, and characterized according to the same method. The results are as follows: Figure 6 As shown, it can be seen that the ribosomal promoter derived from a microorganism of the same genus is also a strong promoter in other microorganisms of the genus.

[0066] Example 7 Expression of resistance genes using a strong promoter in Streptomyces albidoflavus J1074

[0067] The GUS gene in the plasmid in Table 2 of Example 1 was replaced with the neo gene using the primers in Table 9 by the Gibson method to form multiple single exchange plasmids (see Table 10) that control gene expression with ribosomal RNA promoters, and kanamycin resistance was expressed by the Neo gene. Referring to the previously published article "Development of Streptomyces sp.FR-008as an emerging chassis[J].Synthetic&Systems Biotechnology,2016,1(3):207-214", the plasmid was transferred into S.albidoflavus J1074 to characterize the rRNA promoter strength, and the SPL44,KasOP,ermE* promoters in the original document were used as controls. The characterization method is: the growth state of Streptomyces albidoflavus J1074 on plates with different concentrations of kanamycin is used to test the strength of the promoter.

[0068] The results showed that the strain expressing the neo gene using ribosomal RNA promoter was sensitive to kanamycin higher than 200 mg / L, while the strain expressing the neo gene using SPL44 was sensitive to kanamycin about 100 mg / L, the strain expressing the neo gene using KasOP was sensitive to kanamycin about 60 mg / L, and the strain expressing the neo gene using ermE* was sensitive to kanamycin about 30 mg / L.

[0069] Table 9. Primers for constructing rRNA promoter of S.albidoflavus J1074 to express Neo gene

[0070]

[0071]

[0072] Table 10. Construction of plasmids expressing Neo gene from rRNA promoter of S.albidoflavus J1074

[0073]

[0074]

[0075] The above results fully demonstrate that promoters derived from ribosomal RNA of the same genus can exert similar effects in different species of microorganisms.

[0076] Appendix: The following is the sequence of the ribosomal rRNA promoter used by the applicant in the above experiments. Its naming adopts the format of "rRNA name + serial number", such as "16S-1" represents the first 16SRNA promoter sequence.

[0077] Promoter sequence of Streptomyces albidoflavus J1074

[0078] 16S-1

[0079] (SEQ ID NO:75).

[0080] 16S-2

[0081] ggtatcgacgacgcgcgcttcgccgacgtcgtcccccgtatccaggaggtcctggagaagtcggcccaggacggcgtggtcgagccgcaccagctccagcagctggtgcgccgcaccctcggcaagtgggtctccgaccactaccgccggcgcccgatgatcctcccggtcgtcgtcgaggtctgagccgccggccggcgcaccacggagcggggctccccggatttgcatcggggagccccgctccagtacgtttacgtctccaccccagcgggaagcccggcgcacctctgtgtgcccacgcggaacggggcgggtggaaattccgacgcagagtctctgataaagtcggaaccgccgaaagggaaaagcgaagcggaaacgcggagctggaaccggaaaggcaccgaggaaatcggacgcgaaagagtctgatagagtcgggaacacgaaataccgaagggaagcgcccggaggaaagcccgagagggtgagtacaaaggaagcgtccgttccttgagaactcaacagcgtgctaaaagtcaacgccagatatgttgataccccgaccggccaggttcctggctggttgaggttcctttgaaatacaacagcgaggacgctgtgtgcgacagggattattcctccttgtcgcaccgctctcatgtctgttgcaccggattaccggtacacattcacgg(SEQ ID NO:76)。

[0082] 16S-3

[0083] gccgaggcagccttcctcgtctacgtctacgcggtcggcggccgagcagcccgcgccggccgtaccggcgacctcgcagccgacgagaccgggagcggtgtccctgtggccacctgatgtgcatcggacggccgtgagctggtactgtcctcgacgccccggaaaaaccgttgacacggtcggaccggggaggtagattcgaacagttgcccgggagctggtacagtcctggaggcgaaggttgaacatcttcctgcttctcgctccggatcaaacatccgcacggagaagccaccgattcaccagaacggaccgccggtcaaaccggcgaaattcctctgatagagtcggaaccgccggaaagggaaaagcgaagcggaaacgcggagctggaaccggaaaggcgccgaggaaatcggacgcgaaagagtctgatagagtcgggaacacgaaataccgaagggaagcgcccggaggaaagcccgagagggtgagtacaaaggaagcgtccgttccttgagaactcaacagcgtgctaaaagtcaacgccagatatgttgataccccgaccggccaggttcctggctggttgaggttcctttgaaatacaacagcgaggacgctgtgtgcggcagggattattccttcttgtcgcaccgctctcatgtctgttgcaccggattaccggtacacattcacgg(SEQ ID NO:77)。

[0084] 16S-4

[0085] gcggacctggactgagaagggccgcaggacggggttgacacgccccggccggatccgtaaggtactccgagctgccacagcccgacaggtgcttcgggcagcacctcagccgcgcaaggtcgcggcactccacaccccagcaacatccctcccgggaagatttccggcatgccgtcatggctgcctggaattcactttccggggctgacgcatctcgcccggaccgcatcggcccgattatgagttgcggcgggaatccactagggttctggacgtcggaacggcccaacagccgggaagacgaaacccgctgactgggaatcaggcccgaaaggatctgatagagtcggaaccgccggaaagggaaaagcgaagcggaaacgcggagctggaaccggaaaggcgccgaggaaatcggacgcgaaagagtctgatagagtcgggaacacgaaataccgaagggaagcgcccggaggaaagcccgagagggtgagtacaaaggaagcgtccgttccttgagaactcaacagcgtgctaaaagtcaacgccagatatgttgataccccgaccggccaggttcctggctggttgaggttcctttgaaatacaacagcgaggacgctgtgtgcggcagggattattccttcttgtcgcaccgctctcatgtctgttgcaccggattaccggtacacattcacgg(SEQ ID NO:78)。

[0086] 16S-5

[0087] Gagcccgttgtacgtacgcgtggtcacgggggggagcttagaccgggaccaccccaagttgacagcccctggagcccctccgtatggtccaccgagttgcccgacgtgagcgccggttcccaccggtccccgggcagccgatccgcaggacctcttcagaacgcacagcgatctccgctgctcgttccgtcgcgcattgcggaatgaggaatccgcgtcccgacagggccgcccccgattagctcggggaaagggaatccgctaaagtctcaccagtcggaacggcccaacagccgggaagacgaatcccgctgactgggaatcaggcccgaaaggatctgatagagtcggaaccgccggaaagggaaaagcgaagcggaaacgcggagctggaaccggaaaggcaccgaggaaatcggacgcgaaagagtctgatagagtcggaacacgaagtaccgaagggaagcgcccggaggaaagcccgagagggtgagtacgaaggaagcgtccgttccttgagaactcaacagcgtgctaaaagtcaacgccagatatgttgataccccgaccggccaggttcctggctggttgaggttcctttgaaatacaacagcgaggatgctgtgtgcggcagggattattccttcttgtcgcaccgctctcatgtctgttgcaccggattaccggtacacattcacgg(SEQ ID NO:79)。

[0088] 16S-6

[0089] cggcaccgctgcgcatcctcaccggccgcccggtccccgccgaccaggtccgcaccggcccccgcacgggagtggccggagaaggaggcatccggccctggcgctactggcaggccgaggaccgcacggtcagcccctaccgggcccacgcaccccggcgccggccacgaacttgactcgcccttggcggaggtctaacgtggcccgagccgctgaacacggttccgcacttctgcgggccgaggcggcacccactactccagcaagatcccttcaccgggcttctttcggcatgctccgaatgaaatcccgaatacctcgattatgaggtgcgaagagaatccgctaacgtagtgcccagccgaaaggcagaggccctccaacggccaccggagatgaaatccgcaccggaaacggaacggaaaaaggatctggtaaggttggaaacacgaaataccgaagggaagcgcccggaggaaagcccgagagggtgagtacaaaggaagcgtccgttccttgagaactcaacagcgtgctaaaagtcaacgccagatatgttgataccccgaccggccaggttcctggctggttgaggttcctttgaaatacaacagcgaggacgctgtgtgcggcagggattattcctccttgtcgcaccgctctcatgtctgttgcaccggattaccggtacacattcacgg(SEQ ID NO:80)。

[0090] 16S-7

[0091] Ctcgcgcaccgggtcgatcgcggtaccgggccccaccatcgcgcccgagaagaccgggtcgggcaccgaggccagcccgacggcctggccgctgagcggggacatcacttcggtcatggcggaacctccgagaagatgagcaggtctgagaaggacaggagaaccgccgggcggacctggacggcacgttgccgagtagcgtaagtcatacgaagtcacgattccgcccaagacgtcctgttgaagacgtgggcccgtcgcgagcagaaacgatttgcatcgcgactccgcgcctgggtacagtcgactcctgcccagcgccgagcacgacattcgagcgtgccgacggggcgacccaaactcagcagattccctgaatccactgcatatccgcatgcctgcggacggtggtcggaggcaggaaaaagaactgatagagtcgggaacacgaaataccgaagggaagcgcccggaggaaagcccgagagggtgagtacaaaggaagcgtccgttccttgagaactcaacagcgtgctaaaagtcaacgccagatatgttgataccccgaccggccaggttcctggctggttgaggttcctttgaaatacaacagcgaggacgctgtgtgcgacagggactattcctccttgtcgcaccgctctcatgtctgttgcaccggattaccggtacacattcacgg(SEQ ID NO:81).

