TNF-Targeting Aptamers for Treating or Diagnosing TNF-Related Inflammatory Diseases and Their Uses

By developing anti-TNFα nucleic acid aptamer of 200 nucleotides in length, the problem of lack of effective targeting and detection of TNFα in the prior art is solved, effective treatment and diagnosis of TNF-mediated diseases is achieved, reducing liver damage and promoting liver regeneration, while avoiding the side effects of long-term inhibition of TNF signaling.

CN112567037BActive Publication Date: 2025-07-04周美吟 +1
View PDF 18 Cites 0 Cited by

Patent Information

Application Number
CN201880094692.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2018-04-20
Filing Date
2018-12-21
Publication Date
2025-07-04
Estimated Expiration
2038-12-21

AI Technical Summary

Technical Problem

There is a lack of effective non-protein agents in the prior art to target and detect tumor necrosis factor alpha (TNFα), direct antibody therapy may cause antibody-dependent cell-mediated cytotoxicity and complement-dependent cytotoxicity, and lack of conventional predictive markers and diagnostic tools for TNF concentrations in vivo.

Method used

Anti-TNFα nucleic acid aptamers, up to 200 nucleotides in length, have the ability to bind to and neutralize their activity, for in vivo treatment and diagnosis by conjugating with detectable markers, including intratracheal administration to alleviate TNF-mediated disease and monitor TNF presence.

Benefits of technology

Effectively inhibit TNF signaling, reduce acute liver damage, promote liver regeneration, and can be used for in vivo imaging, providing a diagnostic tool for TNF concentration, and avoiding the side effects of long-term inhibition of TNF signaling.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN112567037B_ABST
    Figure CN112567037B_ABST
Patent Text Reader

Abstract

The present disclosure relates to nucleic acid aptamers that bind to tumor necrosis factor α (TNF). The present disclosure further provides pharmaceutical compositions comprising these anti-TNF aptamers, as well as methods for using them in therapeutic and diagnostic applications, e.g., reducing liver injury and monitoring the presence of TNF in vivo or in vitro.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Cross - Reference to Related Applications

[0002] This application claims the benefit of U.S. Provisional Application No. 62 / 660,324, filed on Apr. 20, 2018, the entire content of which is incorporated herein by reference. Technical Field

[0003] The present disclosure relates to nucleic acid aptamers for treating tumor necrosis factor α (TNFα)-related inflammatory diseases, and methods for using them in therapeutic and diagnostic applications. Background Art

[0004] Tumor necrosis factor α (TNFα or TNF) is a cytokine involved in inflammation. It is mainly secreted by activated macrophages and other immune cells such as lymphocytes, neutrophils, and NK cells. TNF forms a homotrimer under physiological conditions and binds to its receptor TNFR1 or TNFR2 to trigger downstream NF-κB, MAPK, or death signaling pathways, which regulate cell proliferation, differentiation, or apoptosis. TNF plays a role in almost all types of inflammation-related diseases, and dysregulated TNF secretion causes diseases including rheumatoid arthritis, psoriasis, ankylosing spondylitis, inflammatory bowel disease, neurodegenerative diseases, liver injury, and cancer.

[0005] However, antibodies that directly counter TNF can induce antibody - dependent cell - mediated cytotoxicity (ADCC) and complement - dependent cytotoxicity (CDC) against cells expressing membrane - bound TNF such as Kupffer cells and polymorphonuclear leukocytes, and there are no conventional predictive markers for TNF concentration or diagnostic tools for detecting TNF in vivo. In addition, protein - based drugs such as antibodies require cell - based production systems, which are usually expensive and have batch - to - batch variations.

[0006] Therefore, it is highly desirable to develop non - protein reagents for targeting and detecting TNF. Summary of the Invention

[0007] The present disclosure is based on the development of anti - TNFα (i.e., anti - TNF) nucleic acid aptamers that inhibit TNF signaling in vitro and attenuate TNF - mediated acute liver injury in vivo.

[0008] Accordingly, one aspect of the present disclosure features nucleic acid aptamers (anti - TNF aptamers) that bind TNF and neutralize TNF activity. The length of any nucleic acid aptamer of the present disclosure can be up to 200 nucleotides (nts). For example, the anti - TNF nucleic acid aptamer can consist of 40 to 100 nucleotides.

[0009] In some specific embodiments, the nucleic acid aptamer comprises a nucleic acid motif having the nucleotide sequence 5'-GCGCCACTACAGGGGAGCTGCCATTCGAATAGGTGGGCCGC-3' (SEQ ID NO: 1). This anti-TNF aptamer may comprise a nucleic acid sequence that is at least 85% identical to SEQ ID NO: 1 (e.g., at least 90%, at least 95% or higher). In one embodiment, the nucleic acid aptamer comprises the nucleic acid sequence of SEQ ID NO: 1. In another embodiment, the nucleic acid aptamer consists of the nucleic acid sequence of SEQ ID NO: 1.

[0010] In some specific embodiments, the nucleic acid aptamer is conjugated to a polyethylene glycol (PEG) moiety (e.g., a PEG moiety having a molecular weight of about 15 to 40 kDa).

[0011] In some specific embodiments, the nucleic acid aptamer presents in a dimer form containing two nucleic acid aptamer copies. In some specific embodiments, the PEG moiety links the two nucleic acid aptamer copies.

[0012] In some specific embodiments, the nucleic acid aptamer is conjugated to a detectable label.

[0013] Another aspect of the present disclosure features a pharmaceutical composition comprising any anti-TNF aptamer described herein and a pharmaceutically acceptable carrier.

[0014] In another aspect, the present disclosure provides a method for inhibiting TNF activity in an individual, which includes administering to an individual in need thereof an effective amount of any nucleic acid aptamer described herein. In some specific embodiments, the individual is a human patient suffering from a TNFα-mediated disease, suspected of suffering from a TNFα-mediated disease, or at risk of a TNFα-mediated disease (e.g., rheumatoid arthritis, psoriasis, Crohn's disease, acute liver injury, acute lung injury (ALI), acute lung failure, systemic inflammatory response syndrome (SIRS)-associated encephalopathy, acute respiratory distress syndrome, dry eye, uveitis, acute pancreatitis, acute glomerular injury, acute renal failure, ANCA-associated vasculitis or acute encephalopathy). In some specific embodiments, the individual has received or is undergoing treatment involving a TNF antagonist. In some specific embodiments, the individual is in the acute phase of the disease.

[0015] In another aspect, the present disclosure provides a method for reducing liver injury or promoting liver regeneration, comprising administering an effective amount of any of the nucleic acid aptamers described herein to an individual in need thereof. In some specific embodiments, the individual has liver injury associated with liver diseases (e.g., hepatitis, cirrhosis, liver fibrosis, fatty liver disease, liver cancer, or acute liver injury). In some specific embodiments, the amount of the nucleic acid aptamer administered is sufficient to reduce the level of serum aspartate aminotransferase (AST), the level of serum alanine aminotransferase (ALT), or both in the individual. In some specific embodiments, the amount of the nucleic acid aptamer administered is sufficient to reduce neutrophil infiltration into the liver of the individual.

[0016] In any of the methods disclosed herein, the nucleic acid aptamer can be administered to an individual in need of treatment by an intratracheal route. In some specific embodiments, the aptamer can be administered by inhalation or subcutaneous injection.

[0017] Furthermore, the present disclosure provides a method for detecting the presence of TNF in a sample, the method comprising contacting a TNF-specific nucleic acid aptamer conjugated with a detectable label described herein with a biological sample suspected of containing TNF, and examining the binding of the nucleic acid aptamer to TNF in the sample.

[0018] In another aspect, the present disclosure provides a method for in vivo monitoring of tumor necrosis factor α (TNF), the method comprising administering an effective amount of a TNF-specific nucleic acid aptamer conjugated with a detectable label to an individual in need thereof, and detecting the location of the nucleic acid aptamer based on the signal released by the detectable label. In some specific embodiments, the individual is a human patient suffering from or suspected of suffering from a liver disease. In some specific embodiments, the detecting step is performed by measuring the signal level released by the detectable label located at the liver of the human patient.

[0019] Details of one or more specific embodiments of the present disclosure are set forth in the following description. Other features or advantages of the present disclosure will be apparent from the following drawings, detailed description of several embodiments, and the appended claims. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 is a schematic diagram showing that aptTNF-α and / or aptTNF-α-PEG can be used to inhibit TNF-α-mediated apoptosis during the acute injury phase without affecting the proliferative signaling during the tissue repair phase.

[0021] Figures 2A to 2G includes data showing that aptTNF-α binds to human TNFα with high affinity and can be used as a molecular imaging probe for in vivo monitoring of TNFα. Figure 2A : Structure of exemplary aptTNF-α. The aptTNF-α comprises SEQ ID NO: 1.Figure 2B : Chart of the dissociation constant of aptTNF-α and human TNFα (left figure) and a chart showing the binding of aptTNF-α to human and mouse TNFα (n = 3, right figure). Figure 2C : Photos showing the detection of aptTNF-α signal in mice with and without ALI (n = 3). Figure 2D : Quantify Figure 2C Chart of the aptTNF-α signal in Figure 2E : Showing 4 hours after the administration of the aptamer (n = 3), A series of photos of the biodistribution of 800CW-labeled aptTNF-α. Figure 2F : Quantify Figure 2E Shown in Chart of the biodistribution of 800CW-labeled aptTNF-α. Figure 2G : A series of charts showing the levels of LDH, AST, and ALT in serum 4 hours after the administration of the aptamer (n = 5).

[0022] Figures 3A to 3C Including data showing that the inhibition duration of aptTNF-α-PEG on the TNFα pathway is shorter than that of the anti-TNFα antibody. Figure 3A : Schematic diagram of the exemplary dimer aptTNF-α-PEG, and the aptTNF-α aptamer contains two copies of SEQ ID NO: 1. Figure 3B : Chart showing the binding of aptTNF-α-PEG to mouse TNFα (n = 3). Figure 3C : Chart showing the inhibitory effects of aptTNF-α, aptTNF-α-PEG, and anti-TNFα antibody confirmed by TNF-α / NF-kB reporter gene assay 4 hours (upper figure) and 24 hours (lower figure) after TNFα treatment (n = 3).

[0023] Figures 4A to 4J Including data showing the inhibition of LPS-induced ALI by intratracheal (i.t.) or intravenous (i.v.) delivery of aptTNF-α and aptTNF-α-PEG. Figure 4A : Chart showing the effect of intratracheal or intravenous administration of aptTNF-α-PEG on blood oxygen saturation level. Figure 4B : Chart showing the effect of intratracheal or intravenous administration of aptTNF-α-PEG on the wet lung weight normalized by body weight. Figure 4C : A series of photos showing hematoxylin and eosin (H&E) staining and neutrophil staining of lung tissue. Figure 4D : Chart showing the effect of intratracheal or intravenous administration of aptTNF-α-PEG on lung injury score.Figure 4E : Chart showing the effect of intratracheal or intravenous administration of different concentrations of aptTNF-α-PEG on total protein in bronchoalveolar lavage fluid (BALF). Figure 4F : Chart showing the effect of intratracheal or intravenous administration of different concentrations of aptTNF-α-PEG on total cell count in BALF. Figure 4G : Chart showing the effect of intratracheal or intravenous administration of different concentrations of aptTNF-α-PEG on myeloperoxidase (MPO) activity in BALF. Figures 4H to 4J : A series of graphs showing the expression levels of specified cytokines / chemokines in lung tissue. Figures 4A to 4J Includes data from different treatment groups (n = 6). Treatment doses are expressed as μg / kg.

