Mutant microorganism capable of producing 1,3-propylene glycol and method for preparing 1,3-propylene glycol using the same

Abstract

The present invention relates to: a variant microorganism in which a glycerol decomposition pathway and a 1,3-PDO biosynthesis metabolic pathway are introduced into a microorganism that cannot utilize glycerol as a single carbon source; and a method for preparing 1,3-PDO using the variant microorganism. According to the present invention, glycerol, which is a low-cost material, is used as a single carbon source, so that a variant microorganism having the ability to produce 1,3-PDO can grow while producing 1,3-PDO, and therefore, the present invention is useful for economically producing 1,3-PDO.

Description

Technical Field

[0001] The present disclosure relates to a mutant microorganism having the ability to produce 1,3-propanediol (1,3-PDO) from glycerol and a method of producing 1,3-PDO using the mutant microorganism; and more particularly to a mutant microorganism in which a glycerol decomposition pathway and a 1,3-PDO biosynthesis pathway are introduced into a microorganism that cannot use glycerol as a carbon source; and a method of producing 1,3-PDO using the mutant microorganism. Background Art

[0002] 1,3-Propanediol (1,3-PDO) is a compound used as a monomer for synthetic polymers such as polyethers, polyurethanes, and polytrimethylene terephthalate (PTT). As a conventional production method of 1,3-PDO, chemical synthesis methods are mainly used, including hydration of acrolein, hydroformylation of ethylene oxide in the presence of phosphine, or enzymatic conversion of glycerol. These chemical production methods have limitations because they include expensive and environmentally harmful production processes (Lee et al., Renewable and Sustainable Energy Reviews, 42 (Supplement C): 963-972; U.S. Pat. No. 8,236,994 B2).

[0003] As a biological method, methods for producing 1,3-PDO using microorganisms are mainly performed using microorganisms such as Klebsiella, Clostridia, Enterobacter, Citrobacter, or Lactobacilli. All of these methods directly convert glycerol into 1,3-PDO through two consecutive metabolic pathways, through which glycerol is converted into 3-hydroxypropionaldehyde (3-HPA) by glycerol dehydratase, and then 3-HPA is reduced to 1,3-PDO ( Figure 1 ). DuPont has successfully commercialized 1,3-PDO by introducing the metabolic pathway into Escherichia coli (E. coli). However, most microorganisms that biosynthesize 1,3-PDO, including E. coli, have the disadvantage of also producing various byproducts such as formic acid, acetic acid, lactic acid, ethanol and 2,3-butanediol.

[0004] Corynebacterium glutamicum (Corynebacterium glutamicum) as Gram-positive facultative anaerobic bacteria is widely used in the fermentation process of amino acid production. In addition, in order to generate various chemicals and fuels using Corynebacterium glutamicum, many metabolic engineering studies have been carried out, and the purpose is to enable Corynebacterium glutamicum to use various carbon sources. However, little research has been carried out on using Corynebacterium glutamicum to generate 1,3-PDO. In addition, a study reports that Corynebacterium glutamicum uses glucose and glycerol as carbon sources, uses glucose to promote its cell growth, and Corynebacterium glutamicum generates glutamic acid together with 1,3-PDO from glycerol (Huang et al., Scientific Reports, 7:42246,2017).

[0005] Therefore, the inventors have made efforts to more efficiently produce 1,3-PDO using glycerol as a single carbon source, and as a result, have found that when a mutant microorganism obtained by introducing a glycerol facilitator encoding gene, a glycerol kinase encoding gene, and a glycerol dehydrogenase encoding gene into a microorganism that cannot use glycerol as a single carbon source in order to construct a glycerol decomposition pathway, and further introducing a glycerol reactivation enzyme encoding gene and a 1,3-propanediol oxidoreductase encoding gene in order to biosynthesize 1,3-PDO, it produces 1,3-PDO, thereby completing the present disclosure. Summary of the invention

[0006] An object of the present disclosure is to provide mutant microorganisms into which a glycerol decomposition pathway has been introduced and which are capable of growing using glycerol as a sole carbon source.

[0007] Another object of the present disclosure is to provide a mutant microorganism into which a 1,3-POD biosynthetic pathway is introduced and which is capable of producing 1,3-PDO using glycerol as a single carbon source.

[0008] Still another object of the present disclosure is to provide a method for producing 1,3-PDO using a mutant microorganism that uses only glycerol as a single carbon source.

[0009] To achieve the above objectives, the present disclosure provides a mutant microorganism, wherein a glycerol facilitating protein encoding gene, a glycerol kinase encoding gene and a glycerol dehydrogenase encoding gene are introduced into a microorganism that cannot use glycerol as a single carbon source, and the mutant microorganism is able to grow with glycerol as a single carbon source.

[0010] The present disclosure also provides a mutant microorganism, wherein a gene encoding a glycerol facilitating protein, a gene encoding a glycerol kinase, a gene encoding a glycerol dehydrogenase, a gene encoding a glycerol dehydratase, a gene encoding a glycerol reactivation enzyme, and a gene encoding a 1,3-propanediol oxidoreductase are introduced into a microorganism that cannot use glycerol as a single carbon source, and the mutant microorganism has the ability to produce 1,3-propanediol from glycerol.

[0011] The present disclosure also provides a method for producing 1,3-propanediol from glycerol, the method comprising the following steps: (a) culturing a mutant microorganism having the ability to produce 1,3-propanediol from glycerol in a glycerol-containing medium to produce 1,3-propanediol; and (b) collecting the produced 1,3-propanediol. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 Schematic diagram of the overall metabolic pathway including the 1,3-PDO biosynthesis pathway and the glycerol decomposition pathway in Corynebacterium glutamicum.

[0013] Figure 2 The pCSglpFKD recombinant vector containing the glpF, glpK and glpD genes encoding the glycerol catabolic pathway is shown.

[0014] Figure 3 Shown are the results of observing cell growth at initial glycerol concentrations of 18 g / L, 20 g / L, and 40 g / L during flask culture of the wild-type Corynebacterium glutamicum ATCC13032 strain into which the pCSglpFKD vector was introduced.

[0015] Figure 4 is a schematic diagram showing the ALE method performed using the wild-type Corynebacterium glutamicum ATCC13032 strain into which the pCSglpFKD vector was introduced at an initial glycerol concentration ranging from 20 g / L to 40 g / L.

[0016] Figure 5 It was shown that the cell growth rate of the wild-type Corynebacterium glutamicum ATCC13032 strain into which the pCSglpFKD vector was introduced was significantly increased when the initial glycerol concentration was 40 g / L in flask culture by the ALE method.

[0017] Figure 6 Shown is the pEK-dg recombinant vector constructed by inserting the dhaB1234 / gdrAB gene cluster encoding glycerol dehydratase and glycerol reactivase to construct the 3-HPA biosynthetic metabolic pathway.

[0018] Figure 7Shown is the pEK-pdu recombinant vector constructed by inserting the pduCDEGH gene cluster encoding glycerol dehydratase to construct the 3-HPA biosynthetic metabolic pathway.

[0019] Figure 8 Shown is a pEK-dgyE recombinant vector constructed by inserting the yqhD gene encoding Escherichia coli 1,3-PDO oxidoreductase into the pEK-dg vector to construct a 1,3-PDO biosynthetic metabolic pathway.

[0020] Fig. 9 Shown is a pEK-dgyK recombinant vector constructed by inserting the yqhD gene encoding Klebsiella pneumoniae DSMZ2026 1,3-PDO oxidoreductase into the pEK-dg vector to construct a 1,3-PDO biosynthetic metabolic pathway.

[0021] Fig.10 Shown is a pEK-dgdk recombinant vector constructed by inserting the dhaT gene encoding the Klebsiella pneumoniae DSMZ2026 1,3-PDO oxidoreductase into the pEK-dg vector to construct a 1,3-PDO biosynthetic metabolic pathway.

[0022] Fig.11 Shown is a pEK-pduyE recombinant vector constructed by inserting the yqhD gene encoding Escherichia coli 1,3-PDO oxidoreductase into the pEK-pdu vector to construct a 1,3-PDO biosynthetic metabolic pathway.

[0023] Fig.12 Shown is a pEK-pduyK recombinant vector constructed by inserting the yqhD gene encoding the Klebsiella pneumoniae DSMZ2026 1,3-PDO oxidoreductase into the pEK-pdu vector to construct a 1,3-PDO biosynthetic metabolic pathway.

[0024] Fig.13 Shown is a pEK-pdudk recombinant vector constructed by inserting the dhaT gene encoding Klebsiella pneumoniae DSMZ2026 1,3-PDO oxidoreductase into the pEK-pdu vector to construct a 1,3-PDO biosynthetic metabolic pathway.

[0025] Fig.14 The results of 1,3-PDO production observed in flask culture of mutant microorganisms of Corynebacterium glutamicum into which six recombinant vectors (pEK-dgyE, pEK-dgyK, pEK-dgdK, pEK-pduyE, pEK-pduyK and pEK-pdudK) were respectively introduced to construct a 1,3-PDO biosynthetic pathway are shown.

[0026] Fig.15 Shown are the results of 1,3-PDO production by the MBEL-HCC-C-13PDO1 strain depending on aeration conditions in flask culture.

[0027] Fig.16 Shown are the results of fed-batch fermentation culture of the MBEL-HCC-C-13PDO1 strain when glycerol was used as the sole carbon source.

[0028] Fig.17 Shown are the results of 1,3-PDO production observed in flask cultures of the MBEL-HCC-C-13PDO1 strain depending on the weight ratio of glucose to glycerol.

[0029] Fig.18 Shown are the results of fed-batch fermentation culture of the MBEL-HCC-C-13PDO1 strain when glucose and glycerol were used at a weight ratio of 1:3.

[0030] Fig.19 Shown are the results of fed-batch fermentation culture of the MBEL-HCC-C-13PDO1 strain when glucose and glycerol were used at a weight ratio of 1:2. DETAILED DESCRIPTION

[0031] Unless otherwise defined, all technical and scientific terms used in this specification have the same meaning as commonly understood by those skilled in the art to which this disclosure belongs. Generally, the nomenclature used in this specification is well known and commonly used in the art.

[0032] According to the present disclosure, a mutant microorganism is constructed, whose cells can use glycerol as a single carbon source for cell growth through a constructed glycerol decomposition pathway, and which produces 1,3-PDO through a constructed 1,3-PDO biosynthesis metabolic pathway. In the present disclosure, a mutant microorganism is constructed by introducing a glycerol facilitating protein encoding gene, a glycerol kinase encoding gene, and a glycerol dehydrogenase encoding gene responsible for the glycerol decomposition pathway into a microorganism that cannot naturally use glycerol as a single carbon source, and the mutant microorganism is found to grow in a culture medium containing glycerol as a single carbon source.

[0033] Thus, in one aspect, the present disclosure relates to a mutant microorganism, wherein a glycerol facilitating protein encoding gene, a glycerol kinase encoding gene, and a glycerol dehydrogenase encoding gene are introduced into a microorganism that is unable to use glycerol as a single carbon source, and the mutant microorganism is able to grow using glycerol as a single carbon source.

[0034] In the present disclosure, the gene encoding the glycerol facilitating protein, the gene encoding the glycerol kinase, and the gene encoding the glycerol dehydrogenase may be glpF, glpK, and glpD derived from Escherichia coli W3110, respectively.

[0035] In the present disclosure, the microorganism that cannot use glycerol as a sole carbon source may be a microorganism such as Corynebacterium spp., Lactobacillus panis, Clostridium acetobutylicum, Clostridium beijerinckii, Mycobacterium tuberculosis or Rhodobacter capsulatus, but is not limited thereto.

[0036] In the present disclosure, the gene can be overexpressed by a strong promoter (such as tac, trc, H36 or tuf).

[0037] In one embodiment of the present disclosure, glycerol kinase and glycerol dehydrogenase are introduced into the microorganism Corynebacterium glutamicum, which can diffuse glycerol naturally, but cannot grow cells when glycerol is used as a single carbon source, and glycerol facilitator protein is introduced into the microorganism to increase the glycerol uptake rate. As used herein, the term "introducing" refers to converting by inserting the above-mentioned enzyme into the Corynebacterium glutamicum genome or introducing a vector expressing the enzyme into the genome.

[0038] In one embodiment of the present disclosure, adaptive laboratory evolution (ALE) is performed to increase the uptake rate of glycerol in microorganisms into which a glycerol catabolic pathway has been introduced or in microorganisms whose cell growth is significantly inhibited or low when glycerol is used. ALE refers to the continuous transfer and cultivation of cells in fresh culture medium. The time point for transferring cells is the time when cell growth in the preculture medium is observed and the preculture is inoculated into the next culture medium. The end point is the time when the cell shows enhanced cell growth during cultivation with a single carbon source at the desired glycerol concentration.

