Nucleic acid aptamers targeting lymphocyte activation gene 3 (LAG-3) and uses thereof

Abstract

Nucleic acid aptamers capable of binding to lymphocyte activation gene 3 (LAG-3) and their use for regulating immune responses. Such aptamers may include a G-rich motif, for example, GX1GGGX2GGTX3A (SEQ ID NO: 1), wherein X1 and X2 are each independently G, C or absent, and X3 is T or C, or L-(G) n ‑L', wherein n is an integer of 5-9 (including 5 and 9), and L and L' are nucleotide segments with complementary sequences. Also provided herein is a polymer nucleic acid aptamer containing a backbone portion, the backbone portion comprising a palindromic sequence.

Description

[0001] Related Applications

[0002] This application claims the benefit under 35 USC §119 of U.S. Provisional Application No. 62 / 684,139, filed on June 12, 2018, and U.S. Provisional Application No. 62 / 740,751, filed on October 3, 2018, the entire contents of each of which are incorporated herein by reference. Background Art

[0003] Activated T cells express a variety of co-inhibitory molecules (called immune checkpoint molecules) to regulate T cell responses. Exemplary immune checkpoint molecules include programmed cell death protein 1 (PD-1), lymphocyte activation gene 3 (LAG-3) and cytotoxic T lymphocyte-associated protein 4 (CTLA-4). These immune checkpoint molecules play an important role in maintaining immune homeostasis and preventing autoimmunity.

[0004] Immune checkpoint molecules are usually activated in cancer, resulting in suppression of anti-tumor immune responses. Therefore, immune checkpoint inhibitor therapy provides effective long-term treatment for a variety of cancers. However, only a portion of cancer patients have been found to respond to these treatments. Therefore, it is very meaningful to develop new agents for inhibiting immune checkpoint targets for the treatment of cancer and other diseases by regulating immune cell activity (such as T cell proliferation and activation). Summary of the invention

[0005] The present disclosure is based at least in part on the development of nucleic acid aptamers in monomeric or tetrameric form that bind to human lymphocyte activation gene 3 (LAG-3) with high affinity and modulate immune responses by, for example, disrupting the interaction between LAG-3 and MHC class II molecules. Unexpectedly, such nucleic acid aptamers alone exhibit anti-tumor activity and enhance the anti-tumor activity of checkpoint inhibitors (such as anti-PD-1 antibodies).

[0006] Thus, one aspect of the present disclosure features a nucleic acid aptamer capable of binding to human LAG-3. The nucleic acid aptamer may include the following nucleotide motif: GX 1 GGGX 2 GGTX 3 A (SEQ ID NO: 1), wherein X 1 and X 2 are each independently G, C or absent, and X 3is T or C. In one example, the nucleotide motif may be GGGGGGGGTTA (SEQ ID NO: 2). Alternatively, the nucleic acid aptamer may include the following nucleotide motif: L-(G)n-L', wherein n is an integer of 5-9 (including 5 and 9) (SEQ ID NO: 3-7), and L and L' are nucleotide segments having complementary sequences (e.g., each containing 5-8 nucleotides).

[0007] Any of the nucleic acid aptamers described herein may include a nucleotide sequence that is at least 85% (e.g., at least 90%, at least 95% or more) identical to one of the following nucleotide sequences:

[0008] (i) TGGGGGGGGTTAGTTCAATACATGCGGGCG (SEQ ID NO: 8);

[0009] (ii) TGGGGGGGGGTTAGACTTACACTCTTATTCG (SEQ ID NO: 9);

[0010] (iii) AGAGGGGGGGGTTAGCTGCTTTAACTCATG (SEQ ID NO: 10); and

[0011] (iv) AGGGGGGGGGTTACTGCGCATGTATCTCAG (SEQ ID NO: 11).

[0012] In some examples, the nucleic acid aptamer includes one of the above nucleotide sequences.

[0013] In one example, the nucleic acid aptamer comprises the nucleotide sequence TGGGGGGGGTTAGTTCAATACATG (SEQ ID NO: 12). Specific examples include:

[0014] (a)

[0015] TCCCTACGGCGCTAACTGGGGGGGGTTAGTTCAATACATGCGGGCGGCCACCGTGCTACAAC (SEQ IDNO: 13);

[0016] (b) ACGGCGCTAACTGGGGGGGGTTAGTTCAATACATG (SEQ ID NO: 14);

[0017] (c) GCTAACTGGGGGGGGTTAGTTCAATACATGCGGGC (SEQ ID NO: 15); and

[0018] (d) CTGGGGGGGGTTAGTTCAATACATGCGGGCGGCCA (SEQ ID NO: 16).

[0019] In another aspect, the disclosure features a polymeric nucleic acid aptamer (eg, a tetrameric aptamer) comprising a first polynucleic acid, a first nucleic acid aptamer, and a second nucleic acid aptamer. The first polynucleic acid may comprise a nucleotide sequence of the formula 5'-XL 1 -YL 2 -Z-3', wherein X and Z are each a nucleotide segment complementary to a portion of the first nucleic acid aptamer and / or the second nucleic acid aptamer, and L 1 and L 2 Each is independently a linker, and Y is a nucleotide segment having a palindromic sequence. The first nucleic acid aptamer and the second nucleic acid aptamer can form a duplex with the X and Z regions of the first polynucleic acid.

[0020] In some embodiments, the polymer nucleic acid aptamer described herein may further include a second polynucleic acid, a third nucleic acid aptamer, and a fourth nucleic acid aptamer. The second polynucleic acid includes a nucleotide sequence of 5'-X'-L 1 '-YL 2 '-Z'-3', wherein X' and Z' are each a nucleotide segment complementary to a portion of the third nucleic acid aptamer and / or the fourth nucleic acid aptamer, L 1 ' and L 2 ' are each independently a linker or absent, and Y is a nucleotide segment having a palindromic sequence. The third nucleic acid aptamer and the fourth nucleic acid aptamer can form a duplex with the X' and Z' regions of the second polynucleic acid. The first polynucleic acid and the second polynucleic acid can form a duplex at the palindromic sequence of the Y region.

[0021] In some embodiments, the polymer aptamers described herein may include at least two aptamers specific for the same target molecule. In some instances, the polymer aptamers described herein may include at least two identical aptamers. In some instances, all aptamer portions in the polymer aptamers are identical.

[0022] In other embodiments, the polymer nucleic acid aptamer described herein may include at least two nucleic acid aptamers that are specific to different target molecules of interest. In some instances, the polymer nucleic acid aptamer described herein may include at least two different nucleic acid aptamers. In some instances, all nucleic acid aptamer portions in the polymer nucleic acid aptamer are different.

[0023] In some embodiments, at least one of the first nucleic acid aptamer, the second nucleic acid aptamer, the third nucleic acid aptamer, and the fourth nucleic acid aptamer in any multimeric nucleic acid aptamer may be those nucleic acid aptamers disclosed herein that are capable of binding to human LAG-3.

[0024] In another aspect, the present disclosure provides a multimeric nucleic acid complex comprising a first polynucleic acid and optionally a second polynucleic acid. The first polynucleic acid comprises a nucleotide sequence of the formula 5'-XL 1 -YL 2 -Z-3', wherein X represents the first nucleic acid, Z represents the second nucleic acid, L 1 and L 2 Each is independently a linker, and Y is a nucleotide segment having a palindromic sequence. The second polynucleic acid comprises a nucleotide sequence of the formula 5'-X'-L 1 '-Y'-L 2 '-Z'-3', wherein X' represents the third nucleic acid, Z' represents the fourth nucleic acid, L 1 ' and L 2 ' are each independently a linker or are absent, and Y is a nucleotide segment having a palindromic sequence; wherein the first polynucleic acid and the second polynucleic acid form a duplex in the palindromic sequence region.

[0025] In some embodiments, the first nucleic acid, the second nucleic acid, the third nucleic acid, the fourth nucleic acid, or a combination thereof in the polymer nucleic acid complex may be a nucleic acid aptamer (same or different). In other embodiments, the first nucleic acid, the second nucleic acid, the third nucleic acid, the fourth nucleic acid, or a combination thereof may be an antisense oligonucleotide or siRNA (same or different). In yet other embodiments, at least one of the first nucleic acid, the second nucleic acid, the third nucleic acid, and the fourth nucleic acid is conjugated to a therapeutic agent, such as a small molecule drug, a peptide drug, or a protein drug.

[0026] In some embodiments, at least two of the first nucleic acid, the second nucleic acid, the third nucleic acid, and the fourth nucleic acid are specific for the same target molecule. For example, at least two of the first nucleic acid, the second nucleic acid, the third nucleic acid, and the fourth nucleic acid are the same aptamer. In some instances, the first nucleic acid, the second nucleic acid, the third nucleic acid, and the fourth nucleic acid are all the same aptamer.

[0027] In some embodiments, at least two of the first nucleic acid, the second nucleic acid, the third nucleic acid, and the fourth nucleic acid are specific for different target molecules of interest. For example, at least two of the first nucleic acid, the second nucleic acid, the third nucleic acid, and the fourth nucleic acid are different nucleic acid aptamers. In some cases, the first nucleic acid, the second nucleic acid, the third nucleic acid, and the fourth nucleic acid are all different nucleic acid aptamers. In some instances, at least one of the first nucleic acid, the second nucleic acid, the third nucleic acid, and the fourth nucleic acid is an anti-LAG3 nucleic acid aptamer disclosed herein.

[0028] In some examples, at least one of the first, second, third, and fourth nucleic acids is a nucleic acid aptamer, and at least one of the other nucleic acids is an antisense oligonucleotide, siRNA, or is conjugated to a therapeutic agent.

[0029] In some embodiments, the multimeric nucleic acid complex disclosed herein may further include a nucleic acid group, which includes a fifth nucleic acid, a sixth nucleic acid, a seventh nucleic acid, an eighth nucleic acid, or a combination thereof, wherein each nucleic acid of the nucleic acid group includes a portion that is complementary to the first nucleic acid, the second nucleic acid, the third nucleic acid, or the fourth nucleic acid and forms a duplex with the first nucleic acid, the second nucleic acid, the third nucleic acid, or the fourth nucleic acid. The fifth nucleic acid, the sixth nucleic acid, the seventh nucleic acid, the eighth nucleic acid, or a combination thereof may include a nucleic acid aptamer, an antisense oligonucleotide, or an siRNA. Alternatively, at least one of the fifth nucleic acid, the sixth nucleic acid, the seventh nucleic acid, and the eighth nucleic acid is conjugated to a therapeutic agent, such as a small molecule drug, a peptide drug, or a protein drug.