[0024] Figures 5A to 5G Includes data showing that aptTNF-α and aptTNF-α-PEG attenuate the degree of D-GalN / TNFα-induced acute liver injury and enhance early liver regeneration. Figure 5A : A series of photographs showing that the aptTNF-PEG conjugate rescued severe hepatocyte death and bleeding (H&E staining) in liver tissue induced by TNF and D-GalN, and that neutrophil infiltration (neutrophil staining) was inhibited by treatment with aptTNF-α-PEG. Figure 5B : Chart showing that aptTNF-α and aptTNF-α-PEG have excellent effects on reducing serum AST levels induced by D-GalN and TNF compared to NAC. Figure 5C : Chart showing that treatment with aptTNF and aptTNF-α-PEG significantly inhibits TNF- and D-GalN-induced serum ALT levels in a mouse model of acute liver injury. Figures 5D to 5F : A series of graphs showing that the expression levels of pro-inflammatory cytokines (IL1β, IL6) and neutrophil recruitment chemokine (CXCL2) are increased by TNF and D-GalN injection and decreased by treatment with aptTNF-α or aptTNF-α-PEG. Figure 5G : Photographs showing that treatment with aptTNF-α or aptTNF-α-PEG increases PCNA protein expression and promotes liver regeneration in a mouse model of acute liver injury. Figures 5A to 5G Includes data from liver tissue of different treatment groups (n = 6). Treatment doses are expressed as μg / kg.

[0025] Figure 6 is a photograph showing that aptTNF-α or aptTNF-α-PEG inhibits caspase-3 activation in liver tissue.

[0026] Figure 7A series of graphs showing that the expression levels of macrophage recruitment chemokine (CCL2) and neutrophil recruitment chemokines (IL23 and IL17) are increased by TNFα and D-GalN injection and decreased by aptTNF-α-PEG treatment.

[0027] Figure 8 A series of graphs showing that in a mouse model of acute liver injury, aptTNF-α and aptTNF-α-PEG treatment increase the expression of cyclin d1 (CCND1) and PCNA mRNA and promote liver regeneration.

[0028] Figures 9A to 9C Including data showing that aptTNF-α can be used as a diagnostic agent for in vivo monitoring of liver TNFα. Figure 9A : A series of photographs showing 800CW-labeled aptTNF-α specifically localizes to the livers of mice with endogenous TNFα secretion and acute liver injury induced by LPS and D-GalN, but not to the livers of mice without LPS and D-GalN injection, although aptTNF-α is excreted into the bladder in both groups. Figure 9B : Showing from the liver Total flux graph of 800DW-labeled aptTNF-α over time. Figure 9C : Showing in a mouse model of acute liver injury induced by LPS and D-GalN injection, Photographs of 800DW-labeled aptTNF-α localized to the kidneys and liver. Detailed implementation

[0029] The present disclosure is based in part on the development of anti-TNF nucleic acid aptamers (aptTNF) and their PEG conjugates, which have shown excellent effects in inhibiting TNF signaling and reducing TNF-mediated acute liver injury in vivo. For example, exemplary aptamers (e.g., aptTNF or aptTNF-PEG) have been found to be as effective as or superior to anti-TNF antibodies in inhibiting TNF signaling in vitro. In addition, results obtained from animal models of acute liver injury showed that, for reducing the levels of serum aminotransferases, exemplary anti-TNF aptamers showed a similar or more effective therapeutic effect as N-acetylcysteine (a commonly used therapeutic agent for acute liver injury), which led to a reduction in neutrophils infiltrating into the liver and promoted liver regeneration. Thus, anti-TNF aptamers as described herein can be used to reduce inflammation, reduce liver injury, and / or promote liver regeneration, thereby effectively treating TNF-mediated diseases, such as liver diseases. Anti-TNF aptamers also showed tissue-protective and systemic anti-inflammatory effects in a mouse model of acute lung injury. In addition, given the binding affinity for TNF, any anti-TNF aptamer can also be used as a diagnostic reagent for detecting the presence and / or level of TNF in vitro or in vivo. The presence and / or level of TNF can serve as a biomarker related to inflammatory disorders and cancers associated with TNF signaling.

[0030] Accordingly, anti-TNF aptamers, pharmaceutical compositions containing the same, and methods of using the same for therapeutic and / or diagnostic purposes are described herein.

[0031] Anti-TNF aptamer

[0032] Described herein are nucleic acid aptamers (anti-TNF aptamers) that bind to TNF and inhibit TNF-mediated signaling, which would, as expected, reduce inflammation. As used herein, a nucleic acid aptamer refers to a nucleic acid molecule (DNA or RNA) that has binding activity to a specific target molecule (TNF, e.g., human TNF). The aptamer can block TNF-mediated signaling by binding to the TNF molecule. The anti-TNF aptamers of the present disclosure, in linear or circular form, can be RNA, DNA (e.g., single-stranded DNA), modified nucleic acids, or mixtures thereof. The anti-TNF aptamer can be a non-naturally occurring molecule (e.g., containing a nucleotide sequence not present in natural genes or containing modified nucleotides not naturally present). Alternatively or additionally, the anti-TNF aptamer may not contain a nucleotide sequence encoding a functional peptide.

[0033] TNF, refers to tumor necrosis factor (also known as tumor necrosis factor α, TNFα, cachexin or cachectin), which is a cytokine related to inflammation. It is mainly produced by activated macrophages, but can also be produced by other cell types, including neutrophils, mast cells and lymphocytes. In humans, TNF is encoded by the TNFA gene, and an exemplary human TNF sequence is provided under GenBank accession number NP_000585.2.

[0034] The anti-TNF nucleic acid aptamers disclosed herein may comprise a nucleotide sequence that is at least 85% (e.g., 90%, 95% or 98%) identical to 5’-GCGCCACTACAGGGGAGCTGCCATTCGAATAGGTGGGCCGC-3’

[0035] (SEQ ID NO: 1).

[0036] The "percentage of similarity" between two nucleic acids is determined using the algorithm of Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5877, as modified from Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264-2268. These algorithms are incorporated into the NBLAST and XBLAST programs (version 2.0) of Altschul et al. (1990) J. Mol. Biol. 215:403-410. The BLAST nucleotide search can be performed with the NBLAST program, score = 100, wordlength = 12, to obtain nucleotide sequences homologous to the nucleic acid molecules disclosed herein. When there are gaps between two sequences, the Gapped BLAST program described in Altschul et al. (1997) Nucleic Acids Res. 25(17):3389-3402 can be used. When using the BLAST and Gapped BLAST programs, the default parameters of each program (e.g., XBLAST and NBLAST) can be used.

[0037] In other specific embodiments, compared to the nucleotide sequence of 5’-GCGCCACTACAGGGGAGCTGCCATTCGAATAGGTGGGCCGC-3’

[0038] (SEQ ID NO: 1), the anti-TNF aptamers described herein may contain up to 5 (e.g., up to 5, 4, 3, 2 or 1) nucleotide variations. As Figure 2AAs shown, certain portions of SEQ ID NO: 1 form a duplex structure. In some cases, the nucleotides involved in one or more base pairs in any duplex segment can be converted or replaced with different base pairs. These variants will maintain the same secondary structure as Figure 2A SEQ ID NO: 1 shown therein and maintain all loop structures / sequences.

[0039] Any anti-TNF aptamer disclosed herein can contain up to 200 nucleotides (nts), such as 150 nts, 100 nts, 80 nts, 70 nts, 60 nts, 50 nts, 40 nts, or 30 nts. In some embodiments, the anti-TNF aptamer can contain nucleotides in the range of 30 to 150 nts, 30 to 100 nts, 30 to 80 nts, 30 to 70 nts, 30 to 60 nts, 30 to 50 nts, or 30 to 40 nts.

[0040] The anti-TNF aptamer can specifically bind human TNF. Alternatively, the aptamer can bind TNF molecules from different species (e.g., human and mouse). When bound to TNF, this aptamer can block TNF-mediated cell signaling by at least 20% (e.g., 40%, 50%, 80%, 100%, 2-fold, 5-fold, 10-fold, 100-fold, or 1,000-fold). The inhibitory activity of the TNF aptamer on TNF-mediated signaling can be confirmed by conventional assays and / or those described in the following examples.

[0041] In some specific embodiments, the anti-TNF aptamers described herein can contain non-naturally occurring nucleobases, sugars, or covalent internucleoside linkages (backbones). This modified oligonucleotide confers desired properties, such as enhanced cellular uptake, improved affinity for the target nucleic acid, and increased in vivo stability.

[0042] In one embodiment, the aptamers described herein have modified backbones, including those that retain a phosphorus atom (see, e.g., U.S. Pat. Nos. 3,687,808, 4,469,863, 5,321,131, 5,399,676, and 5,625,050) and those that do not have a phosphorus atom (see, e.g., U.S. Pat. Nos. 5,034,506, 5,166,315, and 5,792,608). Examples of phosphorus-containing modified backbones include, but are not limited to, phosphorothioates, chiral phosphorothioates, dithiophosphates, phosphotriesters, aminoalkyl phosphotriesters, methyl and other alkyl phosphates (including 3'-alkylene phosphates, 5'-alkylene phosphates, and chiral phosphates), phosphinates, phosphoramidates (including 3'-aminophosphoramidates and aminoalkyl phosphoramidates), phosphorothioamides, thioalkyl phosphates, thioalkyl phosphotriesters, selenophosphates, and boranophosphates, having 3'-5' linkages, or 2'-5' linkages. These backbones also include backbones having inverse polarity, i.e., 3' to 3', 5' to 5', or 2' to 2' linkages. Modified backbones that do not have a phosphorus atom are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatom or heterocyclic internucleoside linkages. These backbones include those having morpholino linkages (formed in part from the sugar portion of the nucleoside); siloxane backbones; sulfide, sulfoxide, and sulfone backbones; formyl and thioformyl backbones; methyleneformyl and thioformyl backbones; ribosylacetyl backbones; olefin-containing backbones; sulfamic acid backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and other backbones having other components with mixed N, O, S, and CH2 components.

[0043] In another embodiment, the aptamers described herein include one or more substituted sugar moieties. These substituted sugar moieties can include one of the following groups at their 2'-position: OH; F; O-alkyl, S-alkyl, N-alkyl, O-alkenyl, S-alkenyl, N-alkenyl; O-alkynyl, S-alkynyl, N-alkynyl, and O-alkyl-O-alkyl. Among these groups, the alkyl, alkenyl, and alkynyl can be substituted or unsubstituted C1 to C10 alkyl or C2 to C10 alkenyl and alkynyl. They can also include heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, RNA cleaving group, reporter group, intercalator, a group for improving the pharmacokinetic properties of the oligonucleotide, or a group for improving the pharmacodynamic properties of the oligonucleotide at their 2'-position. Preferred substituted sugar moieties include moieties having 2'-methoxyethoxy, 2'-dimethylaminooxyethoxy, and 2'-dimethylaminoethoxyethoxy. See Martin et al. (1995) Helv. Chim. Acta, 78, 486-504.

[0044] Alternatively or additionally, the aptamers described herein include one or more modified natural nucleobases (i.e., adenine, guanine, thymine, cytosine, and uracil). Modified nucleobases include those described in, for example, U.S. Patent No. 3,687,808; Concise Encyclopedia of Polymer Science and Engineering, pp. 858-859, Kroschwitz, J.I. ed., John Wiley & Sons, 1990; Englisch et al., Angewandte Chemie, Int. Ed., 1991, 30, 613; and Sanghvi, Y.S., Chapter 15, Antisense Research and Applications, pp. 289-302, CRC Press, 1993. Some of these nucleobases are particularly useful for increasing the binding affinity of the aptamer molecule to its target site. These include 5-substituted pyrimidines, 6-aza pyrimidines, and N-2, N-6, and O-6 substituted purines (e.g., 2-aminopropyl-adenine, 5-propynyluracil, and 5-propynylcytosine). See Sanghvi et al. eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278.

[0045] Any of the aptamers described herein can be prepared by conventional methods, such as chemical synthesis or in vitro transcription. Their expected biological activities as described herein can be verified by those described in the following examples. Vectors for expressing any anti-TNF aptamer are also within the scope of the present disclosure.