[0039] The present disclosure provides a method for shortening the lag phase of a mutant microorganism in a culture medium containing glycerol as a single carbon source, the method comprising the following steps: (a) culturing a mutant microorganism capable of growing on glycerol as a single carbon source in a culture medium containing glycerol as a single carbon source; (b) inoculating a portion of the culture containing the mutant microorganism grown in step (a) into a fresh culture medium containing glycerol as a single carbon source; and (c) repeating steps (a) and (b) several times, and collecting microorganisms with reduced lag phase.

[0040] In one embodiment of the present disclosure, a mutant microorganism having an enhanced ability to produce 1,3-PDO is generated by the following method: introducing a glycerol facilitating protein encoding gene, a glycerol kinase encoding gene, and a glycerol dehydrogenase encoding gene into a microorganism Corynebacterium glutamicum that cannot naturally use glycerol as a single carbon source, the genes being genes responsible for the glycerol decomposition pathway, so that the cells of the microorganism having the ability to produce 1,3-PDO can grow using glycerol; and introducing a glycerol dehydratase encoding gene, a glycerol reactivation enzyme encoding gene, and a 1,3-propanediol oxidoreductase encoding gene, the genes being genes encoding enzymes responsible for the biosynthesis of 1,3-PDO, so that the microorganism has an enhanced activity compared to its endogenous activity. It was confirmed that under conditions where glycerol is used as a single carbon source, the constructed mutant microorganism produces 1,3-PDO simultaneously with cell growth.

[0041] Therefore, in another aspect, the present disclosure relates to a mutant microorganism into which a glycerol facilitator-encoding gene, a glycerol kinase-encoding gene, a glycerol dehydrogenase-encoding gene, a glycerol dehydratase-encoding gene, a glycerol reactivase-encoding gene and a 1,3-propanediol oxidoreductase-encoding gene are introduced, and which has the ability to produce 1,3-propanediol from glycerol.

[0042] In the present disclosure, the glycerol facilitating protein encoding gene, the glycerol kinase encoding gene and the glycerol dehydrogenase encoding gene may be glpF, glpK and glpD, respectively.

[0043] In the present disclosure, the glycerol dehydratase encoding gene, the glycerol reactivation enzyme encoding gene, and the 1,3-propanediol oxidoreductase encoding gene may be pduCDEG and yqhD, respectively.

[0044] In the present disclosure, the microorganism that cannot use glycerol as a sole carbon source may be a microorganism such as Corynebacterium species, Lactobacillus breadi, Clostridium acetobutylicum, Clostridium beijerinckii, Mycobacterium tuberculosis or Rhodobacter capsulatum, but is not limited thereto.

[0045] In the present disclosure, the gene can be overexpressed by a strong promoter selected from tac, trc, H36 and tuf.

[0046] In one embodiment of the present disclosure, as the glycerol dehydratase encoding gene, glycerol reactivation enzyme encoding gene, and 1,3-propanediol oxidoreductase encoding gene introduced to impart or enhance the ability to produce 1,3-PDO, those derived from Klebsiella pneumoniae DSMZ 2026 are used. In this case, the glycerol dehydratase encoding gene and the glycerol reactivation enzyme encoding gene may be dhaB1234gdrAB or pduCDEGH as a gene cluster fragment, and the 1,3-POD oxidoreductase encoding gene may be yqhD or dhaT, or the 1,3-POD oxidoreductase encoding gene derived from Escherichia coli may be yqhD.

[0047] In another example of the present disclosure, a glycerol decomposition pathway was first constructed by introducing a glycerol facilitating protein, a glycerol kinase, and a glycerol dehydrogenase. Through ALE, it was confirmed that when glycerol was used as a single carbon source at an initial glycerol concentration of about 40 g / L, the cell growth of the mutant strain was significantly increased.

[0048] Based on the above results, strains showing excellent cell growth when using glycerol as a single carbon source were selected, and then a 1,3-PDO biosynthetic metabolic pathway was constructed by introducing glycerol dehydratase, glycerol reactivation enzyme, and 1,3-PDO oxidoreductase into the selected strains. For about six mutant microorganisms that constructed or enhanced the PDO biosynthetic metabolic pathway, it was confirmed that the pduCDEGH gene from Klebsiella pneumoniae DSMZ2026 encoding glycerol dehydratase and glycerol reactivation enzyme and the yqhD gene from Escherichia coli encoding 1,3-PDO oxidoreductase produced the highest amount of 1,3-PDO.

[0049] From the above results, it can be confirmed that overexpression of glycerol dehydratase, glycerol reactivase and 1,3-PDO oxidoreductase enhances the 1,3-PDO biosynthetic metabolic pathway and makes 1,3-PDO production possible.

[0050] Therefore, in still another aspect, the present disclosure relates to a method for producing 1,3-propanediol from glycerol, the method comprising the steps of: (a) culturing a mutant microorganism having the ability to produce 1,3-propanediol from glycerol in a glycerol-containing medium, thereby producing 1,3-propanediol; and (b) collecting the produced 1,3-propanediol.

[0051] According to the present disclosure, glucose may be added to the culture medium, and a weight ratio between glucose and glycerol added to the culture medium may be 1:2 to 9.

[0052] In another example of the present disclosure, it can be confirmed that the ability to produce 1,3-PDO is highest under certain microaerobic conditions determined by optimizing the aeration conditions during strain culture. The constructed mutant microorganism is named MBEL-HCC-C-13PDO1, which shows excellent cell growth when using glycerol as a single carbon source and has an endowed or enhanced ability to produce 1,3-PDO.

[0053] In another embodiment of the present disclosure, a batch-fed fermentation culture of the MBEL-HCC-C-13PDO1 strain was performed under optimized aeration conditions, including but not particularly limited to 0.25 vvm, 600 rpm, pH 7, and temperature 30°C. It was confirmed that under these conditions, when glycerol was used as a single carbon source, about 47.3 g / L of 1,3-PDO was produced. Under these conditions, about 44.0 g / L of 3-HP as a byproduct was observed. Therefore, it was determined that the endogenous activity of any aldehyde dehydrogenase naturally present in Corynebacterium glutamicum was generated or enhanced to supply the reducing power required for the production of 1,3-PDO. Therefore, in order to supply the reducing power derived from the activation of the pentose phosphate pathway by adding a certain ratio of glucose to reduce the endogenous activity of the 3-HP production metabolic pathway, a specific ratio of glucose and glycerol was used as a carbon source for culture. The results confirmed that when glucose and glycerol were used at a specific ratio, the production of 3-HP was reduced and the production of 1,3-PDO was increased. This suggests that when aldehyde dehydrogenase involved in the metabolic pathway for 3-HP production is deleted or weakened in a microorganism showing the ability to produce 3-HP, in a microorganism imparted with the ability to produce 1,3-PDO, the ability of the microorganism to produce 1,3-PDO is enhanced.

[0054] Based on these results, it was determined that the addition of glucose enhanced the supply of reducing power, thereby weakening the activity of aldehyde dehydrogenase, and the fed-batch fermentation culture was carried out at the observed ratio, and the results confirmed that 60.3 g / L of 1,3-PDO was produced in the MBEL-HCC-C-13PDO1 strain. In addition, it was confirmed that when the ratio of glucose was slightly increased to further increase the supply of reducing power and further weaken the activity of aldehyde dehydrogenase, 77.3 g / L of 1,3-PDO was finally produced.

[0055] As used herein, the term "endogenous activity" refers to the activity of an enzyme possessed by a microorganism in its natural state, i.e., in a state without modification, and "modified to have an enhanced activity compared to the endogenous activity" means that the activity of the enzyme is newly introduced or further improved compared to the activity of the corresponding enzyme before modification.

[0056] In the present disclosure, "enhancement of enzyme activity" includes improving enzyme activity by the following methods: improving endogenous gene activity, amplifying endogenous genes by internal or external factors, deleting regulatory factors used to inhibit gene expression, increasing gene copy number, increasing activity by introducing exogenous genes or modifying expression regulatory sequences (particularly replacing or modifying promoters) and mutations within genes, and introducing or improving the activity of the enzyme itself to achieve effects beyond endogenous function.

[0057] In the present disclosure, "modified to have an enhanced activity compared to the endogenous activity" means that the activity of the microorganism is increased after manipulation, such as the introduction of a gene showing activity, or increasing the number of gene copies, deleting a regulatory factor for inhibiting gene expression, or modifying an expression regulatory sequence (e.g., using an improved promoter), compared to the activity of the microorganism before the manipulation.

[0058] In the present disclosure, "deletion" is intended to cover mutation, substitution (replacement) or deletion of all or a portion of a target gene or the introduction of one or more nucleotides into a gene, such that the gene is not expressed or does not exhibit enzymatic activity, and further, such that even if it is expressed, the biosynthetic pathway associated with the gene is blocked.

[0059] In the present disclosure, "overexpression" refers to the expression of a gene in a cell at a level higher than that normally expressed in that type of cell, and is intended to include methods of increasing expression levels by replacing the promoter of a gene present on the genome with a strong promoter or cloning the relevant gene into an expression vector and transforming the cell with the expression vector.

[0060] In the present disclosure, "vector" refers to a DNA construct containing a DNA sequence that is operably linked to a suitable control sequence that can achieve expression of the DNA in a suitable host. The vector can be a plasmid, a phage particle, or simply a potential genomic insert. Once incorporated into a suitable host, the vector can replicate and function independently of the host genome, or, in some cases, can be integrated into the genome itself. In this specification, "plasmid" and "vector" are sometimes used interchangeably because plasmids are the most commonly used vector form. For the purpose of the present disclosure, plasmid vectors are preferably used. Typical plasmid vectors that can be used for this purpose contain: (a) an origin of replication, through which replication is efficiently carried out so that hundreds of plasmid vectors are generated per host cell; (b) an antibiotic resistance gene, through which host cells transformed with the plasmid vector can be selected; and (c) a restriction enzyme cleavage site that can be inserted into an exogenous DNA fragment. Even if there is no suitable restriction enzyme cleavage site in the vector, the vector can be easily connected to the exogenous DNA fragment using conventional synthetic oligonucleotide adapters or joints.

[0061] After ligation, the vector should be transformed into a suitable host cell. In the present disclosure, preferred host cells are prokaryotic cells. Suitable prokaryotic host cells include E. coli DH5α, E. coli JM101, E. coli K12, E. coli W3110, E. coli X1776, E. coli XL-1Blue (Stratagene), E. coli B and E. coli B21. However, E. coli strains such as FMB101, NM522, NM538 and NM539 and other prokaryotic species and genera, etc., can also be used. In addition to the E. coli mentioned above, the following strains can also be used as host cells: strains of the genus Agrobacterium, such as Agrobacterium A4; strains of the genus Bacillus, such as Bacillus subtilis; other enterobacteria, such as Salmonella typhimurium or Serratia marcescens; and various strains of the genus Pseudomonas.

[0062] Transformation of prokaryotic cells can be readily performed using the calcium chloride method described in Section 1.82 (Sambrook et al., supra). Alternatively, electroporation (Neumann et al., EMBO J., 1:841, 1982) can be used for transformation of these cells.

[0063] The vector for overexpressing the gene according to the present disclosure can be any expression vector known in the art, and is preferably a pET-based vector (Novagen). When cloning using a pET-based vector, the histidine group is combined with the end of the expressed protein, thereby effectively purifying the protein. The expressed protein can be separated from the cloned gene using conventional methods known in the art. Specifically, Ni-NTA His conjugated resin (Novagen) can be used to separate the expressed protein by chromatography. In the present disclosure, the recombinant vector can be pET-SLTI66, and the host cell can be Escherichia coli or Agrobacterium.

[0064] As used herein, the term "expression control sequence" means a DNA sequence necessary for the expression of a coding sequence operably linked to a specific host organism. Such control sequences include a promoter for transcription, any operator sequence for controlling such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence for controlling the termination of transcription and translation. For example, control sequences suitable for prokaryotes include a promoter, optionally an operator sequence and a ribosome binding site. Eukaryotic cells include a promoter, a polyadenylation signal, and an enhancer. The factor that has the greatest influence on the expression level of a gene in a plasmid is the promoter. Preferably, SRα promoter, a promoter derived from cytomegalovirus, etc. are used as promoters for high expression. Any of a variety of expression control sequences can be used in a vector to express the DNA sequence of the present disclosure. Useful expression control sequences include, for example, the early and late promoters of SV40 or adenovirus, the lac system, the trp system, the TAC or TRC system, the T3 and T7 promoters, the major operator and promoter region of bacteriophage lambda, the control region of the fd-encoded protein, the promoter of 3-phosphoglycerate kinase or other glycol lyases, the promoter of phosphatases (such as Pho5), the promoter of the yeast α-mating system, or other sequences known to control gene expression in prokaryotic or eukaryotic cells or viruses, and various combinations thereof. The T7 promoter can be used to express the proteins of the present disclosure in E. coli.

