Use of a mutant of miR396 or a gene encoding the same
By regulating miR396 or mutants of its encoding gene to reduce the expression or activity of miR396, the problem of low nitrogen utilization in existing technologies has been solved, achieving improved nitrogen utilization efficiency and the cultivation of environmentally friendly new rice varieties. This has increased nitrogen fertilizer utilization, reduced nitrogen fertilizer application, and decreased environmental pollution.
Patent Information
- Application Number
- CN201910605771.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2019-07-05
- Publication Date
- 2026-02-03
- Estimated Expiration
- 2039-07-05
AI Technical Summary
The lack of miRNA targets in existing technologies to improve nitrogen use efficiency in plants leads to low nitrogen fertilizer utilization efficiency and serious environmental pollution.
By regulating miR396 or mutants of its encoding gene, reducing miR396 expression or activity, nitrogen fertilizer utilization efficiency in plants can be improved, and the amount of nitrogen fertilizer applied can be reduced. Nucleic acid constructs or mutants of their encoding genes can be used in combination with agricultural compositions and gene editing technology to regulate target genes to improve nitrogen utilization efficiency.
It significantly improved the nitrogen fertilizer utilization rate of plants, reduced the amount of nitrogen fertilizer applied, reduced environmental pollution, and improved the efficiency and environmental friendliness of agricultural production.
Smart Images

Figure CN112251433B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of crop genetics, in particular to the application of a mutant of miR396 or a coding gene thereof. BACKGROUND
[0002] Rice is one of the most important food crops in the world, and is also the first food crop in China. From the late 1950s to the early 1960s, the dwarf breeding and the successful application of three-line hybrid indica rice in the 1970s made China's rice yield realize two great leaps, which made a great contribution to meet China's food self-sufficiency. In recent decades, with the continuous increase of China's population, the demand for total rice production is increasing. In the process of modern agricultural production, the use of chemical fertilizers, especially nitrogen fertilizers, plays a crucial role in promoting the development of agricultural production. However, while people use a large amount of nitrogen fertilizer, it also brings many problems and influences, not only causing huge waste of economy and resources, but also causing serious threats to the ecological environment. Excessive use of nitrogen fertilizer leads to soil acidification, secondary salinization, and also leads to greenhouse effect and ozone layer depletion, eutrophication of water body, etc. Therefore, how to improve the utilization rate of nitrogen fertilizer of crops on the basis of maintaining the existing yield and cultivate environment-friendly new rice varieties is one of the problems that agricultural breeders need to solve.
[0003] microRNA (miRNA) is a class of non-coding single-stranded small RNA molecules with a length of 20-24 nucleotides, which binds to the mRNA of the target gene through base pairing, thereby causing the degradation or translation inhibition of mRNA. miRNA controls the growth, development, stress tolerance, etc. of plants by regulating the accumulation of protein-encoding genes in situ cells. In recent years, miRNA has also been widely used in crop improvement. On the one hand, miRNA can affect crop yield by regulating tillering, grain type and panicle type, etc.; on the other hand, some members of miRNA can respond to external environmental signal stimulation to improve the ability of crops to cope with adversity stress. Therefore, miRNA as a potential target for crop improvement needs to be further explored.
[0004] However, no miRNA target for improving plant nitrogen utilization has been found.
[0005] Therefore, there is an urgent need in the art to explore the regulation mechanism of rice nitrogen utilization, and to target and regulate target genes, to cultivate new rice varieties with "less input, more output, and environment-friendly". SUMMARY
[0006] The purpose of the present application is to explore the regulation mechanism of rice nitrogen utilization, and to target and regulate target genes, to cultivate new rice varieties with "less input, more output, and environment-friendly".
[0007] In a first aspect of the present application, there is provided a use of a nucleic acid construct or a mutant of a gene encoding the same for (a) increasing nitrogen fertilizer use efficiency of a plant; and / or (b) reducing nitrogen fertilizer application amount, or for preparing a composition or a preparation for (a) increasing nitrogen fertilizer use efficiency of a plant; and / or (b) reducing nitrogen fertilizer application amount.