[0046] Any aptamer described herein can be conjugated to one or more polyether moieties (such as polyethylene glycol (PEG) moieties) by covalent bonds, non-covalent bonds, or both. Thus, in some specific embodiments, the aptamers described herein are PEGylated. The present disclosure is not meant to limit the PEG moieties to a particular molecular weight. In some specific embodiments, the molecular weight of the polyethylene glycol moiety ranges from 5 kDa to 100 kDa, 10 kDa to 80 kDa, 20 kDa to 70 kDa, 20 kDa to 60 kDa, 20 kDa to 50 kDa, 10 kDa to 40 kDa, 10 kDa to 30 kDa, 15 kDa to 40 kDa, 15 kDa to 30 kDa, 15 kDa to 35 kDa, 15 kDa to 25 kDa, 20 kDa to 40 kDa, 20 kDa to 35 kDa, or 20 kDa to 30 kDa. In some embodiments, the PEG moiety has a molecular weight of 20 kDa. The PEG moiety conjugated to the anti-TNF aptamer described herein can be linear or branched. It can be conjugated to the 5'-end of the nucleic acid aptamer, the 3'-end of the aptamer, or both. When needed, the PEG moiety can be covalently conjugated to the 3'-end of the nucleic acid aptamer. PEG conjugation is expected to extend the half-life of the nucleic acid aptamer.

[0047] Methods for conjugating PEG moieties to nucleic acids are known in the art and have been previously described, for example, in PCT Publication WO 2009 / 073820 A2, the relevant teachings of which are incorporated herein by reference. It should be understood that the PEG-conjugated nucleic acid aptamers and the methods for conjugating PEG to the nucleic acid aptamers described herein are exemplary and not meant to be limiting.

[0048] In some cases, the nucleic acid aptamer can be conjugated to one or more N-acetylglucosamine (GalNAc) moieties to facilitate tissue-specific delivery (such as liver delivery).

[0049] The anti-TNF nucleic acid aptamer can be presented in a multimeric form, for example, a dimeric form. In some specific embodiments, the anti-TNF aptamer dimer can comprise two anti-TNF aptamers linked by a suitable polymeric moiety, which can be a PEG moiety as described herein. Non-limiting examples of the dimeric anti-TNF aptamer are shown in Figure 3A . One or both of the two aptamers in the dimer can comprise the nucleotide sequence of SEQ ID NO: 1. The two anti-TNF aptamers can be the same or different. For example, one or both of the anti-TNF aptamers can comprise SEQ ID NO: 1. In some specific embodiments, the anti-TNF nucleic acid aptamer is an anti-TNF aptamer dimer in which two aptamers having SEQ ID NO: 1 are linked by PEG.

[0050] Any anti-TNF aptamer described herein can be chemically synthesized. The aptamer can be manipulated with functional groups to conjugate with a drug for therapeutic purposes or with a detectable label (e.g., an imaging agent such as a contrast agent) for in vivo or in vitro diagnostic purposes. As used herein, "conjugated" or "attached" means that two entities are associated, preferably with sufficient affinity to achieve the therapeutic / diagnostic benefit of the association between the two entities. The association between the two entities can be direct or through a linker, such as a polymeric linker. Conjugated or attached can include covalent or non-covalent linkages and other forms of association, such as entrapment of one or both entities on or within another or within a third entity, such as a micelle.

[0051] In one embodiment, an anti-TNF aptamer as described herein is attached to a detectable label, which is a compound capable of directly or indirectly releasing a detectable signal such that the aptamer can be detected, measured, and / or identified in vitro or in vivo. Examples of these "detectable labels" are intended to include, but are not limited to, fluorescent labels, chemiluminescent labels, colorimetric labels, enzyme labels, radioisotopes, and affinity labels such as biotin. These labels can be conjugated to the aptamer directly or indirectly by conventional methods.

[0052] In some specific embodiments, the detectable label is an agent suitable for imaging a TNF-mediated disease, which can be a radioactive molecule, radiopharmaceutical, or iron oxide particle. Radioactive molecules suitable for in vivo imaging include, but are not limited to, 122 I, 123 I, 124 I, 125 I, 131 I, 18 F, 75 Br, 76 Br, 76 Br, 77 Br, 211 At, 225 Ac, 177 Lu, 153 Sm, 186 Re, 188 Re, 67 Cu, 213 Bi, 212 Bi, 212 Pb and 67 Ga. Exemplary radiopharmaceuticals suitable for in vivo imaging include 111 In oxyquinoline, 131 I sodium iodide, 99m Tc mebrofenin, and 99mTechnetium (Tc) red blood cells, 123 Sodium (Na) iodide, 99m Technetium (Tc) exametazime, 99m Technetium (Tc) macroaggregate albumin, 99m Technetium (Tc) medronate, 99m Technetium (Tc) mertiatide, 99m Technetium (Tc) oxidronate, 99m Technetium (Tc) pentetate, 99m Technetium (Tc) pertechnetate, 99m Technetium (Tc) sestamibi, 99m Technetium (Tc) sulfur colloid, 99m Technetium (Tc) tetrofosmin, thallium-201, and xenon-133. The reporter agent can also be a dye, such as a fluorophore, which is useful for detecting TNF-mediated diseases in tissue samples.

[0053] Without being bound by a particular theory, the anti-TNF aptamers described herein can confer at least the following benefits. First, anti-TNF aptamers are small-sized molecules (e.g., having a molecular weight of about 14 kDa), which can penetrate the blood-brain barrier (BBB) and are useful for treating neurodegenerative diseases. Second, the production of anti-TNF aptamers does not require a cell-based system and is cost-effective. Third, compared to protein-based therapeutic agents (e.g., monoclonal antibodies), anti-TNF aptamers have a shorter half-life in vivo. Therefore, anti-TNF aptamers may be more suitable for treating acute inflammatory diseases because they are expected to block acute-phase TNF signaling without affecting the long-term innate immunity against infections.

[0054] Pharmaceutical composition

[0055] One or more anti-TNF aptamers (monomers or multimers, such as dimers) or their PEG conjugates as described herein can be mixed with a pharmaceutically acceptable carrier (excipient) to form a pharmaceutical composition for treating a target disease. "Acceptable" means that the carrier must be compatible with the active ingredient of the composition (and preferably, capable of stabilizing the active ingredient) and harmless to the individual to be treated. Pharmaceutically acceptable excipients (carriers) containing buffers are well known in the art. See, for example, Remington: The Science and Practice of Pharmacy (20th Edition), (2000), Lippincott Williams and Wilkins, edited by K.E. Hoover.

[0056] The pharmaceutical compositions for the methods of the present disclosure may comprise a pharmaceutically acceptable carrier, excipient, or stabilizer, and be in the form of a lyophilized preparation or an aqueous solution. See, e.g., Remington: The Science and Practice of Pharmacy (20th ed.) (2000), Lippincott Williams and Wilkins, edited by K.E. Hoover. Acceptable carriers, excipients, or stabilizers are non-toxic to the recipient at the dosages and concentrations employed and may include buffering agents, such as phosphates, citrates, and other organic acids; antioxidants, including ascorbic acid and methionine; preservatives (such as octadecyl dimethyl benzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens, such as methylparaben or propylparaben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); polypeptides of low molecular weight (less than about 10 residues); proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers, such as polyvinylpyrrolidone; amino acids, such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextran; chelating agents, such as EDTA; sugars, such as sucrose, mannitol, trehalose, or sorbitol; salt-forming counterions, such as sodium; metal complexes (e.g., zinc-protein complexes); and / or nonionic surfactants, such as TWEEN TM , PLURONICS TM or polyethylene glycol (PEG).

[0057] In some embodiments, the pharmaceutical compositions described herein include liposomes containing a TNF-binding aptamer (or a vector for generating the aptamer), which can be prepared by methods known in the art, such as Epstein et al. (1985), Proc. Natl. Acad. Sci. USA 82:3688; Hwang et al. (1980), Proc. Natl. Acad. Sci. USA 77:4030; and U.S. Patent Nos. 4,485,045 and 4,544,545. Liposomes with enhanced circulation times are disclosed in U.S. Patent No. 5,013,556. Particularly useful liposomes can be produced by the reverse-phase evaporation method using a lipid composition comprising phosphatidylcholine, cholesterol, and PEG-derived phosphatidylethanolamine (PEG-PE). The liposomes are extruded through a filter with a defined pore size to produce liposomes with the desired diameter.

[0058] The anti-TNF aptamers described herein can also be encapsulated in microcapsules prepared, for example, by coacervation techniques or by interfacial polymerization, such as in colloidal drug delivery systems (e.g., liposomes, albumin microspheres, microemulsions, nanoparticles, and nanocapsules) or in hydroxyethylcellulose or gelatin microcapsules and poly(methyl methacrylate) microcapsules in a coarse emulsion. These techniques are known in the art, see, for example, Remington: The Science and Practice of Pharmacy (20th Edition), Mack Publishing (2000).

[0059] In other embodiments, the pharmaceutical compositions described herein can be formulated in a sustained release form. Suitable examples of sustained release formulations include semipermeable matrices of solid hydrophobic polymers containing the TNF-binding aptamer, which matrices are in the form of shaped articles, e.g., films or microcapsules. Examples of sustained release matrices include polyesters, hydrogels (e.g., poly(2-hydroxyethyl methacrylate), or polyvinyl alcohol), polylactides (U.S. Patent No. 3,773,919), copolymers of L-glutamic acid and γ-ethyl-L-glutamate, non-degradable ethylene-vinyl acetate, degradable lactic acid-glycolic acid copolymers, such as LUPRON DEPOT TM (injectable microspheres composed of a lactic acid-glycolic acid copolymer and leuprolide acetate), sucrose acetate isobutyrate, and poly-D-(-)-3-hydroxybutyric acid.

[0060] The pharmaceutical compositions for in vivo administration must be sterile. This can be readily accomplished, for example, by filtration through sterile filtration membranes. The therapeutic TNF-binding aptamer composition can be placed in a container having a sterile access port, e.g., an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle.

[0061] The pharmaceutical compositions described herein can be in unit dosage forms, such as tablets, pills, capsules, powders, granules, solutions or suspensions, or suppositories for oral, parenteral or rectal administration, or administered by inhalation or insufflation.

[0062] For the preparation of solid compositions such as tablets, the main active ingredient can be mixed with a pharmaceutical carrier (e.g., conventional tableting ingredients such as corn starch, lactose, sucrose, sorbitol, talc, stearic acid, magnesium stearate, dibasic calcium phosphate or gums) and other pharmaceutical diluents (e.g., water) to form a solid pre - formulation composition containing a homogeneous mixture of the compounds of the present disclosure or their pharmaceutically acceptable non - toxic salts. When these pre - formulation compositions are referred to as homogeneous, it means that the active ingredient is uniformly dispersed throughout the composition such that the composition can be easily subdivided into equivalent unit dosage forms such as tablets, pills and capsules. The solid pre - formulation composition is then further divided into unit dosage forms of the above types, which contain from 0.1 to about 500 mg of the active ingredient of the present disclosure. Tablets or pills of the new composition can be coated or otherwise mixed to provide dosage forms with the advantage of extended action. For example, a tablet or pill can contain an inner dosage form and an outer dosage form component, the latter forming a coating on the former. These two components can be separated by an enteric layer which is used to resist disintegration in the stomach and allow the internal component to enter the duodenum intact or with delayed release. A variety of materials can be used for these enteric layers or coatings, including many polymeric acids and mixtures of polymeric acids with materials such as shellac, cetyl alcohol and cellulose acetate.