[0092] Promoter of rRNA of Actinoplanes utahensis producing acarbose

[0093] 16sRNA-1

[0094] Gaccacggtcaccagcacgagcacgccgatcacgagctgccagagcggcacgatcaggtccagtaacccgtcgctcgccgacgcctcggatgggttcatgaggtcactctgtcacggtttccggcccgggtgtacgccgcgcggccgctgatgaccatgttcatcgatttgcgcgacggacgggcggtcaagtaatttcttctctgccagcgggaaagcggtacggacaggcacgaaagtgacaatccggatcgccacctcgagggccgctgcagcgagctagtcttgttttcagcgccgggcggtgcggcaggatctcgaaacctcgaggttgcgccagcgagaccgaccgggtatagtggatcagccagcaggagccgggcggacgttcgagtcggccggtctgcatgagccacttccacattcgtggaaaacacttgggcgaggccagcgagatccccggatttcgccgagcgaaaacgaccaggtaagcttgaacggttgcctcggaagcggttctccggacggagatcgggtttcgatgtgcggttgttctttgagaactcaacagggtgctttaaaagccagtgccaattatggcaataccccggctgatcgtttcggcggtcagtgggagattcctttggcaacatttttgttgccgggacagtttttcaacagattttgttgg(SEQ ID NO:82)。

[0095] 16sRNA-2

[0096] Ttgcgccacggctgcccgccggtgacggtgcggctgctggccgagccggcacggctgaccctcgacgtgtccgacggtgatccggcgagcgagccgctgttcggcacccgccggccgttcggtgcgggcgggctggggctgctactggtgcggaccttcgcgcgggacagcggttggtatcgacggggcgcgagcaagcacgtctgggcggtattcgatcatcgggcctgactatccgaatgcgcttcattactcactgaatgatttccgcaccatccacatcacccgccccgacttggggggtcggtttggaggcggtgcgggcgaccgggtaatgttctccgagccggcagggaaacgggcgagcgagcttctggggttacccagcaagatccgcggccgtcctgccaaacccccgagatcgagtgcgacgcttcgtcgtgtaaggttccgcggggcccgagcgagattcggttccggcaaatccgagggaaaccgcggatttggcgaaacgaaagcgtaagggtaaagttgaacgagtgccccggagggcgggccgcgaaagcggaacgtgtgatggtgtgcggttgttctttgagaactcaacagggtgctttaaaagccagtgccaattatggcaataccccggctgatcgtttcggcggtcagtgggagattcctttggcaacatttttgttgccgggacagtttttcaacagattttgttgg(SEQ ID NO:83)。

[0097] 16sRNA-3

[0098] Gggcagtccggtggcgagatgatcggggcggtggcggtggcggtgcacgccgaggtgccggtgtcgacgttgctcagccagatctgggcgtacccgacgtttcatcgggggctggggcaggcgcttcagtcgctggcctgaacttgccggtcgtctcatgcgggcctgaggttgctggttcccgccttcgctgtgcgggcctgaggttgccggtatccccgcgccggcccgagtttgctcgttttcctgcgctgacctggaacgacgcgggacactggaccccgatttggaggccagggaaccaacgggtaatgttttccgggccggtagggaaacgggcgagcgaacttctggggtcacccagcaagatccgcggccgtcctgccaaatcctctgatcttgggactacagcctcgctgtgtgctgagctcagagcggccgtactaggtcagatcggcaccaaccgggaaaaaccggttgacaacgccgaacggaccgagtaacgtagagcgagtgccccgggcgccgggccgcgaaagcgggtcgggcgaaggtgtgcggttgttctttgagaactcaacagggtgctttaaaagccagtgccaattatggcaataccccggctgatcgtttcggcggtcagtgggagattcctttggcaacatttttgttgccgggacagtttttcaacagattttgttgg(SEQ ID NO:84)。

[0099] 16sRNA-4

[0100] Ctgtgcggagccccgccgagcagcgcgatgatccggcccgctccggaccgtccggcgcgtatcccgggtgtacgcgggtggttgcggtggtccgccccttcgctgtggtccagcgccgccgcaacgttccgggttgctgtcctcccttggcgttcaccgaccgctgcgatgatccatccgctggcgcccggtgaccgccgcgtgtcggtcgcgacgcccgggtttcgcggggctcgtcctccgaccgggtggtgtgatcggggtcgcgcccaccccggtttggagttgcggggcagggcctgtaatgttttccgagccgccagggagacgggcgagcgaacgagacccgcgaggggctcgggccggccgtcctgacggaaatcctccaacgatctcgcgatccagtgttgcgggttgctggatgggtgctgctcaccatttctggtgcgttgaaatccggttgcaaaacacggatttgacgaactgagaatggcgggtaaagtagagcgagtgccccggagggcgggccgcgaaagcggaacgtgtgatggtgtgcggttgttctttgagaactcaacagggtgctttaaaagccagtgccaattatggcaataccccggctgatcgtttcggcggtcagtgggagattcctttggcaacatttttgttgccgggacagtttttcaacagattttgttgg(SEQ ID NO:85)。

[0101] 16sRNA-5

[0102] Aacgaggcccgccggacgatcagcgagggtggcgcctacctgaacaacgagcggatcaccgacgctgaggcgacggtgccggccgccgcgctgctgcacgggaggttcctggtgctgcgacgagggaagcggaccttcgccggtgtcgaactgacggcctgacccgccactcacggagtctccgtcctctttcaggggaccggggctccgtcgggtggccgtccgggggcggctattcccgcgctgacctgaggttttgtcgcggcgaagggtgtgacggtggtcgctggaccccgatttggcgttgcccgggggaagcgggtaatgttttcggagccgccagggagacgggcgagcgacacgggacccgcgaggggcccggagcggccgtcctgacggaaatcttacccagatctcgcgatctcgcatcgcgggttcctcggtgcgttgaaatccggttgcgaaacacggatttgacgaaacgagaatggtgagtaaagtagagcgagtgccccggacggggagctgcggaaagcggttcttcggatggtgtgcggttgttctttgagaactcaacagggtgctttaaaagccagtgccaattatggcaataccccggctgatcgtttcggcggtcagtgggagattcctttggcaacatttttgttgccgggacagtttttcaacagattttgttgg(SEQ ID NO:86).

[0103] rRNA promoter sequence of Saccharopolyspora spinosa

[0104] 16S-1

[0105] Gcccgttgcgttcgcggcgccgggatcggcaccgcgctggtgtccaacgctggcggccttcgcgaaccggatctggctgatctgttcgacgcggtggtgctgtccggagcggtcggtgtctcgaagccgaacgccgagatctacctgctggccgcacgccgactgggactcgaaccgggccagtgcgttttcgtcgacgaccttccccggaacgtggccggggcggtcggtgcggggatggtcggcgtccaccactgcgacgtcgcttcgacggtcaccgaactggccgcgctcttcgacctggagatcaccctctgacctgctgtttcgatacttaagggggggtggttgccgggggtgtttcgggggtgtgtaactttatccaagtcagagcgacacgggacgggaaaccggaccgggcctgacagcgggtcgcgaaccaagcttcaaccttcgggtgacagagtgggcgaaccgaaaagaggaaatgctccccggagctgcgggtcccttggtggggtcgggtgatggtgtgggtgtgttctttgagaactcaacagcggactgtttcggttagtgttcttttatgcccccgaccatgcgggtttgtgtggttggtggtttctttgagtatcacgctccaagatcttttccttcgggtgggttttgttgagtgtgtgctgggattgtatccaatgca(SEQ ID NO:87)。

[0106] 16S-2

[0107] gccctcgacggcggggtgacgacctccctcgccctcgacacccacggcaaagcgctcagctcccgactcctgtcctggacctcccgcgaccggatagatagtgatttacgcaggtgaatggccgtgagtgttttgggttgcgatagccgcccaaaacactcacggccccctcgccgacgcttaaggggggtggttgttgggggtgtttcggggccgtgtaacttattccaagtcagcgcgacacgggccgggaaaaccgggccgggcctgatgcgggtcccgcgaaccaagctctcacgaatgagtggtagagtgggcgggcctgaaaacggtaagacttgataaagtgaaacgcttgcgcgtgttgaaaactgaagaccgaatggttttccgaagataacgagttgggtcggatcggaaacgagccccccggtttgacagcggaaaacacgatggtctaaagtcggtgacacaagaaagcgaagaggaaatgctccccggagcttcctggccgttggctgggggtgatggtgtgggtgtgttctttgagaactcaacagcggactgttttggttagtgttcttttatgcccccgaccatgcgggtttgtgtggttggtggtttctttgagtatcacgctccaagatcttttccttcgggtgggttttgttgagtgtgtgctgggattgtatccaatgca(SEQ ID NO:88)。

[0108] 16S-3

[0109] Gatcggtgtggagtccactgctacccccgttctggcgatcgtctgggaggctacctccgcagtccaggcgagtcgcggcgacaaatcaggaccacacgaacgtggacatcgatcggggcggcggacacgggcggcggcgcgacgccccaaaatcgtctctgacctggcgttttcaccttttgtggggggtggttgttgggggtgtttcggggccgtgtaacttattccaagtcagcgcgacacgggccgggaaaaccgggccgggcctgatgcgggtcccgcgaaccaagctctcacgaatgagtggtagagtgggcgggcctgaaaacggtaagacttgataaagtgaaacgcttgcgcgtgttgaaaactgaagaccgaatggttttccgaagataacgaattgggtcggatcggaaacgagcccccccggtttgacagcggaaaacacgatggtctaaagtcggtgacacaagaaagcgaagaggaaatgctccccggagcttcctggccgttggctgggggtgatggtgtgggtgtgttctttgagaactcaacagcggactgttttggttagtgttcttttatgcccccgaccatgcgggtttgtgtggttggtggtttctttgagtatcacgctccaggatcttttccttcgggtgggttttgttgagtgtgtgctgggattgtatccaatgca(SEQ ID NO:89)。

[0110] 16S-4

[0111] Gtcccgatcggccgaacccatgcggtcaccgcctctgacctgctggaagcgatcgacgcggcgggttcggcgagcaccgtgaagctctggctgcggccgaagcagaagtgacccaagatcccccgaaggagcgccgtcaagagtttgaccaggcgatttgactttcacgtagggtgtgcgtaactttcccttcgccgcatggaaagccggacgaaacaggacacaagagcctgacgaggacggcctggggagcgccccggagatcggaaacgaactccgcggagcgcacaccaaccggggcacgcggtttgacaccgcgaagtgcaccgggtaacgtaaagcggtcgccaagtagacgtcaaggctacgaggcgcgttgataactcaagcaacgggctcgatcttcggagcgatcagcgcggggttgacccccctgaaaacgccgaaatgagcgcctgctacagttaccgacacaagaaagcgaagaggaaatgctccccggagcttcctggccgttggctgggggtggtggtgtgggtgtgttctttgagaactcaacagcggactgttttggttagtgttcttttatgcccccgaccatgcgggtttgtgtggttggtggtttctttgagtatcacgctccaggactttttccttcgggtgggttttgttgagtgtgtgctgggattgtatccaatgca(SEQ ID NO:90)。

[0112] 16S-5

[0113] Tggtcgccggacaaggacgacctgctgcacggccgctggctggtaattcgccgtggcaagcgtcacactgcgggcgtcagggtcgtgcattagcctggaatcagcaccggaaagggcgctgagctgcatgttcggttccttccggggttgacttgagccgatttgacttggtgcggatcaacgcgtaaattatttcaggtcagcgcggaacgggccgatgaaaacggaacgggcactgacacgggtcgcgaaccaagctcctgccttctggtggtagagtgggtgccccgatggaaaaccgaaatttctggcgggcttttcgtccgcaggacgaggttgcggtttccaaccagatctttgatacaacagtgcttggctgtggccgagtggaatagcgagccgaaattcggcggtgatccggtggggtgaccccccggtgagcccgaaaaagggcctgctactctggtcgatagcaaaagcacaagaggaaatgctccccggagcttcctggccgttggctgggggtgatggtgtgggtgtgttctttgagaactcaacagcggactgttttggttagtgttcttttatgcccccgaccatgcgggtttgtgtggttggtggtttctttgagtatcacgctccaggactttttccttcgggtgggttttgttgagtgtgtgctgggattgtatccaatgca(SEQ ID NO:91).