[0008] wherein the nucleic acid construct has a 5'-3' structure of Formula I:
[0009] X1-X2-X3 (I)
[0010] wherein X1 is selected from 1-12 of SEQ ID NO.: 1 or 1-9 of SEQ ID NO.: 2;
[0011] X2 is selected from a mature sequence / conserved sequence of miR396;
[0012] X3 is selected from 44-184 of SEQ ID NO.: 1 or 41-176 of SEQ ID NO.: 2;
[0013] and each "-" is a bond or a nucleotide linker sequence.
[0014] In another preferred embodiment, the mature sequence / conserved sequence of miR396 comprises a mature sequence / conserved sequence of miR396a, miR396b, miR396c, miR396d, miR396e, miR396f, miR396g and / or miR396h.
[0015] In another preferred embodiment, the mature sequence / conserved sequence of miR396 comprises a mature sequence / conserved sequence of miR396e and / or miR396f.
[0016] In another preferred embodiment, X2 is selected from 13-43 of SEQ ID NO.: 1 or 10-40 of SEQ ID NO.: 2.
[0017] In another preferred embodiment, the increase in nitrogen fertilizer use efficiency of the plant is ≥5%, preferably ≥10%, more preferably ≥15%, more preferably ≥20%, more preferably ≥25% as compared with a wild type plant.
[0018] In another preferred embodiment, the nucleic acid construct is selected from the group consisting of:
[0019] (a) having a nucleotide sequence as shown in SEQ ID NO: 1 or 2;
[0020] (b) a polynucleotide having a nucleotide sequence that is >75% (preferably >85%, more preferably >90% or >95%) homologous to the sequence set forth in SEQ ID NO.: 1 or 2;
[0021] (c) a polynucleotide that is truncated at the 5' end and / or 3' end of the polynucleotide set forth in SEQ ID NO.: 1 or 2 by 1-60 (preferably 1-30, more preferably 1-10) nucleotides.
[0022] In another preferred embodiment, the nucleic acid construct has a sequence set forth in SEQ ID NO.: 1 or 2.
[0023] In another preferred embodiment, the nucleic acid construct is encoded by a gene.
[0024] In another preferred embodiment, the gene comprises MIR396a, MIR396b, MIR396c, MIR396d, MIR396e, MIR396f, MIR396g and / or MIR396h.
[0025] In another preferred embodiment, the gene comprises MIR396e and / or MIR396f.
[0026] In another preferred embodiment, the nucleic acid construct or gene thereof is derived from one or more plants selected from the group consisting of Arabidopsis thaliana, rice, Chinese cabbage, soybean, tomato, maize, tobacco, wheat, sorghum, rape, spinach, lettuce, cucumber, artichoke, water spinach, celery, lettuce.
[0027] In another preferred embodiment, the nucleic acid construct or gene thereof is derived from rice.
[0028] In another preferred embodiment, the mutant of the nucleic acid construct or gene thereof is derived from one or more plants selected from the group consisting of Arabidopsis thaliana, rice, Chinese cabbage, soybean, tomato, maize, tobacco, wheat, sorghum, rape, spinach, lettuce, cucumber, artichoke, water spinach, celery, lettuce.
[0029] In another preferred embodiment, the mutant of the nucleic acid construct or gene thereof is derived from rice.
[0030] In another preferred embodiment, the composition is an agricultural composition.
[0031] In another preferred embodiment, the composition comprises (a) a miR396 inhibitor; and (b) an agriculturally acceptable carrier.
[0032] In another preferred embodiment, the dosage form of the composition or formulation is selected from the group consisting of a solution, an emulsion, a suspension, a powder, a foam, a paste, a granule, an aerosol, or a combination thereof.
[0033] In another preferred embodiment, the plant comprises a monocotyledon and a dicotyledon.
[0034] In another preferred embodiment, the dicotyledon is selected from the group consisting of Cycadaceae, Podocarpaceae, Araucariaceae, Pinaceae, Taxodiaceae, Cupressaceae, Cephalotaxaceae, Taxaceae, Ephedraceae, Gnetaceae, Monimiaceae, Lecythidaceae, or a combination thereof.
[0035] In another preferred embodiment, the plant comprises a monocotyledon and a dicotyledon.
[0036] In another preferred embodiment, the plant comprises a monocotyledon and a dicotyledon.
[0037] In another preferred embodiment, the monocotyledon is selected from the group consisting of Solanaceae, Poaceae, Leguminosae, or a combination thereof.
[0038] In another preferred embodiment, the dicotyledon is selected from the group consisting of Actinidaceae, Rosaceae, Moraceae, or a combination thereof.