[0063] Suitable surfactants specifically include non - ionic agents such as polyoxyethylene sorbitan (e.g., Tween TM 20, 40, 60, 80 or 85) and other sorbitan anhydrides (e.g., Span TM 20, 40, 60, 80 or 85). Compositions with surfactants will conveniently contain from 0.05 to 5% of the surfactant and can be between 0.1 and 2.5%. It should be understood that other ingredients such as mannitol or other pharmaceutically acceptable carriers can be added if desired.

[0064] Suitable emulsions can be prepared using commercially available fat emulsions such as Intralipid TM 、Liposyn TM 、Infonutrol TM 、Lipofundin TM and Lipiphysan TM。The active ingredient can be dissolved in the premixed emulsion composition or can be dissolved in an oil (such as soybean oil, safflower oil, cottonseed oil, sesame oil, corn oil or almond oil) and forms an emulsion when mixed with a phospholipid (such as, lecithin, soy phospholipid or soy lecithin) and water. It should be understood that other ingredients, such as glycerol or glucose, can be added to adjust the tension of the emulsion. Suitable emulsions typically contain up to 20% oil, such as 5 to 20%. The fat emulsion may contain fat droplets of 0.1 to 1.0 μm, especially 0.1 to 0.5 μm, and have a pH of 5.5 to 8.0.

[0065] The emulsion composition can be prepared by mixing the anti-TNF aptamer with Intralipid TM or its components (soybean oil, lecithin, glycerol and water).

[0066] The pharmaceutical compositions for inhalation or insufflation include solutions and suspensions, as well as powders, in pharmaceutically acceptable aqueous or organic solvents or mixtures thereof. The liquid or solid compositions may contain suitable pharmaceutically acceptable excipients as described above. In some specific embodiments, the composition is administered via the oral or nasal respiratory route for local or systemic action.

[0067] Preferably, the composition in a sterile pharmaceutically acceptable solvent can be atomized using a gas. The atomized solution can be breathed directly from the atomizing device, or the atomizing device can be connected to a face mask, a tent or an intermittent positive pressure ventilator. The solution, suspension or powder composition can be administered by delivering the formulation from the device in a suitable manner, preferably orally or nasally.

[0068] Therapeutic and diagnostic applications

[0069] TNF plays a role in almost all types of inflammation-related diseases, and dysregulated TNF secretion causes diseases such as rheumatoid arthritis, psoriasis, ankylosing spondylitis, inflammatory bowel disease, neurodegenerative diseases, acute lung injury (or acute lung failure), acute liver injury, adult respiratory distress syndrome and cancer. Therefore, modulating TNF-mediated signal transduction and / or detecting the presence / level of TNF can effectively treat or diagnose TNF-mediated diseases.

[0070] Any anti-TNF aptamer or its PEG conjugate as described herein can be used for therapeutic and diagnostic purposes. For example, anti-TNF aptamers can be used to inhibit TNF-mediated signal transduction, thereby effectively treating TNF-mediated diseases, including rheumatoid arthritis, psoriasis, Crohn's disease, asthma, systemic inflammatory response syndrome (SIRS)-associated encephalopathy, liver diseases (such as acute liver injury), acute lung injury, acute respiratory distress syndrome, dry eye disease, uveitis, acute pancreatitis, acute glomerular injury, acute renal failure, ANCA-associated vasculitis, or acute encephalopathy.

[0071] Acute liver failure (ALF) or acute liver injury is a rare but life-threatening disease in which most hepatocytes undergo cell death in the absence of pre-existing liver disease (Bernal et al., N. Engl. J. Med. 2013; 369: 2525-34). As ALF progresses, dysfunction of other tissues (including cardiovascular, respiratory, renal, central nervous, and hematological systems) will soon occur. The only available treatment for ALF prior to liver transplantation is intravenous infusion of N-acetylcysteine (NAC) (Mumtaz et al., Hepatol. Int. 2009; 3(4): 563-70; Sales et al., Ann. Hepatol. 2013; 12(1): 6-10). However, NAC has shown no benefit in ALF patients with advanced cerebral edema (Lee et al., Gastroenterology 2009; 137: 856-64). Therefore, clinical alternatives remain an unmet need for ALF patients, especially those with encephalopathy, and centers without liver transplantation facilities.

[0072] The underlying mechanisms behind ALF include the interaction between hepatocytes and different types of immune cells (Possamai et al., J. Hepatol. 2014; 61(2):439-45). Once hepatocytes undergo cell death, the released danger-associated molecular patterns (DAMPs) will activate resident neutrophils and hepatic macrophages (Kupffer cells). Activated Kupffer cells will secrete tumor necrosis factor (TNF) and chemokines to recruit more monocytes and neutrophils to the damaged liver tissue, thereby exacerbating the death signaling in hepatocytes (Krenkel et al., 2014; 3(6):331-43; Bantel et al., Front Physiol. 2012; 3:79). In addition, TNF will affect the blood-brain barrier permeability, cause neuroinflammation, and trigger cerebral edema and encephalopathy (Lv et al., Liver Int. 2010; 30(8):1198-210; Bémeur et al., Neurochem. Int. 2010; 56(2):213-5; Butterworth et al., Hepatology. 2011; 53(4):1372-6). Although TNF blockers have shown promising therapeutic efficacy in animal models, they cause severe infections in patients with acute alcoholic hepatitis (Naveau et al., Hepatology 2004; 39:1390-1397; Boetticher et al., Gastroenterology 2008; 135:1953-1960). Severe infections may be caused by unnecessary antibody-dependent cell-mediated cytotoxicity (ADCC) and complement-dependent cytotoxicity (CDC) effects, which are caused by antibodies or Fc fusion recombinant proteins that recognize membrane-bound TNF expressed on macrophages, activated T lymphocytes, and polymorphonuclear leukocytes (Naveau et al., Hepatology 2004; 39:1390-1397; Tracey et al., Pharmacol. Ther. 2008; 117(2):244-79). In addition, the sustained inhibition of TNF / NF-κB signaling due to the long half-life of these TNF blockers prevents liver regeneration after acute liver injury (Naveau et al., Hepatology 2004; 39:1390-1397; Tracey et al., Pharmacol. Ther. 2008; 117(2):244-79; Bhushan et al., Am. J. Pathol. 2014; 184(11):3013-25).

[0073] Patients with higher TNF concentrations in serum may have a better response to anti-TNF therapy and reduce the side effects of infection. However, there is still no conventional predictive marker for TNF concentration or diagnostic tool for detecting TNF in vivo. As described above, the TNF aptamers disclosed herein can be manipulated and modified to conjugate to imaging agents for CT, MRI, ultrasound, and endoscopic detection (Bird-Lieberman et al., Nat. Med. 2012; 18(2): 315-21; Van den Brande et al., Gut. 2007; 56(4): 509-17). Using aptamers to pre-screen potential responders to anti-TNF therapy can improve safety and efficacy. In some specific embodiments, the anti-TNF aptamers disclosed herein have diagnostic and therapeutic effects and can be used as potential monitoring tools. Before TNF transplantation, the anti-TNF aptamers can provide an alternative treatment method for ALF patients.

[0074] In addition, the antidote for aptTNF- / aptTNF-α-PEG is the complementary sequence of the aptamer itself, which can be easily designed and synthesized, allowing for the immediate administration of the antidote. Without being bound by a particular theory, the anti-TNF aptamers described herein, optionally together with aptamer inhibitors (including antisense sequences), can allow for the appropriate inhibition of the TNFα pathway during the acute tissue injury phase, avoid inhibition of regeneration during the tissue repair phase, and strengthen the immediate termination of the anti-effect when needed.

[0075] SIRS is a common phenomenon that occurs during end-organ damage (Bernal et al., N. Engl. J. Med. 2013; 369: 2525-34; Ware et al., N. Engl. J. Med. 2000; 342: 1334-49; Gattinoni et al., Am. J. Resp. Crit. Care. 2016; 194: 1051-2). As demonstrated in the ALI model described below, in LPS-induced ALI, systemic LDH, AST, and ALT levels increase, and aptTNF-α signals are detected in the major vital organs. The surge of cytokine storm advances a single-organ disease into a systemic inflammatory disease and can lead to multiple organ dysfunctions, including the central nervous, cardiovascular, respiratory, gastrointestinal, renal, and hematological systems, etc. Without being bound by a particular theory, the small molecule-sized aptamers described herein can allow for effective tissue penetration. In some specific embodiments, the aptamers described herein can penetrate the blood-brain barrier. Without specific limitation, the anti-TNF aptamers described herein can be used to treat SIRS-related encephalopathy common in critical care medicine.

[0076] To practice the methods disclosed herein, an effective amount of a pharmaceutical composition containing at least one anti-TNF aptamer as described herein can be administered to an individual in need of treatment (e.g., a human) by a suitable route (e.g., intravenously), which is administered by a suitable route, such as by bolus injection or by intravenous infusion over a period of time, intramuscularly, intraperitoneally, intrathecal, subcutaneously, intra-articularly, intrasynovially, intrathecally, orally, by inhalation or by topical route. Commercially available nebulizers for liquid formulations, including jet nebulizers and ultrasonic nebulizers, are available for administration. Liquid formulations can be nebulized directly, while lyophilized powders can be nebulized after reconstitution. Alternatively, the compositions containing anti-TNF aptamers as described herein can be nebulized using a fluorocarbon formulation and a metered-dose inhaler, or inhaled as a lyophilized and milled powder.

[0077] As used herein, "effective amount" means the amount of each active agent that, alone or in combination with one or more other active agents, confers a therapeutic effect on an individual. In some specific embodiments, the therapeutic effect is to block TNF-mediated cell signaling, reduce inflammation, reduce liver injury, and / or increase liver regeneration. It will be apparent to those skilled in the art to determine whether the amount of TNF-binding aptamer achieves a therapeutic effect. As is known to those skilled in the art, the effective amount varies depending on the specific condition being treated, the severity of the condition, individual patient parameters, including age, physical condition, size, sex and weight, the duration of treatment, the nature of concurrent therapies (if any), the specific route of administration, and similar factors in the knowledge and expertise of the medical personnel. These factors are well known to those of ordinary skill in the art and can be addressed by routine experimentation alone. It is generally preferred to use the maximum dose of each component or combination thereof, i.e., the highest safe dose based on reasonable medical judgment.

[0078] Empirical considerations such as half-life will generally assist in determining the dose. The frequency of administration can be determined and adjusted during the course of treatment and is generally (but not necessarily) based on the treatment and / or inhibition and / or improvement and / or delay of the target disease / condition. Alternatively, sustained continuous release formulations of TNF-binding aptamers may be suitable. A variety of formulations and devices for achieving sustained release are known in the art.

[0079] In one embodiment, the dose of an anti-TNF aptamer as described herein can be determined empirically in an individual who has received one or more doses of a TNF-binding aptamer. The individual is given incremental doses of the antagonist. To evaluate the efficacy of the antagonist, the indicators of the disease / condition can be followed.

[0080] Typically, for administering any anti-TNF aptamer described herein, an initial candidate dose can be administered to an individual in need of treatment, which can be adjusted based on the individual's response to the anti-TNF aptamer. For the purposes of this disclosure, depending on the above factors, a typical daily dose can be any one of from about 0.1 μg / kg to 100 mg / kg or higher.

[0081] In some specific embodiments, for adult patients of normal body weight, a dose range of from about 0.3 to 5.00 mg / kg can be administered. The specific dosage regimen, i.e., dose, timing, and repetition, will depend on the particular individual and the individual's medical history, as well as the nature of the individual agent (e.g., the half-life of the agent and other considerations well known in the art).