[0114] rRNA promoter of Bacillus subtilis

[0115] 16s-1

[0116] (SEQ ID NO:92)。

[0117] 16s-2

[0118] (SEQ ID NO:93)。

[0119] 16s-3

[0120] (SEQ ID NO:94)。

[0121] 16s-4

[0122] Gtgtctttatgacgtgggggttcaagtcccttcacccgcattatataggataacagttagaaaaactggacatcctgtctgcggaagtagttcagtggtagaacaccaccttgccaaggtgggggtcgcgggttcgaatcccgtcttccgctccaactataccatccacgccggggtggtggaattggcagacacacaggacttaaaatcctgcggtaggtgactaccgtgccggttcaagtccggccctcggcattatgttttgcgcccgtagctcaattggatagagcgtttgactacggatcaaaaggttaggggttcgactcctctcgggcgcgccatatcttttaatagaatagataggaaatcgggaagtagctcagcttggtagagcacatggtttgggaccatggggtcgcaggttcgaatcctgtcttcccgaccatttttttatggggccttagctcagctgggagagcgcctgctttgcacgcaggaggtcagcggttcgatcccgctaggctccaccaaaagtttttaaaaaagttgttgactttgaagaagtgacgttgtatactaataaagttgctttaacaaagcggacaaacaaaatgatctttgaaaactaaacaagacaaaacgtacctgttaattcagtttttaaaaatcgcacagcgatgtgcgtagtcagtcaaactac(SEQ ID NO:95)。

[0123] 16s-5

[0124] (SEQ ID NO:96)。

[0125] 16s-6

[0126] Cgtaggttcgaatcctacctgcggagcattgcttccatagctcagcaggtagagcacttccatggtaaggaagaggtcagcggttcgagcccgcttggaagcttaaatgtattattaccaaggtttctcataaggagaaagctttttttattgcgatatgcggaagtagttcagtggtagaacaccaccttgccaaggtgggggtcgcgggttcgaatcccgtcttccgctccatttacctaacgggatattgtaaattgaattgcgcccgtagctcaattggatagagcgtttgactacggatcaaaaggttaggggttcgactcctctcgggcgcgccatatcttttaatagaatagataggaaatcgggaagtagctcagcttggtagagcacatggtttgggaccatggggtcgcaggttcgaatcctgtcttcccgaccattttttatggggccttagctcagctgggagagcgcctgctttgcacgcaggaggtcagcggttcgatcccgctaggctccaccaaaagtttttaaaaaaggttattgactttgaagaagtgacattgtatactaataaagttgctttaacaaagcggacaaacaaaatgatctttgaaaactaaacaagacaaaacgtacctgttaattcagtttttaaaaatcgcacagcgatgtgcgtagtcagtcaaactac(SEQ ID NO:97)。

[0127] 16s-7

[0128] Cgcccattaaagcggtacgcgagctgggttcagaacgtcgtgagacagttcggtccctatccgtcgcgggcgcaggaaatttgagaggagctgtccttagtacgagaggaccgggatggacgcaccgctggtgtaccagttgttctgccaagggcatcgctgggtagctatgtgcggacgggataagtgctgaaagcatctaagcatgaagcccccctcaagatgagatttcccattccgcaaggaagtaagatccctgaaagatgatcaggttgataggtctgaggtggaagtgtggcgacacatggagctgacagatactaatcgatcgaggacttaaccatatttttgaatgatgtcacacctgttatctagttttgagagaacactctcaatttgtttggtggcgatagcgaagaggtcacacccgttcccataccgaacacggaagttaagctcttcagcgccgatggtagtcgggggtttccccctgtgagagtaggacgccgccaagcaattgcacattagtgtaattttttaaaaaagttattgactttgaagaagtgacattgtatactaataaagttgctttaacaaagcggacaaacaaaatgatctttgaaaactaaacaagacaaaacgtacctgttaattcagtttttaaaaatcgcacagcgatgtgcgtagtcagtcaaactac(SEQ ID NO:98)。

[0129] 16s-8

[0130] (SEQ ID NO:99)。

[0131] 16s-9

[0132] (SEQ ID NO:100)。

[0133] 16s-10

[0134] Tcaataaggcgaaccagttgcttagattgattcatatctatctccttccattgacagacaaccaaaaggacaacaaaaaagcagcacgcggaaggatgagaaaagttccacgcactgctttacgatctgcaattcatttgactttgccacatccctacgccagcgttaactaacaggttcaaagggtcagaacgaaaccgctcactctcagctttaatgctccccttgtggtcatcagtatttagttcgtttctactatacaagaaaacgaaaaaaacaacaagatcacatgactgatgtatatgttcttttaagaaacttatatgatacacacgctttagaaatcatggcgaggattatagtttatttgttttatagattttttttaaaaaactattgcaataaataaatacaggtgttatattattaaacgtcgctgatgcacagcggacacaaactagatgcttcaaaacaacttgaaaaaagttgttgacaaaaaagaagctgaatgttatattagtaaagctgcttcattgagaagtaacgaaatgatctttgaaaactaaacaagacaaaacgtacctgttaattcagtttttaaaaatcgcactgcgatgtgcgtagtcagtcaaactagggcctgcacgacgcaggtcacacaggtgtcgccgcaggatgcggtgaacttaacctgtgatcc(SEQ ID NO:101).

[0135] Micromonospora rRNA promoter

[0136] 16S

[0137] (SEQ ID NO: 102).

[0138] In the description of this specification, the description with reference to the terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art may combine and combine the different embodiments or examples described in this specification and the features of the different embodiments or examples, without contradiction.