[0065] When a nucleic acid sequence is aligned with another nucleic acid sequence based on a functional relationship, it is "operably connected" to it. It can be one or more genes and one or more control sequences, which are connected in such a way that gene expression can be performed when a suitable molecule (e.g., a transcription activator protein) is connected to the one or more control sequences. For example, when expressed as a preprotein involved in the secretion of a polypeptide, the DNA of the presequence or secretory leader sequence is operably connected to the DNA of the polypeptide; and when a promoter or enhancer affects the transcription of the sequence, it is operably connected to the coding sequence; or when a ribosome binding site affects the transcription of the sequence, it is operably connected to the coding sequence; or when it is positioned to promote translation, the ribosome binding site is operably connected to the coding sequence. Generally, "operably connected" means that the connected DNA sequence is in contact with it, or means that the secretory leader sequence is in contact with it and is present in the reading frame. However, the enhancer does not need to be in contact with it. These sequences are connected by connection (ligation / linkage) at a convenient restriction enzyme site. When such sites are not present, synthetic oligonucleotide adapters or joints according to conventional methods are used.

[0066] As used herein, the term "expression vector" generally refers to a recombinant vector into which a heterologous DNA fragment is inserted, and generally means a double-stranded DNA fragment. Here, heterologous DNA refers to foreign DNA that does not naturally exist in the host cell. Once the expression vector is present in the host cell, it can replicate independently of the host chromosomal DNA, and several copies of the vector and its inserted (heterologous) DNA can be generated.

[0067] As is well known in the art, in order to increase the expression level of the transgene in the host cell, the gene should be operably linked to a transcription / translation expression control sequence that works in the selected expression host. Preferably, the expression control sequence and the corresponding gene are included in a recombinant vector containing a bacterial selection marker and an origin of replication. When the host cell is a eukaryotic cell, the recombinant vector should further include a useful expression marker in the eukaryotic expression host.

[0068] Host cells transfected or transformed by the above-mentioned recombinant vectors constitute another aspect of the present disclosure. As used herein, the term "transformation" means the introduction of DNA into a host and allows the DNA to replicate using extrachromosomal factors or chromosomal integration. As used herein, the term "transfection" means that an expression vector is accommodated by a host cell, regardless of whether any coding sequence is actually expressed.

[0069] It should be understood that not all vectors work the same when expressing the DNA sequence of the present disclosure. Similarly, for the same expression system, not all hosts work the same. However, any technician in the field can make appropriate selections from various vectors, expression control sequences and hosts without departing from the scope of the present disclosure or taking on too much experimental burden. For example, the vector should be selected in consideration of the host, because the vector should be replicated in the host. In addition, the copy number of the vector, the ability to adjust the copy number, and the expression of other proteins encoded by the corresponding vector (for example, the expression of antibiotic markers) should also be considered. Many factors should be considered to select the expression control sequence. For example, in particular with regard to possible secondary structures, the relative strength, controllability and compatibility of the sequence with the DNA sequence of the present disclosure should be considered. A unicellular host can be selected in consideration of factors such as the following: the toxicity of the selected vector, the product encoded by the DNA sequence of the present disclosure, the secretion characteristics, the ability to accurately fold proteins, the cultivation and fermentation factors, and the purification of the product encoded by the DNA sequence according to the present disclosure. Within the scope of these factors, a person skilled in the art can select various vector / expression control sequence / host combinations capable of expressing the DNA sequence of the present disclosure in fermentation or large animal culture. As screening methods for cloning cDNAs of proteins according to the present disclosure by expression cloning, binding methods, panning methods, membrane emulsion methods, etc. can be applied.

[0070] Hereinafter, the present disclosure will be described in more detail with reference to the following examples. However, it will be apparent to those skilled in the art that the following examples are provided only to illustrate the present disclosure and should not be construed as limiting the scope of the present disclosure.

[0071] In the following examples, Corynebacterium glutamicum is used as the host microorganism. However, it will be apparent to those skilled in the art that other types of Escherichia coli, bacterium, yeast and fungi can also be used. In addition, although only the gene derived from a specific strain as the gene introduced has been described in the following examples, it will be apparent to those skilled in the art that these genes are not limited, as long as they can be expressed in a host cell and show required activity.

[0072] Example 1: Construction of a recombinant Corynebacterium glutamicum capable of growing using glycerol as a single carbon source

[0073] 1-1: Construction of pCSglpFKD vector to construct glycerol decomposition pathway

[0074] It is known that cells of Corynebacterium glutamicum cannot grow using glycerol as a single carbon source. Therefore, in order to construct the glycerol decomposition pathway, the Corynebacterium glutamicum shuttle vector pCES208s-H36-S3 was first used to express genes encoding enzymes responsible for the glycerol decomposition pathway from Escherichia coli W3110.

[0075] The glpFK gene fragment encoding glycerol facilitator protein and glycerol kinase operon enzyme was obtained by PCR using chromosomal DNA of Escherichia coli W3110 (ATCC 39936) as a template and primers of SEQ ID NOs: 1 and 2, and the glpD gene fragment encoding glycerol-3-phosphate dehydrogenase was obtained by PCR using primers of SEQ ID NOs: 3 and 4. In order to connect the glpFK gene fragment (SEQ ID NO: 19) and the glpD gene fragment (SEQ ID NO: 20), overlapping PCR was performed using primers of SEQ ID Nos: 1 and 4 to obtain the glpFKD gene fragment. In order to linearize the pCES208s-H36-S3 vector (a vector obtained by replacing the Km antibiotic of the pCES208-H36 vector (Korean Patent Application Laid-Open No. 10-2013-0022691 or Yim S.S. et al., Biotechnol. Bioeng., 110: 2959, 2013) with spectinomycin antibiotic (SEQ ID NO: 21)), PCR was performed using primers of SEQ ID NOs: 5 and 6. The linearized vector was ligated with the constructed glpFKD gene fragment using the Gibson assembly method to construct the pCSglpFKD vector ( Figure 2 ).

[0076] [Table 1] Primers for constructing pCSglpFKD vector

[0077] SEQ ID NO Nucleotide sequence SEQ ID NO:1 5'-TTGGTTGGTAGGAGTAGCATGGGATCCATGAGTCAAACATCAACCTT-3' SEQ ID NO:2 5'-GTTTCCATCTATATCTCCTTTTTCGTCGTGTTCTTCCC-3' SEQ ID NO:3 5'-AAGGAGATATAGATGGAAACCAAAGATCTGAT-3'' SEQ ID NO:4 5'-TAATTATAATGGCCGGCTGGGCCTCTAGAGTTACGACGCCAGCGATAACC-3'' SEQ ID NO:5 5'-TCTAGAGGCCCAGCCGGCCATTATAATTAG-3' SEQ ID NO:6 5'-GGATCCCATGCTACTCCTACCAACCAAGGT-3'

[0078] 1-2: Construction of recombinant Corynebacterium glutamicum and enhancement of bacterial growth through glycerol degradation

[0079] A library of recombinant strains into which the glpFKD gene was introduced was constructed by introducing the pCSglpFKD vector constructed in Example 1-1 into the wild-type Corynebacterium glutamicum ATCC13032 strain, and flask culture was performed using glycerol as a carbon source to confirm that glycerol degradation resulted in cell growth.

[0080] First, the recombinant strain library into which the glpFKD gene was introduced was inoculated into a test tube containing 10 mL of BHIS medium (37 g / L brain heart infusion (BHI) and 91 g / L sorbitol) and pre-cultured at 30°C for 16 hours. Then, 1 mL of the pre-culture was inoculated and cultured in 25 mL of CGXII medium (Table 2) in a 250 mL baffled flask. The initial glycerol concentration of the medium was set to 10 g / L, 20 g / L, and 40 g / L, and the flask culture was performed in triplicate for 48 hours.

[0081] Results, such as Figure 3 As shown, all strains in the recombinant strain library have a very long lag phase. Among the strains cultivated with an initial glycerol concentration of 20 g / L, the WSG201 strain that showed the fastest cell growth was selected. In order to increase the glycerol uptake rate of the selected WSG201 strain, adaptive laboratory evolution (ALE) was performed.

[0082] like Figure 4 As shown, ALE was performed by inoculating and culturing 250 μL of preculture in 25 mL of CGXII medium in a 250 mL flask. ALE was performed for a total of eight generations starting from an initial glycerol concentration of 20 g / L, and an initial glycerol concentration of 40 g / L was used starting from the fifth generation.

[0083] Results, such as Figure 5 As shown, it can be confirmed that the very long lag phase of the strain when cultured in a glucose-containing medium is significantly reduced, and the cell growth of the strain is also increased. That is, from the results of ALE, it can be seen that when the initial glycerol concentration is 40 g / L, the lag phase of the transformed recombinant strain is significantly reduced, and its cell growth is significantly enhanced.

[0084] [Table 2] Composition of CGXII medium for culturing Corynebacterium glutamicum

[0085]

[0086]

[0087] Example 2: Analysis and optimization of 1,3-PDO production in recombinant Corynebacterium glutamicum when using glycerol as the sole carbon source

[0088] 2-1: Construction of pEK-dgyE, pEK-dgyK, pEK-dgdk, pEK-pduyE, pEK-pduyk and pEK-pdudk vectors To construct the 1,3-PDO biosynthetic metabolic pathway

[0089] In order to construct a 1,3-PDO biosynthetic metabolic pathway in the recombinant Corynebacterium glutamicum whose cells were confirmed to grow using glycerol as a single carbon source in Example 1-2, the Corynebacterium glutamicum pEKEx1 shuttle vector (Eikmanns et al., Gene 102:93, 1991; SEQ ID NO:22) was used to express exogenous enzymes derived from Klebsiella pneumoniae DSMZ2026 (KCTC 4952) and Escherichia coli W3110.

[0090] First, the dhaB1234 / gdrAB gene cluster fragment encoding glycerol dehydratase and glycerol reactivation enzyme was obtained by PCR using the chromosomal DNA of Klebsiella pneumoniae DSMZ2026 strain as a template and the primers of SEQ ID NOs:7 and 8. In addition, the pduCDEGH gene cluster fragment encoding another glycerol dehydratase and glycerol reactivation enzyme was obtained by PCR using the chromosomal DNA of Klebsiella pneumoniae DSMZ2026 strain as a template and the primers of SEQ ID NOs:9 and 10. In order to connect the obtained dhaB1234 / gdrAB gene fragment and the pduCDEGH gene fragment to the shuttle vector pEKEx1 vector respectively, the gene fragments were treated with restriction enzymes EcoRI and PstI, and then connected to the shuttle vector by Gibson assembly, thereby constructing pEK-dg vector ( Figure 6 ) and pEK-pdu vector ( Figure 7 ).

[0091] The pTac15kyqhD recombinant vector (a recombinant vector obtained by inserting yqhD from Escherichia coli W3110 into the pTac15k vector (p15A origin, tac promoter, Km R );SEQ ID NO:23) as a template and primers of SEQ ID NOs:11 and 12 were used to perform PCR to obtain the yqhD gene fragment encoding 1,3-PDO oxidoreductase, and the yqhD gene and dhaT gene fragments were obtained by using chromosomal DNA of Klebsiella pneumoniae DSMZ2026 strain as a template and primers of SEQ ID NOs:11 and 13 and primers of SEQ ID NOs:11 and 14 to perform PCR, respectively.

[0092] In order to connect the obtained gene fragments to the pEK-dg vector, the gene fragments were connected with restriction enzyme StuI and connected to the vector by Gibson assembly, thereby constructing pEK-dgyE vectors ( Figure 8 )、pEK-dgyK vector ( Fig. 9 ) and pEK-dgdK vector ( Fig.10 ).

[0093] The yqhD gene fragment encoding 1,3-PDO oxidoreductase was obtained by PCR using the pTac15kyqhD recombinant vector as a template and primers of SEQ ID NOs: 15 and 16, and the yqhD and dhaT gene fragments encoding another 1,3-PDO oxidoreductase were obtained by PCR using chromosomal DNA of Klebsiella pneumoniae DSMZ2026 strain as a template and primers of SEQ ID NOs: 15 and 17 and primers of SEQ ID NOs: 15 and 18, respectively.

[0094] In order to connect the obtained gene fragments to the pEK-pdu vector, the gene fragments were treated with restriction enzyme DraI and connected to the vector by Gibson assembly, thereby constructing pEK-pduyE vectors ( Fig.11 )、pEK-pduyK vector ( Fig.12 ) and pEK-pdudK vector ( Fig.13 ).