[0039] In another preferred embodiment, the plant is selected from the group consisting of Brassicaceae, Poaceae, Leguminosae, Solanaceae, Actinidaceae, Malvaceae, Papaveraceae, Rosaceae, Liliaceae, or a combination thereof.
[0040] In another preferred embodiment, the plant is selected from the group consisting of Arabidopsis thaliana, rice, Chinese cabbage, soybean, tomato, maize, tobacco, wheat, sorghum, rape, spinach, lettuce, cucumber, artichoke, spinach, celery, lettuce, or a combination thereof.
[0041] In another preferred embodiment, the rice is selected from the group consisting of indica rice, japonica rice, or a combination thereof.
[0042] In another preferred embodiment, the nucleic acid construct or the mutant of the gene encoding the nucleic acid construct is natural or artificially synthesized.
[0043] In another preferred embodiment, the nucleic acid construct or the mutant of the gene encoding the nucleic acid construct comprises a substitution, insertion, and / or deletion of a base of the nucleic acid construct or the gene encoding the nucleic acid construct defined in the first aspect of the present application.
[0044] In another preferred embodiment, the substitution, insertion, and / or deletion of the base occurs at a site comprising at least a portion of the mature sequence region or the conserved sequence region.
[0045] In another preferred embodiment, the expression or activity of the nucleic acid construct or its mutant encoding gene is reduced by ≥ 50%, more preferably by ≥ 70%, more preferably by ≥ 90% or 100% compared to the expression or activity of the wild type nucleic acid construct or its mutant encoding gene.
[0046] In another preferred embodiment, the ratio of the activity E1 of the nucleic acid construct or its mutant encoding gene to the background activity E0 of the wild type nucleic acid construct or its mutant encoding gene is ≤ 1 / 2, preferably ≤ 1 / 5, more preferably ≤ 1 / 10, most preferably 0.
[0047] The second aspect of the present application provides a method for (a) increasing nitrogen fertilizer use efficiency of a plant; and / or (b) reducing the amount of nitrogen fertilizer applied, comprising:
[0048] reducing the expression or activity of miR396 in the plant.
[0049] In another preferred embodiment, the reduction of the expression or activity of miR396 in the plant is achieved by:
[0050] (1) introducing into the plant the nucleic acid construct or its mutant encoding gene as defined in the first aspect of the present application, and / or
[0051] (2) introducing into the plant an inhibitor of miR396.
[0052] In another preferred embodiment, the inhibitor of miR396 comprises an inhibitor of miR396a, miR396b, miR396c, miR396d, miR396e, miR396f, miR396g and / or miR396h.
[0053] In another preferred embodiment, the inhibitor of miR396 comprises an inhibitor of miR396e and / or miR396f.
[0054] In another preferred embodiment, the inhibitor of miR396 is selected from the group consisting of a small molecule compound, an antisense nucleic acid, a microRNA, an siRNA, an RNAi, a Crispr reagent, or a combination thereof.
[0055] In another preferred embodiment, the "reduction" means that the expression or activity of miR396 is reduced to meet the following conditions:
[0056] the ratio of A1 / A0 is ≤ 80%, preferably ≤ 60%, more preferably ≤ 40%, most preferably 0-30%; wherein A1 is the expression or activity of miR396 in the plant; and A0 is the expression or activity of the same miR396 in a wild type plant of the same type.
[0057] In another preferred embodiment, the reduction of the expression of miR396 in the plant is achieved by a method selected from the group consisting of: gene mutation, gene knockout, gene interruption, RNA interference technology, Crispr technology, or a combination thereof.
[0058] In another preferred embodiment, the reduction of the expression or activity of miR396 in the plant is achieved by gene editing of miR396 with 1 or more sgRNA mediated Cas9 nuclease.
[0059] The third aspect of the present application provides a composition for (a) increasing nitrogen use efficiency of a plant; and / or (b) reducing the amount of nitrogen fertilizer applied, comprising:
[0060] (i) a miR396 inhibitor; and
[0061] (ii) an agronomically acceptable carrier.
[0062] In another preferred embodiment, the composition comprises an agricultural composition.
[0063] In another preferred embodiment, the dosage form of the composition is selected from the group consisting of: a solution, an emulsion, a suspension, a powder, a foam, a paste, a granule, an aerosol, or a combination thereof.