[0030] In some cases, at least two of the fifth, sixth, seventh, and eighth nucleic acids are specific for the same target molecule of interest. For example, at least two (e.g., all) of the fifth, sixth, seventh, and eighth nucleic acids include the same aptamer. In other cases, at least two (e.g., all) of the fifth, sixth, seventh, and eighth nucleic acids are specific for different target molecules of interest. In some instances, at least one of the fifth, sixth, seventh, and eighth nucleic acids is an anti-LAG3 aptamer disclosed herein.

[0031] In some embodiments, at least one of the fifth, sixth, seventh, and eighth nucleic acids comprises a nucleic acid aptamer, and at least one of the other nucleic acids comprises an antisense oligonucleotide, siRNA, or is conjugated to a therapeutic agent.

[0032] In any of the multimeric nucleic acid complexes described herein (e.g., aptamers), L 1 , L 2 , L 1 ' and L 2 One or more of ', if applicable, is a linker, such as a polyA or polyT segment, which may consist of 4-10 A or T nucleotides. Alternatively or additionally, the palindromic sequence consists of 8, 10, 12, 14 or 16 nucleotides. In some examples, the palindromic sequence is (A / T) 4 (C / G) 4 (A / T) 4 In some embodiments, X and X', L in the first polynucleic acid and the second polynucleic acid in the multimeric nucleic acid aptamer described herein 1 and L 1 ',L 2 and L 2 ', and either Z and Z' (if applicable) are the same.

[0033] In addition, the disclosure features a method for modulating an immune response comprising administering to a subject in need thereof a pharmaceutical composition comprising any nucleic acid aptamer that binds to LAG-3 (in monomeric or polymeric form as described herein) and a pharmaceutically acceptable carrier. Such pharmaceutical compositions that can be formulated for intravenous injection are also within the scope of the disclosure. In some embodiments, any anti-LAG3 aptamer described herein is administered to a subject in only a single dose.

[0034] In some embodiments, the subject may be a human patient who has, is suspected of having, or is at risk of cancer. Examples include, but are not limited to, lung cancer, melanoma, colorectal cancer, renal cell carcinoma, urothelial carcinoma, and Hodgkin's lymphoma. In some instances, the pharmaceutical composition may be administered to a patient in an amount sufficient to enhance T cell activity and / or inhibit cancer growth.

[0035] In addition, the present disclosure features a method for detecting the presence of LAG-3 positive cells, comprising: (i) contacting a cell suspected of expressing LAG-3 with any nucleic acid aptamer (in monomeric or polymeric form) that binds to LAG-3 as described herein, wherein the nucleic acid aptamer is conjugated to a detection agent; and (ii) measuring a signal released from the detection agent conjugated to the nucleic acid aptamer bound to the cell; wherein the signal intensity indicates the presence or level of LAG-3 positive cells. In some embodiments, the contacting step (i) is performed by administering a nucleic acid aptamer or a polymer nucleic acid aptamer to a subject in need thereof.

[0036] The details of one or more embodiments of the present invention are set forth in the following description. Other features or advantages of the present invention will become apparent from the following drawings and detailed description of several embodiments and the appended claims. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figures 1A-1E 1A: is a graph showing the results of LAG-3 / MHC-II bioassays using the indicated LAG-3 aptamer candidates. 1B: a schematic diagram of the conserved motif (SEQ ID NO: 1) identified in the exemplary LAG-3 aptamer. 1C: a graph showing the results of in vitro binding of LAG-3 aptamers to His-tagged recombinant LAG-3 attached to nickel-coated beads. 1D: a graph showing the results of in vitro binding of LAG-3 aptamers to His-tagged recombinant LAG-3 attached to nickel-coated wells of a plate. 1E: is a graph showing the results of in vitro binding of a truncated form of the LAG-3 aptamer B4 to His-tagged recombinant LAG-3 attached to nickel-coated beads.

[0038] Figure 2A-2EFigures showing the molar ratios of backbone molecules and LAG-3 aptamer B4_FL in LAG-3 tetramers determined using size exclusion chromatography. 2A: The molar ratio of backbone: backbone: aptamer is 1:1:10. 2B: The molar ratio of backbone: backbone: aptamer is 1:1:8. 2C: The molar ratio of backbone: backbone: aptamer is 1:1:6. 2D: The molar ratio of backbone: backbone: aptamer is 1:1:5. 2E: The molar ratio of backbone: backbone: aptamer is 1:1:4.

[0039] Figures 3A-3J 3A: The molar ratio of the backbone sequence R1, R2 and the aptamer sequence B4_FL in the LAG-3 aptamer tetramer thus formed. 3B: The molar ratio of the backbone sequence R1_B10_P16 and R2_B10_P16 to the aptamer sequence B4_SL3_P16 in the LAG-3 aptamer tetramer thus formed. 3C: The molar ratio of the backbone sequence R1_B10_P16 and R2_B10_P16 to the aptamer sequence B4_SL8_P16 in the LAG-3 aptamer tetramer thus formed. 3D: The molar ratio of the backbone sequence R1_B10_P16 and R2_B10_P16 to the aptamer sequence B4_SL11_P16 in the LAG-3 aptamer tetramer thus formed. 3E: The molar ratio of the backbone sequences R1_B10_P10 and R2_B10_P10 to the aptamer sequence B4_SL3_P10 in the LAG-3 aptamer tetramer thus formed. 3F: The molar ratio of the backbone sequences R1_B10_P10 and R2_B10_P10 to the aptamer sequence B4_SL8_P10 in the LAG-3 aptamer tetramer thus formed. 3G: The molar ratio of the backbone sequences R1_B10_P10 and R2_B10_P10 to the aptamer sequence B4_SL11_P10 in the LAG-3 aptamer tetramer thus formed. 3H: The molar ratio of the backbone sequences R1_B18_P10 and R2_B18_P10 to the aptamer sequence B4_SL3_P10 in the LAG-3 aptamer tetramer thus formed. 3I: The molar ratio of the backbone sequences R1_B18_P10 and R2_B18_P10 to the aptamer sequence B4_SL8_P10 in the LAG-3 aptamer tetramer thus formed. 3J: The molar ratio of the backbone sequences R1_B18_P10 and R2_B18_P10 to the aptamer sequence B4_SL11_P10 in the LAG-3 aptamer tetramer thus formed.

[0040] Figures 4A-4C4A: A graph showing the results of LAG-3 / MHC-II bioassay using LAG-3 tetramers formed with the sequences shown in Table 4. 4B: A graph showing the results of in vitro binding of LAG-3 tetramers to His-tagged recombinant LAG-3. 4C: A graph showing the results of in vitro binding of LAG-3 tetramers to His-tagged recombinant LAG-3 from different species such as rat, mouse and human.

[0041] Figure 5 is a graph showing the results of size exclusion chromatography of LAG-3 tetramer formed by the aptamer sequence B4-SL3.

[0042] Figures 6A-6C are graphs showing the use of LAG-3 aptamer tetramers for the treatment of xenograft mice bearing colon tumors induced by subcutaneous inoculation of CT26 colon cancer cells. 6A: Schematic representation of the treatment area of ​​a mouse implanted with CT26 colon cancer cells. 6B: Graph showing tumor volume at different time points after implantation of CT26 colon cancer cells in mice. 6C: Picture of a tumor extracted from a mouse on day 21 after implantation of CT 26 colon cancer cells.

[0043] Figures 7A-7D The following are pictures showing agarose gel analysis of various backbone sequences with palindromic residues. 7A: Picture showing agarose gel of backbone sequence with 8 palindromic residues. 7B: Picture showing agarose gel of backbone sequence with 10 palindromic residues. 7C: Picture showing agarose gel of backbone sequence with 12 palindromic residues. 7D: Picture showing agarose gel of backbone sequence with 16 palindromic residues.

[0044] Figures 8A-8B 8A: A diagram showing the results of size exclusion chromatography of a LAG-3 tetramer formed using a backbone sequence having palindromic residues. 8B: A diagram showing the results of size exclusion chromatography of a LAG-3 tetramer formed using a backbone sequence having 8 palindromic residues.

[0045] Fig. 9 is a picture of an agarose gel showing backbone sequences with different 12 residue palindromic sequences. B12P16: SEQ ID NO: 17. B12P16_1: SEQ ID NO: 18. B12P16_2: SEQ ID NO: 19. B12P16_3: SEQ ID NO: 20. B12P16_4: SEQ ID NO: 21. B12P16_5: SEQ ID NO: 22. B12P16_6: SEQ ID NO: 23.

[0046] Figures 10A-10B Contains graphs showing the therapeutic effect of anti-LAG3 aptamer (tetramer) in combination with anti-PD-L1 antibody observed in a mouse model. Fig. 10A : Schematic representation of an exemplary dosing regimen. Fig. 10B : Graph showing inhibition of tumor groups in mice treated with anti-LAG3 aptamer in combination with anti-PD-L1 antibody.

[0047] Fig.11 is a schematic diagram showing a number of exemplary multimeric nucleic acid complexes carrying aptamers, siRNAs and / or therapeutic agents. DETAILED DESCRIPTION

[0048] Lymphocyte activation gene 3 (LAG-3, also known as CD223) is a cell surface molecule belonging to the immunoglobulin (Ig) superfamily. It is a type I transmembrane cell surface protein with four extracellular Ig-like domains. LAG-3 is usually expressed on activated T cells, natural killer cells, B cells and / or dendritic cells. The natural ligand of LAG-3 is MHC class II molecule, and LAG-3 has a higher binding affinity to it than CD4. As a checkpoint receptor, similar to CTLA-4 and PD-1, LAG-3 can negatively regulate T cell proliferation, activation and homeostasis. LAG-3 maintains CD8 during chronic viral infection + The tolerogenic state of cells and / or CD8 + LAG-3 may also play a role in the maturation and activation of dendritic cells. In humans, LAG-3 is encoded by the LAG3 gene. An exemplary amino acid sequence of human LAG-3 can be found under GenBank accession number NP_002277.4.