[0139] Although the embodiments of the present invention have been shown and described above, it is to be understood that the above embodiments are exemplary and are not to be construed as limitations of the present invention. A person skilled in the art may change, modify, replace and vary the above embodiments within the scope of the present invention. SEQUENCE LISTING <110> Wuhan Hesheng Technology Co., Ltd. <120> Use of ribosomal RNA promoter in strongly promoting expression of non-RNA genes <130> PIDC3190706 <160> 102 <170> PatentIn version 3.3 <210> 1 <211> 50 <212> DNA <213> Artificial <220> <223> J1074-GUS-16S-1-F <400> 1 gactctagat atcggaacga tcgttggctg aggagcacgg gccctgcttg 50 <210> 2 <211> 65 <212> DNA <213> Artificial <220> <223> J1074-GUS-16S-1-R <400> 2 cagcatatgg cgtatcccctttcagatacc tgtcgtattc tccccgtgaa tgtgtaccgg 60 taatc 65 <210> 3 <211> 51 <212> DNA <213> Artificial <220> <223> J1074-GUS-16S-2-F <400> 3 gactctagat atcggaacga tcgttggctg ggtatcgacg acgcgcgctt c 51 <210> 4 <211> 65 <212> DNA <213> Artificial <220> <223> J1074-GUS-16S-2-R <400> 4 cagcatatgg cgtatcccct ttcagatacc tgtcgtattc tccccgtgaa tgtgtaccgg 60 taatc 65 <210> 5 <211> 51 <212> DNA <213> Artificial <220> <223> J1074-GUS-16S-3-F <400> 5 gactctagat atcggaacga tcgttggctg gccgaggcag ccttcctcgt c 51 <210> 6 <211> 65 <212> DNA <213> Artificial <220> <223> J1074-GUS-16S-3-R <400> 6 cagcatatgg cgtatcccct ttcagatacc tgtcgtattc tccccgtgaa tgtgtaccgg 60 taatc 65 <210> 7 <211> 49 <212> DNA <213> Artificial <220> <223> J1074-GUS-16S-4-F <400> 7 gactctagat atcggaacga tcgttggctg gcggacctgg actgagaag 49 <210> 8 <211> 65 <212> DNA <213> Artificial <220> <223> J1074-GUS-16S-4-R <400> 8 cagcatatgg cgtatcccct ttcagatacc tgtcgtattc tccccgtgaa tgtgtaccgg 60 taatc 65 <210> 9 <211> 52 <212> DNA <213> Artificial <220> <223> J1074-GUS-16S-5-F <400> 9 gactctagat atcggaacga tcgttggctg gagcccgttg tacgtacgcg tg 52 <210> 10 <211> 65 <212> DNA <213> Artificial <220> <223> J1074-GUS-16S-5-R <400> 10 cagcatatgg cgtatcccct ttcagatacc tgtcgtattc tccccgtgaa tgtgtaccgg 60 taatc 65 <210> 11 <211> 50 <212> DNA <213> Artificial <220> <223> J1074-GUS-16S-6-F <400> 11 gactctagat atcggaacga tcgttggctg cggcaccgct gcgcatcctc 50 <210> 12 <211> 65 <212> DNA <213> Artificial <220> <223> J1074-GUS-16S-6-R <400> 12 cagcatatgg cgtatcccct ttcagatacc tgtcgtattc tccccgtgaa tgtgtaccgg 60 taatc 65 <210> 13 <211> 50 <212> DNA <213> Artificial <220> <223> J1074-GUS-16S-7-F <400> 13 cgactctaga tatcggaacg atcgttggct gctcgcgcac cgggtcgatc 50 <210> 14 <211> 65 <212> DNA <213> Artificial <220> <223> J1074-GUS-16S-7-R <400> 14 cagcatatgg cgtatcccct ttcagatacc tgtcgtattc tccccgtgaa tgtgtaccgg 60 taatc 65 <210> 15 <211> 45 <212> DNA <213> Artificial <220> <223> pAK-16S-1 5-F <400> 15 cgctctagat atcggaacga tcgttggctg gaccacggtc accag 45 <210> 16 <211> 65 <212> DNA <213> Artificial <220> <223> pAK-16S-1 5R <400> 16 cgccatatgg cgtatcccct ttcagatacc tgtcgtattc tccccaacaa aatctgttga 60 aaaac 65 <210> 17 <211> 54 <212> DNA <213> Artificial <220> <223> pAK-16S-2 6-F <400> 17 cagtctagat atcggaacga tcgttggctg ttgcgccacg gctgcccgcc ggtg 54 <210> 18 <211> 65 <212> DNA <213> Artificial <220> <223> pAK-16S-2 6-R <400> 18 cgccatatgg cgtatcccct ttcagatacc tgtcgtattc tccccaacaa aatctgttga 60 aaaac 65 <210> 19 <211> 51 <212> DNA <213> Artificial <220> <223> pAK-16S-3 7-F <400> 19 cgctctagat atcggaacga tcgttggctg gggcagtccg gtggcgagat g 51 <210> 20 <211> 65 <212> DNA <213> Artificial <220> <223> pAK-16S-3 7-R <400> 20 cgccatatgg cgtatcccct ttcagatacc tgtcgtattc tccccaacaa aatctgttga 60 aaaac 65 <210> 21 <211> 51 <212> DNA <213> Artificial <220> <223> pAK-16S-4 8-F <400> 21 cgctctagat atcggaacga tcgttggctg ctgtgcggag ccccgccgag c 51 <210> 22 <211> 65 <212> DNA <213> Artificial <220> <223> pAK-16S-4 8-R <400> 22 cgccatatgg cgtatcccct ttcagatacc tgtcgtattc tccccaacaa aatctgttga 60 aaaac 65 <210> 23 <211> 51 <212> DNA <213> Artificial <220> <223> pAK-16S-5 9-F <400> 23 cgctctagat atcggaacga tcgttggctg aacgaggccc gccggacgat c <210> 24 <211> 65 <212> DNA <213> Artificial <220> <223> pAK-16S-5 9-R <400> 24 cgccatatgg cgtatcccct ttcagatacc tgtcgtattc tccccaacaa aatctgttga aaaac 65 <210> 25 <211> 57 <212> DNA <213> Artificial <220> <223> SA-GUS-16S-1-F <400> 25 gactctagat atcggaacga tcgttggctg gcccgttgcg ttcgcggcgc cgggatc 57 <210> 26 <211> 63 <212> DNA <213> Artificial <220> <223> SA-GUS-16S-1-R <400> 26 cagcatatgg cgtatcccct ttcagatacc tgtcgtattc tcctgcattg gatacaatcc cag 63 <210> 27 <211> 50 <212> DNA <213> Artificial <220> <223> SA-GUS-16S-2-F <400> 27 gactctagat atcggaacga tcgttggctg gccctcgacg gcggggtgac 50 <210> 28 <211> 63 <212> DNA <213> Artificial <220> <223> SA-GUS-16S-2-R <400> 28 cagcatatgg cgtatcccct ttcagatacc tgtcgtattc tcctgcattg gatacaatcc 60 cag 63 <210> 29 <211> 50 <212> DNA <213> Artificial <220> <223> SA-GUS-16S-3-F <400> 29 gactctagat atcggaacga tcgttggctg gatcggtgtg gagtccactg 50 <210> 30 <211> 63 <212> DNA <213> Artificial <220> <223> SA-GUS-16S-3-R <400> 30 cagcatatgg cgtatcccct ttcagatacc tgtcgtattc tcctgcattg gatacaatcc 60 cag 63 <210> 31 <211> 52 <212> DNA <213> Artificial <220> <223> SA-GUS-16S-4-F <400> 31 gactctagat atcggaacga tcgttggctg gtcccgatcg gccgaaccca tg <210> 32 <211> 63 <212> DNA <213> Artificial <220> <223> SA-GUS-16S-4-R <400> 32 cagcatatgg cgtatcccct ttcagatacc tgtcgtattc tcctgcattg gatacaatcc cag 63 <210> 33 <211> 51 <212> DNA <213> Artificial <220> <223> SA-GUS-16S-5-F <400> 33 gactctagat atcggaacga tcgttggctg tggtcgccgg acaaggacga c <210> 34 <211> 63 <212> DNA <213> Artificial <220> <223> SA-GUS-16S-5-R <400> 34 cagcatatgg cgtatcccct ttcagatacc tgtcgtattc tcctgcattg gatacaatcc cag 63 <210> 35 <211> 70 <212> DNA <213> Artificial <220> <223> GUS-F <400> 35 aattgtgagc ggataacaat tcccaattaa aggaggaagg atcctctaga tgctgcgccc 60 ggtcgagacc 70 <210> 36 <211> 71 <212> DNA <213> Artificial <220> <223> GUS-R <400> 36 tccatggacg cgtgacgtga aaaaagcccg ccattaggc gggctgcccc tcactgcttg 60 ccgccctgct g 71 <210> 37 <211> 38 <212> DNA <213> Artificial <220> <223> BS-16s-1-F <400> 37 gcttggtacc aggaagaatc acacgtcctt atcgtaac 38 <210> 38 <211> 74 <212> DNA <213> Artificial <220> <223> BS-16s-1-R <400> 38 tagaggatcc ttcctccttt aattgggaat tgttatccgc tcacaattcc acaaggatca 60 caggttaagt tcac 74 <210> 39 <211> 30 <212> DNA <213> Artificial <220> <223> BS-16s-2-F <400> 39 gcttggtacc gctggttgaa aaaagcttag 30 <210> 40 <211> 75 <212> DNA <213> Artificial <220> <223> BS-16s-2-R <400> 40 tagaggatcc ttcctccttt aattgggaat tgttatccgc tcacaattcc acaagtagtt 60 tgactgacta cgcac 75 <210> 41 <211> 30 <212> DNA <213> Artificial <220> <223> BS-16s-3-F <400> 41 gcttggtacc cttcgaacaa aaaattgaag 30 <210> 42 <211> 76 <212> DNA <213> Artificial <220> <223> BS-16s-3-R <400> 42 tagaggatcc ttcctccttt aattgggaat tgttatccgc tcacaattcc acaatgtagt 60 ttgactgact acgcac 76 <210> 43 <211> 33 <212> DNA <213> Artificial <220> <223> BS-16s-4-F <400> 43 gcttggtacc gtgtctttat gacgtggggg ttc 33 <210> 44 <211> 76 <212> DNA <213> Artificial <220> <223> BS-16s-4-R <400> 44 tagaggatcc ttcctccttt aattgggaat tgttatccgc tcacaattcc acaatgtagt 60 ttgactgact acgcac 76 <210> 45 <211> 35 <212> DNA <213> Artificial <220> <223> BS-16s-5-F <400> 45 gcttggtacc gcccatgctc ccgatttgat ggccg 35 <210> 46 <211> 76 <212> DNA <213> Artificial <220> <223> BS-16s-5-R <400> 46 tagaggatcc ttcctccttt aattgggaat tgttatccgc tcacaattcc acaatgtagt 60 ttgactgact acgcac 76 <210> 47 <211> 37 <212> DNA <213> Artificial <220> <223> BS-16s-6-F <400> 47 gcttggtacc cgtaggttcg aatcctacct gcggagc 37 <210> 48 <211> 76 <212> DNA <213> Artificial <220> <223> BS-16s-6-R <400> 48 tagaggatcc ttcctccttt aattgggaat tgttatccgc tcacaattcc acaatgtagt 60 ttgactgact acgcac 76 <210> 49 <211> 34 <212> DNA <213> Artificial <220> <223> BS-16s-7-F <400> 49 