[0064] In another preferred embodiment, the composition comprises 0.0001-99 wt%, preferably 0.1-90 wt% of component (i), based on the total weight of the composition.
[0065] In another preferred embodiment, the composition further comprises other substances that can (a) increase nitrogen use efficiency of a plant; and / or (b) reduce the amount of nitrogen fertilizer applied.
[0066] In another preferred embodiment, the other substance that can (a) improve nitrogen fertilizer use efficiency of the plant; and / or (b) reduce the application amount of nitrogen fertilizer is selected from the group consisting of urease inhibitors (such as inorganic metals, aminobenzenesulfonamides, dithiocarbamic acid salts, hydroxamic acid salts, organic mercury compounds, phenols, quinones (hydroquinone), phosphoraminic compounds or their transformation products); nitrification inhibitors (such as dicyandiamide, 2-chloro-6-(trichloromethyl)pyridine, potassium azide, 2-amino-4-chloro-9-methylpyridine, sulfathiazole, thiourea-N-2,5-dichlorobenzenedisulfonamide, 4-amino-1,2,3-triazole hydrochloride, amidinyl thiourea); ammonia stabilizers; plant growth regulators (such as prohexadione (DA-6), forchlorfenuron, sodium nitrophenolate, auxins, gibberellins, ethylene, cytokinins, abscisic acid, brassinosteroids, salicylic acid, jasmonic acid, paclobutrazol and polyamines); biological bacterial agents; insecticides, or combinations thereof.
[0067] The fourth aspect of the present application provides a use of the composition of the third aspect of the present application for (a) improving nitrogen fertilizer use efficiency of the plant; and / or (b) reducing the application amount of nitrogen fertilizer.
[0068] The fifth aspect of the present application provides a method for preparing a genetically edited plant tissue or plant cell, comprising the steps of:
[0069] reducing the expression or activity of miR396 in the plant tissue or plant cell, thereby obtaining a genetically edited plant tissue or plant cell.
[0070] The sixth aspect of the present application provides a method for preparing a genetically edited plant, comprising the steps of:
[0071] regenerating the genetically edited plant tissue or plant cell prepared by the method of the fifth aspect of the present application into a plant body, thereby obtaining a genetically edited plant.
[0072] The seventh aspect of the present application provides a method for preparing a high-nitrogen utilization plant, comprising the steps of:
[0073] reducing the expression or activity of miR396 in the plant tissue or plant cell.
[0074] The eighth aspect of the present application provides a genetically edited plant, which is prepared by the method of the sixth aspect of the present application.
[0075] It should be understood that, within the scope of the present application, each of the technical features of the present application described above and each of the technical features specifically described in the following (such as the examples) can be combined with each other to constitute a new or preferred technical solution. Due to the limited space, they will not be listed one by one here. BRIEF DESCRIPTION OF DRAWINGS
[0076] The following drawings are used to illustrate the specific embodiments of the present application, and are not used to limit the scope of the present application defined by the claims.
[0077] Figure 1 The accumulation of mir396e / f mature bodies in plants is shown.
[0078] Figure 2 The utilization of nitrogen by wild type and mutant plants under different nitrogen conditions is shown.
[0079] Figure 3 The expression of genes related to nitrogen absorption and utilization in wild type and mutant plants is shown. DETAILED DESCRIPTION
[0080] The present inventors, through extensive and in-depth research, first discovered or synthesized a new type of miR396 and its family members, nucleic acid constructs or mutants of their encoding genes shown in formula I. The nucleic acid constructs or mutants of their encoding genes of the present application can significantly (a) improve the nitrogen utilization rate of plants; and / or (b) reduce the amount of nitrogen fertilizer applied. On this basis, the present inventors completed the present application.
[0081] miR396
[0082] miR396 is a non-coding single-stranded small RNA molecule containing 20-24 nucleotides in length, mainly located at the 5' end of the coding sequence, and the 5' end and the 3' end are partially base-paired, so that it forms a neck ring structure, which contains 8 members miR396a, miR396b, miR396c, miR396d, miR396e, miR396f, miR396g, and miR396h. By base-pairing binding to the mRNA of the target gene, it causes the degradation or translation inhibition of the mRNA, and plays an important regulatory role in the process of plant growth and development.
[0083] In a preferred embodiment, the sequence of miR396e is shown in SEQ ID NO.: 1, and the sequence of miR396f is shown in SEQ ID NO.: 2.