[0082] For the purposes of this disclosure, a suitable dose of a TNF-binding aptamer as described herein will depend on the specific TNF-binding aptamer, the type and severity of the disease / condition, whether the TNF-binding aptamer is for prophylactic or therapeutic purposes, prior therapies, the patient's clinical history and response to the antagonist, and the discretion of the attending physician. The clinician can administer the TNF-binding aptamer until a dose that achieves the desired result is reached. In some specific embodiments, the desired result is a reduction in inflammation (e.g., a reduction in neutrophil infiltration into tissues), a reduction in liver damage, and / or an increase in liver regeneration. The method for determining whether a dose produces the desired result will be apparent to those skilled in the art. Administration of one or more TNF-binding aptamers can be continuous or intermittent, depending on, for example, the physiological condition of the recipient, whether the administration is for therapeutic or prophylactic purposes, and other factors known to the skilled person. Administration of the TNF-binding aptamer can be substantially continuous over a preselected period of time, or can be a series of spaced doses, e.g., before, during, or after the development of the target disease or condition.

[0083] As used herein, the term "treatment" refers to the administration or application to an individual of a composition comprising one or more active agents, said individual having a target disease or condition, symptoms of said disease / condition, or susceptibility to said disease / condition, with the purpose of curing, healing, alleviating, relieving, altering, remedying, improving, ameliorating, or affecting the disease, symptoms of the disease, or susceptibility to the disease or condition.

[0084] Reducing a target disease / condition includes delaying the development or progression of the disease or reducing the severity of the disease. Reducing a disease does not necessarily require a therapeutic effect. As used herein, "delaying" the development of a target disease or condition means postponing, hindering, slowing, retarding, stabilizing, and / or deferring the progression of the disease. These delays can have different time lengths, depending on the history of the disease and / or the individual being treated. A method of "delaying" or reducing the development of a disease or delaying the onset of a disease is a method of reducing the likelihood of occurrence of one or more disease symptoms and / or reducing the degree of symptoms within a given time frame. Within a given time frame, these comparisons are typically based on clinical studies using a sufficient number of individuals to give statistically significant results, as compared to not using the method.

[0085] "Development" or "progression" of a disease means the initial manifestation and / or subsequent progression of the disease. The development of a disease can be detected and evaluated using standard clinical techniques well known in the art. However, development also refers to progress that may not be detectable. For the purposes of this disclosure, development or progression refers to the biological process of symptoms. "Development" includes occurrence, recurrence, and onset. As used herein, "onset" or "occurrence" of a target disease or condition includes initial onset and / or recurrence.

[0086] In some specific embodiments, the TNF-binding aptamer described herein is administered to an individual in need of treatment in an amount sufficient to reduce TNF-mediated signal transduction by at least 5% (e.g., 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or higher), which can be confirmed by conventional assays and / or as described in the following examples. In some specific embodiments, the amount of TNF-binding aptamer administered is effective to reduce inflammation in the tissues of the individual by at least 5% (e.g., 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or higher) (e.g., reducing neutrophil infiltration, reducing one or more pro-inflammatory cytokines (e.g., IL1β and IL-6), one or more macrophage recruitment chemokines (e.g., CCL2), one or more neutrophil recruitment chemokines (e.g., IL23 and IL17), or a combination thereof).

[0087] In other specific embodiments, the TNF-binding aptamer is administered in an amount effective to reduce the serum level of aminotransferases (e.g., alanine aminotransferase (ALT) or aspartate aminotransferase (AST)) in an individual (e.g., in an individual suffering from liver injury) by at least 5% (e.g., 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more). In some specific embodiments, the anti-TNF aptamer is administered in an amount effective to increase the expression of cell cycle genes (e.g., cyclin D1 or PCNA) in the liver (thereby promoting liver regeneration) by at least 5% (e.g., 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more).

[0088] The pharmaceutical composition can be administered to an individual using conventional methods known to those of ordinary skill in the medical art, depending on the type of disease or the site of the disease to be treated. The composition can also be administered by other conventional routes, such as orally, parenterally, by inhalation spray, topically, rectally, nasally, buccally, vaginally or by an implanted reservoir. The term "parenterally" as used herein includes subcutaneous, intradermal, intravenous, intramuscular, intra-articular, intra-arterial, intrasynovial, intrasternal, intrathecal, intralesional and intracranial injection or infusion techniques. Additionally, it can be administered to an individual by an injectable depot administration route, such as using injectable or biodegradable materials and methods with 1-month, 3-month or 6-month depots. In some embodiments, the pharmaceutical composition is administered intravitreally or intravitreally. In some embodiments, the pharmaceutical composition is administered intratracheally. In other embodiments, the pharmaceutical composition can be administered by inhalation or subcutaneous injection.

[0089] Injectable compositions can contain various carriers, such as vegetable oils, dimethylacetamide, dimethylformamide, ethyl lactate, ethyl carbonate, isopropyl myristate, ethanol and polyols (glycerol, propylene glycol, liquid polyethylene glycol, etc.). For intravenous injection, a water-soluble TNF-binding aptamer can be administered by the drip method, whereby a pharmaceutical preparation containing the TNF-binding aptamer and a physiologically acceptable excipient is infused. Physiologically acceptable excipients can include, for example, 5% dextrose, 0.9% saline, Ringer's solution or other suitable excipients. Intramuscular preparations, such as sterile preparations of a suitable soluble salt form of the TNF-binding aptamer, can be dissolved in a pharmaceutical excipient and administered, such as water for injection, 0.9% saline or 5% dextrose solution.

[0090] In a specific embodiment, the TNF-binding aptamer is administered by site-specific or targeted local delivery techniques. Examples of site-specific or targeted local delivery techniques include various implantable depot sources or local delivery catheters for the TNF-binding aptamer, such as infusion catheters, indwelling catheters or needle catheters, synthetic grafts, adventitial wraps, shunts and stents or other implantable devices, site specific carriers, direct injection or direct application. See, for example, PCT Publication No. WO 00 / 53211 and U.S. Patent No. 5,981,568.

[0091] In some specific embodiments, the aptamers described herein are compatible with different materials and can be formulated into different preparations for local use. In some specific embodiments, in individuals with acute lung injury, administration of the anti-TNF aptamers described herein via the intratracheal route results in optimal effects at lower drug concentrations compared to the intravenous route. In some specific embodiments, local delivery increases the local effective drug concentration and reduces systemic side effects, which can be used for inflammatory diseases, including asthma.

[0092] Targeted delivery of therapeutic compositions containing antisense polynucleotides, expression vectors or subgenomic polynucleotides can also be used. Receptor-mediated DNA delivery techniques are described, for example, in Findeis et al. (1993), Trends Biotechnol., 11:202; Chiou et al. (1994), Gene Therapeutics: Methods and Applications of Direct Gene Transfer (edited by J.A. Wolff); Wu et al. (1988), J. Biol. Chem., 263:621; Wu et al. (1994), J. Biol. Chem., 269:542; Zenke et al. (1990), Proc. Natl. Acad. Sci. USA, 87:3655; Wu et al. (1991), J. Biol. Chem., 266:338.

[0093] A therapeutic composition containing a polynucleotide (e.g., the TNF-binding aptamer described herein or a vector for its production) is administered at a DNA dose of about 100 ng to about 200 mg for local administration in a gene therapy protocol. In some specific embodiments, during a gene therapy protocol, concentration ranges of about 500 ng to about 50 mg, about 1 μg to about 2 mg, about 5 μg to about 500 μg and about 20 μg to about 100 μg of DNA or more can also be used.

[0094] Individuals treated by the methods described herein can be mammals, such as farm animals, sport animals, pets, primates, horses, dogs, cats, mice, and rats. In one embodiment, the individual is a human. Compositions containing anti-TNF aptamers can be used to reduce inflammation, promote liver regeneration, reduce liver injury, and reduce tumor burden in an individual in need of treatment. In some embodiments, the individual can be a human individual having an elevated serum level of TNF relative to a healthy human individual (e.g., one without a TNF-related disease). The level of TNF within an individual (e.g., in the serum of the individual) can be assessed using conventional medical practices.

[0095] In some embodiments, the individual can be a human patient having a TNF-mediated disease, suspected of having a TNF-mediated disease, or at risk of having a TNF-mediated disease (including rheumatoid arthritis, psoriasis, ankylosing spondylitis, inflammatory bowel disease, acute lung injury, neurodegenerative diseases, liver diseases associated with liver injury, and cancer). Exemplary liver diseases include hepatitis, cirrhosis, liver fibrosis, fatty liver disease, and liver cancer. In some embodiments, the individual can be a human patient suffering from a TNF-mediated acute inflammatory disorder. Examples include acute liver injury, acute lung injury, acute respiratory distress syndrome, dry eye disease, uveitis, acute pancreatitis, acute glomerular injury, acute renal failure, ANCA-associated vasculitis, and acute encephalopathy.

[0096] Individuals having a target disease or disorder (e.g., a TNF-mediated disease, including rheumatoid arthritis, psoriasis, ankylosing spondylitis, inflammatory bowel disease, neurodegenerative diseases, acute lung injury, acute liver injury, and cancer) can be identified by conventional medical examinations, such as laboratory tests, organ function tests, CT scans, or ultrasounds. Individuals suspected of having any of these target diseases / disorders may exhibit one or more symptoms of the disease / disorder. Individuals at risk of a disease / disorder can be individuals having one or more risk factors associated with the disease / disorder. Such individuals can also be identified by conventional medical practices. The level of TNF within an individual can also be evaluated using the methods described herein. In some specific embodiments, patients with a higher TNF concentration have a better response to anti-TNF therapy (e.g., anti-TNF aptamer treatment) and reduced side effects caused by infection.

[0097] The specific dosage regimen used in the methods described herein, i.e., the dose, timing, and repetition, will depend on the particular individual (e.g., a human patient) and the individual's medical history.

[0098] In some specific embodiments, the anti-TNF aptamer can be used in combination with another suitable therapeutic agent for a target disease, as described herein. Alternatively or additionally, the anti-TNF aptamer can also be used in combination with other agents for enhancing and / or supplementing the effectiveness of the agent.

[0099] The therapeutic efficacy of the target disease / condition can be evaluated by, for example, the methods described in the following examples.

[0100] In some specific embodiments, an anti-TNF aptamer conjugated with a detectable label (such as an imaging agent) disclosed herein is administered to an individual to evaluate the TNF level in the individual. This TNF detection can be used to identify anti-TNF therapy for relevant patients (e.g., treatment with the anti-TNF pharmaceutical composition disclosed herein or treatment with an anti-TNF antibody).

[0101] TNF in a sample (e.g., a biological sample suspected of containing TNF, including but not limited to blood samples and urine samples) can be detected in vitro by any aptamer described herein using conventional methods. In some cases, the aptamer can be conjugated with a detectable label, which can directly or indirectly release a signal indicating the presence and / or level of TNF in the sample. Alternatively, the anti-TNF aptamer can be used for in vivo imaging of the presence and location of TNF in an individual (e.g., a human patient as described herein). The results obtained from any diagnostic assay (in vitro or in vivo) described herein can indicate the risk or status of a TNF-related disease.

[0102] Kits for treatment or diagnosis

[0103] The present disclosure also provides for reducing inflammation (e.g., reducing the production of inflammatory proteins or reducing neutrophil infiltration, alleviating TNF-mediated diseases (e.g., rheumatoid arthritis, psoriasis, ankylosing spondylitis, inflammatory bowel disease, acute lung disease, neurodegenerative diseases, liver injury associated with liver diseases and cancer)) and detecting the TNF level in an individual. Such kits can include one or more containers containing an aptamer that binds TNF, such as any aptamer described herein.

[0104] In some specific embodiments, the kit can contain instructions for use according to any method described herein. The included instructions can include a description of the aptamer administration for treating, delaying the onset, or alleviating the target disease, as described herein. The kit can further include a description of selecting an individual suitable for treatment based on identifying whether the individual has the target disease. In other specific embodiments, the instructions include a description of administering the aptamer to an individual at risk of the target disease.

[0105] Instructions for use of TNF-binding aptamers typically include information about the dosage, administration regimen, and route of administration of the intended treatment. The container can be a unit dose, bulk package (e.g., multi-dose package), or sub-unit dose. The instructions provided in the kits of the present disclosure are typically written instructions on a label or package insert (e.g., a sheet included in the kit), but machine-readable instructions (e.g., instructions carried on a magnetic or optical storage disk) are also acceptable.