[0095] [Table 3] Primers for constructing a recombinant vector containing the 1,3-PDO biosynthetic metabolic pathway

[0096] SEQ ID NO Nucleotide sequence SEQ ID NO:7 5'-ACAATTTCACACAGGAAACAGAATTCATGAAAAGATCAAAAC-3' SEQ ID NO:8 5'-AAAACAGCCAAGCTTGGCTGCAGTCAGTTTCTCTCACTTAACG-3'' SEQ ID NO:9 5'-ACAATTTCACACAGGAAACAGAATTCATGAGATCGAAAAGATTTGAAG-3' SEQ ID NO:10 5'-AAAACAGCCAAGCTTGGCTGCAGTTAAGCATGGCGATCCCGAAATG-3′' SEQ ID NO:11 5'-TGGATGATGGGGCGATTCAGGTTGACAATTAATCATCGGCT-3' SEQ ID NO:12 5'-AAGGTGTTGCTGACTCATACCAGGTTAGCGGGCGGCTTCGTATA-3' SEQ ID NO:13 5'-AAGGTGTTGCTGACTCATACCAGGTTAGCGTGCAGCCTCGTAAA-3' SEQ ID NO:14 5'-AAGGTGTTGCTGACTCATACCAGGTCAGAATGCCTGGCGGAAAA-3' SEQ ID NO:15 5'-TTCCAATGATGAGCACTTTTTTGACAATTAAT-3' SEQ ID NO:16 5'-GCGCCACATAGCAGAACTTTTTAGCGGGCGGCTTCGTATATAC-3' SEQ ID NO:17 5'-GCGCCACATAGCAGAACTTTTTAGCGTGCAGCCTCGTAAATAC-3' SEQ ID NO:18 5'-GCGCCACATAGCAGAACTTTTCAGAATGCCTGGCGGAAAAT-3'

[0097] 2-2: Construction of mutant microorganisms that produce 1,3-PDO from glycerol

[0098] The six constructed recombinant vectors (pEK-dgyE, pEK-dgyK, pEK-dgdk, pEK-pduyE, pEK-pduyK and pEK-pdudK) were each introduced into the recombinant strain obtained in Example 1-2 (showing a significantly reduced lag phase and enhanced cell growth by ALE at an initial glycerol concentration of 40 g / L), and then selected in BHIS plate medium (37 g / L brain heart infusion (BHI), 91 g / L sorbitol and 15 g / L agar) supplemented with 25 μg / L kanamycin.

[0099] Each of the selected six recombinant strains was inoculated into a test tube containing 10 mL of BHIS medium (37 g / L brain heart infusion (BHI) and 91 g / L sorbitol) and pre-cultured at 30°C for 16 hours, and then 1 mL of each pre-culture was inoculated and cultured in 25 mL of CGXII medium in a 250 mL baffled flask. The initial glycerol concentration was set to 40 g / L, 10 g / L yeast extract was added to the medium, and the flask culture was performed in triplicate for 48 hours.

[0100] Results, such as Fig.14 As shown, it was confirmed that the recombinant strain into which the pEK-pduyE vector was introduced produced the highest amount of 1,3-PDO using glycerol as a single carbon source. The corresponding strain was named MBEL-HCC-C-13PDO1.

[0101] 2-3: Optimizing flask culture conditions to increase 1,3-PDO production

[0102] After confirming the 1,3-PDO production ability together with cell growth when glycerol was used as the sole carbon source in Example 2-2, flask culture conditions were optimized to enhance 1,3-PDO production.

[0103] Since the activation concentrations of glycerol dehydratase and 1,3-PDO oxidoreductase involved in the 1,3-PDO biosynthetic metabolic pathway are known to be sensitive (inversely proportional) to oxygen concentration, aeration conditions (including the type of flask and the type of lid for sealing the flask) were changed and flask culture was performed.

[0104] First, the MBEL-HCC-C-13PDO1 strain was inoculated into a test tube containing 10 mL of BHIS medium and precultured at 30°C for 16 hours, and then 1 mL of the preculture was inoculated and cultured in 25 mL of CGXII medium in a 250 mL baffled flask or a 250 mL conical flask. The initial glycerol concentration was set to 40 g / L, 10 g / L yeast extract was added to the medium, and the flask culture was performed in triplicate for 48 hours. In this case, baffled flasks and conical flasks with relatively low aeration were selected as the type of flask, and cotton caps and silicon plugs with relatively low aeration were selected as the type of lid.

[0105] Results, such as Fig.15 As shown, it was confirmed that the MBEL-HCC-C-13PDO1 strain produced the maximum amount of 1,3-PDO when using a conical flask and a cotton cap (slightly aerobic conditions). This result shows that the two enzymes involved in the 1,3-PDO biosynthetic metabolic pathway are affected by aeration conditions, and 1,3-PDO production increases under optimized aeration conditions.

[0106] 2-4: Mutant microorganisms producing 1,3-PDO by fed-batch fermentation

[0107] Using the flask type and aeration conditions established in Example 2-3, a fed-batch culture was performed to examine the 1,3-PDO production ability of the MBEL-HCC-C-13PDO1 strain.

[0108] First, the MBEL-HCC-C-13PDO1 strain was plated on a BHIS plate medium (37 g / L brain heart infusion (BHI), 91 g / L sorbitol, and 15 g / L agar) supplemented with kanamycin and spectinomycin, and cultured at 30°C for 48 hours. The formed colonies were inoculated into 50 mL of the BHIS medium in a 250 mL conical flask with a cotton cover selected in Example 2-3. Then, the colonies were pre-cultured at 30°C for 16 hours. The pre-culture was inoculated into 50 mL of CGXII medium in each of four 250 mL baffled flasks (OD at the start of culture). 600 =0.1) (fermenter seed) and cultured in a shaking incubator at 200 rpm and 30°C for 24 hours. Here, the initial glycerol concentration of the CGXII medium was set to 40 g / L, 10 g / L yeast extract was added to the medium, and MOPS was not included. Thereafter, a total of 200 mL of preculture was inoculated into 1.8 L of CGXII fermentation medium (a total volume of 6 L fermenter) (starting OD 600 =3.0 to 4.0), glycerol was added at an initial glycerol concentration of 40 g / L, 10 g / L yeast extract was added, and MOPS was not included. In addition, each of MgSO4-7H2O, biotin, thiamine, protocatechuic acid, kanamycin and spectinomycin was added after filtration. In addition, 1 mM IPTG was added in the first feed at the end of the batch cycle.

[0109] During the batch fed fermentation culture, the pH was maintained at 7.0 using aqueous ammonia (28%, Junsei Chemical Co., Ltd., Tokyo, Japan), and the temperature and stirring speed were maintained at 30°C and 600 rpm, respectively, in PID (proportional-integral-differential) mode. The aeration rate was maintained at 0.25 vvm, and the bubbles generated during the culture were treated with defoamer 204 (Sigma-Aldrich). The feed solution consisted of 800 g / L glycerol, and 100 mL of the feed solution was added when the residual glycerol concentration dropped to 10 g / L.

[0110] Results, such as Fig.16As shown, when the MBEL-HCC-C-13PDO1 strain was cultured in a fed-batch fermentation, about 47.3 g / L of 1,3-PDO was produced using glycerol as a single carbon source. Therefore, it was confirmed that the MBEL-HCC-C-13PDO1 strain having the constructed glycerol decomposition metabolic pathway and 1,3-PDO biosynthesis metabolic pathway was able to produce 1,3-PDO while the cells were growing.

[0111] Example 3: Increasing the production of 1,3-PDO in recombinant Corynebacterium glutamicum by using glycerol and glucose as carbon sources

[0112] 3-1: Increasing 1,3-PDO production in Corynebacterium glutamicum by optimizing the glycerol / glucose ratio

[0113] As can be seen from the results of the fed-batch fermentation culture performed in Example 2-4, the MBEL-HCC-C-13PDO1 strain produced the highest amount of 1,3-PDO while growing using glycerol as a single carbon source. However, it was shown that under the above conditions, 3-HP was produced as a byproduct in an amount similar to that of 1,3-PDO.

[0114] Considering the redox balance, when the enzymes involved in the 1,3-PDO biosynthetic metabolic pathway and the 3-HP biosynthetic metabolic pathway use NADPH as a cofactor, it was determined that the aldehyde dehydrogenase present in Corynebacterium glutamicum activates the 3-HP biosynthetic metabolic pathway to supply the reducing power NADPH required for 1,3-PDO production ( Figure 1 ). Therefore, it was determined that when glycerol was used as the sole carbon source, the pentose phosphate metabolic pathway could not be used, and thus the 3-HP biosynthetic metabolic pathway was further activated to increase the supply of NADPH ( Figure 1 ).

[0115] Since it is known that Corynebacterium glutamicum supplies about 70% of NADPH through the pentose phosphate metabolic pathway, a comparative experiment of flask culture was performed in order to examine whether the addition of glucose increases the production of 1,3-PDO.

[0116] First, the MBEL-HCC-C-13PDO1 strain was inoculated into a tube containing 10 mL of BHIS medium and pre-cultured at 30°C for 16 hours, and then 1 mL of the pre-culture was inoculated and cultured in 25 mL of CGXII in a 250 mL conical flask. Glucose and glycerol were added at initial weight ratios of 1:1, 1:3, 1:9, and 1:19, 10 g / L yeast extract was added to the medium, and flask culture was performed in triplicate for 48 hours.

[0117] Results, such as Fig.17As shown, it was confirmed that when glucose and glycerol were used at a weight ratio of 1:3, the strain had the highest 3-PDO production and no 3-HP was produced. In addition, it was confirmed that as the ratio of glycerol to glucose increased (as the amount of glucose decreased), 3-HP production increased, and as the ratio of glycerol to glucose decreased (as the amount of glucose increased), 3-HP production decreased. That is, these results indicate that when the MBEL-HCC-C-13PDO1 strain uses glycerol as a single carbon source, the reducing power required for 1,3-PDO production is supplied by activating the 3-HP biosynthesis metabolic pathway, and a specific ratio of glycerol to glucose is effective for increasing the production of 1,3-PDO.

[0118] 3-2: Production of 1,3-PDO by fed-batch fermentation when glucose and glycerol were added at a ratio of 1:3 Mutant microorganisms

[0119] Using the glucose / glycerol weight ratio selected in Example 3-1, fed-batch culture was performed to examine the 1,3-PDO-producing ability of the MBEL-HCC-C-13PDO1 strain.

[0120] First, the MBEL-HCC-C-13PDO1 strain was plated on a BHIS plate medium supplemented with kanamycin and spectinomycin and cultured at 30°C for 48 hours. The formed colonies were inoculated into 50 mL of BHIS medium in a 250 mL conical flask with a cotton cover selected in Example 2-3. Then, the colonies were pre-cultured at 30°C for 16 hours. The pre-culture was inoculated into 50 mL of CGXII medium in each of four 250 mL baffled flasks (OD at the start of culture). 600 =0.1) (fermenter seed) and cultured in a shaking incubator at 200 rpm and 30°C for 24 hours. Here, the initial glycerol concentration of the CGXII medium was set to 40 g / L, 10 g / L yeast extract was added to the medium, and MOPS was not included. Thereafter, a total of 200 mL of preculture was inoculated into 1.8 L of CGXII fermentation medium (a total volume of 6 L fermenter) (starting OD 600 =3.0 to 4.0), glycerol was added at an initial glycerol concentration of 40 g / L, 10 g / L yeast extract was added, and MOPS was not included. In addition, each of MgSO4-7H2O, biotin, thiamine, protocatechuic acid, kanamycin and spectinomycin was added after filtration. In addition, 1 mM IPTG was added in the first feed at the end of the batch cycle.

[0121] During the batch fed fermentation culture, the pH was maintained at 7.0 using aqueous ammonia (28%, Junsei Chemical Co., Ltd., Tokyo, Japan), and the temperature and stirring speed were maintained at 30°C and 600 rpm, respectively, in PID (proportional-integral-differential) mode. The aeration rate was maintained at 0.25 vvm, and the bubbles generated during the culture were treated with defoamer 204 (Sigma-Aldrich). As feed solutions, 800 g / L of glycerol solution and 800 g / L of glucose solution were prepared, and when the residual glycerol concentration was reduced to 10 g / L, 50 mL of each solution was added.

[0122] Results, such as Fig.18 As shown, it was confirmed that when the MBEL-HCC-C-13PDO1 strain was subjected to fed-batch fermentation culture using glucose and glycerol added at a weight ratio of 1:3, about 60.1 g / L of 1,3-PDO was produced. That is, it was confirmed that when glucose and glycerol were added at a weight ratio of 1:3, the MBEL-HCC-C-13PDO1 strain produced 1,3-PDO more efficiently while the cells were growing.

[0123] 3-3: Production of 1,3-PDO by fed-batch fermentation when glucose and glycerol were added at a ratio of 1:2 Mutant microorganisms

[0124] In Example 3-2, after adding glucose and glycerol at a weight ratio of 1:3, the 1,3-PDO production ability of the MBEL-HCC-C-13PDO1 strain was confirmed by batch feeding culture. However, it was confirmed that a large amount of 3-HP was still produced as a byproduct. In order to apply the finding that 3-HP production decreases as the amount of glucose increases, as shown in Example 3-1, MBEL-HCC-C-13PDO1 was fed-batch fermentation culture using glucose and glycerol added at a weight ratio of 1:2.