[0084] Mature sequence / conserved sequence of miR396
[0085] In the present application, the mature sequence / conserved sequence refers to the sequence that truly functions after the RNA precursor sequence is cut and processed.
[0086] Specifically, the miR396 in the present application represents a RNA precursor sequence; the mature sequence is a RNA sequence formed after the RNA precursor sequence is cut and processed; the conserved sequence refers to a RNA fragment identical among different species; the mature sequence can be equivalent to the conserved sequence; the mature sequence and the conserved sequence can be crossed; and the conserved sequence can be longer than the mature sequence. The MIR396 represents a DNA sequence encoding the miR396.
[0087] In the miR396 family, the similarity of the mature sequence / conserved sequence among the subtypes a, b, c, d, e, f, g and h of the miR396 family is very high.
[0088] The nucleic acid construct of the present application or a mutant of the encoding gene thereof
[0089] The present application provides a nucleic acid construct or a mutant of the encoding gene thereof for (a) improving the nitrogen fertilizer utilization rate of a plant; and / or (b) reducing the application amount of nitrogen fertilizer.
[0090] In the present application, the nucleic acid construct of the present application has a 5'-3' structure of formula I:
[0091] X1-X2-X3 (I)
[0092] In the formula, X1 is selected from 1-12 of SEQ ID NO.: 1 or 1-9 of SEQ ID NO.: 2;
[0093] X2 is selected from the conserved sequence of MIR396;
[0094] X3 is selected from 44-184 of SEQ ID NO.: 1 or 41-176 of SEQ ID NO.: 2;
[0095] And each "-" is a bond or a nucleotide connecting sequence.
[0096] In the present application, the nucleic acid construct of the present application or a mutant of the encoding gene thereof can be a single mutation, can be a double mutation, can be a multiple mutation, preferably a single mutation or a double mutation, and more preferably a mutation of miR396e and / or miR396f.
[0097] The various elements used in the construct of the present application are known in the art or can be prepared by methods known to those skilled in the art.
[0098] Inserting the mutant of the encoding gene of the construct of the present application into an exogenous vector (especially a vector suitable for transgenic plant operation) constitutes the vector of the present application.
[0099] The plant cell containing the exogenous gene is regenerated into a plant body, thereby obtaining a plant containing the exogenous gene.
[0100] The plant cell containing the exogenous gene is regenerated into a plant body, thereby obtaining a plant containing the exogenous gene.
[0101] The mutant of the coding gene of the above nucleic acid construct constructed in the present application can be introduced into a plant cell by a conventional genetic transformation technique (e.g., Agrobacterium transfection technique), thereby obtaining a plant cell carrying the coding gene of the nucleic acid construct (or a vector carrying the coding gene of the nucleic acid construct) or a plant cell having the mutant of the coding gene of the nucleic acid construct integrated into the genome.
[0102] Inhibitor of miR396
[0103] The present application also provides an inhibitor of miR396, which can inhibit the expression or activity of miR396. In the present application, the inhibitor of miR396 is selected from the group consisting of a small molecule compound, an antisense nucleic acid, a microRNA, an siRNA, an RNAi, a Crispr reagent, or a combination thereof.
[0104] Use
[0105] The present application also provides a use of the nucleic acid construct of formula I of the present application or the mutant of the coding gene thereof or the inhibitor of miR396, which is used for (a) improving the nitrogen fertilizer utilization rate of a plant; and / or (b) reducing the application amount of nitrogen fertilizer. In the present application, the nucleic acid construct of formula I of the present application or the mutant of the coding gene thereof is derived from rice, and preferably, the sequence of the nucleic acid construct of formula I of the present application is shown in SEQ ID NO.: 1 or 2.
[0106] In the present application, the expression or activity of miR396 can be inhibited by gene mutation, gene knockout, gene interruption, RNA interference technology, Crispr technology, etc.
[0107] In a preferred embodiment, the gene editing of MIR396 can be mediated by Cas9 nuclease with 1 or more sgRNAs.
[0108] Improvement of plants (e.g., rice)
[0109] The present application also provides a method for improving plants (e.g., rice), which comprises (a) improving the nitrogen fertilizer utilization rate of a plant; and / or (b) reducing the application amount of nitrogen fertilizer, comprising the step of reducing the expression or activity of miR396 in the plant, applying an inhibitor of miR396 or the nucleic acid construct or the mutant of the coding gene thereof of the present application.