[0049] Provided herein are nucleic acid aptamers that can bind to LAG-3 and block its interaction with MHC II, thereby modulating immune responses mediated by LAG-3 / MHCII interactions. As observed in animal models, the exemplary anti-LAG-3 aptamers described herein, whether in monomeric or tetrameric form, successfully inhibited tumor growth.

[0050] Thus, described herein are anti-LAG-3 aptamers (in monomeric or polymeric form), pharmaceutical compositions comprising the same, and methods of enhancing immune activity and / or treating diseases (such as cancer) using the anti-LAG-3 aptamers disclosed herein. Also provided herein are designs of multimeric nucleic acid complexes that can be used to deliver various therapeutic agents, including nucleic acid-based agents (e.g., aptamers, antisense oligonucleotides and / or interfering RNAs such as siRNAs), protein-based agents (e.g., peptide drugs or protein drugs), or small molecule agents.

[0051] Anti-LAG-3 Aptamer

[0052] Described herein are nucleic acid aptamers that bind to human LAG-3 and interfere with its interaction with MHC class II molecules (as the natural ligand of LAG-3), thereby modulating an immune response, e.g., an immune response mediated by the interaction between LAG-3 and MHC class II molecules. Thus, the anti-LAG-3 aptamers disclosed herein will effectively modulate immune responses, which may be beneficial in treating certain diseases and disorders, such as cancer and immune disorders (e.g., autoimmune disorders).

[0053] As used herein, nucleic acid aptamers refer to nucleic acid molecules (DNA or RNA) that have binding activity to a specific target molecule (e.g., LAG-3). Aptamers can bind to specific target molecules, thereby inhibiting the activity of target molecules by, for example, blocking the binding of target molecules to their natural ligands, causing conformational changes in target molecules, and / or blocking the active center of target molecules. The anti-LAG-3 aptamers (in linear or circular form) disclosed herein can be RNA, DNA (e.g., single-stranded DNA), modified nucleic acids, or mixtures thereof. Anti-LAG-3 aptamers can be non-natural molecules (e.g., containing nucleotide sequences that are not present in natural genes or containing modified nucleotides that are not present in natural genes). Alternatively or in addition, anti-LAG-3 aptamers may not contain nucleotide sequences encoding functional peptides. In some cases, anti-LAG-3 aptamers may be monomeric, i.e., include one binding site for a target molecule. Alternatively, anti-LAG3 aptamers may be polymeric, i.e., include 2 or more binding sites for one or more target molecules. See discussion below.

[0054] The anti-LAG-3 nucleic acid aptamers disclosed herein may include a G-rich segment (e.g., which plays an important role in binding to LAG-3 molecules (e.g., human LAG-3) and interfering with its interaction with MHC class II ligands). In some embodiments, the anti-LAG-3 aptamer may include a nucleotide motif (a): GX 1 GGGX 2 GGTX 3 A (SEQ ID NO: 1), wherein X 1 and X 2 Each may independently be G, C or absent, and / or X 3 Can be T or C. In some examples, X 3 Can be T. Alternatively or additionally, X 1 , X 2 Or both may not exist. In other examples, X 1 , X 2 or both can be G or C. In a specific example, X 1 , X 2Or both are G. For example, the anti-LAG-3 aptamer may include a nucleotide motif of GGGGGGTTA (SEQ ID NO: 24), GGGGGGGTTA (SEQ ID NO: 25), GGGGGGGGTTA (SEQ ID NO: 2), or GGGGGGGGGTTA (SEQ ID NO: 26).

[0055] In other embodiments, the anti-LAG-3 aptamer may include the nucleotide motif (b): L-(G) n -L', wherein n is an integer from 5 to 9 (including 5 and 9) (e.g., 5, 6, 7, 8 or 9; SEQ ID Nos: 3-7, respectively), L and L' are nucleotide sequences having complementary sequences, such that the anti-LAG-3 aptamer can have a hairpin structure, wherein L / L' forms a stem region, and the polyG segment forms the entire or a portion of the loop structure. In some cases, a portion of segment L is complementary to all or a portion of segment L'. In other cases, a portion of segment L' is complementary to all or a portion of segment L.

[0056] Both motif (a) and motif (b) contain a polyG segment, which is expected to play an important role in the binding of the aptamer to LAG-3. Therefore, it is expected that a nucleic acid molecule including either motif is an anti-LAG-3 aptamer as described herein.

[0057] In some examples, an anti-LAG-3 aptamer disclosed herein may include a nucleotide sequence that is at least 85% (e.g., 90%, 95%, or 98%) identical to the following nucleotide sequence:

[0058] (i) TGGGGGGGGTTAGTTCAATACATGCGGGCG (SEQ ID NO: 8);

[0059] (ii) TGGGGGGGGGTTAGACTTACACTCTTATTCG (SEQ ID NO: 9);

[0060] (iii) AGAGGGGGGGGTTAGCTGCTTTAACTCATG (SEQ ID NO: 10); or

[0061] (iv) AGGGGGGGGGTTACTGCGCATGTATCTCAG (SEQ ID NO: 11).

[0062] Such anti-PDL1 nucleic acid aptamers disclosed herein may include or consist of any one of the nucleotide sequences in (i)-(iv) above.

[0063] The "percent identity" of two nucleic acids is determined using the algorithm of Karlin and Altschul Proc. Natl. Acad. Sci. USA 87:2264-68, 1990 (modified as in Karlin and Altschul Proc. Natl. Acad. Sci. USA 90:5873-77, 1993). This algorithm is incorporated into the NBLAST and XBLAST programs (version 2.0) of Altschul, et al. J. Mol. Biol. 215:403-10, 1990. BLAST nucleotide searches can be performed with the NBLAST program, score = 100, word length -12, to obtain nucleotide sequences homologous to the nucleic acid molecules of the invention. When a gap exists between the two sequences, Gapped BLAST can be used as described in Altschul et al., Nucleic Acids Res. 25 (17):3389-3402, 1997. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (eg, XBLAST and NBLAST) can be used.

[0064] In other embodiments, the anti-PDL1 aptamers described herein may contain up to 8 (e.g., up to 7, 6, 5, 4, 3, 2, or 1) nucleotide changes compared to a reference sequence (such as any of nucleotide sequences (i)-(iv)). The position at which such changes may be introduced may be determined based on, for example, the secondary structure of the aptamer predicted using a computer algorithm (such as Mfold). For example, a base pair in the double-stranded stem region may be mutated to a different base pair. Such a mutation will maintain the base pair in the double-stranded region at this position and therefore will have no significant effect on the overall secondary structure of the aptamer. Such mutations are well known to those skilled in the art. For example, an AT pair may mutate to a TA pair. Alternatively, it may mutate to a GC or CG pair. In another example, a GC pair may mutate to a CG pair. Alternatively, it may mutate to an AT pair or a TA pair. Preferably, one or more changes are located outside the core sequence GGGGGGTTAA (SEQ ID NO: 27), GGGGGGGTTA (SEQ ID NO: 28) or GGGGGGGGTTA (SEQ ID NO: 29).

[0065] In some examples, the anti-LAG-3 aptamer comprises the nucleotide sequence TGGGGGGGGTTAGTTCAATACATG (SEQ ID NO: 12). Examples include but are not limited to:

[0066] TCCCTACGGCGCTAACTGGGGGGGGTTAGTTCAATACATGCGGGCGGCCACCGTGCTACAAC (SEQ IDNO: 13);

[0067] ACGGCGCTAACTGGGGGGGGTTAGTTCAATACATG (SEQ ID NO: 14);

[0068] GCTAACTGGGGGGGGTTAGTTCAATACATGCGGGC (SEQ ID NO: 15); and

[0069] CTGGGGGGGGTTAGTTCAATACATGCGGGCGGCCA (SEQ ID NO: 16).

[0070] Any of the anti-LAG-3 aptamers may also contain an anchor segment at the 5' end, the 3' end, or both. When the aptamer contains anchor segments at both the 5' end and the 3' end, the two anchor segments may be the same or different. The anchor segment may serve as a primer binding site, which can be used to amplify the aptamer sequence. Alternatively or additionally, the anchor segment may be used as a binding site for linking the aptamer to a backbone nucleic acid via base pairing to form a multimeric anti-LAG-3 aptamer. See discussion below. Exemplary anchor sequences include 5'-TCCCTACGGCGCTAAC-3' (SEQ ID NO: 30) and 5'-GCCACCGTGCTACAAC-3' (SEQ ID NO: 31). The anti-LAG-3 aptamers described herein may contain the entire anchor sequence described above or a portion thereof. Exemplary aptamers containing anchor sequences are provided below (anchor sequences are italicized; core sequences are in bold):

[0071] 5'-TCCCTACGGCGCTAACTGGGGGGGGTTAGTTCAATACATGCGGGCGGCCACCGTGCTACAAC-3' (SEQ ID NO: 13)

[0072] 5'-TCCCTACGGCGCTAACTGGGGGGGGGTTAGACTTACACTCTTATTCGGCCACCGTGCTACAAC-3' (SEQ ID NO: 32)

[0073] 5'-TCCCTACGGCGCTAACAGAGGGGGGGGTTAGCTGCTTTAACTCATGGCCACCGTGCTACAAC-3' (SEQ ID NO: 33)

[0074] 5'-TCCCTACGGCGCTAACAGGGGGGGGGGTTACTGCGCATGTATCTCAGGCCACCGTGCTACAAC-3' (SEQ ID NO: 34)

[0075] Any anti-PDL1 aptamer disclosed herein may contain a length of about 30-100 nucleotides (nt) (e.g., 35-100nt). In some embodiments, the nucleic acid aptamer comprising the nucleic acid motif is about 40-80nt, 40-65nt, 40-62nt, 50-80nt, 60-80nt, or 70-80nt. In some embodiments, the nucleic acid aptamer comprising the nucleic acid motif is about 30-70nt, 30-65nt, 30-62nt, 30-60nt, 30-50nt, or 30-40nt. In some specific examples, the length of the anti-LAG-3 aptamer may be in the range of about 50nt to about 60nt.

[0076] Generally, the term "about" means within an acceptable error range for a particular value determined by one of ordinary skill in the art. "About" can mean a range of less than ±30%, preferably less than ±20%, more preferably less than ±10%, more preferably less than ±5%, and more preferably less than ±1% of a given value.