[0125] Batch feeding culture was carried out in the same manner as in Example 3-2. As feed solutions, 800 g / L glycerol solution, 800 g / L glucose solution, 200 g / L MgSO4-7H2O solution and 200X TMS solution were prepared, and when the residual glycerol concentration was reduced to 10 g / L, the solution was added in an amount of 50 mL, 100 mL, 5 mL and 5 mL, respectively. The composition of the TMS solution used here is shown in Table 4 below.

[0126] [Table 4] Components of 200x TMS solution

[0127] Composition of TMS solution Concentration (200x) <![CDATA[CaCl2·2H2O]]> 2,6g / L <h2 style=";text-align:left;direction:ltr"><![CDATA[FeSO <h2 style=";text-align:left;direction:ltr"> 40 <h2 style=";text-align:left;direction:ltr"> 7H2O]]><h2 style=";text-align:left;direction:ltr"> 2.0g / L <![CDATA[MnSO4·5H2O]]> 2.8g / L <![CDATA[ZnSO4·7H2O]]> 0.2g / L <![CDATA[CuSO4·5H2O]]> 0.06g / L <![CDATA[NiCl2·6H2O]]> 4mg / L

[0128] Results, such as Fig.19As shown, it was confirmed that when the MBEL-HCC-C-13PDO1 strain was subjected to batch feeding culture using glucose and glycerol added at a weight ratio of 1:2, about 77.5 g / L of 1,3-PDO was produced. In addition, it was confirmed that 3-HP production was greatly reduced to about 7.2 g / L. That is, it was confirmed that when glucose and glycerol were added at a weight ratio of 1:2, the MBEL-HCC-C-13PDO1 strain produced 1,3-PDO more efficiently while the cells were growing.

[0129] Industrial Applicability

[0130] According to the present disclosure, 1,3-PDO can be produced while growing a mutant microorganism having 1,3-PDO production ability using glycerol, an inexpensive raw material, as a single carbon source. Therefore, the present disclosure is useful for economically producing 1,3-PDO.

[0131] Although the present disclosure has been described in detail with reference to specific features, it will be clear to those skilled in the art that this description is only a description of its preferred embodiments and does not limit the scope of the present disclosure. Therefore, the essential scope of the present disclosure will be defined by the appended claims and their equivalents.