[0106] The label or package insert indicates that the composition is for the treatment, delay in onset, and / or alleviation of a disease or disorder associated with cancer, such as those described herein. Instructions for practicing any of the methods described herein can be provided.

[0107] The kits of the present disclosure are in a suitable package. Suitable packages include, but are not limited to, vials, bottles, jars, flexible packages (e.g., sealed Mylar or plastic bags), etc. Packages for use in conjunction with specific devices, such as inhalers, nasal administration devices (e.g., atomizers), or infusion devices, such as micropumps, are also contemplated. The kit can have a sterile access port (e.g., the container can be an intravenous solution bag or a vial with a stopper pierceable by a subcutaneous injection needle). The container can also have a sterile access port (e.g., the container can be an intravenous solution bag or a vial with a stopper pierceable by a subcutaneous injection needle). At least one active agent in the composition is a TNF-binding aptamer as described herein.

[0108] The kit can optionally provide additional components, such as buffers and interpretive information. Generally, the kit includes a container and a label or package insert on or associated with the container. In some specific embodiments, the present disclosure provides an article comprising the contents of the above-described kit.

[0109] General Techniques

[0110] Unless otherwise indicated, the practice of the present disclosure will employ conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry, and immunology, which are within the skill of the art. Molecular Cloning: A Laboratory Manual (2nd Edition)

[0111] (Sambrook et al., 1989), Cold Spring Harbor Press; Oligonucleotide Synthesis (ed. M.J. Gait, 1984); Methods in Molecular Biology, Humana Press; Cell Biology: A Laboratory Handbook (ed. J.E. Cellis, 1998) Academic Press; Animal Cell Culture (ed. R.I. Freshney, 1987); Introduction to Cell and Tissue Culture (J.P. Mather and P.E. Roberts, 1998) Plenum Press; Cell and Tissue Culture: Laboratory Procedures (eds. A. Doyle, J.B. Griffiths and D.G. Newell, 1993 - 8) J.Wiley and Sons; Methods in Enzymology (Academic Press, Inc.); Handbook of Experimental Immunology (eds. D.M. Weir and C.C. Blackwell); Gene Transfer Vectors for Mammalian Cells (eds. J.M. Miller and M.P. Calos, 1987); Current Protocols in Molecular Biology (eds. F.M. Ausubel et al., 1987); PCR: The Polymerase Chain Reaction (eds. Mullis et al., 1994); Current Protocols in Immunology (eds. J.E. Coligan et al., 1991); Short Protocols in Molecular Biology (Wiley and Sons, 1999); Immunobiology (C.A. Janeway and P. Travers, 1997); Antibodies (P. Finch, 1997); Antibodies: A Practical Approach (ed. D. Catty, IRL Press, 1988 - 1989); Monoclonal Antibodies: A Practical Approach (eds. P. Shepherd and C. Dean, Oxford University Press, 2000);

[0112] Using Antibodies: A Laboratory Manual (E. Harlow and D. Lane (Cold Spring Harbor Laboratory Press, 1999); Antibodies (eds. M. Zanetti and J.D. Capra, Harwood Academic Publishers, 1995). Without further elaboration, it is believed that those skilled in the art can make the fullest use of the present disclosure based on the above description. Accordingly, the following specific examples should be construed as merely illustrative and not limiting the remainder of the present disclosure in any way. For the purposes of citation herein or the subject matter of the application, all publications cited herein are incorporated by reference.

[0113] Example

[0114] Example 1: TNF-targeting nucleic acid aptamer and its therapeutic effect on acute lung injury (ALI)

[0115] Materials and methods

[0116] Chemicals and oligonucleotides

[0117] All chemicals were purchased from Sigma-Aldrich (St. Louis, MO, USA), and oligonucleotides were synthesized by Integrated DNA Technologies (Coralville, IA, USA). The sequence of aptTNF-α is 5’-GCGCCACTACAGGGGAGCTGCCATTCGAATAGGTGGGCCGC-3’

[0118] (SEQ ID NO: 1).

[0119] SELEX

[0120] Human TNF-α-targeting aptamers were identified by nitrocellulose membrane SELEX. The synthesized single-stranded DNA library consisted of single-stranded DNA 80 nucleotides in length, with 40 random sequences flanked by the primer sequence 5’-ACGCTCGGATGCCACTACAG[N] 40 CTCATGGACGTGCTGGTGAC (SEQ ID NO: 2), where N = A, T, G, C. In the first SELEX cycle, 10 15 molecules of the ssDNA library were incubated with recombinant human TNF-α protein (R&D Systems, Minneapolis, MN, USA). The ssDNA that bound to the TNF-α protein was collected by nitrocellulose membrane, and the unbound ssDNA was removed by repeated washing. Then the TNFα-bound ssDNA was eluted by heating, incubated with albumin for negative selection, and then passed through the nitrocellulose membrane. The effluent was collected and amplified by PCR. SELEX was repeated ten times. The TNFα-bound ssDNA and albumin-bound ssDNA were subjected to next-generation sequencing (Illumina MiSeq System, Illumina, San Diego, CA). The output reads were clustered by FASTApatmer (Alam et al., Mol. Ther. Nucleic Acids. 2015; 4: e230) and subtracted by the clusters that appeared in the albumin-binding group. Then the representative sequences with the highest reads in the remaining clusters were subjected to structural analysis using Mfold. Truncated derivatives were designed based on the predicted secondary structures.

[0121] PEG conjugate

[0122] Excess amine-labeled aptTNF-α was incubated with bifunctional N-hydroxysuccinimide polyethylene glycol (NHS-PEG-NHS, molecular weight 20 kDa, Polysciences Inc., Warrington, PA) in sodium bicarbonate buffer (pH 8.3) at 37 °C for 18 h. The PEGylated dimer aptTNF-α (aptTNF-α-PEG) was purified by non-denaturing polyacrylamide gel electrophoresis and its concentration was determined by a Nanodrop spectrophotometer (Thermo Scientific, Hudson, NH, USA).

[0123] Binding affinity assay

[0124] Human TNFα protein (0, 8.75, 17.5, 35, 70, 140 nM, R&D Systems) was incubated with aptTNF-α (50 nM) at 37 °C for 1 h. In addition, mouse TNFα protein (140 nM) or BSA (140 nM) was incubated with aptTNF-α (50 nM) or aptTNF-α-PEG (50 nM). Then the aptamers bound to the protein were collected through a nitrocellulose filter membrane and eluted by heating. The amount of the eluted aptamers was quantified by quantitative PCR (LightCycler480 System, Roche Applied Science, Mannheim, Germany). The dissociation constant (Kd) was calculated using the equation Y = Amax × X / (Kd + X) by GraphPad Prism 5 (GraphPad Software, San Diego, CA). The relative amounts of protein-bound aptamers (human TNF-α protein and mouse TNF-α protein) were expressed as fold changes, using BSA as a reference (1-fold).

[0125] Bio-distribution of aptTNF-α

[0126] Mice were purchased from the Experimental Animal Center. All animal experiments were conducted according to the guidelines of the animal facility. Six-week-old male Balb / c mice were administered LPS (10 mg / kg, intratracheally) to induce ALI. One hour after LPS administration, an intravenous injection was given 800CW-labeled aptTNF-α (Integrated DNA Technologies). At 2 hours, 4 hours, 7 hours, 10 hours, and 24 hours after aptamer administration, the Xenogen IVIS imaging system 200 series (Caliper Life Sciences, Alameda) was used to detect the fluorescence signal emitted by aptTNF-α (Cakarova et al., Am. J. Respir. Crit. Care Med. 2009; 180: 521-32). Additionally, mice in the 800CW-labeled aptTNF-α-treated group were sacrificed 4 hours after aptamer administration. Vital organs, including the heart, liver, spleen, lungs, kidneys, and bladder, were collected, and the fluorescence signal emitted by aptTNF-α was detected. Blood samples were taken, and the levels of LDH, AST, and ALT were measured using a Fuji Dri-Chem 4000i (Fujifilm, Tokyo, Japan).

[0127] Cell culture and luciferase activity assay

[0128] HEK293 cells were cultured in DMEM (Gibco BRL, Life Technologies, Grand Island, NY, USA) containing 10% FBS (Gibco) and transfected with an NF-κB reporter gene (pGL4.32, Promega, Madison, WI, USA). At 24 hours after transfection, the cells were treated with hygromycin to select antibiotic-resistant clones. HEK293 cells expressing the NF-κB reporter gene were seeded into 96-well plates (2000 cells each) and cultured overnight. TNFα protein (5 ng) was added to each individual well together with aptTNF-α (50, 500 nM), aptTNF-α-PEG (10, 50 nM), or anti-human TNFα antibody (10, 50 nM, R&D Systems). After incubation for 4 or 24 hours, luciferase activity was measured using a luciferase assay system (Promega) according to the manufacturer's protocol. The data were expressed as relative luciferase activity, using the untreated group as the negative control (0% activity) and the TNFα-treated group as the positive control (100% activity).

[0129] Animal study of acute lung injury (ALI)

[0130] To induce ALI, 6-week-old male Balb / c mice were treated intratracheally with LPS (10 mg / kg). One hour after LPS treatment, aptTNF-α (1600 μg / kg) or aptTNF-α-PEG (32, 320 μg / kg) was administered intratracheally or intravenously. Oxygen saturation was recorded 24 hours after treatment by a MouseMonitor TM S Plus pulse oximeter module (Indus Instruments, Webster, TX, USA). In one study group, the mice were sacrificed. The lungs were weighed and the tissues were subjected to RNA and protein extraction and immunohistochemical staining. In another group, bronchoalveolar lavage fluid (BALF) was collected. The total cell count in BALF was calculated, the total protein concentration in BALF was quantified by a Nanodrop spectrophotometer, and the MPO activity in BALF was determined by a myeloperoxidase (MPO) fluorescence activity assay kit (BioVision) according to the manufacturer's protocol.

[0131] Quantitative PCR

[0132] RNA was extracted from mouse liver tissues using Trizol (Invitrogen), and cDNA was synthesized using random hexamers (Invitrogen) and SuperScript III reverse transcriptase (Invitrogen) according to the manufacturer's protocol. Quantitative PCR was performed on a LightCycler 480 system (Roche Applied Science, Mannheim, Germany).The primer sequences for mouse cDNA used in qPCR are listed below: IL-1β, 5’-agttgacggaccccaaaag-3’ (forward) (SEQ ID NO: 3) and 5’-agctggatgctctcatcagg-3’ (reverse) (SEQ ID NO: 4); IL-6, 5’-gctaccaaactggatataatcagga-3’ (forward) (SEQ ID NO: 5) and 5’-ccaggtagctatggtactccagaa-3’ (reverse) (SEQ ID NO: 6); CXCL2, 5’-aatcatccaaaagatactgaacaaag-3’ (forward) (SEQ ID NO: 7) and 5’-ttctctttggttcttccgttg-3’ (reverse) (SEQ ID NO: 8); actb, 5’-ctaaggccaaccgtgaaaag-3’ (forward) (SEQ ID NO: 9) and 5’-accagaggcatacagggaca-3’ (reverse) (SEQ ID NO: 10); CCL2, 5’-catccacgtgttggctca-3’ (forward) (SEQ ID NO: 11) and 5’-gatcatcttgctggtgaatgagt-3’ (reverse) (SEQ ID NO: 12); 5-IL17, 5’-cagggagagcttcatctgtgt-3’ (forward) (SEQ ID NO: 13) and 5’-gctgagctttgagggatgat-3’ (reverse) (SEQ ID NO: 14); IL23, 5’-tccctactaggactcagccaac-3’ (forward) (SEQ ID NO: 15) and 5’-agaactcaggctgggcatc-3’ (reverse) (SEQ ID NO: 16); CCND1, 5’-tttctttccagagtcatcaagtgt-3’ (forward) (SEQ ID NO: 17) and 5’-tgactccagaagggcttcaa-3’ (reverse) (SEQ ID NO: 18); and PCNA, 5’-ctagccatgggcgtgaac-3’ (forward) (SEQ ID NO: 19) and 5’-gaatactagtgctaaggtgtctgcatt-3’ (reverse) (SEQ ID NO: 20).