[0077] In some embodiments, the anti-LAG-3 aptamers described herein can bind to LAG-3 (e.g., human LAG-3) with a dissociation constant (Kd) of less than 20 nM (e.g., 15 nM, 10 nM, 5 nm, 1 nm, or less). The anti-LAG-3 aptamers can specifically bind to human LAG-3. Alternatively, the aptamers can bind to LAG-3 molecules from different species (e.g., human, mouse, or rat). When bound to LAG-3 molecules expressed on the surface of a cell, such aptamers can inhibit the activity of LAG-3 (thereby increasing immune cell activity, such as T cell activity) by at least 20% (e.g., 40%, 50%, 80%, 100%, 2-fold, 5-fold, 10-fold, 100-fold, or 1000-fold). The inhibitory activity of anti-LAG-3 aptamers on LAG-3 (and thus enhancing the activation of immune cell activity such as T cell activity) can be determined by methods known in the art, for example, T cell proliferation assays, which have been previously described in, for example, Clay TM, et al., Assays for Monitoring Cellular Immune Responses to Active Immunotherapy of Cancer, Clin Cancer Res., May 2001, 7, 1127; the relevant teachings of which are incorporated herein by reference. It should be understood that the methods for measuring T cell activity provided herein are exemplary and are not meant to be limiting.

[0078] In some embodiments, any of the anti-LAG-3 aptamers described herein may contain non-naturally occurring nucleobases, sugars, or covalent internucleoside linkages (backbones). Such modified oligonucleotides impart desirable properties, such as enhanced cellular uptake, improved affinity for target nucleic acids, and increased in vivo stability.

[0079] In one example, aptamers described herein have modified backbones, including those that retain phosphorus atoms (see, e.g., U.S. Pat. Nos. 3,687,808; 4,469,863; 5,321,131; 5,399,676 and 5,625,050) and those that do not have phosphorus atoms (see, e.g., U.S. Pat. Nos. 5,034,506; 5,166,315 and 5,792,608). The example of phosphorus-containing modified skeleton includes but is not limited to thiophosphate, chiral thiophosphate, phosphorodithioate, phosphotriester, aminoalkyl-phosphotriester, methyl and other alkyl phosphonates (comprising 3'-alkylene phosphonates, 5'-alkylene phosphonates and chiral phosphonates), phosphinate, phosphoramide (comprising 3'-aminophosphoramide and aminoalkyl phosphoramide, thiophosphoramide), thioalkylphosphonates, thioalkylphosphotriester, selenophosphoramidate and boric acid phosphate, it has 3'-5' key or 2'-5' key.This skeleton also includes those with reverse polarity, that is, 3' to 3', 5' to 5' or 2' to 2' key.The modified skeleton not comprising phosphorus atom is formed by key between short-chain alkyl or cycloalkyl nucleosides, heteroatoms and alkyl or cycloalkyl nucleosides of mixing, or key between one or more short-chain heteroatoms or heterocyclic nucleosides. Such backbones include those with morpholino bonds (formed in part by the sugar portion of the nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; acetyl and thioacetyl backbones; methyleneacetyl and thioacetyl backbones; riboseacetyl backbones; olefin-containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and backbones with mixed N, O, S and CH 2 Other skeletons of component parts.

[0080] In another example, the aptamers described herein comprise one or more substituted sugar moieties. Such substituted sugar moieties may comprise one of the following groups at their 2' position: OH; F; O-alkyl, S-alkyl, N-alkyl, O-alkenyl, S-alkenyl, N-alkenyl; O-alkynyl, S-alkynyl, N-alkynyl and O-alkyl-O-alkyl. Among these groups, alkyl, alkenyl and alkynyl may be substituted or unsubstituted C1 to C10 alkyl or C2 to C10 alkenyl and alkynyl. They may also comprise heterocycloalkyl, heterocycloalkylaryl, aminoalkylamino, polyalkylamino, substituted silyl, RNA cleavage groups, reporter groups, intercalators, groups for improving the pharmacokinetic properties of oligonucleotides, or groups for improving the pharmacodynamic properties of oligonucleotides at their 2' position. Preferred substituted sugar moieties include those with 2'-methoxyethoxy, 2'-dimethylaminooxyethoxy and 2'-dimethylaminoethoxyethoxy. See Martin et al., Helv. Chim. Acta, 1995, 78, 486-504.

[0081] Alternatively or additionally, the aptamers described herein comprise one or more modified natural nucleobases (i.e., adenine, guanine, thymine, cytosine, and uracil). Modified nucleobases include those described in U.S. Pat. No. 3,687,808, The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, JI, ed. John Wiley & Sons, 1990; Englisch et al., Angewandte Chemie, International Edition, 1991, 30,613, and Sanghvi, YS, Chapter 15, Antisense Research and Applications, pages 289-302, CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the aptamer molecule to its target site. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines (e.g., 2-aminopropyl-adenine, 5-propynyluracil, and 5-propynylcytosine). See Sanghvi, et al., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278.

[0082] Alternatively or additionally, the anti-PDL1 aptamers described herein may include one or more locked nucleic acids (LNAs). LNAs are commonly referred to as inaccessible RNAs and are modified RNA nucleotides in which the ribose moiety is modified with an additional bridge connecting the 2' oxygen and the 4' carbon. The bridge "locks" the ribose into a 3'-internal (North) conformation, which is typically found in A-type duplexes. LNA nucleotides can be used in any anti-PDL1 aptamer described herein. In some instances, up to 50% (e.g., 40%, 30%, 20% or 10%) of the nucleotides in the anti-PDL1 aptamer are LNAs. In some instances, the anti-PDL1 aptamer may include 10, 8, 6, 5, 4, 3, 2 or 1 LNAs.

[0083] Any aptamer described herein can be prepared by conventional methods (e.g., chemical synthesis or in vitro transcription). The expected biological activities described herein can be verified by, for example, those described in the following examples. Vectors for expressing any anti-PDL1 aptamer are also within the scope of the present disclosure.

[0084] Any aptamer described herein can be conjugated to one or more polyether moieties (such as polyethylene glycol (PEG) moieties) by covalent bonds, non-covalent bonds, or both. Therefore, in some embodiments, the aptamers described herein are PEGylated. For PEG moieties of specific molecular weights, the disclosure is not intended to be limiting. In some embodiments, the molecular weight of the polyethylene glycol moiety is in the range of 5kDa to 100kDa, 10kDa to 80kDa, 20kDa to 70kDa, 20kDa to 60kDa, 20kDa to 50kDa, or 30kDa to 50kDa. In some instances, the PEG moiety has a molecular weight of 40kDa. The PEG moiety conjugated to the anti-PDL1 aptamer described herein can be linear or branched. It can be conjugated to the 5' end of the nucleic acid aptamer, the 3' end of the aptamer, or both. When desired, the PEG moiety can be covalently conjugated to the 3' end of the nucleic acid aptamer.

[0085] Methods for conjugating PEG moieties to nucleic acids are known in the art and have been previously described, for example, in PCT Publication No. WO2009 / 073820, the relevant teachings of which are incorporated herein by reference. It should be understood that the PEG-conjugated aptamers and methods for conjugating PEG to the aptamers described herein are exemplary and non-limiting.

[0086] Polymeric Aptamers

[0087] The present disclosure also provides nucleic acid aptamers in the form of polymers, that is, they contain more than one aptamer binding portion for binding to the same or different target molecules of interest. In some cases, the multimeric aptamer is a tetramer containing four aptamer binding portions, which may be specific for the same target molecule or different target molecules. Relative to the same aptamer binding portion in monomeric form, when the multimeric aptamer contains multiple binding portions to the same target molecule, it is expected to show higher binding activity to the target molecule. In addition, when containing multiple binding portions for different target molecules, the multimeric aptamer will have multiple binding specificities, allowing simultaneous binding and regulation of multiple targets.

[0088] The polymer nucleic acid aptamer described herein may include a backbone portion, which may be covalently or conjugated to multiple (e.g., 2, 3, or 4) aptamer portions by base pairing. In certain embodiments, the backbone portion contains two nucleic acid molecules, and the middle portion of each nucleic acid molecule contains a complementary sequence. As used herein, a complementary sequence (comprising a fully or partially complementary sequence) refers to a sequence that can form a double-stranded duplex by base pairing according to the standard Watson-Crick complementary rules. The nucleic acid molecule of the backbone portion also contains a nucleotide sequence flanking the complementary sequence. Each flanking sequence may contain a docking site, which includes a sequence complementary to a portion of the aptamer sequence (e.g., the anchoring site discussed in the above section), so that the docking site can be conjugated to the aptamer by base pairing. Alternatively, the flanking sequence may include an aptamer portion. The flanking sequence and the complementary sequence in each nucleic acid molecule of the backbone portion may be directly covalently linked, or covalently linked by a linker (such as a polyA or polyT segment).

[0089] In some embodiments, the backbone portion may contain two identical nucleic acid molecules, which may contain a palindromic sequence as described below. A palindromic sequence (also referred to as a reverse-inverted sequence) refers to a nucleotide sequence that matches a complementary sequence read between 5' and 3' (from 5' to 3' forward). Palindromic sequences tend to self-assemble to form a stem-loop (hairpin) structure, which may be problematic in constructing a multimeric aptamer complex. Unexpectedly, the present disclosure reports the successful construction of a tetrameric aptamer using a backbone portion comprising a palindromic sequence. Such tetramers exhibit desired biological activity, as shown in the following examples.

[0090] In other embodiments, the backbone portion may contain two different nucleic acid molecules. The backbone portion may be conjugated to 2, 3 or 4 aptamer portions. In some cases, all aptamer portions are capable of binding to the same target molecule, e.g., the same aptamer portion. In other cases, at least two aptamer portions are capable of binding to different target molecules, i.e., multispecific aptamers.

[0091] In some embodiments, the multimeric aptamers disclosed herein (eg, tetramers) may include a first polynucleic acid, a first nucleic acid aptamer, and a second nucleic acid aptamer, all of which form a complex. The first polynucleic acid includes a nucleotide sequence of 5'-XL 1 -YL 2 -Z-3'. X and Z are each independently a nucleotide segment containing a docking site complementary to a portion of the first nucleic acid aptamer and the second nucleic acid aptamer, respectively, so that the first nucleic acid aptamer and the second nucleic acid aptamer can form base pairs with the X and Z segments in the first polynucleic acid. In some cases, X and Z are the same. In other cases, X and Z are different (e.g., in length and / or sequence). L 1 and L 2Each is a linker, which can be a polyA or polyT segment (e.g., containing 4-10 A or T residues). 1 and L 2 are the same linker. In other examples, L 1 and L 2 is a different linker (e.g., different in sequence and / or length). 1 , L 2 Or both may not exist.