gcttggtacc cgcccattaa agcggtacgc gagc 34 <210> 50 <211> 76 <212> DNA <213> Artificial <220> <223> BS-16s-7-R <400> 50 tagaggatcc ttcctccttt aattgggaat tgttatccgc tcacaattcc acaatgtagt 60 ttgactgact acgcac 76 <210> 51 <211> 31 <212> DNA <213> Artificial <220> <223> BS-16s-8-F <400> 51 gcttggtacc tccggtttaa tgatattaat c 31 <210> 52 <211> 75 <212> DNA <213> Artificial <220> <223> BS-16s-8-R <400> 52 tagaggatcc ttcctccttt aattgggaat tgttatccgc tcacaattcc acaatggatc 60 acaggttaag tccac 75 <210> 53 <211> 34 <212> DNA <213> Artificial <220> <223> BS-16s-9-F <400> 53 gcttggtacc agcacgtatt gaagtaatcg acag 34 <210> 54 <211> 75 <212> DNA <213> Artificial <220> <223> BS-16s-9-R <400> 54 tagaggatcc ttcctccttt aattgggaat tgttatccgc tcacaattcc acaatggatc 60 acaggttaag ttcac 75 <210> 55 <211> 30 <212> DNA <213> Artificial <220> <223> BS-16s-10-F <400> 55 gcttggtacc tcaataaggc gaaccagttg 30 <210> 56 <211> 75 <212> DNA <213> Artificial <220> <223> BS-16s-10-R <400> 56 tagaggatcc ttcctccttt aattgggaat tgttatccgc tcacaattcc acaatggatc 60 acaggttaag ttcac 75 <210> 57 <211> 57 <212> DNA <213> Artificial <220> <223> 10-F <400> 57 cgctctagat atcggaacga tcgttggctg gccggggcaa gcggtcgttc gccggtg 57 <210> 58 <211> 63 <212> DNA <213> Artificial <220> <223> pGen-16S 10-R <400> 58 cgccatatgg cgtatcccct ttcagatacc tgtcgtattc tcctctccaa caaaaacttg 60 ttg 63 <210> 59 <211> 59 <212> DNA <213> Artificial <220> <223> J1074-Neo-16S-1-F <400> 59 ggggagaata cgacaggtat ctgaaagggg atacgccaat gattgaacaa gatggattg 59 <210> 60 <211> 59 <212> DNA <213> Artificial <220> <223> J1074-Neo-16S-2-F <400> 60 ggggagaata cgacaggtat ctgaaagggg atacgccaat gattgaacaa gatggattg 59 <210> 61 <211> 59 <212> DNA <213> Artificial <220> <223> J1074-Neo-16S-3-F <400> 61 ggggagaata cgacaggtat ctgaaagggg atacgccaat gattgaacaa gatggattg 59 <210> 62 <211> 59 <212> DNA <213> Artificial <220> <223> J1074-Neo-16S-4-F <400> 62 ggggagaata cgacaggtat ctgaaagggg atacgccaat gattgaacaa gatggattg 59 <210> 63 <211> 59 <212> DNA <213> Artificial <220> <223> J1074-Neo-16S-5-F <400> 63 ggggagaata cgacaggtat ctgaaagggg atacgccaat gattgaacaa gatggattg 59 <210> 64 <211> 59 <212> DNA <213> Artificial <220> <223> J1074-Neo-16S-6-F <400> 64 ggggagaata cgacaggtat ctgaaagggg atacgccaat gattgaacaa gatggattg 59 <210> 65 <211> 59 <212> DNA <213> Artificial <220> <223> J1074-Neo-16S-7-F <400> 65 ggggagaata cgacaggtat ctgaaagggg atacgccaat gattgaacaa gatggattg 59 <210> 66 <211> 59 <212> DNA <213> Artificial <220> <223> J1074-Neo-R <400> 66 cattatggtg aaagttggaa cctcttacgt gccgatcatc agaagaactc gtcaagaag 59 <210> 67 <211> 59 <212> DNA <213> Artificial <220> <223> J1074-Neo-ZT-F <400> 67 gcatcgcctt ctatcgcctt cttgacgagt tcttctgatg atcggcacgt aagaggttc 59 <210> 68 <211> 59 <212> DNA <213> Artificial <220> <223> J1074-Neo-ZT-16S-1-R <400> 68 ttggcgtatc ccctttcaga tacctgtcgt attctccccg tgaatgtgta ccggtaatc 59 <210> 69 <211> 59 <212> DNA <213> Artificial <220> <223> J1074-Neo-ZT-16S-2-R <400> 69 ttggcgtatc ccctttcaga tacctgtcgt attctccccg tgaatgtgta ccggtaatc 59 <210> 70 <211> 59 <212> DNA <213> Artificial <220> <223> J1074-Neo-ZT-16S-3-R <400> 70 ttggcgtatc ccctttcaga tacctgtcgt attctccccg tgaatgtgta ccggtaatc 59 <210> 71 <211> 59 <212> DNA <213> Artificial <220> <223> J1074-Neo-ZT-16S-4-R <400> 71 ttggcgtatc ccctttcaga tacctgtcgt attctccccg tgaatgtgta ccggtaatc <210> 72 <211> 59 <212> DNA <213> Artificial <220> <223> J1074-Neo-ZT-16S-5-R <400> 72 ttggcgtatc ccctttcaga tacctgtcgt attctccccg tgaatgtgta ccggtaatc <210> 73 <211> 59 <212> DNA <213> Artificial <220> <223> J1074-Neo-ZT-16S-6-R <400> 73 ttggcgtatc ccctttcaga tacctgtcgt attctccccg tgaatgtgta ccggtaatc <210> 74 <211> 59 <212> DNA <213> Artificial <220> <223> J1074-Neo-ZT-16S-7-R <400> 74 ttggcgtatc ccctttcaga tacctgtcgt attctccccg tgaatgtgta ccggtaatc <210> 75 <211> 701 <212> DNA <213> Artificial <220> <223> Streptomyces albidoflavus J1074 16S-1 <400> 75 aggagcacgg gccctgcttg acttcgttcc cgccgatgcg tagtgttcaa cgagctgccg 60 tccagcccca agggctgggg aagcacctca gccgcgcgga gcgcggctca cttcaaaacc 120 tcagcaagaa ccctccagaa atacctttcc tcaggcatgc cctcgggcag gcccggattt 180 cttttttccg gaggtcctct tgtcatctcg gtacgacagt cagagccatt cggccccgat 240 tgtgagagat cgagagagtt cgctatggtt ctggacgtcg gaacggccca acagccggga 300 aggcgaatcc cgctgactgg gaatcaggcc cgaaaggatc tgatagagtc ggaaccgccg 360 aaagggaaaa gcgaagcgga aacgcggagc tggaaccgga aaggcaccga ggaaatcgga 420 cgcgaaagag tctgatagag tcgggaacac gaagtaccga agggaagcgc ccggaggaaa 480 gccgagagg gtgagtacaa aggaagcgtc cgtccttga gaactcaaca gcgtgctaaa 540 agtcaacgcc agatatgttg ataccccgac cggccaggtt cctggctggt tgaggttcct 600 ttgaaataca acagcgagga cgctgtgtgt gacaggggact attcctcctt gtcgcaccgc 660 tctcatgtct gttgcaccgg attaccggta cacattcacg g 701 <210> 76 <211> 701 <212> DNA <213> Artificial <220> <223> Streptomyces albidoflavus J1074 16S-2 <400> 76 ggtatcgacg acgcgcgctt cgccgacgtc gtccccgta tccaggaggt cctggagaag 60 tcggcccagg acggcgtggt cgagccgcac cagctccagc agctggtgcg ccgcaccctc 120 ggcaagtggg tctccgacca ctaccgccgg cgcccgatga tcctcccggt cgtcgtcgag 180 gtctgagccg ccggccggcg caccacggag cggggctccc cggatttgca tcggggagcc 240 ccgctccagt acgtttacgt ctccacccca gcgggaagcc cggcgcacct ctgtgtgccc 300 acgcggaacg gggcgggtgg aaattccgac gcagagtctc tgataaagtc ggaaccgccg 360 aaagggaaaa gcgaagcgga aacgcggagc tggaaccgga aaggcaccga ggaaatcgga 420 cgcgaaagag tctgatagag tcgggaacac gaaataccga agggaagcgc ccggaggaaa 480 gcccgagagg gtgagtacaa aggaagcgtc cgttccttga gaactcaaca gcgtgctaaaa 540 agtcaacgcc agatatgttg atacccgac cggccaggtt cctggctggt tgaggttcct 600 ttgaaataca acagcgagga cgctgtgtgc ggagggatt attcctcctt gtcgcaccgc 660 tctcatgtct gttgcaccgg attaccggta cacattcacg g 701 <210> 77 <211> 701 <212> DNA <213> Artificial <220> <223> Streptomyces albidoflavus J1074 16S-3 <400> 77 gccgaggcag ccttcctcgt ctacgtactac gcggtcggcg gccgagcagc ccgcgccggc 60 cgtaccggcg acctcgcagc cgacgacc gggagcggtg tccctgtggc cacctgatgt 120 gcatcggacg gccgtgagct ggtactgtcc tcgacgcccc ggaaaaaccg ttgacacggt 180 cggaccgggg aggtagatc gaacagttgc ccgggagctg gtacagtcct ggaggcgaag 240 gttgaacatc ttcctgcttc tcgctccgga tcaacatcc gcacggagaa gccaccgatt 300 caccagaacg gaccgccggt aaaccggcg aaattccctct gatagagtcg gaaccgccgg 360 aaagggaaaa gcgaagcgga aacggcggagc tggaccgga aaggcgccga ggaatcgga 420 cgcgaaagag tctgatagag tcgggacac gaataccga agggaagcgc ccggaggaaa 480 gccgagagg gtgagtacaa aggaagcgtc cgtccttga gaactcaaca gcgtgctaaa 540 agtcaacgcc agatatgttg ataccccgac cggccaggtt cctggctggt tgaggttcct 600 ttgaaataca acagcgagga cgctgtgtgc ggcagggatt attccttctt gtcgcaccgc 660 tctcatgtct gttgcaccgg attaccggta cacattcacg g 701 <210> 78 <211> 700 <212> DNA <213> Artificial <220> <223> Streptomyces albidoflavus J1074 16S-4 <400> 78 gcggacctgg actgagaagg gccgcaggac ggggttgaca cgccccggcc ggatccgtaa 60 ggtactccga gctgccacag cccgacaggt gcttcgggca gcacctcagc cgcgcaaggt 120 cgcggcactc cacaccccag caacatccct cccggggaaga tttccggcat gccgtcatgg 180 ctgcctggaa ttcactttcc ggggctgacg catctcgccc ggaccgcatc ggcccgatta 240 tgagttgcgg cgggaatcca ctagggttct ggacgtcgga acggcccaac agccgggaag 300 acgaaacccg ctgactggga atcaggccg aaaggatctg atagagtcgg aaccgccgga 360 aagggaaaag cgaagcggaa acgcggagct ggaaccggaa aggcgccgag gaaatcggac 420 gcgaaagagt ctgatagagt cgggaacacg aaataccgaa gggaagcgcc cggaggaaag 480 cccgagaggg tgagtacaaa ggaagcgtcc gttccttgag aactcaacag cgtgctaaaa 540 gtcaacgcca gatatgttga taccccgacc ggccaggttc ctggctggtt gaggttcctt 600 tgaaatacaa cagcgaggac gctgtgtgcg gcagggatta ttccttcttg tcgcaccgct 660 ctcatgtctg ttgcaccgga ttaccggtac acattcacgg 700 <210> 79 <211> 700 <212> DNA <213> Artificial <220> <223> Streptomyces albidoflavus J1074 16S-5 <400> 79 gagcccgttg tacgtacgcg tggtcacggg ggggagctta gaccgggacc accccaagtt 60 gacagcccct ggagcccctc cgtatggtcc accgagttgc ccgacgtgag cgccggttcc 120 caccggtccc