[0133] Western blot and immunohistochemical staining

[0134] The primary antibodies used for Western blotting are listed below: anti-GAPDH (Santa Cruz) and anti-PCNA (Cell Signaling Technology, Beverly, MA, USA). Hematoxylin and eosin staining (H&E) was performed in the Pathology Core Facility of the Institute of Biomedical Sciences. Lung injury scores were calculated according to a scoring system designed by the Animal Acute Lung Injury Study Group (Matute-Bello et al., Am. J. Respir. Cell Mol. Biol. 2011; 44: 725-38). For immunohistochemical staining, anti-Ly6G (clone 1A8, Biolegend, San Diego, CA, USA) antibody was used at a 1:100 dilution. ImmPRESS TM HRP anti-rat IgG, mouse adsorbed (peroxidase) polymer detection kit (Vectors Laboratories, Burlingame, CA, USA) was used to amplify the signal, and DAB peroxidase (HRP) substrate kit (Vectors Laboratories) was used for color development.

[0135] Statistics

[0136] Results are shown as mean ± standard error of the mean, and P values were calculated by Student's t-test. A two-tailed P value of less than 0.05 was defined as statistically significant.

[0137] Results

[0138] AptTNF-α binds to TNFα with high affinity and targets TNFα in vivo

[0139] TNFα-targeting aptamers (aptTNF or aptTNF-α, Figure 2A ) were selected by nitrocellulose membrane SELEX, analyzed by FASTAptamer, and optimized using Mfold based on the predicted secondary structure. The dissociation constant (Kd) of aptTNF-α and human TNFα was 8 nM ( Figure 2B , left panel). Since the data further showed that aptTNF-α also binds to mouse TNFα ( Figure 2B , right panel), the in vivo binding effect of aptTNF-α was then studied using the ALI mouse model.

[0140] Data showed that in the ALI group, aptTNF-α signal was clearly observed in the thoracic cavity at 2 hours and 4 hours, but disappeared 24 hours after LPS-induced ALI ( Figure 2C and Figure 2D)。This observation is consistent with the reported TNFα kinetics in lung tissue during ALI (Cakarova et al., Am. J. Respir. Crit. Care Med. 2009; 180: 521-32). Since SIRS may occur after ALI and lead to multi-organ damage, vital organs were collected 4 hours after administration of aptTNF-α, and their biodistribution was examined. The data showed that, when the same dose of aptTNF-α was administered, the aptTNF-α signal in the liver, spleen, lung, and kidney of the ALI group was significantly increased compared with that of the control group ( Figure 2E and Figure 2F ). In the control group, the aptTNF-α signal was mainly observed in the kidney and bladder, and the organs were involved in aptamer excretion, but the signal intensity was lower than that of the ALI group. Further blood tests also showed that the levels of LDH, AST, and ALT in the ALI group were significantly increased. This data supports the occurrence of end-organ damage observed in the aptTNF-α biodistribution imaging study ( Figure 2G ). In summary, the data show that aptTNF-α has good in vitro binding affinity for human TNFα and can target TNFα in vivo, as shown in the mouse ALI model.

[0141] AptTNF-α-PEG inhibits TNFα-mediated signal transduction

[0142] Next, it was investigated whether aptTNF-α or its derivatives were effective in inhibiting TNFα-mediated signal transduction. Since biologically active TNFα exists as a trimer under physiological conditions, a dimer of aptTNF-α was synthesized by adding a polyethylene glycol (PEG) linker between two aptTNF-α monomers (aptTNF-α-PEG, Figure 3A ) to enhance the potential antagonistic effect of aptTNF-α. The data showed that the dimer aptTNF-α-PEG also had specific binding activity for human and mouse TNFα proteins ( Figure 3B ).

[0143] In addition, reporter gene assays showed that although monomeric aptTNF-α effectively inhibited TNF-α / NF-κB signal transduction at a concentration of 500 nM, the dimer aptTNF-α-PEG had better efficacy in inhibiting TNF-α / NF-κB at 50 nM signal transduction measured 4 hours after TNFα treatment ( Figure 3C , upper figure). In addition, the inhibitory effect of monomeric aptTNF-α that subsided 24 hours after TNFα treatment and the inhibitory effect of the dimer aptTNF-α-PEG decreased to approximately 40% of the original efficacy. In contrast, the inhibitory effect of the anti-TNFα antibody remained at 24 hours after TNFα treatment ( Figure 3C, (see the figure below). These data suggest the potential role of aptTNF-α and aptTNF-α-PEG in acute diseases with systemic inflammatory responses, as they only inhibit acute-phase TNFα signaling. This can avoid interference with the basal TNFα signaling required during the tissue repair phase and side effects associated with persistent inhibition of innate immunity.

[0144] AptTNF-α can reduce the severity of acute lung injury

[0145] Next, the in vivo effects of aptTNF-α and aptTNF-α-PEG were investigated using a mouse model of LPS-induced ALI. As indicated by the significant decrease in oxygen saturation, the data showed that LPS treatment caused respiratory distress ( Figure 4A ). The increase in wet lung weight in the LPS-treated group indicated enhanced permeability of the alveolar-capillary membrane to LPS-induced injury ( Figure 4B ). Histological examination of the LPS-induced ALI group showed thickening of the alveolar septum, accumulation of red blood cells, neutrophils, and fibrin strands in the alveoli, and an increase in the lung injury score ( Figure 4C and Figure 4D ). Further analysis of BALF showed increased total protein levels, increased total cell counts, enhanced myeloperoxidase (MPO) activity, and upregulated expression of pro-inflammatory cytokines / chemokines (IL-1β, IL-6, and CXCL2) ( Figures 4E to 4J ). These phenotypic and molecular results were consistent with the expected tissue response cascade coordinated by cytokine and chemokine responses to ALI.

[0146] Subsequently, it was shown that intratracheal or intravenous administration of aptTNF-α-PEG rescued LPS-induced injury in a dose-dependent manner at the phenotypic, histological, and molecular levels ( Figures 4A to 4J ). The data showed that aptTNF-α-PEG had better efficacy when delivered via the intratracheal route compared to systemic delivery, which may be related to higher local concentrations. Although intratracheal administration of aptTNF-α also inhibited LPS-induced ALI to some extent, this was only achieved at relatively high drug concentrations (5 times that of aptTNF-α-PEG), indicating higher potency of aptTNF-α-PEG. In summary, the data suggest that aptTNF-α-PEG or aptTNF-α can inhibit acute-phase apoptotic signals mediated by the TNFα pathway and subsequent cytokine storms, which ultimately lead to tissue damage in ALI.

[0147] Example 2: The novel TNF-targeting aptamer has a therapeutic effect on acute liver failure (ALF)

[0148] Materials and methods

[0149] Except for the animal studies described below, the materials and methods used were the same as those in Example 1.

[0150] Animal studies of acute liver failure (ALF)

[0151] To induce ALF, 6-week-old male Balb / c mice were injected with D-galactosamine (D-GalN, 100 mg / kg, intraperitoneally) and human TNFα (40 μg / kg, intravenously). Next, they were treated with intravenous administration of N-acetylcysteine (NAC, 600 mg / kg), aptTNF-α (1600 μg / kg), or aptTNF-α-PEG (3.2, 32, 320 μg / kg), and blood was sampled 6 hours after treatment (Saito et al., Hepatology. 2010; 51:246-54;

[0152] Sass et al., Cytokine. 2002; 19:115-20). Blood was used for AST and ALT analysis (Fuji Dri-Chem4000i). Mice were sacrificed 6 or 24 hours after treatment. Liver tissues were collected for RNA, protein extraction, and immunohistochemical staining.

[0153] Results

[0154] AptTNF-α attenuates TNFα-mediated acute liver failure (ALF) and enhances early liver regeneration

[0155] For ALF patients with fulminant outcomes, the current treatment available before liver transplantation is systemic infusion of N-acetylcysteine (NAC) (Bernal et al., N. Engl. J. Med. 2013; 369:2525-34). Since ALF is TNFα-mediated, the roles of aptTNF-α and aptTNF-α-PEG in ALF were subsequently investigated, and their effects were compared with NAC using a D-galactosamine (D-GalN) / TNF-α-induced mouse ALF model.

[0156] Data showed that injection of D-GalN / TNFα induced severe hepatocyte death, accompanied by tissue hemorrhage and neutrophil infiltration. Treatment with aptTNF-α-PEG reduced the observed liver injury ( Figure 5A ). Further analysis of serum AST / ALT and tissue pro-inflammatory cytokines / chemokines (IL-1β, IL-6, and CXCL2) showed that aptTNF-α (1600 μg / kg) or aptTNF-α-PEG (3.2 μg / kg to 320 μg / kg) to NAC (600 mg / kg) had excellent hepatoprotective effects ( Figures 5B to 5F)。The macrophage chemoattractant (CCL2) and neutrophil chemoattractants (IL23, IL17) were also increased by TNF and D-GalN injection and decreased by aptTNF-α-PEG treatment ( Figure 7 )。In addition, aptTNF-α-PEG had a dose-dependent hepatoprotective effect and was again superior to aptTNF-α ( Figures 5B to 5F )。

[0157] In addition, since hepatocytes transition from G0 to G1 phase after the acute injury phase, an upregulation of PCNA expression is typically observed during liver regeneration. Data showed that both the aptTNF-α- and aptTNF-α-PEG-treated groups had higher PCNA protein ( Figure 5G ) and mRNA ( Figure 8 ) expression compared to the NAC-treated group. The data indicated that hepatocytes in the aptTNF-α / aptTNF-α-PEG-treated groups entered the G1 phase at an earlier time point after acute injury ( Figure 5G )。

[0158] The aptTNF-PEG group also showed significantly higher protein and mRNA expression of cyclin D1 (data not shown and Figure 8 ), with only a slight increase in expression in the NAC group ( Figure 8 and data not shown), also indicating that hepatocytes in the aptTNF-PEG group entered the regeneration process at an earlier time point.

[0159] In addition, it was shown that the degree of reversal of elevated AST and ALT was the same in the groups receiving aptTNF-α or aptTNF-α-PEG treatment. Nevertheless, although the elevated ALT in the NAC treatment group could be reversed, AST remained high ( Figure 5B and Figure 5C ). In liver tissue, all treatments (including those using NAC, aptTNF, or aptTNF-PEG) inhibited caspase-3 activation ( Figure 6)). ALT is an enzyme mainly expressed in the liver. In contrast, AST is expressed not only in the liver but also in the heart, muscle, and brain tissues. Since liver failure is not only a single-organ disease but also can lead to SIRS and multiple organ failure, our data indicate that treatment with aptTNF-α / aptTNF-α-PEG can not only rescue acute liver injury but also inhibit the process of SIRS. This data implies the potential systemic protective effect of aptTNF-α / aptTNF-α-PEG in ALF. In summary, the data described in this article show that aptTNF-α / aptTNF-α-PEG has good hepatoprotective effects and may also inhibit the process of SIRS, thus preventing multiple organ failure common in clinical practice.