[0132] Sequence Listing Free Text

[0133] Electronic files are attached. <110> KAIST Hanwha Solutions <120> Mutant microorganism capable of producing 1,3-propylene glycol and method for preparing 1,3-propylene glycol using the same <130> PP-B2130 <150> KR 10-2018-0005451 <151> 2018-01-16 <160> twenty three <170> KopatentIn 2.0 <210> 1 <211> 47 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 1 ttggttggta ggagtagcat gggatccatg agtcaaacat caacctt 47 <210> 2 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 2 gtttccatct atatctcctt ttattcgtcg tgttcttccc 40 <210> 3 <211> 32 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 3 aaggagatat agatggaaac caaagatctg at 32 <210> 4 <211> 50 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 4 taattataat ggccggctgg gcctctagag ttacgacgcc agcgataacc 50 <210> 5 <211> 30 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 5 tctagaggcc cagccggcca ttataattag 30 <210> 6 <211> 30 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 6 ggatcccatgctactcctaccaaccaaggt 30 <210> 7 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 7 acaatttcac acaggaaaca gaattcatga aaagatcaaa ac 42 <210> 8 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 8 aaaacagcca agcttggctg cagtcagttt ctctcactta acg 43 <210> 9 <211> 48 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 9 acaatttcac acaggaaaca gaattcatga gatcgaaaag atttgaag 48 <210> 10 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 10 aaaacagcca agcttggctg cagttaagca tggcgatccc gaaatg 46 <210> 11 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 11 tggatgatgg ggcgattcag gttgacaatt aatcatcggc t 41 <210> 12 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 12 aaggtgttgc tgactcatac caggttagcg ggcggcttcg tata 44 <210> 13 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 13 aaggtgttgc tgactcatac caggttagcg tgcagcctcg taaa 44 <210> 14 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 14 aaggtgttgc tgactcatac caggtcagaa tgcctggcgg aaaa 44 <210> 15 <211> 32 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 15 ttccaatgat gagcactttt ttgacaatta at 32 <210> 16 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 16 gcgccacata gcagaacttt ttagcgggcg gcttcgtata tac 43 <210> 17 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 17 gcgccacata gcagaacttt ttagcgtgca gcctcgtaaa tac 43 <210> 18 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 18 gcgccacata gcagaacttt tcagaatgcc tggcggaaaa t 41 <210> 19 <211> 2405 <212> DNA <213> glpFK gene from E. coli W3110 <400> 19 atgagtcaaa catcaacctt gaaaggccag tgcattgctg aattcctcgg taccgggttg 60 ttgattttct tcggtgtggg ttgcgttgca gcactaaaag tcgctggtgc gtcttttggt 120 cagtgggaaa tcagtgtcat ttggggactg ggggtggcaa tggccatcta cctgaccgca 180 ggggtttccg gcgcgcatct taatcccgct gttaccattg cattgtggct gtttgcctgt 240 ttcgacaagc gcaaagttat tccttttatc gtttcacaag ttgccggcgc tttctgtgct 300 gcggctttag tttacgggct ttactacaat ttatttcg acttcgagca gactcatcac 360 attgttcgcg gcagcgttga aagtgttgat ctggctggca ctttctctac ttaccctaat 420 cctcatatca atttgtgca ggctttcgca gttgagatgg tgattaccgc tattctgatg 480 gggctgatcc tggcgttaac ggacgatggc aacggtgtac cacgcggccc ttggctccc 540 ttgctgattg gtctactgat tgcggtcatt ggcgcatcta tgggcccatt gacaggtttt 600 gccatgaacc cagcgcgtga cttcggtccg aaagtctttg cctggctggc gggctggggc 660 aatgcgcct ttaccggcgg cagagacatt cttacttcc tggtgccgct ttcggccct 720 atcgttggcg cgattgtagg tgcatttgcc taccgcaaac tgattggtcg ccatttgcct 780 tgcgatatct gtgttgtgga agaaaaggaa accacaactc cttcagaaca aaaagcttcg 840 ctgtaatatg actacgggac aattaaacat gactgaaaaa aaatatatcg ttgcgcatga 900 ctgaaaaaaa atatatcgtt gcgctcgacc agggcaccac cagctcccgc gcggtcgtaa 960 tggatcacga tgccaatatc attagcgtgt cgcagcgcga atttgagcaa atctacccaa 1020 aaccaggttg ggtagaacac gacccaatgg aaatctgggc cacccaaagc tccacgctgg 1080 tagaagtgct ggcgaaagcc gatatcagtt ccgatcaaat tgcagctatc ggtattacga 1140 accagcgtga aaccactatt gtctgggaaa aagaaaccgg caagccttatc tataacgcca 1200 ttgtctggca gtgccgtcgt accgcagaaa tctgcgagca tttaaaacgt gacggtttag 1260 aagattatat ccgcagcaat accggtctgg tgattgaccc gtacttttct ggcaccaaag 1320 tgaagtggat cctcgaccat gtggaaggct ctcgcgagcg tgcacgtcgt ggtgaattgc 1380 tgtttggtac ggttgatacg tggcttatct ggaaaatgac tcagggccgt gtccatgtga 1440 ccgattacac caacgcctct cgtaccatgt tgttcaacat ccataccctg gactgggacg 1500 acaaaatgct ggaagtgctg gatatccgc gcgagatgct gccagaagtg cgtcgttctt 1560 ccgaagtata cggtcagact aacattggcg gcaaaggcgg cacgcgtatt ccaatctccg 1620 ggatcgccgg tgaccagcag gccgcgctgt ttggtcagtt gtgcgtgaaa gaagggatgg 1680 cgaagaacac ctatggcact ggctgcttta tgctgatgaa cactggcgag aaagcggtga 1740 aatcagaaaa cggcctgctg accaccatcg cctgcggccc gactggcgaa gtgaactatg 1800 cgttggaagg tgcggtgttt atggcaggcg catccattca gtggctgcgc gatgaatga 1860 agttgattaa cgacgcctac gattccgaat atttcgccac caaagtgcaa aacaccaatg 1920 gtgtgtatgt ggttccggca tttaccgggc tgggtgcgcc gtactgggac ccgtatgcgc 1980 gcggggcgat tttcggtctg actcgtgggg tgaacgctaa ccacattata cgcgcgacgc 2040 tggagtctat tgcttatcag acgcgtgacg tgctggaagc gatgcaggcc gactctggta 2100 tccgtctgca cgccctgcgc gtggatggtg gcgcagtagc aaacaatttc ctgatgcagt 2160 tccagtccga tattctcggc acccgcgttg agcgccccgga agtgcggaa gtcaccgcat 2220 tgggtgcggc ctatctcgca ggcctggcgg ttggcttctg gcagaacctc gacgagctgc 2280 aagaagaagc ggtgattgag cgcgagttcc gtccaggcat cgaaaccact gagcgtaatt 2340 accgttacgc aggctggaaa aaagcggtta aacgcgcgat ggcgtgggaa gaacacgacg 2400 aataa 2405 <210> 20 <211> 2405 <212> DNA <213> glpD gene of E.coli W3110 <400> 20 atgagtcaaa catcaacctt gaaaggccag tgcattgctg aattcctcgg taccgggttg 60 ttgattttct tcggtgtggg ttgcgttgca gcactaaaag tcgctggtgc gtcttttggt 120 cagtgggaaa tcagtgtcat ttggggactg ggggtggcaa tggccatcta cctgaccgca 180 ggggtttccg gcgcgcatct taatcccgct gttaccattg cattgtggct gtttgcctgt 240 ttcgacaagc gcaaagttat tccttttatc gtttcacaag ttgccggcgc tttctgtgct 300 gcggctttag tttacgggct ttactacaat ttatttttcg acttcgagca gactcatcac 360 attgttcgcg gcagcgttga aagtgttgat ctggctggca ctttctctac ttaccctaat 420 cctcatatca attttgtgca ggctttcgca gttgagatgg tgattaccgc tattctgatg 480 gggctgatcc tggcgttaac ggacgatggc aacggtgtac cacgcggccc tttggctccc 540 ttgctgattg gtctactgat tgcggtcatt ggcgcatcta tgggcccatt gacaggtttt 600 gccatgaacc cagcgcgtga cttcggtccg aaagtctttg cctggctggc gggctggggc 660 aatgcgcct ttaccggcgg cagagacatt cttacttcc tggtgccgct ttcggccct 720 atcgttggcg cgattgtagg tgcatttgcc taccgcaaac tgattggtcg ccatttgcct 780 tgcgatatct gtgttgtgga agaaaaggaa accacaactc cttcagaaca aaaagcttcg 840 ctgtaatatg actacgggac aattaaacat gactgaaaaa aaatatatcg ttgcgcatga 900 ctgaaaaaaa atatatcgtt gcgctcgacc agggcaccac cagctcccgc gcggtcgtaa 960 tggatcacga tgccaatatc attagcgtgt cgcagcgcga atttgagcaa atctacccaa 1020 aaccaggttg ggtagaacac gacccaatg aaatctgggc cacccaaagc tccacgctgg 1080 tagaagtgct ggcgaaagcc gatatcagtt ccgatcaaat tgcagctatc ggtattacga 1140 accagcgtga aaccactatt gtctgggaaa aagaaaccgg caagcctatc tataacgcca 1200 ttgtctggca gtgccgtcgt accgcagaaa tctgcgagca tttaaaacgt gacggtttag 1260 aagattatat ccgcagcaat accggtctgg tgattgaccc gtactttctct ggcaccaaag 1320 tgaagtggat cctcgaccat gtggaaggct ctcgcgagcg tgcacgtcgt ggtgaattgc 1380 tgtttggtac ggttgatacg tggcttatct ggaaaatgac tcagggccgt gtccatgtga 1440 ccgattacac caacgcctct cgtaccatgt tgttcaacat ccataccctg gactgggacg 1500 acaaaatgct ggaagtgctg gatattccgc gcgagatgct gccagaagtg cgtcgttctt 1560 ccgaagtata cggtcagact aacattggcg gcaaaggcgg cacgcgtatt ccaatctccg 1620 ggatcgccgg tgaccagcag gccgcgctgt ttggtcagtt gtgcgtgaaa gaagggatgg 1680 cgaagaacac ctatggcact ggctgcttta tgctgatgaa cactggcgag aaagcggtga 1740 aatcagaaaa cggcctgctg accaccatcg cctgcggccc gactggcgaa gtgaactatg 1800 cgttggaagg tgcggtgttt atggcaggcg catccattca gtggctgcgc gatgaaatga 1860 agttgattaa cgacgcctac gattccgaat atttcgccac caaagtgcaa aacaccaatg 1920 gtgtgtatgt ggttccggca tttaccgggc tgggtgcgcc gtactgggac ccgtatgcgc 1980 gcggggcgat tttcggtctg actcgtgggg tgaacgctaa ccacattata cgcgcgacgc 2040 tggagtctat tgcttatcag acgcgtgacg tgctggaagc gatgcaggcc gactctggta 2100 tccgtctgca cgccctgcgc gtggatggtg gcgcagtagc aaacaatttc ctgatgcagt 2160 tccagtccga tattctcggc acccgcgttg agcgcccgga agtgcgcgaa gtcaccgcat 2220 tgggtgcggc ctatctcgca ggcctggcgg ttggcttctg gcagaacctc gacgagctgc 2280 aagagaaagc ggtgattgag cgcgagttcc gtccaggcat cgaaaccact gagcgtaatt 2340 accgttacgc aggctggaaa aaagcggtta aacgcgcgat ggcgtgggaa gaacacgacg 2400 aataa 2405 <210> 21 <211> 6538 <212> DNA <213> Artificial sequence <220> <223> pCES208S-H36-S3 <400> 21 gatctttggg agcagtcctt gtgcgcttac gaggtgagcc ggtggggaac cgttatctgc 60 ctatggtgtg agccccccta gagagcttca agagcaatca gcccgaccta gaaaggaggc 120 caagagagag acccctacgg ggggaaccgt tttctgccta cgagatggca catttactgg 180 gaagctttac ggcgtcctcg tggaagttca atgcccgcag acttaagtgc tctattcacg 240 gtctgacgtg acacgctaaa ttcagacata gcttcattga ttgtcgccac gagccagtct 300 ctccctcaac agtcataaac caacctgcaa tggtcaagcg atttccttta gctttcctag 360 cttgtcgttg actggactta gctagttttt ctcgctgtgc tcgggcgtac tcactgtttg 420 ggtctttcca gcgttctgcg gcctttttac cgccacgtct tcccatagtg gccagagctt 480 ttcgccctcg gctgctctgc gtctctgtct gacgagcagg gacgactggc tggcctttag 540 cgacgtagcc gcgcacacgt cgcgccatcg tctggcggtc acgcatcggc ggcagatcag 600 gctcacggcc gtctgctccg accgcctgag cgacggtgta ggcacgctcg taggcgtcga 660 tgatcttggt gtcttttagg cgctcaccag ccgcttttaa ctggtatccc acagtcaaag 720 cgtggcgaaa agccgtctca tcacgggcgg cacgccctgg agcagtccag aggacacgga 780 cgccgtcgat cagctctcca gacgcttcag cggcgctcgg caggcttgct tcaagcgtgg 840 caagtgcttt tgcttccgca gtggcttttc ttgccgcttc gatacgtgcc cgtccgctag 900 aaaactcctg ctcatagcgt tttttaggtt tttctgtgcc tgagatcatg cgagcaacct 960 ccataagatc agctaggcga tccacgcgat tgtgctgggc atgccagcgg tacgcggtgg 1020 gatcgtcgga gacgtgcagt ggccaccggc tcagcctatg tgaaaaagcc tggtcagcgc 1080 cgaaaacgcg ggtcatttcc tcggtcgttg cagccagcag gcgcatattc gggctgctca 1140 tgcctgctgc ggcatacacc ggatcaatga gccagatgag ctggcatttc ccgctcagtg 1200 gattcacgcc gatccaagct ggcgcttttt ccaggcgtgc ccagcgctcc aaaatcgcgt 1260 agacctcggg gtttacgtgc tcgattttcc cgccggcctg gtggctcggc acatcaatgt 1320 ccaggacaag cacggctgcg tgctgcgcgt gcgtcagagc aacatactgg caccgggcaa 1380 gcgattttga accaactcgg tataacttcg gctgtgtttc tcccgtgtcc gggtctttga 1440 tccaagcgct ggcgaagtcg cgggtcttgc tgccctggaa attttctctg cccaggtgag 1500 cgaggaattc gcggcggtct tcgctcgtcc agccacgtga tcgcagcgcg agctcgggat 1560 gggtgtcgaa cagatcagcg gaaaatttcc aggccggtgt gtcaatgtct cgtgaatccg 1620 ctagagtcat ttttgagcgc tttctcccag gtttggactg ggggttagcc gacgccctgt 1680 gagttaccgc tcacggggcg ttcaacattt ttcaggtatt cgtgcagctt atcgcttctt 1740 gccgcctgtg cgctttttcg acgcgcgacg ctgctgccga ttcggtgcag gtggtggcgg 1800 cgctgacacg tcctgggcgg ccacggccac acgaaacgcg gcatttacga tgtttgtcat 1860 gcctgcgggc accgcgccac gatcgcggat aattctcgct gccgcttcca gctctgtgac 1920 gaccatggcc aaaatttcgc tcgggggacg cacttccagc gccatttgcg acctagccgc 1980 ctccagctcc tcggcgtggc gtttgttggc gcgctcgcgg ctggctgcgg cacgacacgc 2040 atctgagcaa tattttgcgc gccgtcctcg cgggtcaggc cggggaggaa tcaggccacc 2100 gcagtaggcg caactgattc gatcctccac tactgtgcgt cctcctggcg ctgccgagca 2160 cgcagctcgt cagccagctc ctcaagatcc gccacgagag tttctaggtc gctcgcggca 2220 ctggcccagt ctcgtgatgc tggcgcgtcc gtcgtatcga gagctcggaa aaatccgatc 2280 accgttttta aatcgacggc agcatcgagc gcgtcggact ccagcgcgac atcagagaga 2340 tccatagctg atgattcggg ccaattttgg tacttcgtcg tgaaggtcat gacaccatta 2400 taacgaacgt tcgttaaagt ttttggcgga aaatcacgcg gcacgaaaat tttcacgaag 2460 cgggactttg cgcagctcag gggtgctaaa aattttgtat cgcacttgat ttttccgaaa 2520 gacagattat ctgcaaacgg tgtgtcgtat ttctggcttg gtttttaaaa aatctggaat 2580 cgaaaatttg cggggcgacc gagaagtttt ttacaaaagg caaaaacttt ttcgggatcg 2640 acagaaataa aacgatcgac ggtacgcaac aaaaaagcgt caggatcgcc gtagagcgat 2700 tgaagaccgt caaccaaagg ggaagcctcc aatcgacgcg acgcgcgctc tacggcgatc 2760 ctgacgcaga tttttagcta tctgtcgcag cgccctcagg gacaagccac ccgcacaacg 2820 tcgcgagggc gatcagcgac gccgcagtac tgatcctccg gcgttcagcc tgtgccacag 2880 ccgacaggat ggtgaccgcg caattaaccc tcactaaagg gaacaaaagc tgggtaccgg 2940 gccccccctc gaggtcgacg gtacctctat ctggtgccct aaacggggga atattaacgg 3000 gcccagggtg gtcgcacctt ggttggtagg agtagcatgg gatcctctag aggcccagcc 3060 ggccattata attaggcctc gggggccgcg gccgctgcct ggcggcagta gcgcggtggt 3120 cccacctgac cccatgccga actcagaagt gaacgccgt agcgccgatg gtagtgtggg 3180 gtctccccat gcgagagtag ggaactgcca ggcatcaaat aaaacgaaag gctcagtcga 3240 aagactgggc ctttcgtttt atctgttgtt tgtcggtgaa cgctctcctg agtaggacaa 3300 atccgccggg agcggatttg aacgttgcga agcaacggcc cggagggtgg cgggcaggac 3360 gcccgccata aactgccagg catcaaatta agcagaaggc catcctgacg gatggccttt 3420 tgccaccgcg gtggagctcc aattcgccct atagtgagtc gtattacgcg cggtgaccac 3480 catttgcccc atatcaccgt cggtactgat cccgtcgtca ataaaccgaa ccgctacacc 3540 ctgagcatca aactctttta tcagttggat catgtcggcg gtgtcgcggc caagacggtc 3600 gagcttcttc accagaatga catcaccttc ctccacctt atcctcagca aatccagccc 3660 ttcccgatct gttgaactgc cggatgcctt gtcggtaaag atgcggttag cttttacccc 3720 tgcatctttg agcgctgagg tctgcctcgt gaagaaggtg ttgctgactc ataccaggcc 3780 tgaatcgccc catcatccag ccagaaagtg agggagccac ggttgatgag agctttgttg 3840 taggtggacc agttggtgat tttgaacttt tgctttgcca cggaacggtc tgcgttgtcg ggaagatgcg tgatctgatc cttcaactca gcaaaagttc gatttattca acaaagccgc cgtcccgtca agtcagcgta atgctctgcc agtgttacaa ccattcaaat atgtatccgc 4080. tgagcaata ctagcataac cccttggggc ctctaaacgg gtcttgaggg gttttttgct gaaacctcag gcatttgaga agcacacggt cacactgctt ccggtagtca ataaaccggt aaaccagcaa tagacatag cggctattta acgaccctgc cctgaaccga cgaccgggtc atcgtggccg gatcttgcgg cccctcggct tgaacgaatt gttagacatt atttgccgac 4260. taccttggtg atctcgcctt tcacgtagtg gacaaattct tccaactgat ctgcgcgcga ggccaagcga tcttcttctt gtccaagata agcctgtcta gcttcaagta tgacgggctg 4380. atactgggcc ggcaggcgct ccattgccca gtcggcagcg acatccttcg gcgcgatttt gccggttact gcgctgtacc aaatgcgggga caacgtaagc actacatttc gctcatcgcc agcccagtcg ggcggcgagt tccatagcgt taaggtttca tttagcgcct caaatagatc 4560. ctgttcagga accggatcaa agagttcctc cgccgctgga cctaccaagg caacgctatg 4620 ttctcttgct tttgtcagca agatagccag atcaatgtcg atcgtggctg gctcgaagat 4680 acctgcaaga atgtcattgc gctgccattc tccaaattgc agttcgcgct tagctggata 4740 acgccacgga atgatgtcgt cgtgcacaac aatggtgact tctacagcgc ggagaatctc 4800 gctctctcca ggggaagccg aagtttccaa aaggtcgttg atcaaagctc gccgcgttgt 4860 ttcatcaagc cttacggtca ccgtaaccag caaatcaata tcactgtgtg gcttcaggcc 4920 gccatccact gcggagccgt acaaatgtac ggccagcaac gtcggttcga gatggcgctc 4980 gatgacgcca actacctctg atagttgagt cgatacttcg gcgatcaccg cttccctcat 5040 actcttcctt tttcaatatt attgaagcat ttatcagggt tattgtctca tgagcggata 5100 catatttgaa tgtatttaga aaaataaaca aatagctagc tcactcggtc ggagtgtata 5160 ctggcttact atggctgagt tgaaggatca gatcacgcat cttcccgaca acgcagaccg 5220 ttccgtggca aagcaaaagt tcaaaatcac caactggtcc acctacaaca aagctctcat 5280 caaccgtggc tccctcactt tctggctgga tgatggggcg attcaggcct ggtatgagtc 5340 agcaacacct tcttcacgag gcagacctca gcgctagcgg agtgtatact ggcttactat 5400 gttggcactg atgagggtgt cagtgaagtg cttcatgtgg caggagaaaa aaggctgcac 5460 cggtgcgtca gcagaatatg tgatacagga tatattccgc ttcctcgctc actgactcgc 5520 tacgctcggt cgtcgactg cggcgagcgg aaatggctta cgaacggggc ggagatttcc 5580 tggaagatgc caggaagata cttaacaggg aagtgagagg gccgcggcaa agccgttttt 5640 ccataggctc cgcccccctg acaagcatca cgaaatctga cgctcaaatc agtggtggcg 5700 aaacccgaca ggactataaa gataccaggc gtttccccct ggcggctccc tcgtgcgctc 5760 tcctgttcct gccttcggt ttaccggtgt cattccgctg ttatggccgc gttgtctca 5820 ttccacgcct gacactcagt tccgggtagg cagttcgctc caagctggac tgtatgcacg 5880 aaccccccgt tcagtccgac cgctgcgcct tatccggtaa ctatcgtctt gagtccaacc 5940 cggaaagaca tgcaaaagca ccactggcag cagccactgg taattgattt agaggagtta 6000 gtcttgaagt catgcgccgg ttaaggctaa actgaaagga caagttttgg tgactgcgct 6060 cctccaagcc agttacctcg gttcaaagag ttggtagctc agagaacctt cgaaaaaccg 6120 ccctgcaagg cggttttttc gttttcagag caagagatta cgcgcagacc aaaacgatct 6180 caagaagatc atcttattaa ggggtctgac gctcagtgga acgaaaactc acgttaaggg 6240 attttggtca tgagattatc aaaaaggatc ttcacctaga tccttttaaa ttaaaaatga 6300 agttttaaat caatctaaag tatatatgag taaacttggt ctgacagtta ccaatgctta 6360 atcagtgagg cacctatctc agcgatctgt ctatttcgtt