cgggcagccg atccgcagga cctcttcaga acgcacagcg atctccgctg 180 ctcgttccgt cgcgcattgc ggaatgagga atccgcgtcc cgacagggcc gccccgatt 240 agctcgggga aagggaatcc gctaaagtct caccagtcgg aacggcccca cagccgggaa 300 gacgaatccc gctgactggg aatcaggccc gaaggatct gatgagtcg gaaccgccgg 360 aaagggaaaa gcgaagcgga aacggcggagc tggaccga aaggcaccga ggaatcgga 420 cgcgaaagag tctgatagag tcggacacg aagtaccgaa gggaagcgcc cggaggaag 480 cccgagagggg tgagtacgaa ggaagcgtcc gttccttgag aactcacag cgtgctaaaa 540 gtcaacgcca gatatgttga taccccgacc ggccaggttc ctggctggtt gaggttcctt 600 tgaaatacaa cagcgaggat gctgtgtgcg gcagggatta ttccttctg tcgcaccgct 660 ctcatgtctg ttgcaccgga ttaccggtac acatcacgg 700 <210> 80 <211> 701 <212> DNA <213> Artificial <220> <223> Streptomyces albidoflavus J1074 16S-6 <400> 80 cggcaccgct gcgcatccctc accggccgcc cggtccccgc cgaccaggctc cgcaccggcc 60 cccgcacgggg agtggccgga gaaggaggca tccggccctg gcgctactgg caggccgagg 120 accgcacggt cagcccctac cgggcccacg caccccggcg ccggccacga acttgactcg 180 cccttggcgg aggtctaacg tggcccgagc cgctgaacac ggttccgcac ttctgcgggc 240 cgaggcggca cccactactc cagcaagatc ccttcaccgg gcttctttcg gcatgctccg 300 aatgaaatcc cgaatacctc gattatgagg tgcgaagaga atccgctaac gtagtgccca 360 gccgaaaggc agaggccctc caacggccac cggagatgaa atccgcaccg gaaacggaac 420 ggaaaaagga tctggtaagg ttggaaacac gaaataccga agggaagcgc ccggaggaaa 480 gcccgagagg gtgagtacaa aggaagcgtc cgttccttga gaactcaaca gcgtgctaaaa 540 agtcaacgcc agatatgttg atacccgac cggccaggtt cctggctggt tgaggttcct 600 ttgaaataca acagcgagga cgctgtgtgc ggcagggatt attcctcctt gtcgcaccgc 660 tctcatgtct gttgcaccgg attaccggta cacattcacg g 701 <210> 81 <211> 700 <212> DNA <213> Artificial <220> <223> Streptomyces albidoflavus J1074 16S-7 <400> 81 ctcgcgcacc gggtcgatcg cggtaccggg ccccaccatc gcgcccgaga agaccgggtc 60 gggcaccgag gccagcccga cggcctggcc gctgagcggg gacatcactt cggtcatggc 120 ggaacctccg agaagatgag caggtctgag aaggacagga gaaccgccgg gcggacctgg 180 acggcacgtt gccgagtagc gtaagtcata cgaagtcacg attccgccca agacgtcctg 240 ttgaagacgt gggcccgtcg cgagcagaaa cgatttgcat cgcgactccg cgcctgggta 300 cagtcgactc ctgcccagcg ccgagcacga cattcgagcg tgccgacggg gcgacccaaa 360 ctcagcagat tccctgaatc cactgcatat ccgcatgcct gcggacggtg gtcggaggca 420 ggaaaaagaa ctgatagagt cgggaacacg aaataccgaa gggaagcgcc cggaggaaag 480 cccgagaggg tgagtacaaa ggaagcgtcc gttccttgag aactcaacag cgtgctaaaa 540 gtcaacgcca gatatgttga taccccgacc ggccaggttc ctggctggtt gaggttcctt 600 tgaaatacaa cagcgaggac gctgtgtgcg acagggacta ttcctccttg tcgcaccgct 660 ctcatgtctg ttgcaccgga ttaccggtac acattcacgg 700 <210> 82 <211> 691 <212> DNA <213> Artificial <220> <223> A promoter of rRNA of Actinoplanes utahensis for acarbose, 16sRNA-1 <400> 82 gaccacggtc accagcacga gcacgccgat cacgagctgc cagagcggca cgatcaggtc 60 cagtaacccg tcgctcgccg acgcctcgga tgggttcatg aggtcactct gtcacggttt 120 ccggcccggg tgtacgccgc gcggccgctg atgaccatgt tcatcgattt gcgcgacgga 180 cgggcggtca agtaatttct tctctgccag cgggaaagcg gtacggacag gcacgaaagt 240 gacaatccgg atcgccacct cgagggccgc tgcagcgagc tagtcttgtt ttcagcgccg 300 ggcggtgcgg caggatctcg aaacctcgag gttgcgccag cgagaccgac cgggtatagt 360 ggatcagcca gcaggagccg ggcggacgtt cgagtcggcc ggtctgcatg agccacttcc 420 acattcgtgg aaaacacttg ggcgaggcca gcgagatccc cggatttcgc cgagcgaaaa 480 cgaccaggta agcttgaacg gttgcctcgg aagcggttct ccggacggag atcgggtttc 540 gatgtgcggt tgttctttga gaactcaaca gggtgcttta aaagccagtg ccaattatgg 600 caataccccg gctgatcgtt tcggcggtca gtgggagatt cctttggcaa catttttgtt 660 gccgggacag tttttcaaca gattttgttg g 691 <210> 83 <211> 729 <212> DNA <213> Artificial <220> <223> AkaBofungin Actinoplanes rRNA promoter 16sRNA-2 <400> 83 ttgcgccacg gctgcccgcc ggtgacggtg cggctgctgg ccgagccggc acggctgacc 60 ctcgacgtgt ccgacggtga tccggcgagc gagccgctgt tcggcacccg ccggccgttc 120 ggtgcgggcg ggctggggct gctactggtg cggaccttcg cgcgggacag cggttggtat 180 cgacggggcg cgagcaagca cgtctgggcg gtattcgatc atcgggcctg actatccgaa 240 tgcgcttcat tactcactga atgatttccg caccatccac atcacccgcc ccgacttggg 300 gggtcggttt ggaggcggtg cgggcgaccg ggtaatgttc tccgagccgg cagggaaacg 360 ggcgagcgag cttctggggt tacccagcaa gatccgcggc cgtcctgcca aacccccgag 420 atcgagtgcg acgcttcgtc gtgtaaggtt ccgcggggcc cgagcgagat tcggttccgg 480 caaatccgag ggaaaccgcg gatttggcga aacgaaagcg taagggtaaa gttgaacgag 540 tgccccggag ggcgggccgc gaaagcggaa cgtgtgatgg tgtgcggttg ttctttgaga 600 actcaacagg gtgctttaaa agccagtgcc aattatggca ataccccggc tgatcgtttc 660 ggcggtcagt gggagattcc tttggcaaca tttttgttgc cgggacagtt tttcaacaga 720 ttttgttgg 729 <210> 84 <211> 703 <212> DNA <213> Artificial <220> <223> A. acarbose游动放线菌rRNA promoter 16sRNA-3 <400> 84 gggcagtccg gtggcgagat gatcggggcg gtggcggtgg cggtgcacgc cgaggtgccg 60 gtgtcgacgt tgctcagcca gatctgggcg tacccgacgt ttcatcgggg gctggggcag 120 gcgcttcagt cgctggcctg aacttgccgg tcgtctcatg cgggcctgag gttgctggtt 180 cccgccttcg ctgtgcgggc ctgaggttgc cggtatcccc gcgccggccc gagtttgctc 240 gttttcctgc gctgacctgg aacgacgcgg gacactggac cccgatttgg aggccaggga 300 accaacgggt aatgttttcc gggccggtag ggaaacgggc gagcgaactt ctggggtcac 360 ccagcaagat ccgcggccgt cctgccaaat cctctgatct tgggactaca gcctcgctgt 420 gtgctgagct cagagcggcc gtactaggtc agatcggcac caaccgggaa aaaccggttg 480 acaacgccga acggaccgag taacgtagag cgagtgcccc gggcgccggg ccgcgaaagc 540 gggtcgggcg aaggtgtgcg gttgttcttt gagaactcaa cagggtgctt taaaagccag 600 tgccaattat ggcaataccc cggctgatcg tttcggcggt cagtgggaga ttcctttggc 660 aacatttttg ttgccgggac agtttttcaa cagattttgt tgg 703 <210> 85 <211> 700 <212> DNA <213> Artificial <220> <223> A. carbophilus rRNA promoter 16sRNA-4 <400> 85 ctgtgcggag ccccgccgag cagcgcgatg atccggcccg ctccggaccg tccggcgcgt 60 atcccgggtg tacgcgggtg gttgcggtgg tccgcccctt cgctgtggtc cagcgccgcc 120 gcaacgttcc gggttgctgt cctcccttgg cgttcaccga ccgctgcgat gatccatccg 180 ctggcgcccg gtgaccgccg cgtgtcggtc gcgacgcccg ggttcgcgg ggctcgtcct 240 ccgaccgggt ggtgtgatcg gggtcgcgcc caccccggtt tggagttgcg gggcagggcc 300 tgtaatgttt tccgagccgc cagggagacg ggcgagcga cgagacccgc gaggggctcg 360 ggccggccgt cctgacgga atcctccaac gatctcgcga tccagtgttg cggggttgctg 420 gatgggtgct gctcaccatt tctggtgcgt tgaatccgg ttgcaaaaca cggatttgac 480 gaactgaga tggcgggtaa agtaggcga gtgccccgga gggcgggccg cgaaagcgga 540 acgtgtgatg gtgtgcggtt gttctttgag aactcaacag ggtgctttaa aagccagtgc 600 caattatggc aataccccgg ctgatcgttt cggcggtcag tgggagattc ctttggcaac atttttgttg ccgggacagt ttttcaacag attttgttgg 700 <210> 86 <211> 699 <212> DNA <213> Artificial <220> <223> Randomized scaffolds in the rRNA chain containing 16sRNA-5 <400> 86 aacgaggccc gccggacgat cagcgagggt ggcgcctacc tgaacaacga gcggatcacc gacgctgagg cgacggtgcc ggccgccgcg ctgctgcacg ggaggttcct ggtgctgcga 120 cgagggaagc ggaccttcgc cggtgtcgaa ctgacggcct gacccgccac tcacggagtc 180 tccgtcctct ttcaggggac cggggctccg tcgggtggcc gtccgggggc ggctattccc 240 gcgctgacct gaggttttgt cgcggcgaag ggtgtgacgg tggtcgctgg accccgattt 300 ggcgttgccc gggggaagcg ggtaatgttt tcggagccgc cagggagacg ggcgagcgac 360 acgggacccg cgaggggccc ggagcggccg tcctgacgga aatcttaccc agatctcgcg 420 atctcgcatc gcgggttcct cggtgcgttg aaatccggtt gcgaaacacg gatttgacga 480 aacgagaatg gtgagtaaag tagagcgagt gccccggacg gggagctgcg gaaagcggtt 540 cttcggatgg tgtgcggttg ttctttgaga actcaacagg gtgctttaaa agccagtgcc 600 aattatggca ataccccggc tgatcgtttc ggcggtcagt gggagattcc tttggcaaca 660 tttttgttgc cgggacagtt tttcaacaga ttttgttgg 699 <210> 87 <211> 700 <212> DNA <213> Artificial <220> <223> rRNA promoter sequence 16S-1 of Saccharopolyspora spinosa <400> 87 gcccgttgcg ttcgcggcgc cgggatcggc accgcgctgg tgtccaacgc tggcggcctt 60 cgcgaaccgg atctggctga tctgttcgac gcggtggtgc tgtccggagc ggtcggtgtc 120 tcgaagccga acgccgagat ctacctgctg gccgcacgcc gactgggact cgaaccgggc 180 cagtgcgttt tcgtcgacga ccttccccgg aacgtggccg gggcggtcgg tgcggggatg 240 gtcggcgtcc accactgcga cgtcgcttcg acggtcaccg aactggccgc gctcttcgac 300 ctggagatca ccctctgacc tgctgtttcg atacttaagg gggggtggtt