[0092] Y is a palindromic sequence, which may contain 8, 10, 12, 14, and 16 nucleotides. In some cases, the palindromic sequence contains (A / T) 4 (G / C) 4 (A / T) 4 Exemplary palindromic sequences include, but are not limited to, TCAGCTGA (SEQ ID NO: 35), ATCAGCTGAT (SEQ ID NO: 36), ATATCGCGATAT (SEQ ID NO: 37), or ATATGACGCGTCATAT (SEQ ID NO: 38).

[0093] The polymer aptamer disclosed above may further include a second polynucleic acid, a third nucleic acid aptamer and a fourth nucleic acid aptamer. The second polynucleic acid may include a nucleotide sequence of the formula 5'-X'-L 1 '-YL 2 '-Z'-3'. X' and Z' are each independently a nucleotide segment containing a docking site complementary to a portion of the third nucleic acid aptamer and the fourth nucleic acid aptamer, respectively, so that the third nucleic acid aptamer and the fourth nucleic acid aptamer can form base pairs with the X' and Z' segments in the second polynucleic acid. In some cases, X' and Z' are the same. In other cases, X' and Z' are different (e.g., in length and / or sequence). In some instances, X and X' and / or Z and Z' are the same. In other instances, X is different from X' and / or Z is different from Z'. L 1 ' and L 2 ' are each linkers, which may be polyA or polyT segments (eg, containing 4-10 A or T residues). In some examples, L 1 ' and L 2 ' are the same linker. In other examples, L 1 ' and L 2 ' is a different linker (eg, different in sequence and / or length).

[0094] In some instances, the first polynucleic acid and the second polynucleic acid in the above-mentioned multimeric aptamer are the same molecule. In other instances, the first polynucleic acid and the second polynucleic acid are different in at least one aspect, for example, different docking sites and / or different linkers. In some cases, at least two aptamers (2, 3 or 4) in the multimeric aptamer complex bind to the same target molecule. In one example, the aptamers (2, 3 or 4) are the same aptamer molecules. In other cases, at least two aptamers (2, 3 or 4) in the multimeric aptamer complex bind to different target molecules.

[0095] Any of the multimeric aptamers described herein, such as tetramers, may contain one or more anti-LAG-3 nucleic acid aptamers described herein. In some embodiments, the multimeric aptamer is a tetramer containing 1, 2, 3, or 4 anti-LAG-3 nucleic acid aptamers as described herein. When the tetramer contains 2 or more anti-LAG-3 aptamers, the anti-LAG-3 aptamer moieties may be the same or different. In some examples, the tetramer contains four identical anti-LAG-3 moieties, which may be any of the anti-LAG-3 aptamers described herein.

[0096] The anti-LAG-3 aptamer can be conjugated to the backbone portion in the multimeric aptamer through base pairing. Alternatively, the anti-LAG-3 aptamer can be covalently linked to the backbone nucleic acid to form a single polynucleotide chain. See the above discussion.

[0097] Polymeric nucleic acid complex

[0098] In addition, the present disclosure provides a general design of a polymer (e.g., tetramer) nucleic acid molecule using a palindromic sequence. A palindromic sequence suitable for preparing a polymer nucleic acid molecule may contain 8, 10, 12, 14, or 16 nucleotides. In some cases, a palindromic sequence contains (A / T) 4 (G / C) 4 (A / T) 4 Exemplary palindromic sequences include, but are not limited to, TCAGCTGA (SEQ ID NO: 35), ATCAGCTGAT (SEQ ID NO: 36), ATATCGCGATAT (SEQ ID NO: 37), or ATATGACGCGTCATAT (SEQ ID NO: 38).

[0099] An exemplary tetrameric nucleic acid complex may contain two polynucleic acid molecules, each polynucleic acid molecule comprising a palindromic sequence flanked by two nucleic acid segments. The target nucleic acid may be directly linked to the palindromic sequence or linked to the palindromic sequence through a linker (such as those described herein). The two polynucleic acid molecules form a duplex through the palindromic sequence, thereby generating a polynucleic acid complex disclosed herein.

[0100] In some embodiments, at least one or all of the nucleic acid segments flanking the palindromic sequence in the two polynucleic acid molecules include a nucleic acid-based therapeutic agent, such as an aptamer (e.g., an anti-LAG3 aptamer disclosed herein), an antisense oligonucleotide, and / or an interfering RNA (such as siRNA). Alternatively or additionally, at least one or all of the nucleic acid segments flanking the palindromic sequence in the two polynucleic acid molecules are conjugated to a therapeutic agent, which may be a peptide drug, a protein drug, or a small molecule drug. A peptide drug, a protein drug, or a small molecule drug refers to any peptide, protein, or small molecule with therapeutic activity.

[0101] In other embodiments, the polynucleotide complex disclosed herein may include one or more nucleic acids, each nucleic acid containing a segment complementary to a portion or all of a nucleic acid segment flanking a palindromic sequence in two polynucleotide molecules, such that the additional nucleic acid forms a duplex with the nucleic acid segment flanking the palindromic sequence. In some cases, the one or more additional nucleic acids may include a nucleic acid-based therapeutic agent (same or different), such as a nucleic acid aptamer (e.g., any anti-LAG3 aptamer disclosed herein), an antisense oligonucleotide, and / or an interfering RNA (such as siRNA). In other cases, the one or more additional nucleic acids may be conjugated to a non-nucleic acid-based therapeutic agent, such as a peptide drug, a protein drug, or a small molecule drug.

[0102] In some cases, the polymer nucleic acid complexes disclosed herein may carry the same therapeutic agents as those described herein. In other cases, the polymer nucleic acid complexes disclosed herein may carry multiple therapeutic agents. In some embodiments, the polymer nucleic acid complexes may contain the same type of target nucleic acid (e.g., nucleic acid aptamers, antisense oligonucleotides or siRNAs capable of binding to the same target). Alternatively, the polymer nucleic acid complexes described herein may contain different types of target nucleic acids (e.g., nucleic acid aptamers binding to different targets). In other embodiments, the polymer nucleic acid complexes disclosed herein may include multiple therapeutic agents, which may be different types of molecules (e.g., peptides, proteins, nucleic acids and / or small molecules). For example, the polymer nucleic acid complexes may include nucleic acid aptamers and therapeutic agents targeting biomarkers associated with a disease, so that the aptamer can guide the therapeutic agent to the position where the biomarker is presented to exert its therapeutic activity.

[0103] Pharmaceutical composition

[0104] One or more anti-LAG-3 aptamers (in monomeric or multimeric form as described herein, and / or in free or PEG-conjugated form as described herein) can be mixed with a pharmaceutically acceptable carrier (excipient) to form a pharmaceutical composition for treating a target disease. "Acceptable" means that the carrier must be compatible with the active ingredients of the composition (and preferably, capable of stabilizing the active ingredients) and not harmful to the subject to be treated. Pharmaceutically acceptable excipients (carriers), including buffers, are well known in the art. See, for example, Remington: The Science and Practice of Pharmacy 20th Ed. (2000) Lippincott Williams and Wilkins, Ed. KE Hoover.

[0105] The pharmaceutical composition used in the method of the present invention may include a pharmaceutically acceptable carrier, excipient or stabilizer in the form of a lyophilized formulation or an aqueous solution. See, for example, Remington: The Science and Practice of Pharmacy 20th Ed. (2000) Lippincott Williams and Wilkins, Ed. KE Hoover. Acceptable carriers, excipients or stabilizers are nontoxic to the recipient at the dosages and concentrations used, and may include buffers such as phosphates, citrates and other organic acids; antioxidants, including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl alcohol or benzyl alcohol; alkyl parabens such as methyl paraben or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextran; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose, or sorbitol; salt-forming counterions such as sodium; metal complexes (e.g., zinc protein complexes); and / or nonionic surfactants such as TWEEN TM 、PLURONICS TM or polyethylene glycol (PEG).

[0106] In some examples, the pharmaceutical compositions described herein include liposomes containing any LAG-3 binding aptamer (in monomeric or polymeric form, or a carrier for producing the aptamer), which can be prepared by methods known in the art, such as Epstein, et al., Proc. Natl. Acad. Sci. USA 82: 3688 (1985); Hwang, et al., Proc. Natl. Acad. Sci. USA 77: 4030 (1980); and described in U.S. Pat. Nos. 4,485,045 and 4,544,545. Liposomes with extended circulation time are disclosed in U.S. Pat. No. 5,013,556. Particularly useful liposomes can be generated by a reverse phase evaporation method using a lipid composition comprising phosphatidylcholine, cholesterol, and PEG-derivatized phosphatidylethanolamine (PEG-PE). The liposomes are extruded through a filter of defined pore size to produce liposomes having a desired diameter.

[0107] The anti-LAG-3 aptamers described herein can also be embedded in microcapsules (e.g., prepared by coacervation techniques or by interfacial polymerization, e.g., hydroxymethylcellulose or gelatin microcapsules and poly(methyl methacrylate) microcapsules, respectively), colloidal drug delivery systems (e.g., liposomes, albumin microspheres, microemulsions, nanoparticles and nanocapsules), or macroemulsions. Such techniques are known in the art, see, e.g., Remington, The Science and Practice of Pharmacy 20th Ed. Mack Publishing (2000).

[0108] In other examples, the pharmaceutical compositions described herein can be formulated in a sustained release form. Suitable examples of sustained release formulations include a semipermeable matrix of a solid hydrophobic polymer containing a LAG-3 binding aptamer, the matrix being in the form of a molded article, e.g., a film or a microcapsule. Examples of sustained release matrices include polyesters, hydrogels (e.g., poly(2-hydroxyethyl methacrylate), or poly(vinyl alcohol)), polylactides (U.S. Pat. No. 3,773,919), copolymers of L-glutamic acid and L-glutamic acid-7-ethyl ester, non-degradable ethylene-vinyl acetate, degradable lactic acid-glycolic acid copolymers (such as LUPRON DEPOT™ (injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate)), sucrose acetate isobutyrate, and poly-D-(-)-3-hydroxybutyric acid.