catccatagt tgcctgactc 6420 cccgtcgtgt agataactac gatacgggag ggcttaccat ctggccccag tgctgcaatg 6480 ataccgcgag acccacgctc accggctcca gatttatcag caataaacca gccagccg 6538 <210> 22 <211> 8084 <212> DNA <213> Artificial Sequence <220> <223> pEKEX1 <400> 22 ccaagcttgg ctgttttggc ggatgagaga agattttcag cctgatacag attaaatcag 60 aacgcagaag cggtctgata aaacagaatt tgcctggcgg cagtagcgcg gtggtcccac 120 ctgaccccat gccgaactca gaagtgaaac gccgtagcgc cgatggtagt gtggggtctc 180 cccatgcgag agtagggaac tgccaggcat caaataaaac gaaaggctca gtcgaaagac 240 tgggccttc gtttatctg ttgtttgtcg gtgaacgctc tcctgagtag gacaaatccg 300 ccgggagcgg atttgaacgt tgcgaagcaa cggcccggag ggtggcggc aggacgcccg 360 ccataaactg ccaggcatca aattaagcag aaggccatcc tgacggatgg cctttttgcg 420 tttctacaaa ctcttttgtt tatttttcta aatacattca aatatgtatc cgctcatgag 480 acaataaccc tgataaatgc ttcaataata ttgaaaaagg aagagtatga gtattcaaca 540 tttccgtgtc gcccttattc ccttttttgc ggcattttgc cttcctgttt ttgctcaccc 600 agaaacgctg gtgaaagtaa aagatgctga agatcagttg ggtgcacgag tgggttacat 660 cgaactggat ctcaacagcg gtaagatcct tgagagtttt cgccccgaag aacgttttcc 720 aatgatgagc acttttaaag ttctgctatg tggcgcggta ttatcccgtg ttgacgccgg 780 gcaagagcaa ctcggtcgcc gcatacacta ttctcagaat gacttggttg agtaattcgt 840 aatcatgtca tagctgtttc ctgtgtgaaa ttgttatccg ctcacaattc cacacaacat 900 acgagccgga agcataaagt gtaaagcctg gggtgcctaa tgagtgagct aactcacatt 960 aattgcgttg cgctcactgc ccgctttcca gtcgggaaac ctgtcgtgcc agctgcatta 1020 atgaatcggc caacgcgcgg ggagaggcgg tttgcgtatt gggcgctctt ccgcttcctc 1080 gctcactgac tcgctgcgct cggtcgttcg gctgcggcga gcggtatcag ctcactcaaa 1140 ggcggtaata cggttatcca cagaatcagg ggataacgca ggaaagaaca tgtgagcaaa 1200 aggccagcaa aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt tccataggct 1260 ccgcccccct gacgagcatc acaaaaatcg acgctcaagt cagaggtggc gaaacccgac 1320 aggactataa agataccagg cgtttccccc tggaagctcc ctcgtgcgct ctcctgttcc 1380 gaccctgccg cttaccggat acctgtccgc ctttctccct tcgggaagcg tggcgctttc 1440 tcatagctca cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca agctgggctg 1500 tgtgcacgaa ccccccgttc agcccgaccg ctgcgcctta tccggtaact atcgtcttga 1560 gtccaacccg gtaagacacg acttatcgcc actggcagca gccactggta acaggattag 1620 cagagcgagg tatgtaggcg gtgctacaga gttcttgaag tggtggccta actacggcta 1680 1740 agttggtagc tcttgatccg gcaaaaac caccgctggt agcggtggtt tttttgtttg 1800 caagcagcag attacgcgca gaaaaaaagg atctcaagaa gatcctttga tcttttctac 1860 ggggtctgac gctcagtgga acgaaaactc acgttaaggg attttggtca tgagattatc 1920 aaaaaggatc ttcacctaga tccttttggg ggggggggga aagccacgtt gtgtctcaaa 1980 atctctgatg ttacattgca caagataaaa atatatcatc atgaacaata aaactgtctg 2040 cttacataa cattaataca aggggtgtta tgagccatat tcaacgggaa acgtcttgct 2100 cgaggccgcg attaaattcc aacatggatg ctgatttata tgggtataaa tgggctcgcg 2160 ataatgtcgg gcaatcaggt gcgacaatct atcgattgta tgggaagccc gatgcgccag 2220 agttgtttct gaaacatggc aaaggtagcg ttgccaatga tgttacagat gagatggtca 2280 gactaaactg gctgacggaa tttatgcctc ttccgaccat caagcattt atccgtactc 2340 ctgatgatgc atggtactc accactgcga tccccgggaa aacagcattc caggtattag 2400 aagaatatcc tgattcaggt gaaaatattg ttgatgcgct ggcagtgttc ctgcgccggt 2460 tgcattcgat tcctgtttgt aattgtcctt ttaacagcga tcgcgtattt cgtctcgctc 2520 aggcgcaatc acgaatgaat aacggtttgg ttgatgcgag tgattttgat gacgagcgta 2580 atggctggcc tgttgaacaa gtctggaaag aaatgcataa gcttttgcca ttctcaccgg 2640 attcagtcgt cactcatggt gatttctcac ttgataacct tatttttgac gaggggaaat 2700 taataggttg tattgatgtt ggacgagtcg gaatcgcaga ccgataccag gatcttgcca 2760 tcctatggaa ctgcctcggt gagttttctc cttcattaca gaaacggctt tttcaaaaat 2820 atggtattga taatcctgat atgaataaat tgcagtttca tttgatgctc gatgagtttt 2880 tctaatcaga attggttaat tggttgtaac actggcagag cattacgctg acttgacggg 2940 acggcggctt tgttgaataa atcgaacttt tgctgagttg aaggatcaga tcacgcatct 3000 tcccgacaac gcagaccgtt ccgtggcaaa gcaaaagttc aaaatcacca actggtccac 3060 ctacaacaaa gctctcatca accgtggctc cctcactttc tggctggatg atggggcgat 3120 tcaggcctgg tatgagtcag caacaccttc ttcacgaggc agacctcagc gccccccccc 3180 ccctagcttg tctacgtctg atgctttgaa tcggacggac ttgccgatct tgtatgcggt 3240 gatttttccc tcgtttgccc actttttaat ggtggccggg gtgagagcta cgcgggcggc 3300 gacctgctgc gctgtgatcc aatattcggg gtcgttcact ggttcccctt tctgatttct 3360 ggcatagaag aacccccgtg aactgtgtgg ttccgggggt tgctgatttt tgcgagactt 3420 ctcgcgcaat tccctagctt aggtgaaaac accatgaaac actagggaaa cacccatgaa 3480 acacccatta gggcagtagg gcggcttctt cgtctagggc ttgcatttgg gcggtgatct 3540 ggtctttagc gtgtgaaagt gtgtcgtagg tggcgtgctc aatgcactcg aacgtcacgt 3600 catttaccgg gtcacggtgg gcaaagagaa ctagtgggtt agacattgtt ttcctcgttg 3660 tcggtggtgg tgagcttttc tagccgctcg gtaaacgcgg cgatcatgaa ctcttggagg 3720 ttttcaccgt tctgcatgcc tgcgcgcttc atgtcctcac gtagtgccaa aggaacgcgt 3780 gcggtgacca cgacgggctt agcctttgcc tgcgcttcta gtgcttcgat ggtggcttgt 3840 gcctgcgctt gctgcgcctg tagtgcctgt tgagcttctt gtagttgctg ttctagctgt 3900 gccttggttg ccatgcttta agactctagt agctttcctg cgatatgtca tgcgcatgcg 3960 tagcaaacat tgtcctgcaa ctcattcatt atgtgcagtg ctcctgttac tagtcgtaca 4020 tactcatatt tacctagtct gcatgcagtg catgcacatg cagtcatgtc gtgctaatgt 4080 gtaaaacatg tacatgcaga ttgctggggg tgcagggggc ggagccaccc tgtccatgcg 4140 gggtgtgggg cttgccccgc cggtacagac agtgagcacc ggggcaccta gtcgcggata 4200 ccccccctag gtatcggaca cgtaaccctc ccatgtcgat gcaaatcttt aacattgagt 4260 acgggtaagc tggcacgcat agccaagcta ggcggccacc aaacaccact aaaaattaat 4320 agttcctaga caagacaaac ccccgtgcga gctaccaact catatgcacg ggggccacat 4380 aacccgaagg ggtttcaatt gacaaccata gcactagcta agacaacggg cacaacaccc 4440 gcacaaactc gcactgcgca accccgcaca acatcgggtc taggtaacac tgaaatagaa 4500 gtgaacacct ctaaggaacc gcaggtcaat gagggttcta aggtcactcg cgctagggcg 4560 tggcgtaggc aaaacgtcat gtacaagatc accaatagta aggctctggc ggggtgccat 4620 aggtggcgca gggacgaagc tgttgcggtg tcctggtcgt ctaacggtgc ttcgcagttt 4680 gagggtctgc aaaactctca ctctcgctgg gggtcacctc tggctgaatt ggaagtcatg 4740 ggcgaacgcc gcattgagct ggctattgct actaagaatc acttggcggc gggtggcgcg 4800 ctcatgatgt ttgtgggcac tgttcgacac aaccgctcac agtcatttgc gcaggttgaa 4860 gcgggtatta agactgcgta ctcttcgatg gtgaaaacat ctcagtggaa gaaagaacgt 4920 gcacggtacg gggtggagca cacctatagt gactatgagg tcacagactc ttgggcgaac 4980 ggttggcact tgcaccgcaa catgctgttg ttcttggatc gtccactgtc tgacgatgaa 5040 ctcaaggcgt ttgaggattc catgttttcc cgctggtctg ctggtgtggt taaggccggt 5100 atggacgcgc cactgcgtga gcacggggtc aaacttgatc aggtgtctac ctggggtgga 5160 gacgctgcga aaatggcaac ctacctcgct aagggcatgt ctcaggaact gactggctcc 5220 gctactaaaa ccgcgtctaa ggggtcgtac acgccgtttc agatgttgga tatgttggcc 5280 gatcaaagcg acgccggcga ggatatggac gctgttttgg tggctcggtg gcgtgagtat 5340 gaggttggtt ctaaaaacct gcgttcgtcc tggtcacgtg gggctaagcg tgctttgggc 5400 attgattaca tagacgctga tgtacgtcgt gaaatggaag aagaactgta caagctcgcc 5460 ggtctggaag caccggaacg ggtcgaatca acccgcgttg ctgttgcttt ggtgaagccc 5520 gatgattgga aactgattca gtctgatttc gcggttaggc agtacgttct agattgcgtg 5580 gataaggcta aggacgtggc cgctgcgcaa cgtgtcgcta atgaggtgct ggcaagtctg 5640 ggtgtggatt ccaccccgtg catgatcgtt atggatgatg tggacttgga cgcggttctg 5700 cctactcatg gggacgctac taagcgtgat ctgaatgcgg cggtgttcgc gggtaatgag 5760 cagactattc ttcgcaccca ctaaaagcgg cataaacccc gttcgatatt ttgtgcgatg 5820 aatttatggt caatgtcgcg ggggcaaact atgatgggtc ttgttgttga caatggctga 5880 tttcatcagg aatggaactg tcatgctgtt atgtgcctgg ctcctaatca aagctgggga 5940 caatgggttg ccccgttgat ctgatctagt tcggattggc ggggcttcac tgtatctggg 6000 ggtggcatcg tgaatagatt gcacaccgta gtgggcagtg tgcacaccat agtggccatg 6060 agcaccacca cccccaggga cgccgacggc gcgaagctct gcgcctggtg cggctcggag 6120 atcaagcaat ccggcgtcgg ccggagccgg gactactgcc gccgctcctg ccgccagcgg 6180 gcgtacgagg cccggcgcca gcgcgaggcg atcgtgtccg ccgtggcgtc ggcagtcgct 6240 cgccgagata cgtcacgtga cgaaatgcag cagccttcca ttccgtcacg tgacgaaact 6300 cgggccgcag gtcagagcac ggttccgccc gctccggccc tgccggaccc ccggcatccc 6360 gcaagaggcc cggcagtacc ggcataacca agcctatgcc tacagcatcc agggtgacgg 6420 tgccgaggat gacgatgagc gcattgttag atttcataca cggtgcctga ctgcgttagc 6480 aatttaactg tgataaacta ccgcattaaa gcttatcgat gataagctgt caaacatggc 6540 ctgtcgcttg cggtattcgg aatcttgcac gccctcgctc aagccttcgt cactggtccc 6600 gccaccaaac gtttcggcga gaagcaggcc attatcgccg gcatggcggc cgacgcgcgg 6660 ggagaggcgg tttgcgtatt gggcgccagg gtggtttttc ttttcaccag tgagacgggc 6720 aacagctgat tgcccttcac cgcctggccc tgagagagtt gcagcaagcg gtccacgctg 6780 gtttgcccca gcaggcgaaa atcctgtttg atggtggtta acggcgggat ataacatgag 6840 ctgtcttcgg tatcgtcgta tcccactacc gagatatccg caccaacgcg cagcccggac 6900 tcggtaatgg cgcgcattgc gcccagcgcc atctgatcgt tggcaaccag catcgcagtg 6960 ggaacgatgc cctcattcag catttgcatg gtttgttgaa aaccggacat ggcactccag 7020 tcgccttccc gttccgctat cggctgaatt tgattgcgag tgagatattt atgccagcca 7080 gccagacgca gacgcgccga gacagaactt aatgggcccg ctaacagcgc gatttgctgg 7140 tgacccaatg cgaccagatg ctccacgccc agtcgcgtac cgtcttcatg ggagaaaata 7200 atactgttga tgggtgtctg gtcagagaca tcaagaaata acgccggaac attagtgcag 7260 gcagcttcca cagcaatggc atcctggtca tccagcggat agttaatgat cagcccactg 7320 acgcgttgcg cgagaagatt gtgcaccgcc gctttacagg cttcgacgcc gcttcgttct 7380 accatcgaca ccaccacgct ggcacccagt tgatcggcgc gagatttaat cgccgcgaca 7440 atttgcgacg gcgcgtgcag ggccagactg gaggtggcaa cgccaatcag caacgactgt 7500 ttgcccgcca gttgttgtgc cacgcggttg ggaatgtaat tcagctccgc catcgccgct 7560 tccacttttt cccgcgtttt cgcagaaacg tggctggcct ggttcaccac gcgggaaacg 7620 gtctgataag agacaccggc atactctgcg acatcgtata acgttactgg tttcacattc 7680 accaccctga attgactctc ttccgggcgc tatcatgcca taccgcgaaa ggttttgcac 7740 cattcgatgg tgtcaacgta aatgcatgcc gcttcgcctt cgcgcgcgaa ttgcaagctg 7800 atccgggctt atcgactgca cggtgcacca atgcttctgg cgtcaggcag ccatcggaag 7860 ctgtggtatg gctgtgcagg tcgtaaatca ctgcataatt cgtgtcgctc aaggcgcact 7920 cccgttctgg ataatgtttt ttgcgccgac atcataacgg ttctggcaaa tattctgaaa 7980 tgagctgttg acaattaatc atcggctcgt ataatgtgtg gaattgtgag cggataacaa 8040 tttcacacag gaaacagaat tcccggggat ccgtcgacct gcag 8084 <210> 23 <211> 5095 <212> DNA <213> Artificial Sequence <220> <223> pTac15k <400> 23 gaattcacag gaaacagacc atgaacaact ttaatctgca caccccaacc cgcattctgt 60 ttggtaaagg cgcaatcgct ggtttacgcg aacaaattcc tcacgatgct cgcgtattga 120 ttacctacgg cggcggcagc gtgaaaaaaa ccggcgttct cgatcaagtt ctggatgccc 180 tgaaaggcat ggacgtgctg gaatttggcg gtattgagcc aaacccggct tatgaaacgc 240 tgatgaacgc cgtgaaactg gttcgcgaac agaaagtgac tttcctgctg gcggttggcg 300 gcggttctgt actggacggc accaaattta tcgccgcagc ggctaactat ccggaaaata 360 tcgatccgtg gcacattctg caaacgggcg gtaaagagat taaaagcgcc atcccgatgg 420 gctgtgtgct gacgctgcca gcaaccggtt cagaatccaa cgcaggcgcg gtgatctccc 480 gtaaaaccac aggcgacaag caggcgttcc attctgccca tgttcagccg gtatttgccg 540 tgctcgatcc ggtttatacc tacaccctgc cgccgcgtca ggtggctaac ggcgtagtgg 600 acgcctttgt acacaccgtg gaacagtatg ttaccaaacc ggttgatgcc aaaattcagg 660 accgtttcgc agaaggcatt ttgctgacgc taatcgaaga tggtccgaaa gccctgaaag 720 agccagaaaa ctacgatgtg cgcgccaacg tcatgtgggc ggcgactcag gcgctgaacg 780 gtttgattgg cgctggcgta ccgcaggact gggcaacgca tatgctgggc cacgaactga 840 ctgcgatgca cggtctggat cacgcgcaaa cactggctat cgtcctgcct gcactgtgga 900 atgaaaaacg cgataccaag cgcgctaagc tgctgcaata tgctgaacgc gtctggaaca 960 tcactgaagg ttccgatgat gagcgtattg acgccgcgat tgccgcaacc cgcaatttct 1020 ttgagcaatt aggcgtgccg acccacctct ccgactacgg tctggacggc agctccatcc 1080 cggctttgct gaaaaaactg gaagagcacg gcatgaccca actgggcgaa aatcatgaca 1140 ttacgttgga tgtcagccgc cgtatatacg aagccgcccg ctaaggatcc tctagagtcg 1200 acctgcaggc atgcaagctt ggctgttttg gcggatgaga gaagattttc agcctgatac 1260 agattaaatc agaacgcaga agcggtctga taaaacagaa tttgcctggc ggcagtagcg 1320 cggtggtccc acctgacccc atgccgaact cagaagtgaa acgccgtagc gccgatggta 1380 gtgtggggtc tccccatgcg agagtaggga actgccaggc atcaaataaa acgaaaggct 1440 cagtcgaaag actgggcctt tcgttttatc tgttgtttgt cggtgaacgc tctcctgagt 1500 aggacaaatc cgccgggagc ggatttgaac gttgcgaagc aacggcccgg agggtggcgg 1560 gcaggacgcc cgccataaac tgccaggcat caaattaagc agaaggccat cctgacggat 1620 ggcctttttg cgtttctaca aactcttttt gtttattttt ctaaatacat tcaaatatgt 1680 atccgctcat gagacaataa ccctgataaa tgcttcaata atattgaaaa aggaagagta 1740 tgagtattca acatttccgt gtcgccctta ttcccttttt tgcggcattt tgccttcctg 1800 tttttgctca cccagaaacg ctggtgaaag taaaagatgc tgaagatcag ttgggtgcac 1860 gagtgggtta catcgaactg gatctcaaca gcggtaagat ccttgagagt tttcgccccg 1920 aagaacgttt tccaatgatg agcactttta aagttctgct atgtggcgcg gtattatccc 1980 gtgttgacgc cgggcaagag caactcggtc gccgcataca ctattctcag aatgacttgg 2040 ttgagtaatt cactggccgt cgttttacaa cgtcgtgact gggaaaaccc tggcgttacc 2100 caacttaatc gccttgcagc acatccccct ttcgccagct ggcgtaatag cgaagaggcc 2160 cgcaccgatc gcccttccca acagttgcgg gggggggggg aaagccacgt tgtgtctcaa 2220 aatctctgat gttacattgc acaagataaa aatatatcat catgaacaat aaaactgtct 2280 gcttacataa acagtaatac aaggggtgtt atgagccata ttcaacggga aacgtcttgc 2340 tcgaggccgc gattaaattc caacatggat gctgatttat atgggtataa atgggctcgc 2400 gataatgtcg ggcaatcagg tgcgacaatc tatcgattgt atgggaagcc cgatgcgcca 2460 gagttgtttc tgaaacatgg caaaggtagc gttgccaatg atgttacaga tgagatggtc 2520 agactaaact ggctgacgga atttatgcct cttccgacca tcaagcattt tatccgtact 2580 cctgatgatg catggttact caccactgcg atccccggga aaacagcatt ccaggtatta 2640 gaagaatatc ctgattcagg tgaaatatt gttgatgcgc tggcagtt cctgcgccgg 2700 ttgcattcga ttcctgtttg taattgtcct ttacagcg atcgcgtatt tcgtctcgct 2760 caggcgcaat cacgaatgaa taacggtttg gttgatgcga gtgattttga tgacgagcgt 2820 aatggctggc ctgttgaaca agtctggaaa gaatgcata agctttgcc attctcaccg 2880 gattcagtcg tcactcatgg tgatttctca cttgatacc tatttttga cgaggggaaa 2940 ttaataggtt gtattgatgt tggacgagtc ggaatcgcag accgatacca ggatcttgcc 3000 atcctatgga actgcctcgg tgagttctctctcattac agaaacggct tttcaaaaa 3060 tatggtattg ataatcctga tatgaataaa ttgcagtttc atttgatgct cgatgagttt 3120 ttctaatcag aattggttaa ttggttgtaa cactggcaga gcattacgct gacttgacgg 3180 gacggcggct tgttgaata aatcgaactt tgctgagtt gaaggatcag atcacgcatc 3240 ttcccgacaa cgcagaccgt tccgtggcaa agcaaagtt caaatcacc aactggtcca 3300 cctacaacaa agctctcatc aaccgtggct ccctcacttt ctggctggat gatggggcga 3360 ttcaggcctg gtatgagtca gcaacacctt cttcacgagg cagacctcag cgcccccccc 3420 ccccgcaaac tattaactgg cgaactactt actctagctt cccggcaaca attaatagac 3480 tggatggagg cggataaagt tgcaggacca cttctgcgct cggcccttcc ggctggctgg 3540 tttattgctg ataaatctgg agccggtgag cgtgggtctc gcggtatcat tgcagcactg 3600 gggccagatg gtaagccctc ccgtatcgta gttatctaca cgacggggag tcaggcaact 3660 atggatgaac gaaatagaca gatcgctgag ataggtgcct cactgattaa gcattggtaa 3720 ctgtcagacc aagtttactc atatatactt tagattgatt taaaacttca tttttaattt 3780 aaaaggatct aggtgaagat cctttttgat aatctcatga ccaaaatccc ttaacgtgag 3840 ttttcgttcc actgagcgtc agacccctta ataagatgat cttcttgaga tcgttttggt 3900 ctgcgcgtaa tctcttgctc tgaaaacgaa aaaaccgcct tgcagggcgg tttttcgaag 3960 gttctctgag ctaccaactc tttgaaccga ggtaactggc ttggaggagc gcagtcacca 4020 aaacttgtcc tttcagttta gccttaaccg gcgcatgact tcaagactaa ctcccttaaa 4080 tcaattacca gtggctgctg ccagtggtgc ttttgcatgt ctttccgggt tggactcaag 4140 acgatagtta ccggataagg cgcagcggtc ggactgaacg gggggttcgt gcatacagtc 4200 cagcttggag cgaactgcct acccggaact gagtgtcagg cgtggaatga gacaaacgcg 4260 gccataacag cggaatgaca ccggtaaacc gaaaggcagg aacaggagag cgcacgaggg 4320 agccgccagg gggaaacgcc tggtatcttt atagtcctgt cgggtttcgc caccactgat 4380 ttgagcgtca gatttcgtga tgcttgtcag gggggcggag cctatggaaa aacggctttg 4440 ccgcggccct ctcacttccc tgttaagtat cttcctggca tcttccagga aatctccgcc 4500 ccgttcgtaa gccatttccg ctcgccgcag tcgaacgacc gagcgtagcg agtcagtgag 4560 cgaggaagcg gaatatatcc tgtatcacat attctgctga cgcaccggtg cagccttttt 4620 tctcctgcca catgaagcac ttcactgaca ccctcatcag tgccaacata gtaagccagt 4680 atacactccg ctagcaagga gatggcgccc aacagtcccc cggccacggg gcctgccacc 4740 atacccacgc cgaaacaagc gctcatgagc ccgaagtggc gagcccgatc ttccccatcg 4800 gtgatgtcgg cgatataggc gccagcaacc gcacctgtgg cgccggtgat gccggccacg 4860 atgcgtccgg cgtagaggat ccggagctta tcgactgcac ggtgcaccaa tgcttctggc 4920 gtcaggcagc catcggaagc tgtggtatgg ctgtgcaggt cgtaaatcac tgcataattc 4980 gtgtcgctca aggcgcactc ccgttctgga taatgttttt tgcgccgaca tcataacggt 5040 tctggcaaat attctgaaat gagctgttga caattaatca tcggctcgta taatg 5095