gccgggggtg 360 tttcgggggt gtgtaacttt atccaagtca gagcgacacg ggacgggaaa ccggaccggg 420 cctgacagcg ggtcgcgaac caagcttcaa ccttcgggtg acagagtggg cgaaccgaaa 480 agaggaaatg ctccccggag ctgcgggtcc cttggtgggg tcgggtgatg gtgtgggtgt 540 gttctttgag aactcaacag cggactgttt cggttagtgt tcttttatgc ccccgaccat 600 gcgggtttgt gtggttggtg gtttctttga gtatcacgct ccaagatctt ttccttcggg 660 tgggttttgt tgagtgtgtg ctgggattgt atccaatgca 700 <210> 88 <211> 700 <212> DNA <213> Artificial <220> <223> rRNA promoter sequence 16S-2 of Saccharopolyspora spinosa <400> 88 gccctcgacg gcggggtgac gacctccctc gccctcgaca cccacggcaa agcgctcagc 60 tcccgactcc tgtcctggac ctcccgcgac cggatagata gtgatttacg caggtgaatg 120 gccgtgagtg ttttgggttg cgatagccgc ccaaaacact cacggccccc tcgccgacgc 180 ttaagggggg tggttgttgg gggtgtttcg gggccgtgta acttattcca agtcagcgcg 240 acacgggccg ggaaaaccgg gccgggcctg atgcgggtcc cgcgaaccaa gctctcacga 300 atgagtggta gagtgggcgg gcctgaaaac ggtaagactt gataaagtga aacgcttgcg 360 cgtgttgaaa actgaagacc gaatggtttt ccgaagataa cgagttgggt cggatcggaa 420 acgagccccc cggtttgaca gcggaaaaca cgatggtcta aagtcggtga cacaagaaag 480 cgaagaggaa atgctccccg gagcttcctg gccgttggct gggggtgatg gtgtgggtgt 540 gttctttgag aactcaacag cggactgttt tggttagtgt tcttttatgc ccccgaccat 600 gcgggtttgt gtggttggtg gtttctttga gtatcacgct ccaagatctt ttccttcggg 660 tgggttttgt tgagtgtgtg ctgggattgt atccaatgca 700 <210> 89 <211> 700 <212> DNA <213> Artificial <220> <223> rRNA promoter sequence 16S-3 of Saccharopolyspora spinosa <400> 89 gatcggtgtg gagtccactg ctacccccgt tctggcgatc gtctgggagg ctacctccgc 60 agtccaggcg agtcgcggcg acaaatcagg accacacgaa cgtggacatc gatcggggcg 120 gcggacacgg gcggcggcgc gacgccccaa aatcgtctct gacctggcgt tttcaccttt 180 tgtggggggt ggttgttggg ggtgtttcgg ggccgtgtaa cttattccaa gtcagcgcga 240 cacgggccgg gaaaaccggg ccgggcctga tgcgggtccc gcgaaccaag ctctcacgaa 300 tgagtggtag agtgggcggg cctgaaaacg gtaagacttg ataaagtgaa acgcttgcgc 360 gtgttgaaaa ctgaagaccg aatggttttc cgaagataac gaattgggtc ggatcggaaa 420 cgagcccccc cggtttgaca gcggaaaaca cgatggtcta aagtcggtga cacaagaaag 480 cgaagaggaa atgctccccg gagcttcctg gccgttggct gggggtgatg gtgtgggtgt 540 gttctttgag aactcaacag cggactgttt tggttagtgt tcttttatgc ccccgaccat 600 gcgggtttgt gtggttggtg gtttctttga gtatcacgct ccaggatctt ttccttcggg 660 tgggttttgt tgagtgtgtg ctgggattgt atccaatgca 700 <210> 90 <211> 701 <212> DNA <213> Artificial <220> <223> rRNA promoter sequence 16S-4 of Saccharopolyspora spinosa <400> 90 gtcccgatcg gccgaaccca tgcggtcacc gcctctgacc tgctggaagc gatcgacgcg 60 gcgggttcgg cgagcaccgt gaagctctgg ctgcggccga agcagaagtg acccaagatc 120 ccccgaagga gcgccgtcaa gagtttgacc aggcgatttg actttcacgt agggtgtgcg 180 taactttccc ttcgccgcat ggaaagccgg acgaaacagg acacaagagc ctgacgagga 240 cggcctgggg agcgccccgg agatcggaaa cgaactccgc ggagcgcaca ccaaccgggg 300 cacgcggttt gacaccgcga agtgcaccgg gtaacgtaaa gcggtcgcca agtagcgtc 360 aaggctacga ggcgcgttga taactcaagc aacgggctcg atcttcggag cgatcagcgc ggggttgacc cccctgaaaa cgccgaaatg agcgcctgct acagttaccg acacaagaaa gcgaagagga aatgctcccc ggagcttcct ggccgttggc tgggggtggt ggtgtgggtg 540. tgttctttga gaactcaaca gcggactgtt ttggttagtg ttcttttatg cccccgacca tgcgggtttg tgtggttggt ggtttctttg agtatcacgc tccaggactt tttccttcgg 660 gtgggttttg ttgagtgtgt gctgggattg tatccaatgc a 701 <210> 91 <211> 700 <212> DNA <213> Artificial <220> <223> Labeling of spliced ​​rRNA in the strain 16S-5 <400> 91 tggtcgccgg acaaggacga cctgctgcac ggccgctggc tggtaattcg ccgtggcaag 120. cgtcacactg cgggcgtcag ggtcgtgcat tagcctgga tcagcaccgg aaagggcgct gagctgcatg ttcggttcct tccggggttg acttgagccg atttgacttg gtgcggatca 180 acgcgtaaat tatttcaggt cagcgcggaa cgggccgatg aaaacggaac gggcactgac 240 acgggtcgcg aaccaagctc ctgccttctg gtggtagagt gggtgccccg atggaaaacc 300 gaaatttctg gcgggctttt cgtccgcagg acgaggttgc ggtttccaac cagatctttg 360 atacaacagt gcttggctgt ggccgagtgg aatagcgagc cgaaattcgg cggtgatccg 420 gtggggtgac cccccggtga gcccgaaaaa gggcctgcta ctctggtcga tagcaaaagc 480 acaagaggaa atgctccccg gagcttcctg gccgttggct gggggtgatg gtgtgggtgt 540 gttctttgag aactcaacag cggactgttt tggttagtgt tcttttatgc ccccgaccat 600 gcgggtttgt gtggttggtg gtttctttga gtatcacgct ccaggacttt ttccttcggg 660 tgggttttgt tgagtgtgtg ctgggattgt atccaatgca 700 <210> 92 <211> 700 <212> DNA <213> Artificial <220> <223> rRNA promoter 16s-1 of Bacillus subtilis <400> 92 aggaagaatc acacgtcctt atcgtaactg aaaaagggta cggaaaacga actcctgctg 60 aagagtacag aacccaagc cggggcggaa aaggactcaaacagcgaaa atcaccgaga 120 acaacggcca actagtagca gtgaaagcta ctaaaggtga agaggatcta atgattatta 180 cagctagcgg cgtactcatc agaatggaca tcaatgatat ctccatcacc ggacgtgtca 240 ctcaggtgt gcgtctcatc agaatggcag aagagagca tgttgctaca gtagctttag 300 ttgagaaaaa cgaagagat gagaatgaag aaaaaaaagtgtga aaaaaagcgc 360 agctgaaata gctgcgcttt ttgtgtcat aaccctttac agtcataaaa attatggtat 420 aatcattct gttgtctttt taaagacaca agcatgacca ttatgactag taaaaacttt 480 ttcaaaaag tattgaccta gttaactaaa atgttacta ttaagtagtc gctttgagag 540 aagcacacaa agttctttga aaactaaca agacaaacg tacctgttaa ttcatttta 600 taaatcgcac agcgatgtgc gtagtcagtc aaactagggc ctgcacgacg caggtcacac 660 aggtgtcgcc gcaggatgcg gtgaacttaa cctgtgatcc 700 <210> 93 <211> 700 <212> DNA <213> Artificial <220> <223> The rRNA sequence of 16s-2 <400> 93 gctggttgaa aaaagcttag aaccgtctgc tgaagtgtta tacgaactga aagtagctga 60 agcgaagtat ttttttact taagggaagc gaagcagcga aatttaaaaa tcagccggtg 120 gaagtaagtg gtctaaactc ctggatcttc tcataagctt gtactagaac aagcgaagga 180 gatgagaaga ttcatggagc ctatttttat tattgggatt atttaggac tggttattct 240 tcttttttta tcaggttcag cagcgaagcc tttaaagtgg attggcatca cagctgttaa 300 atttgtggca ggtgctttgc tgctggttg tgtaaatatg ttggcggca gtcttggcat 360 tcatgtgccg attaatctgg ttacaacagc tatcagcgga atttaggaa tacccggaat 420 agctgcgtta gtcgtcatta agcaatttat catttaattg atattatgta ttgacttaga 480 caactgaagg tgttattcta atatacgtcg ctgatgacga acagcttttt tgaaaagaaa 540 atgctaaaaa gttgttgaca gtagcggcgg taaatgttat gataataaag tcgcttaaac 600 gagcggtaaa caaagttctt tgaaaactaa acaagacaaa acgtacctgt taattcattt 660 ttaaatcg cacagcaatg tgcgtagtca gtcaaactac 700 <210> 94 <211> 700 <212> DNA <213> Artificial <220> <223> The rRNA sequence of 16s-3 <400> 94 cttcgaacaa aaaattgaag aaacgcttat tcagccaacg tttatttacg ggcatcctgt 60 agaaatttct cctcttgcta agaaaaaccc tgaggacccg cgttttacag accgttttga 120 gctgttatc gttggccgtg aacatgccaa cgcgtttaca gagctgaatg atcctattga 180 tcaaagagaa cgctttgaag cgcaattaaa agagcgtgaa gccggtaatg atgaagctca 240 tttaatggat gaagactttg ttgaagctct ggaatacggt atgccgccaa caggaggttt 300 aggcatcggt atcgaccgtc tggttatgct gctgacgaat gccccttcta ttcgcgatgt 360 gctgttattc ccgcaaatga gacaacgcta ataaaaaaga gcggtatcct catagggaa 420 aggatgccgc tctttttaaa tcccttagta tttcttcaaa aaaactattg cactattatt 480 tactaggtgg tatattatta ttcgttgccg ctaaacaagg cgataacgaa aaaaagaact 540 tcaaaaaaag ttattgactt cactgagtca acgagttata ataataaagt cgcttgaacg 600 aagtgaacaa aatgatcttt gaaaactaaa caagacaaaa cgtacctgtt aattcagttt 660 ttaaaaatcg cacagcgatg tgcgtagtca gtcaaactac 700 <210> 95 <211> 700 <212> DNA <213> Artificial <220> <223> 16s-4 rRNA sequences <400> 95 gtgtctttat gacgtggggg ttcaagtccc ttcacccgca ttatatagga taacagttag 60 aaaaactgga catcctgtct gcggaagtag ttcagtggta gaacaccacc ttgccaaggt 120 gggggtcgcg ggttcgaatc ccgtcttccg ctccaactat accatccacg ccggggtggt 180 ggaattggca gacacacagg acttaaaatc ctgcggtagg tgactaccgt gccggttcaa 240 gtccggccct cggcattatg tttgcgccc gtagctcaat tggatagagc gtttgactac 300 ggatcaaaag gttaggggtt cgactcctct cgggcgcgcc atactttta atagaataga 360 taggaaatcg ggaagtagct cagcttggta gagcacatgg tttgggacca tggggtcgca 420 ggttcgaatc ctgtcttccc gaccattttt ttatggggcc ttagctcagc tgggagagcg 480 cctgctttgc acgcaggagg tcagcggttc gatcccgcta ggctccacca aaagttttta 540 aaaaagttgt tgactttgaa gaagtgacgt tgtatactaa taaagttgct ttaacaaagc 600 ggacaaacaa aatgatcttt gaaaactaaa caagacaaaa cgtacctgtt