[0110] In this invention, plants or plant seeds may be further treated with other substances that can (a) improve nitrogen fertilizer utilization in plants and / or (b) reduce the amount of nitrogen fertilizer applied, thereby improving the traits of the corresponding plants.
[0111] In a preferred embodiment, the other substances that can (a) improve nitrogen fertilizer utilization in plants and / or (b) reduce the amount of nitrogen fertilizer applied are selected from the group consisting of: urease inhibitors (such as inorganic metals, aminobenzenesulfonamides, dithiocarbamates, hydroxyoxalates, organomercury compounds, phenols, quinones (hydroquinone), phosphoamine compounds or their derivatives); nitrification inhibitors (such as dicyandiamide, 2-chloro-6-(trichloromethyl)pyridine, potassium azide, 2-amino-4-chloro-9-methylpyridine, sulfathiazole, thiourea-N-2,5-dichlorophenylbutanedamide, 4-amino-1,2,3-triazole hydrochloride, amidothiourea); ammonia stabilizers; plant growth regulators (such as aminoethyl ester (DA-6), chlorpyrifos, sodium nitrophenolate, auxin, gibberellin, ethylene, cytokinin, abscisic acid, brassinolide, salicylic acid, jasmonic acid, paclobutrazol and polyamines); biological agents; insecticides, or combinations thereof.
[0112] The main advantages of this invention include:
[0113] (1) This invention is the first to discover that a new class of miR396 and its family members’ nucleic acid constructs of Formula I or mutants of their encoding genes can significantly (a) improve nitrogen fertilizer utilization in plants; and / or (b) reduce the amount of nitrogen fertilizer applied.
[0114] (2) The nucleic acid constructs of Formula I of the present invention or mutants of their encoding genes can also improve agricultural yields, reduce environmental pollution, and protect the environment.
[0115] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions as described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer.
[0116] Unless otherwise specified, all reagents or materials used in the embodiments of this invention are commercially available products.
[0117] Example 1: The miR396ef mutant can improve nitrogen use efficiency in rice.
[0118] 1. Construction of CRISPR-Cas9 gene editing tools
[0119] A) Design small guide-RNA (sgRNA) sequences targeting the mature regions of MIR396a, b and c; MIR396d; MIR396e; MIR396e and f; MIR396g and MIR396h respectively (Table 1): sgRNA is an oligonucleotide sequence containing a 20nt sequence partially complementary to the mature region of the MIR gene and a sticky end.
[0120] B) Dissolve the primers in ddH2O to 10 μM. Add 1 μl of each of the forward and reverse primers to 8 μl of annealing buffer (TE buffer with 50 mM NaCl) and mix well.
[0121] C) Run the annealing program on the mixed primers, heat the PCR instrument to 95°C and hold for 5 min, then reduce the temperature by 0.1°C every 1 second until it reaches 16°C;
[0122] D) Digest the CRISPR-Cas9 vector with BsaI, recover the vector fragment, and set aside for later use;
[0123] E) Connect the gRNA and the CRISPR-Cas9 vector.
[0124] Annealing product 1
[0125] BsaI digested CRISPR vector 1
[0126] 10x T4 buffer 1
[0127] T4 ligase 0.5
[0128] Add water to 10 μl, incubate at 16°C for 2 hours.
[0129] F) Transformed E. coli, selected single clones M13F and sequenced to verify successful ligation of the fragment into the vector.
[0130] Table 1. sgRNA sequences targeting the MIR396 gene
[0131]
[0132] 2. Vector genetic transformation
[0133] A) The above-constructed plasmid was directly transformed into Agrobacterium EHA105:
[0134] 1. Add plasmid DNA to Agrobacterium competent cells, then incubate on ice for 30 min, in liquid nitrogen for 1 min, and then immediately in a 37°C water bath for 2 min.
[0135] 2. Remove the centrifuge tube, add LB culture medium, and incubate with shaking for 3-5 hours.
[0136] 3. Spread the bacterial culture onto an LB agar plate containing the appropriate antibiotic, and incubate upside down in an incubator. Colonies will be visible in about 2 days.