[0160] Example 3: AptTNF-α is used as a diagnostic agent for monitoring TNFα in the liver in vivo

[0161] Materials and methods

[0162] Biodistribution analysis

[0163] For endogenous mouse TNF induction, 6-week-old male Balb / c mice were intraperitoneally injected with D-GalN (650 mg / kg) and LPS (10 μg / kg) to induce acute liver failure. The mice were sacrificed 6 hours after treatment, and serum and liver tissues were collected. For biodistribution determination, 0.5 hour after D-GalN and LPS treatment, aptTNF labeled with 800CW (Integrated DNA Technologies) was intravenously injected, and the fluorescence signal emitted by aptTNF was detected by the Xenogen IVIS imaging system 200 series (Caliper LifeSciences, Alameda). 800CW-labeled aptTNF (Integrated DNA Technologies), and the fluorescence signal emitted by aptTNF was detected by the Xenogen IVIS imaging system 200 series (Caliper LifeSciences, Alameda).

[0164] Results

[0165] AptTNF-α is used as a diagnostic agent for monitoring TNFα in vivo

[0166] In liver tissue, patients with higher TNFα concentrations may respond better to anti-TNFα therapy. However, there are no routine TNFα concentration prediction markers or diagnostic tools to detect TNFα in vivo. To reduce the adverse side effects of anti-TNFα therapy on non-responders, the feasibility of aptTNF-α as a diagnostic agent for monitoring TNFα in vivo was investigated. To induce endogenous TNFα secretion and acute liver injury in mice, LPS and D-GalN were injected into the mice. Fluorescently labeled aptTNF-α was administered 30 minutes after the injection of LPS and D-GalN. Mice that received fluorescently labeled aptTNF-α without LPS and D-GalN injection were used as negative controls. Compared with the negative control group, AptTNF-α accumulated significantly in the liver tissue of the LPS and D-GalN injection group ( Figures 9A to 9C ), although a large amount of aptTNF-α was filtered and excreted from the kidneys to the bladder in both groups.

[0167] Other specific embodiments

[0168] All features disclosed in this specification can be combined in any combination. Each feature disclosed in this specification can be replaced by an alternative feature for the same, equivalent, or similar purpose. Therefore, unless otherwise clearly stated, each feature disclosed is only an example of a series of equivalent or similar features.

[0169] Based on the above description, those skilled in the art can easily determine the basic features of the present disclosure, and without departing from its spirit and scope, various changes and modifications can be made to the present disclosure to adapt it to various uses and conditions. Therefore, other embodiments are also within the scope of the claims.

[0170] Equivalents

[0171] Although several embodiments of the invention have been described and illustrated herein, various other devices and / or structures and / or one or more of the advantages described herein will readily occur to those of ordinary skill in the art for performing the functions and / or obtaining the results. Each of these variations and / or modifications is considered to be within the scope of the specific embodiments of the invention described herein. More generally, those skilled in the art will readily understand that all parameters, dimensions, materials, and configurations described herein are intended to be exemplary, and the actual parameters, dimensions, materials, and / or configurations will depend on the specific application or applications. Those skilled in the art will recognize or be able to use, without more than routine experimentation, many equivalents to the specific embodiments of the specific inventions described herein. Accordingly, it should be understood that the foregoing embodiments are presented by way of example only, and that within the scope of the appended claims and their equivalents, embodiments of the present disclosure may be practiced otherwise than as specifically described and claimed. Embodiments of the inventions of the present disclosure relate to each and every separate feature, system, article, material, kit, and / or method described herein. Moreover, any combination of two or more of these features, systems, articles, materials, kits, and / or methods, if not mutually inconsistent, is included within the scope of the inventions of the present disclosure.

[0172] All definitions defined and used herein shall be understood to be controlled by the definitions in the dictionary, the definitions in the documents incorporated by reference, and / or the ordinary meaning of the defined terms.

[0173] All references, patents, and patent applications disclosed herein are incorporated herein by reference in their entirety for each and every subject matter cited, in some cases covering the entire document.

[0174] Unless explicitly stated to the contrary, the indefinite articles "a" and "an" as used in this specification and the claims shall be understood to mean "at least one".

[0175] The phrase "and / or" as used in this specification and the claims shall be understood to mean "one or both" of the elements so combined, i.e., the elements may be present jointly in some cases and separately in other cases. Multiple elements listed with "and / or" shall be construed in the same manner, i.e., "one or more" of the elements so combined. Other elements may optionally be present, whether related or unrelated to the elements specifically identified, in addition to the elements specifically identified by the "and / or" clause. Thus, as a non-limiting example, when used in conjunction with open-ended language such as "comprising", a reference to "A and / or B" may, in one embodiment, refer only to A (optionally including elements other than B); in another embodiment, only to B (optionally including elements other than A); in yet another specific embodiment, both A and B (optionally including other elements), and so on.

[0176] As used in this specification and the claims, "or" shall be understood to have the same meaning as "and / or" as defined above. For example, when separating items in a list, "or" or "and / or" shall be interpreted as inclusive, i.e., including at least one, but also including a number or list of multiple elements, and optionally other unlisted items. Only terms that explicitly state the contrary, such as "only one" or "exactly one", or, when used in the claims, "consisting of" will refer to including one element in a number or list. Generally, the term "or" as used herein shall only be interpreted to mean the sole alternative before an exclusive clause (i.e., "one or the other but not both"), such as "either", "one of", or "exactly one of". When used in the claims, "consisting essentially of" shall have its ordinary meaning as used in the field of patent law.

[0177] As used in this specification and the claims, with respect to a list of one or more elements, the phrase "at least one" shall be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one element in each of the specifically listed elements in the list of elements, and does not exclude any combination of the elements in the list of elements. This definition also allows for the optional presence of elements, whether related or not related to the specifically identified elements, in addition to the specifically identified elements within the list of elements referred to by the phrase "at least one". Thus, as a non-limiting example, "at least one of A and B" (or equivalently, "at least one of A or B", or equivalently "at least one of A and / or B") can refer to, in one specific embodiment, at least one (optionally including more than one) A, with no B (and optionally including elements other than B); in another specific embodiment, at least one (optionally including more than one) B, with no A (and optionally including elements other than A); in yet another specific embodiment, at least one (optionally including more than one) A and at least one (optionally including more than one) B (and optionally including other elements), and so on.

[0178] It should also be understood that, unless explicitly stated to the contrary, in any method claimed herein that includes more than one step or action, the order of the steps or actions of the method is not necessarily limited to the steps or acts described in the method. Sequence Listing <110> Meiyin Zhou Panchi Yang <120> TNF-Targeting Aptamers for Treating or Diagnosing TNF-Related Inflammatory Diseases and Their Uses <130> A0988.70085WO00 <140> Not Assigned <141> Meanwhile <150> US 62 / 660,324 <151> April 20, 2018 <160> 20 <170> PatentIn version 3.5 <210> 1 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Polynucleotide <400> 1 gcgccactac aggggagctg ccattcgaat aggtgggccg c 41 <210> 2 <211> 80 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Polynucleotide <220> <221> misc_feature <222> (21)..(60) <223> n is a, c, g, or t <400> 2 acgctcggat gccactacag nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60 ctcatggacg tgctggtgac 80 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Polynucleotide <400> 3 agttgacgga ccccaaaag 19 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <400> 4 agctggatgc tctcatcagg 20 <210> 5 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotide <400> 5 gctaccaaac tggatataat cagga 25 <210> 6 <211> 24 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotide <400> 6 ccaggtagct atggtactcc agaa 24 <210> 7 <211> 26 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotide <400> 7 aatcatccaa aagatactga acaaag 26 <210> 8 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotide <400> 8 ttctctttgg ttcttccgtt g 21 <210> 9 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotide <400> 9 ctaaggccaa ccgtgaaaag 20 <210> 10 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotide <400> 10 accagaggca tacagggaca 20 <210> 11 <211> 18 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotide <400> 11 catccacgtg ttggctca 18 <210> 12 <211> 23 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotide <400> 12 gatcatcttg ctggtgaatg agt 23 <210> 13 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotide <400> 13 cagggagagc ttcatctgtg t 21 <210> 14 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotide <400> 14 gctgagcttt gagggatgat 20 <210> 15 <211> 22 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotide <400> 15 tccctactag gactcagcca ac 22 <210> 16 <211> 19 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotide <400> 16 agaactcagg ctgggcatc 19 <210> 17 <211> 24 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotide <400> 17 tttctttcca gagtcatcaa gtgt 24 <210> 18 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotide <400> 18 tgactccaga agggcttcaa 20 <210> 19 <211> 18 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotide <400> 19 ctagccatgg gcgtgaac 18 <210> 20 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Synthetic polynucleotide <400> 20 gaatactagt gctaaggtgt ctgcatt 27

Claims

1. A nucleic acid aptamer capable of binding to human tumor necrosis factor α, characterized in that, The aptamer consists of the nucleic acid sequence GCGCCACTACAGGGGAGCTGCCATTCGAATAGGTGGGCCGC (SEQ ID NO: 1).

2. A nucleic acid aptamer capable of binding to human tumor necrosis factor α, characterized in that, The nucleic acid sequence according to claim 1 is conjugated with a polyethylene glycol moiety.

3. The nucleic acid aptamer according to claim 2, wherein The molecular weight of the polyethylene glycol moiety is from 15 kDa to 40 kDa.

4. The nucleic acid aptamer according to any one of claims 1 to 3, characterized in that The aptamer presents in a dimer form containing two of the said nucleic acid sequences.

5. The nucleic acid aptamer according to claim 4, characterized in that, The two nucleic acid sequences are linked by the polyethylene glycol moiety.

6. The nucleic acid aptamer according to any one of claims 1 to 3, characterized in that, The nucleic acid aptamer is conjugated with a detectable label.

7. A pharmaceutical composition comprising the nucleic acid aptamer according to any one of claims 1 to 6 and a pharmaceutically acceptable carrier.

8. Use of the nucleic acid aptamer according to any one of claims 1 to 6 for the preparation of a medicament for inhibiting the activity of tumor necrosis factor α in an individual It is characterized in that who suffers from acute liver failure or acute lung injury.

9. The use according to claim 8, wherein The individual is a human patient.

10. The use according to claim 8 or 9, characterized in that, The individual has received or is undergoing treatment involving a tumor necrosis factor α antagonist.

11. Use of the nucleic acid aptamer according to any one of claims 1 to 6 for the preparation of a medicament for alleviating liver injury or promoting liver regeneration in an individual It is characterized in that who suffers from acute liver failure.

12. Use according to claim 8, 9 or 11, characterized in that, The amount of the nucleic acid aptamer is sufficient to reduce the serum aspartate aminotransferase level, the serum alanine aminotransferase level or both in the individual.

13. The use according to claim 8, 9 or 11, characterized in that, The amount of the nucleic acid aptamer is sufficient to reduce neutrophil infiltration into the liver of the individual.

14. The use according to claim 8, 9 or 11, characterized in that, The nucleic acid aptamer is administered intratracheally.

15. The use according to claim 8, 9 or 11, characterized in that, The nucleic acid aptamer is administered by inhalation or subcutaneous injection.

16. A non-disease diagnostic method for detecting the presence of tumor necrosis factor α in a sample, comprising contacting the nucleic acid aptamer according to claim 6 with a biological sample suspected of containing tumor necrosis factor α, and detecting the binding of the nucleic acid aptamer to the tumor necrosis factor α in the sample.

17. Use of the nucleic acid aptamer according to claim 6 for preparing a composition for monitoring tumor necrosis factor α in an individual, characterized in that, Detect the position of the nucleic acid aptamer based on the signal released by the detectable label.

18. The use according to claim 17, characterized in that, The individual is a human patient suffering from or suspected of suffering from liver disease.

19. The use according to claim 18, characterized in that, The step of detection is carried out by measuring the level of the signal released by the detectable label located at the liver of the human patient.

Citation Information

Patent Citations

  • Synthetic polynucleotides

    US3687808A

  • Polylactide-drug mixtures

    US3773919A

  • Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof

    US4469863A

  • Synthetic phosphatidyl cholines useful in forming liposomes

    US4485045A

  • Liposomes containing modified cholesterol for organ targeting

    US4544545A