aattcagttt 660 ttaaaaatcg cacagcgatg tgcgtagtca gtcaaactac 700 <210> 96 <211> 700 <212> DNA <213> Artificial <220> <223> rRNA promoter 16s-5 of Bacillus subtilis <400> 96 gcccatgctc ccgatttgat ggccgtcctt tacgatacgg gccactgtgt cgggatggcg 60 ttctgcccaa gaagcggaca ggaaaaacgt tgcgttttta atcccgtttg ctttcagagt 120 attaagtatc ggttctgctc tctcatcacc ccagctgata tcgaaagtaa gtgaaatatc 180 tttagagtct gtttctcctt tataaatggc tttaggtccg gtgtcagttg aaaacacggg 240 aagcgggaca gctctttgga tataaaaaaa gctggcagct gcaaatgcgg cgataagtat 300 aataattaat tgttttaccc gtttaatgtg ccacacatag aagtgattca ctgatgatgc 360 ctccttatct tgtccatcat tcttgtttta catcttatga gcatggacaa ttgaatataa 420 ccgataaaat gtctcttcac atacagccta aattgggtgt tgaccttttg ataatatccg 480 tgatatatta ttattcgtcg ctgataaaca gctgacatca actaaaagct tcattaaata 540 ctttgaaaaa agttgttgac ttaaaagaag ctaaatgtta tagtaataaa gctgcttcgt 600 taagcggcag taatgatctt tgaaaactaa acaagacaaa acgtacctgt taattcattt 660 ttaaatcg cacagcgatg tgcgtagtca gtcaaactac 700 <210> 97 <211> 700 <212> DNA <213> Artificial <220> <223> The rRNA sequence of 16s-6 <400> 97 cgtaggttcg aatcctacct gcggagcatt gcttccatag ctcagcaggt agagcacttc 60 catggtaagg aagaggtcag cggttcgagc ccgcttggaa gcttaaatgt attattacca 120 aggttctca taaggagaaa gcttttttta ttgcgatatg cggaagtagt tcagtggtag 180 aacaccacct tgccaaggtg ggggtcgcgg gttcgaatcc cgtcttccgc tccatttacc 240 taacgggata ttgtaaattg aattgcgccc gtagctcaat tggatagagc gtttgactac 300 ggatcaaaag gttaggggtt cgactcctct cgggcgcgcc atatctttta atagaataga 360 taggaaatcg ggaagtagct cagcttggta gagcacatgg tttgggacca tggggtcgca 420 ggttcgaatc ctgtcttccc gaccattttt tatggggcct tagctcagct gggagagcgc 480 ctgctttgca cgcaggaggt cagcggttcg atcccgctag gctccaccaa aagtttttaa 540 aaaaggttat tgactttgaa gaagtgacat tgtatactaa taaagttgct ttaacaaagc 600 ggacaaacaa aatgatcttt gaaaactaaa caagacaaaa cgtacctgtt aattcagttt 660 ttaaaaatcg cacagcgatg tgcgtagtca gtcaaactac 700 <210> 98 <211> 700 <212> DNA <213> Artificial <220> <223> rRNA promoter 16s - 7 of Bacillus subtilis <400> 98 cgcccattaa agcggtacgc gagctgggtt cagaacgtcg tgagacagtt cggtccctat 60 120 cgcaccgctg gtgtaccagt tgttctgcca agggcatcgc tgggtagcta tgtgcggacg 180 ggataagtgc tgaaagcatc taagcatgaa gccccctca agatgagatt tcccattccg 240 caaggaagta agatccctga aagatgatca ggttgatagg tctgaggtgg aagtgtggcg 300 360 acacctgtta tctagttttg agagaacact ctcaatttgt ttggtggcga tagcgaagag 420 gtcacacccg ttcctacc gaacacggaa gttaagctct tcagcgccga tggtagtcgg 480 gggtttcccc ctgtgagagt aggacgccgc caagcaattg cacattagtg taatttttta 540 aaaaagttat tgactttgaa gaagtgacat tgtatactaa taaagttgct ttaacaaagc 600 ggaaaaa aatgatcttt gaaaaaaa gagaacaaaa cgtacctgtt aattcagttt 660 ttaaaaaatcg cacagcgatg tgcgtagtca gtcaaactac 700 <210> 99 <211> 700 <212> DNA <213> Artificial <220> <223> rRNA promoter 16s-8 of Bacillus subtilis <400> 99 tccggtttaa tgatattaat cagttcctct ttgtagtaat acataacacg cctcatttct 60 tcttaagaga ttttcttata ttatttgtaa gatgagataa aatatataca tgataagcat 120 gggaaggcgt gaaagaagaa aataaaaaaa tacaggaaaa gtgttgacca aataaaacag 180 gcatggtata ttattaaacg tcgctgatga acagcgtgaa acaaaacaga aaaacaaaaa 240 agttttccta aggtgtttac aagattttaa aaatgtgtat aataagaaaa gtcgaattga 300 aaaagattcg aaaaaacatt aaaaaacttc ttgacttcaa catcaaatga tagtatgata 360 gttaagtcgc tcaataagcg cccgtagctc aattggatag agcgtttgac tacggatcaa 420 aaggttaggg gttcgactcc tctcgggcgc gccatataag ataccacgcg ggtgtagttt 480 agtggtaaaa cctcagcctt ccaagctgat gtcgtgagtt cgattctcat cacccgctcc 540 attattgaat gatctttgaa aactaaacaa gacaaaacgt acctgttaat tcagtttttg 600 aaaatcgcac agcgatgtgc gtagtcagtc aaactagggc ctgcacgatg caggtcacac 660 aggtgtcacc gcgggatgcg gtggacttaa cctgtgatcc 700 <210> 100 <211> 700 <212> DNA <213> Artificial <220> <223> The rRNA sequence of 16s-9 <400> 100 agcacgtatt gaagtaatcg acagaggatt ccatcccgaa accacggtgt ggagccaagt 60 gcgccagatg gagccccaag tgtacaaatt atattccgag ctgattgaaa gtcatgagag 120 cctggaaaaa agacttgaat tattattctt agcaaatgat tttctcatcc attccaaagc 180 cgagatcggt tcggcgcatc ttttcgaagt aatgaaagaa aaagacattt ggcaattcgg 240 tgagcttctt caacatcatg acctaaagca cttacccaa gatcttggcg tttgcttga 300 ttacttgacg gaaaagggac ttatcaacgt ctgccagata gaaacgaaag gacaggctgt 360 ctatcaccga ggatattctt ttaaaaaagg tgttgactct gattcttgac cgtgttatat 420 tattaaacgt cgctgatgcg cttctgagaa aacaagctca cagcggcggg aaaataaatc 480 aaaaaaacat ttgacaaaag aaagtcaaaa tgttatatta ataaagtcgc ttcaacaaga 540 agtgaaaatg atctttgaaa actaaacaag acaaaacgta cctgttaatt cagtttttaa 600 aaaatcgcac agcgatgtgc gtagtcagtc aaactagggc ctgcacgacg caggtcacac 660 aggtgtcgcc gcaggatgcg gtgaacttaa cctgtgatcc 700 <210> 101 <211> 700 <212> DNA <213> Artificial <220> <223> The rRNA sequence of 16s-10 <400> 101 tcaataaggc gaaccagttg cttagattga ttcatatcta tctccttcca ttgacagaca 60 accaaaagga caacaaaaaa gcagcacgcg gaaggatgag aaaagttcca cgcactgctt 120 tacgatctgc aattcatttg actttgccac atccctacgc cagcgttaac taacaggttc 180 aaagggtcag aacgaaaccg ctcactctca gctttaatgc tccccttgtg gtcatcagta 240 tttagttcgt ttctactata caagaaaacg aaaaaaacaa caagatcaca tgactgatgt 300 atatgttctt ttaagaaact tatatgatac acacgcttta gaaatcatgg cgaggattat 360 agtttatttg ttttatagat ttttttaaa aaactattgc aataaataaa tacaggtgtt 420 atattattaa acgtcgctga tgcacagcgg acacaaacta gatgcttcaa aacaacttga 480 aaaaagttgt tgacaaaaaa gaagctgaat gttatattag taaagctgct tcattgagaa 540 gtaacgaaat gatctttgaa aactaaacaa gacaaaacgt acctgttaat tcagttttta 600 aaaatcgcac tgcgatgtgc gtagtcagtc aaactagggc ctgcacgacg caggtcacac 660 aggtgtcgcc gcaggatgcg gtgaacttaa cctgtgatcc 700 <210> 102 <211> 689 <212> DNA <213> Artificial <220> <223> Micromonospora rRNA promoter 16S <400> 102 gccggggcaa gcggtcgttc gccggtgttg agctgcgtaa atagccgtac ggcgatgatg 60 tgacgtggga cgcgtccagc ggatttgacg ttcaaaccgc tggacgcgta actttctctc 120 tgccagcgcg gaacggacga aacaggcaaa acgcctggga gtccggttcg ggaatggcac 180 cgggtcagac ggggcaactt ccctgaggtc cggtccgggt ggtgcttcat cggtcgaccg 240 aggggtcgat ttggcggggc ggaaccgacc gggtaaggtt gacgaccggc agggaaccgg 300 gcgagcgagc gggagaccgc agcggccggc ctgtcaaaaa ccacggcaac ggacggcgga 360 aacgccgaat ggattcgtgg tgcatcaaac cggatagaag cacgacaaag cgccacagag 420 cggtttgaca cggcggaaac ggtgaggtaa cgtagtagaa gtgctcgacg cggaagcggc 480 gggtgcgagg acgagatgcc ccggatgggg cccctgaggg ggtttccgga tggtgtgtgg 540 ttgttctttg agaactcaac agggtgcttg ataagccagt gccaattaag ttataccccg 600 tgctggtcgg gccttatgtc tggctggtgg ggattccttt ggcaacactt tgttgctggg 660 atgattgttc aacaagtttt tgttggaga 689

Claims

1. A method for overexpressing a target gene, characterized in that: include: Operably linking a ribosomal RNA promoter to a target gene, wherein the ribosomal RNA promoter is placed at the position of an original promoter of the target gene, and the target gene is a non-ribosomal RNA gene; Introducing a target gene connected to a ribosomal RNA promoter into a recipient cell, so as to achieve overexpression of the target gene in the recipient cell; The recipient cell is Streptomyces lividans TK24 or Streptomyces albidoflavusJ1074; The sequence of the ribosomal RNA promoter is shown in any one of SEQ ID NOs: 75 to 81.

2. The method according to claim 1, characterized in that The ribosomal RNA gene sequence is obtained through the NCBI database or sequencing.

3. The method according to claim 1, characterized in that The target gene is pre-set in a plasmid vector.

4. The method according to claim 3, characterized in that The plasmid vector is pLH1.

5. The method according to claim 3, characterized in that: The target gene is Gus.

6. The method according to claim 4, characterized in that The ribosomal RNA (rRNA) promoter is located between the XbaI and NdeI restriction sites of the pLH1.

7. The method according to claim 1, characterized in that The ribosomal RNA promoter is used to strongly promote the expression of non-ribosomal RNA genes.

Images