[0137] B) Genetically modified rice:
[0138] 1. Callus induction: After dehulling, seeds were disinfected by soaking in NaClO, rinsed with sterile water, and then inoculated into NB induction medium and cultured in an incubator for 10–15 days.
[0139] 2. Callus subculture: The induced callus is cut off with a single-edged scalpel and placed in subculture medium for culture under the same conditions.
[0140] 3. Agrobacterium infection and screening of resistant callus: Agrobacterium strain EH105 transformed into the target vector was propagated, and then callus in good condition was soaked.
[0141] 4. Aspirate or discard the bacterial solution, and place the callus tissue in a dark incubator for 48–72 h.
[0142] 5. After co-culture, the callus tissue was rinsed with carbenicillin-resistant sterile water to remove Agrobacterium.
[0143] 6. Dry the callus tissue and inoculate it onto a selection medium containing antibiotics, then culture it under light for two weeks.
[0144] 7. Callus differentiation culture: Select vigorous callus tissue (resistant callus tissue) and transfer it to a differentiation medium containing antibiotics. Within a week, most callus tissue grows rapidly, and green spots appear on the surface of the callus tissue. The green callus tissue will quickly differentiate into seedlings.
[0145] 3. Plant culture and mutant screening
[0146] A) Transfer the differentiated robust seedlings to a rooting medium containing antibiotics for one week of rooting culture, harden them off at room temperature for 2-3 days, and then transplant them into the field after 15-20 days of substrate cultivation in a greenhouse.
[0147] B) Take leaves from each plant, extract genomic DNA, and design primers on both sides of the target site. Perform Sanger sequencing on the amplified fragments to determine the genotype of each plant.
[0148] C) Detect the mutation types of MIR396e and MIR396f genes. In the T0 generation, a series of mutation types in the miR396e / f mature region were screened, and the mutation type population was continuously increased through 4-5 generations of continuous propagation.
[0149] D) Using miR396e / f as a detection probe, Northern blot hybridization was used to detect the accumulation levels of mature miR396e and miR396f in the mir396e / f mutant.
[0150] 4. Detection of nitrogen utilization rate
[0151] A) Select seeds from wild-type plants and three homozygous mutant plants of mir396e / f. Treat the seeds in nitrogen-rich and nitrogen-deficient culture media and culture them under suitable light, temperature and humidity conditions for 2-3 weeks.
[0152] B) Subsequently, the nitrogen accumulation levels in wild-type and mutant plants under different culture conditions were examined;
[0153] C) Using qRT-PCR technology, the expression levels of nitrogen-related genes in wild-type and mutant rice miR396e / f under low nitrogen conditions were detected to further clarify the regulatory role of OsmiR396e / f in responding to plant abiotic stress.
[0154] 5. Detection of expression levels of genes related to nitrogen uptake and utilization in wild-type and mir396ef mutant plants.
[0155] The NIR1, NIR2, GOGAT2, and GS1.2 genes encode enzymes involved in nitrogen uptake and assimilation, while the OsAAPs gene is associated with amino acid transport, regulating nitrogen utilization and determining the transfer of amino acids from source to sink. The expression levels of these genes in wild-type and mutant strains were detected using RT-qPCR.
[0156] 6. Experimental Results
[0157] Detection revealed almost no accumulation of mature mir396e / f mutants. Figure 1 This indicates that our base alterations to the mature region of miR396e / f caused miR396e / f to lose its biological function.
[0158] Nitrogen accumulation in the plants was measured, and the results showed that under normal cultivation conditions and low-nitrogen conditions without nitrogen fertilizer, the mir396e / f mutant accumulated more nitrogen than the wild type. Figure 2 ).
[0159] The results of gene expression analysis related to nitrogen uptake and utilization showed that, compared with the wild type, the expression of NIR1, NIR2, GOGAT2, GS1.2, and OsAAPs genes was increased in mir396ef mutant seedlings. Figure 3 ).
[0160] 7. Experimental Conclusions
[0161] MIR396e and MIR396f are closely related to nitrogen assimilation and utilization. Silencing or losing the function of the MIR396e and / or MIR396f genes can upregulate the expression of genes related to nitrogen assimilation and utilization, thereby improving the nitrogen utilization rate of crops.
[0162] The above experiments demonstrate that we can improve nitrogen utilization in plants by regulating the MIR396e and / or MIR396f genes or their encoding RNA, thereby reducing nitrogen fertilizer usage and environmental pollution while ensuring yield.