[0109] Pharmaceutical compositions for in vivo administration must be sterile. This is easily achieved, for example, by filtration through a sterile filtration membrane. The therapeutic PDL1 binding aptamer composition can be placed in a container with a sterile access port, for example, an intravenous bag or vial with a stopper pierceable by a hypodermic injection needle.

[0110] The pharmaceutical compositions described herein may be in unit dosage form, such as tablets, pills, capsules, powders, granules, solutions or suspensions, or suppositories, for oral, parenteral or rectal administration, or administration by inhalation or insufflation.

[0111] In order to prepare solid compositions, such as tablets, the main active ingredient can be mixed with a pharmaceutical carrier (e.g., conventional tableting ingredients, such as corn starch, lactose, sucrose, sorbitol, talc, stearic acid, magnesium stearate, dicalcium phosphate or gum) and other pharmaceutical diluents (e.g., water) to form a solid preformulation composition containing a homogeneous mixture of the compound of the present invention, or a non-toxic pharmaceutically acceptable salt thereof. When these preformulation compositions are referred to as homogeneous, it is meant that the active ingredient is evenly dispersed throughout the composition so that the composition can be easily subdivided into equally effective unit dosage forms, such as tablets, pills and capsules. The solid preformulation composition is then subdivided into unit dosage forms of the above type containing 0.1 mg to about 500 mg of the active ingredient of the present invention. The tablets or pills of the novel composition can be coated or otherwise compounded to provide a dosage form with the advantage of prolonged action. For example, a tablet or pill can include an internal dose and an external dose component, the latter being an encapsulated form on the former. The two components can be separated by an enteric layer which serves to resist disintegration in the stomach and permit the inner component to pass intact into the duodenum or to be delayed in release. A variety of materials can be used for such enteric layers or coatings, such materials including a variety of polymeric acids and mixtures of polymeric acids with materials such as shellac, cetyl alcohol, and cellulose acetate.

[0112] Suitable surfactants specifically include nonionic agents such as polyoxyethylene sorbitan (e.g., Tween TM 20, 40, 60, 80 or 85) and other sorbitans (e.g., Span TM 20, 40, 60, 80 or 85). Compositions with surfactant will conveniently include 0.05% to 5% surfactant, and may be 0.1% to 2.5%. It should be understood that other ingredients may be added if desired, such as mannitol or other pharmaceutically acceptable solvents.

[0113] Suitable emulsions include commercially available fat emulsions (such as Intralipid TM , Liposyn TM Infonutrol TM , Lipofundin TM Lipiphysan TM) is prepared. The active ingredient is soluble in a premixed emulsion composition, or it is soluble in an oil (e.g., soybean oil, safflower oil, cottonseed oil, sesame oil, corn oil or almond oil) and an emulsion formed by mixing with a phospholipid (e.g., lecithin, soybean lecithin or soybean lecithin) and water. It should be understood that other ingredients, such as glycerol or glucose, can be added to adjust the tension of the emulsion. Suitable emulsions typically contain up to 20% oil, such as 5% to 20%. Fat emulsions can include fat droplets of suitable size and can have a pH in the range of 5.5 to 8.0.

[0114] The emulsion composition can be prepared by combining the anti-LAG-3 aptamer with the Intralipid TM Or those prepared by mixing its components (soybean oil, lecithin, glycerin and water).

[0115] Pharmaceutical compositions for inhalation or insufflation include solutions and suspensions in pharmaceutically acceptable aqueous or organic solvents or mixtures thereof, and powders. Liquid or solid compositions may contain suitable pharmaceutically acceptable excipients as described above. In some embodiments, the compositions are administered by the oral or nasal respiratory route for local or systemic effect.

[0116] Compositions in preferably sterile pharmaceutically acceptable solvents can be aerosolized by the use of gases. Aerosolized solutions can be inhaled directly from the aerosolizing device, or the aerosolizing device can be connected to a mask, tent or intermittent positive pressure breathing machine. Solution, suspension or powder compositions can be administered from a device that delivers the formulation in an appropriate manner, preferably orally or nasally.

[0117] Therapeutic applications

[0118] Any anti-LAG-3 aptamer in monomeric or multimeric form, free or PEG-conjugated form, all of which have been described herein, can be used to modulate immune activity, such as promoting T cell proliferation, thereby effectively treating diseases or disorders that can benefit from modulating immune responses, such as cancer or immune disorders.

[0119] To practice the methods disclosed herein, an effective amount of a pharmaceutical composition containing at least one anti-LAG-3 aptamer described herein can be administered to a subject (e.g., a human) in need of treatment by a suitable route, such as intravenous administration, e.g., bolus injection or continuous infusion over a period of time, by intramuscular, intraperitoneal, intracerebrospinal, subcutaneous, intraarticular, intrasynovial, intrathecal, oral, inhalation, or topical routes. Commercially available nebulizers for liquid formulations, including jet nebulizers and ultrasonic nebulizers, can be used for administration. Liquid formulations can be directly nebulized, while lyophilized powders can be nebulized after reconstitution. Alternatively, the compositions containing anti-LAG-3 aptamers described herein can be nebulized using fluorocarbon formulations and metered dose inhalers, or inhaled as lyophilized and ground powders.

[0120] As used herein, "effective amount" refers to the amount of each active agent required to administer a therapeutic effect to a subject alone or in combination with one or more other active agents. In some embodiments, the therapeutic effect is a reduction in tumor burden, a reduction in cancer cells, or an increase in immune activity. Determining whether the amount of LAG-3 binding aptamer is sufficient to achieve a therapeutic effect is apparent to one skilled in the art. As will be appreciated by those skilled in the art, the effective amount varies depending on the specific condition being treated, the severity of the condition, individual patient parameters (including age, physical condition, size, sex, and weight), the duration of treatment, the nature of concurrent therapy (if any), the specific route of administration, and similar factors within the knowledge and expertise of the health care practitioner. These factors are well known to those of ordinary skill in the art and can be resolved by only routine experimentation. It is generally preferred to use the maximum dose of the individual components or combinations thereof, i.e., the highest safe dose based on sound medical judgment.

[0121] Empirical considerations such as half-life will generally help determine the dosage. The frequency of administration can be determined and adjusted during the course of treatment and is generally, but not necessarily, based on the treatment and / or inhibition and / or amelioration and / or delay of the target disease / disorder. Alternatively, sustained continuous release formulations of LAG-3 binding aptamers are also suitable. Various formulations and devices for achieving sustained release are known in the art.

[0122] In one example, the dosage of an anti-LAG-3 aptamer as described herein can be determined empirically in an individual who has been given one or more administrations of a LAG-3 binding aptamer. The individual is given increasing doses of an antagonist. To assess the efficacy of the antagonist, indicators of the disease / disorder can be tracked.

[0123] Typically, for administration of any anti-LAG-3 aptamer described herein, the initial candidate dose may be about 2 mg / kg. For purposes of the present disclosure, a typical daily dose may be in any range of about 0.1 μg / kg to 3 μg / kg, to 30 μg / kg, to 300 μg / kg, to 3 mg / kg, to 30 mg / kg, to 100 mg / kg or more, depending on the factors mentioned above. For repeated administration over several days or longer, depending on the condition, treatment is continued until the desired symptom suppression occurs or until a therapeutic level sufficient to alleviate the target disease or condition or its symptoms is reached. An exemplary dosing regimen includes administration of an initial dose of about 2 mg / kg, followed by a maintenance dose of about 1 mg / kg of the LAG-3 binding aptamer weekly, or then a maintenance dose of about 1 mg / kg every other week. However, other dosing regimens may be useful, depending on the pattern of pharmacokinetic decay that the physician wishes to achieve. For example, one to four doses per week may be considered. In some embodiments, a dose ranging from about 3 μg / mg to about 2 mg / kg (such as about 3 μg / mg, about 10 μg / mg, about 30 μg / mg, about 100 μg / mg, about 300 μg / mg, about 1 mg / kg, and about 2 mg / kg) can be used. In some embodiments, the dosing frequency is once every week, every 2 weeks, every 4 weeks, every 5 weeks, every 6 weeks, every 7 weeks, every 8 weeks, every 9 weeks, or every 10 weeks; or once every month, every 2 months, or every 3 months or longer. The progress of the therapy is easily monitored by conventional techniques and assays. The dosing regimen (including the LAG-3 binding aptamer used) can vary over time. In a specific example, the LAG-3 binding aptamer described herein can be administered to a subject in need of treatment (e.g., a human patient in need of modulation of an immune response) in a single dose.

[0124] In some embodiments, for adult patients of normal weight, a dosage ranging from about 0.3 mg / kg to 5.00 mg / kg may be administered. The specific dosing regimen (i.e., dosage, time, and repetition) will depend on the specific individual and the individual's medical history, as well as the properties of each agent (such as the half-life of the agent and other considerations well known in the art).

[0125] For purposes of this disclosure, the appropriate dosage of the LAG-3 binding aptamers described herein will depend on the specific LAG-3 binding aptamer, the type and severity of the disease / disorder, whether the LAG-3 binding aptamer is being administered for preventive or therapeutic purposes, previous therapy, the patient's clinical history and response to antagonists, and the judgment of the attending physician. The clinician can administer the LAG-3 binding aptamer until a dose is reached that achieves the desired result. In some embodiments, the desired result is a reduction in tumor burden, a reduction in cancer cells, or an increase in immune activity. Methods for determining whether a dose produces a desired result will be apparent to those skilled in the art. Administration of one or more LAG-3 binding aptamers can be continuous or intermittent, depending on, for example, the physiological condition of the recipient, whether the purpose of administration is therapeutic or preventive, and other factors known to those skilled in the art. Administration of the LAG-3 binding aptamer can be substantially continuous over a preselected period of time, or can be carried out in a series of spaced doses, for example, before, during, or after the onset of the target disease or condition.

[0126] As used herein, the term "treatment" refers to the application or administration of a composition comprising one or more active agents to a subject suffering from a target disease or condition, symptoms of a disease / condition, or a predisposition to a disease / condition, with the purpose of curing, healing, alleviating, relieving, altering, treating, modifying, improving, or affecting the condition, symptoms of the disease, or a predisposition to the disease or condition.