Claims

1. A method for producing 1,3-propylene glycol from glycerol, the method comprising the following steps: (a) culturing a mutant microorganism having the ability to produce 1,3-propanediol using glycerol as a single carbon source, wherein the mutant microorganism is a recombinant of a microorganism species Corynebacterium glutamicum, wherein a pEK-pduyK vector comprising a glycerol facilitating protein encoding gene glpF from Escherichia coli (E. coli), a glycerol kinase encoding gene glpK from E. coli, a glycerol-3-phosphate dehydrogenase glpD from E. coli, a glycerol dehydratase and glycerol reactivation enzyme encoding gene cluster pduCDEGH from Klebsiella pneumoniae, and a 1,3-PDO oxidoreductase encoding gene yqhD from E. coli is introduced into Corynebacterium glutamicum that cannot use glycerol as a single carbon source, and the mutant microorganism is capable of growing using glycerol as a single carbon source, wherein the culturing is performed in a medium containing glycerol and glucose, wherein the weight ratio of glucose to glycerol in the medium is 1:2 to 3, thereby producing 1,3-propanediol; and (b) collecting the generated 1,3-propanediol.

2. The method according to claim 1, wherein the gene is overexpressed by a strong promoter selected from the group consisting of tac, trc, H36 and tuf.

Images