[0163] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims. sequence list <110> Shandong Shunfeng Biotechnology Co., Ltd. <120> Application of a mutant of miR396 or its encoding gene <130> P2019-0895 <160> 14 <170> SIPOSequenceListing 1.0 <210> 1 <211> 184 <212> RNA <213> Artificial sequence <400> 1 gcgggcaugc uuuccacagg cuuucuugaa cugugaacuc gugggggugu augugcucau 60 guugggauug uggucggugg ccuccaauuc ucugaaaaga aagcugaauu gucgagcucc 120 ccguucuguc uuuggucguc ucuaccuguu gaugguucaa gaaagcccau ggaaaccaug 180 ccgc 184 <210> 2 <211> 176 <212> RNA <213> Artificial sequence <400> 2 gccaugcucu ccacaggcuu ucuugaacug ugaacucgug ugugcaugcu ccucauauau 60 uguucuagau cccaugcaug augcauaucg aucgaucuga ucugaauuag gucaucgaug 120 cgcaucugga uccccaucuu guugauaguu caagaaaguc cuuggaaaac auggug 176 <210> 3 <211> 25 <212> DNA <213> Artificial sequence <400> 3 tgtgtggtgc agttcaagaa agctg 25 <210> 4 <211> 25 <212> DNA <213> Artificial sequence <400> 4 aaaccagctt tcttgaactg cacca 25 <210> 5 <211> 25 <212> DNA <213> Artificial sequence <400> 5 tgtgtgcaca gttcaagaaa gcctg 25 <210> 6 <211> 25 <212> DNA <213> Artificial sequence <400> 6 aaaccaggctttcttgaactgtgca 25 <210> 7 <211> 25 <212> DNA <213> Artificial sequence <400> 7 tgtgtgcggg gggcggcatt tccac 25 <210> 8 <211> 25 <212> DNA <213> Artificial sequence <400> 8 aaacgtggaa atgccgcccc ccgca 25 <210> 9 <211> 25 <212> DNA / RNA <213> Artificial sequence <400> 9 tgtgtgcgac gagcugcgct tccac 25 <210> 10 <211> 25 <212> DNA <213> Artificial sequence <400> 10 aaacgtggaa gcgcagctcg tcgca 25 <210> 11 <211> 25 <212> DNA <213> Artificial sequence <400> 11 tgtgtgtggccaaggacatttccac 25 <210> 12 <211> 25 <212> DNA <213> Artificial sequence <400> 12 aaacgtggaa atgtccttgg ccaca 25 <210> 13 <211> 25 <212> DNA <213> Artificial sequence <400> 13 tgtgtgctca tgttgggatt gtggt 25 <210> 14 <211> 25 <212> DNA <213> Artificial sequence <400> 14 aaacaccaca atcccaacat gagca 25
Claims
1. A method for (a) improving nitrogen fertilizer utilization efficiency in plants; and / or (b) reducing the amount of nitrogen fertilizer applied, characterized in that, include: Reduce the expression or activity of miR396 in plants; wherein miR396 is miR396e and miR396f, and the plant is rice; The reduction of miR396 expression or activity in plants is achieved through one or more of the following methods: Gene mutation, gene knockout, gene interruption, RNA interference technology, CRISPR technology, or a combination thereof.
2. The method as described in claim 1, characterized in that, The reduction of miR396 expression or activity in plants is achieved through any of the following methods: I. Mutate the precursor sequence of miR396 to reduce the expression or activity of the mature miR396 sequence; II. Mutate the mature sequence of miR396 to reduce its expression or activity.
3. Use of a composition, said composition comprising: (i) a miR396 inhibitor; and (ii) an agronomically acceptable carrier; characterized in that it is used for (a) improving nitrogen fertilizer use efficiency in plants; and / or (b) reducing the amount of nitrogen fertilizer applied; wherein the miR396 is miR396e and miR396f, and the plant is rice; wherein the miR396 inhibitor is any one or more of the following: Small molecule compounds, antisense nucleic acids, microRNA, siRNA, RNAi, CRISPR reagent, or combinations thereof.
Citation Information
Patent Citations
Gene capable of increasing nitrogen fertilizer utilization efficiency and yield of rice and application thereof
CN107937416A
Application of miR396e and miR396f in regulation and control of plant type, panicle type and grain weight of rice
CN108660245A