[0127] Alleviate the target disease / illness and include delaying the development or progress of the disease, or reducing the severity of the disease. Alleviate the disease and do not necessarily need a curative effect. As used herein, "delaying" the development of the target disease or illness means delaying, hindering, slowing down, delaying, stabilizing and / or postponing the progress of the disease. The delay can have different time lengths, depending on the history of the disease and / or the individual being treated. "Delaying" or alleviating the development of the disease or delaying the onset of the disease is a method that reduces the possibility of one or more symptoms of the disease developing within a given time frame when compared to not using the method and / or reduces the degree of symptoms within a given time frame. This comparison is usually based on clinical studies, using multiple subjects sufficient to give statistically significant results.

[0128] "Development" or "progression" of a disease means the initial manifestation of the disease and / or the subsequent progression. The development of a disease can be detected and assessed using standard clinical techniques well known in the art. However, development also refers to progression that may not be detected. For the purposes of this disclosure, development or progression refers to the biological course of symptoms. "Development" encompasses occurrence, recurrence, and onset. As used herein, "onset" or "occurrence" of a target disease or condition encompasses initial onset and / or recurrence.

[0129] In some embodiments, the LAG-3 binding aptamers described herein are administered to a subject in need of treatment in an amount sufficient to reduce tumor burden or cancer cell growth in vivo by at least 5% (e.g., 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more). In other embodiments, the LAG-3 binding aptamers are administered in an amount effective to reduce the level of LAG-3 activity by at least 5% (e.g., 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more). In other embodiments, the LAG-3 binding aptamers are administered in an amount effective to increase immune activity by at least 5% (e.g., 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more).

[0130] Depending on the type of disease to be treated or the position of disease, the pharmaceutical composition can be applied to the subject using conventional methods known to those of ordinary skill in the medical field. The composition can also be applied via other conventional routes, for example, by oral, parenteral, by inhalation spray, local, rectal, nasal, cheek, vaginal or via implanted reservoir. As used herein, the term "parenteral" includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intraarterial, intrasynovial, intrasternal, intrathecal, intralesional and intracranial injection or infusion techniques. In addition, it can be applied to the subject by injectable reservoir type administration route, such as using 1,3 or 6 months reservoir type injectable or biodegradable materials and methods. In some instances, the pharmaceutical composition is applied intraocularly or intravitreally.

[0131] Injectable compositions may contain various carriers, such as vegetable oils, dimethylacetamide, dimethylformamide, ethyl lactate, ethyl carbonate, isopropyl myristate, ethanol, and polyols (glycerol, propylene glycol, liquid polyethylene glycol, etc.). For intravenous injection, water-soluble LAG-3 binding aptamers may be administered by drip infusion, thereby infusing a pharmaceutical preparation containing a LAG-3 binding aptamer and a physiologically acceptable excipient. Physiologically acceptable excipients may include, for example, 5% dextrose, 0.9% saline, Ringer's solution, or other suitable excipients. Intramuscular preparations, such as sterile preparations in the form of a suitable soluble salt of the PDL1 binding aptamer, may be dissolved in a pharmaceutical excipient (such as water for injection, 0.9% saline, or 5% glucose solution) and administered.

[0132] In one embodiment, the LAG-3 binding aptamer is administered by site-specific or targeted local delivery techniques. Examples of site-specific or targeted local delivery techniques include implantable reservoir sources or local delivery catheters (such as infusion catheters, indwelling catheters or needle catheters) of various LAG-3 binding aptamers, synthetic grafts, adventitial wraps, shunts and stents or other implantable devices, site-specific carriers, direct injection or direct administration. See, e.g., PCT Publication No. WO 00 / 53211 and U.S. Pat. No. 5,981,568.

[0133] Targeted delivery of therapeutic compositions containing antisense polynucleotides, expression vectors or subgenomic polynucleotides can also be used. Receptor-mediated DNA delivery technology is described in, for example, Findeis et al., Trends Biotechnol. (1993) 11: 202; Chiou et al., Gene Therapeutics: Methods And Applications Of Direct Gene Transfer (JA Wolff, ed.) (1994); Wu et al., J. Biol. Chem. (1988) 263: 621; Wu et al., J. Biol. Chem. (1994) 269: 542; Zenke et al., Proc. Natl. Acad. Sci. USA (1990) 87: 3655; Wu et al., J. Biol. Chem. (1991) 266: 338.

[0134] In a gene therapy regimen, a therapeutic composition containing a polynucleotide (e.g., a LAG-3 binding aptamer described herein or a vector for producing such an aptamer) for topical administration is administered in the range of about 100 ng to about 200 mg of DNA. In some embodiments, concentrations ranging from about 500 ng to about 50 mg, about 1 μg to about 2 mg, about 5 μg to about 500 μg, and about 20 μg to about 100 μg of DNA or more may also be used during a gene therapy regimen.

[0135] The subject to be treated by the methods described herein can be a mammal, such as a farm animal, a sport animal, a pet, a primate, a horse, a dog, a cat, a mouse, and a rat. In one example, the subject is a human. The composition containing the anti-LAG-3 aptamer can be used to enhance immune activity, such as T cell activity, in a subject in need of treatment. In some examples, the subject can be a human patient who has, is suspected of having, or is at risk of having a cancer, such as lung cancer, melanoma, colorectal cancer, renal cell carcinoma, urothelial carcinoma, or Hodgkin's lymphoma. Such patients can also be identified by conventional medical practice.

[0136] Subjects with target diseases or conditions (e.g., cancer or immune disorders) can be identified by conventional medical examinations (e.g., laboratory tests, organ function tests, CT scans, or ultrasound). Subjects suspected of having any such target disease / condition may exhibit one or more symptoms of the disease condition. Subjects at risk of disease / condition can be subjects with one or more risk factors associated with the disease / condition. Such subjects can also be identified by conventional medical practice.

[0137] The specific dosing regimen (ie, dosage, timing and repetition) used in the methods described herein will depend on the particular subject (eg, human patient) and the subject's medical history.

[0138] In some embodiments, the anti-LAG-3 aptamer can be used in conjunction with another suitable therapeutic agent (e.g., an anticancer agent, an antiviral agent, or an antibacterial agent). Alternatively or additionally, the anti-LAG-3 aptamer can also be used in conjunction with other agents that are used to enhance and / or supplement the efficacy of the agent.

[0139] The efficacy of a treatment for a target disease / disorder can be assessed by methods such as those described in the Examples below.

[0140] Diagnostic applications and more

[0141] Any anti-LAG-3 aptamer can also be used to detect the presence of LAG-3 molecules and cells expressing such molecules, or to deliver therapeutic agents to LAG-3. + Cells. Anti-LAG-3 aptamers can be chemically synthesized and manipulated with functional groups to be conjugated in vivo or in vitro with therapeutic agents or detectable labels for diagnostic purposes (e.g., imaging agents (such as contrast agents)). As used herein, "conjugated" or "linked" means that two entities are associated, preferably with sufficient affinity to achieve the therapeutic / diagnostic benefit of the association between the two entities. The association between the two entities can be direct or via a linker (such as a polymer linker). Conjugated or linked can include covalent or non-covalent bonding as well as other forms of association, such as, for example, encapsulation of one entity on or within another entity, or encapsulation of one or both entities on or within a third entity (such as a micelle).

[0142] In one example, an anti-LAG-3 aptamer as described herein can be linked to a detectable label, which is a compound capable of directly or indirectly releasing a detectable signal, such that the aptamer can be detected, measured and / or identified in vitro or in vivo. Examples of such "detectable labels" include, but are not limited to, fluorescent labels, chemiluminescent labels, colorimetric labels, enzyme labels, radioisotopes, and affinity labels (such as biotin). Such labels can be conjugated directly or indirectly to the aptamer by conventional methods.

[0143] In some embodiments, the detectable label is an agent suitable for imaging diseases mediated by LAG-3 / MHC II interactions, which can be a radioactive molecule, a radiopharmaceutical, or an iron oxide particle. Radioactive molecules suitable for in vivo imaging include but are not limited to 122 I. 123 I. 124 I. 125 I. 131 I. 18 F. 75 Br, 76 Br, 76 Br, 77 Br, 211 At 225 Ac, 177 Lu, 153 Sm, 186 Re, 188 Re, 67 Cu, 213 Bi, 212 Bi, 212 Pb and 67 Ga. Exemplary radiopharmaceuticals suitable for in vivo imaging include 111 InHydroxyquinoline, 131 I sodium iodide, 99m Tc mebropheniramine and 99m Tc red blood cells, 123 I sodium iodide, 99m Tc Examex, 99m Tc large particle albumin, 99m Tc methylene diphosphonate, 99m Tc-thiothiopeptide, 99m Tc oxidronate, 99m Tc pentetate, 99m Tc pertechnetate, 99m Tc setabiprofen, 99m Tc sulfur colloid, 99m Tc tetrofosmin, thallium-201 and xenon- 133. The reporter can also be a dye, for example, a fluorophore, which can be used to detect LAG-3 mediated diseases in tissue samples.

[0144] In some embodiments, an anti-LAG-3 aptamer conjugated to a detectable label (e.g., an imaging agent) as disclosed herein is administered to a subject to assess LAG-3 levels in the subject. Such detection of LAG-3 can be used to identify relevant patients for anti-LAG-3 therapy (e.g., treatment with an anti-LAG-3 pharmaceutical composition disclosed herein or treatment with an anti-LAG-3 antibody).

[0145] LAG-3 or LAG-3+ Cells can be detected in vitro in samples (e.g., biological samples suspected of containing LAG-3, including but not limited to blood samples and urine samples) using any of the aptamers described herein by conventional methods. In some cases, the aptamer can be conjugated to a detectable label that can directly or indirectly release a signal indicating the presence and / or level of LAG-3 in the sample. Alternatively, the anti-LAG-3 aptamer can be used to detect LAG-3 or LAG-3 in a subject (e.g., a human patient as described herein). + In vivo imaging of the presence and localization of cells. Results obtained from any of the diagnostic assays described herein (in vitro or in vivo) can be indicative of the risk or status of a disease associated with LAG-3.

[0146] Diagnostic and therapeutic kits containing anti-LAG-3 aptamers

[0147] The present disclosure also provides kits for modulating (e.g., enhancing) immune activity (e.g., T cell activity), reducing cancer (e.g., lung cancer, melanoma, colorectal cancer, or renal cell carcinoma), and / or treating cancer or reducing the risk of cancer. Such kits can include one or more containers that include an aptamer that binds to LAG-3, e.g., any aptamer described herein.

[0148] In some embodiments, the kit may include instructions for use according to any of the methods described herein. For example, the included instructions may include a description of administering the aptamer to treat, delay the onset of, or alleviate a target disease as described herein. The kit may further include a description of selecting an individual suitable for treatment based on identifying whether the individual has the target disease. In other embodiments, the instructions include a description of administering the aptamer to an individual at risk for the target disease.

[0149] Instructions for use of the LAG-3 binding aptamer typically include information about the dosage, dosing regimen, and route of administration for the intended treatment. The container may be a unit dose, bulk package (e.g., a multi-dose package), or a subunit dose. The instructions provided in the kit of the invention are typically written instructions on a label or package insert (e.g., a paper included in the kit), but machine-readable instructions (e.g., instructions carried on a magnetic or optical storage disk) are also acceptable.

[0150] The label or package insert indicates that the composition is used to treat, delay the onset of, and / or alleviate a disease or condition associated with cancer, such as those described herein.Instructions for practicing any of the methods described herein can be provided.

[0151] In addition, the present disclosure provides a method for detecting or measuring LAG-3 and / or LAG-3 in a biological sample. +The kit may include one or more anti-LAG-3 aptamers as described herein, which may be conjugated to a detectable label as also described herein. The kit may further include one or more reagents for directly or indirectly treating a biological sample and / or for generating or detecting a signal released from the detectable label. The kit may further include a kit for detecting or measuring LAG-3 or LAG-3 in a sample using the anti-LAG-3 aptamers included in the kit. + The kit may include instructions for processing a biological sample and performing a suitable assay to measure LAG-3 or LAG-3 in the sample. + Description of cells.

[0152] The kits described herein are in suitable packaging. Suitable packaging includes, but is not limited to, vials, bottles, jars, flexible packaging (e.g., sealed mylar bags or plastic bags), etc. Also contemplated are packaging for use in combination with specific devices, such as inhalers, nasal administration devices (e.g., nebulizers), or infusion devices (such as mini pumps). The kit may have a sterile access port (e.g., the container may be an IV bag or a vial with a stopper pierceable by a hypodermic needle). The container may also have a sterile access port (e.g., the container may be an IV bag or a vial with a stopper pierceable by a hypodermic needle). At least one active agent in the composition is a LAG-3 binding aptamer as described herein.

[0153] The kit may optionally provide other components (such as buffer) and explanatory information. Typically, the kit includes a container and a label or package insert on or associated with the container. In some embodiments, the invention provides an article comprising the contents of the above-mentioned kit.

[0154] General techniques

[0155] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry, and immunology, which are within the skill of the art. Molecular Cloning: A Laboratory Manual, second edition (Sambrook, et al., 1989) Cold Spring Harbor Press; Oligonucleotide Synthesis (MJ Gait, ed., 1984); Methods in Molecular Biology, Humana Press; Cell Biology: A Laboratory Notebook (JECellis, ed., 1998) Academic Press; Animal Cell Culture(RIFreshney,ed.,1987);Introduction to Cell and Tissue Culture(JPMather and PERoberts,1998)Plenum Press;Cell and Tissue Culture:Laboratory Procedures(A.Doyle,JBGriffiths,and DGNewell,eds.,1993-8)J.Wiley and Sons;Methods inEnzymology(Academic Press,Inc.);Handbook of Experimental Immunology(DMWeirand CCBlackwell,eds.);Gene Transfer Vectors for Mammalian Cells (JMMiller and MPCalos, eds., 1987); Current Protocols in Molecular Biology (FMAusubel, et al., eds., 1987); PCR: The Polymerase Chain Reaction, (Mullis, et al., eds., 1994); Current Protocols in Immunology (JEColigan et al., eds., 1994);, 1991); ShortProtocols in Molecular Biology (Wiley and Sons, 1999); Immunobiology (CA Janeway and P. Travers, 1997); Antibodies (P. Finch, 1997); Antibodies: a practical approach (D. Catty., ed., IRL Press, 1988-1989); Monoclonal antibodies: a practical approach approach (P.Shepherd and C.Dean, eds., Oxford University Press, 2000); Using antibodies: alaboratory manual (E.Harlow and D.Lane (Cold Spring Harbor Laboratory Press, 1999)); The Antibodies (M.Zanetti and JDCapra, eds., Harwood Academic Publishers, 1995). Without further detailed description, it is believed that one skilled in the art can utilize the present invention to the greatest extent based on the above description. Therefore, the following specific examples should be interpreted as merely illustrative and not limiting the remainder of the present disclosure in any way. All publications cited herein are incorporated herein by reference for the purposes or subject matter cited herein. .

[0156] Without further detailed description, it is believed that those skilled in the art can make the most of the present invention based on the above description. Therefore, the following specific examples should be interpreted as merely illustrative and not limiting the remainder of the present disclosure in any way. For the purpose or subject matter cited herein, all publications cited herein are incorporated herein by reference.

[0157] Examples

[0158] In order that the invention described herein may be more fully understood, the following examples are set forth. The examples described in this application are provided to illustrate the systems and methods provided herein and are not to be construed in any way as limiting the scope thereof.

[0159] Example 1 :Identification and characterization of LAG-3 aptamers

[0160] We identified candidate lymphocyte activation gene 3 (LAG-3) aptamers from a synthetic ssDNA library using a high-throughput SELEX assay with human recombinant LAG-3 as the target. These LAG-3 aptamer candidates were subjected to next-generation sequencing and tested for their activity in disrupting the interaction of LAG-3 with MHC-II using a LAG-3 / MHC-II bioassay. Several LAG-3 aptamers were found to disrupt the interaction between LAG-3 and MHC-II, as shown by the expression of a luciferase reporter gene. Figure 1A Exemplary results are provided in . Anti-LAG-3 antibody was used as a positive control. Figure 1A .

[0161] LAG-3 aptamers B4, B8, D9 and F4 Figure 1A The sequences of these aptamers are provided in Table 1 below. Sequence alignment revealed conserved motifs among the identified LAG-3 aptamers, such as Figure 1B Aptamers including this conserved motif are expected to bind LAG-3 and disrupt its interaction with MHC-II.

[0162] To directly test the binding of LAG-3 aptamers to LAG-3, in vitro binding assays were performed using His-tagged recombinant LAG-3 attached to nickel-coated beads or nickel-coated wells of the plate. Bound LAG-3 aptamers were eluted and detected by qPCR. Using the bead-based assay, aptamers B4 and B8 showed a concentration-dependent increase in binding to recombinant LAG-3. Figure 1C Using a plate-based assay, aptamer B4 and a biotinylated version of aptamer B4 (Bio-B4) were found to bind recombinant LAG-3 in a similar manner. Figure 1D .

[0163] Table 1. Sequences of exemplary LAG-3 aptamers.

[0164]

[0165] *Conserved motifs are shown in bold and underlined.

[0166] In order to identify the minimal sequence of aptamer B4 involved in binding to LAG-3, various truncated forms of aptamer B4 were prepared and their binding activity to LAG-3 was studied in the binding assay described herein, wherein R9R was used as a negative control. Table 2 shows the aptamer sequences of these truncated forms of aptamer B4 and their dissociation constants (Kd) for binding to recombinant LAG-3. The binding of aptamers B4, B4-SL2, B4-SL3, and B4-SL4 to recombinant LAG-3 increased in a concentration-dependent manner. Figure 1ETruncated forms of B4-SL5 and B4-SL6 showed minimal to no binding; these two truncated variants have a deletion of a portion of the conserved motif described above. Figure 1E .

[0167] Table 2. Truncated aptamer B4 sequences and dissociation constants.

[0168]

[0169]

[0170] *Conserved motifs or parts thereof are shown in bold and underlined.

[0171] These results indicate that Figure 1B The conserved motif shown in is important for binding to recombinant LAG-3 and disrupting the interaction of LAG-3 with MCH-II in cell culture. Therefore, it is expected that an aptamer including this conserved motif has the activity of binding to LAG-3 and disrupting its interaction with MCH-II.

[0172] Example 2 : Synthesis and characterization of tetrameric LAG-3 aptamers

[0173] LAG-3 aptamers are constructed in tetrameric form using two backbone sequences with complementary segments so that they can anneal together by base pairing. Each backbone sequence can be connected to two aptamers at the 5' end and the 3' end to form an aptamer tetramer. This connection is achieved using a backbone sequence with a primer sequence complementary to the primer sequence in the aptamer sequence at each end, which allows the aptamer to base pair with each end of the backbone sequence. Exemplary aptamer sequences and backbone sequences are shown in Table 3.

[0174] Table 3. Exemplary backbone and aptamer sequences.

[0175]

[0176] *Primer sequences are underlined. P16 indicates a 16-residue primer, while P10 indicates a 10-residue primer.

[0177] The backbone and aptamer sequences were mixed at various molar ratios, and the resulting tetramers were separated by size exclusion chromatography. Figures 2A to 2E As shown, the peak representing the free aptamer decreases as the molar concentration of the aptamer decreases. The resulting scaffold / aptamer complex is in the form of a tetramer containing two scaffold molecules associated with four aptamers.

[0178] Tetramers of different backbone and aptamer sequences were formed by incubating 10 μM of each backbone with 60 μM aptamer. The backbone and aptamer combinations and incubation conditions are shown in Table 4. Size exclusion chromatography was used to examine the molar ratio of backbone to aptamer in tetramers formed by various backbone and aptamer sequences, and the results are shown in Figures 3A-3J Multiple peaks were detected in the chromatograms of several tetramer combinations, indicating that these combinations form partial structures (e.g. Figure 3B-3C ). Some structures contain structures other than the desired tetramer, such as trimers or dimers. A peak corresponding to the tetramer and a second peak corresponding to the free aptamer are detected, indicating that the desired aptamer tetramer is formed. Figure 3A and 3H .

[0179] Table 4. Summary of exemplary LAG-3 aptamer tetramer syntheses.

[0180]

[0181]

[0182] Next, the LAG-3 tetramer thus formed was tested for its activity in disrupting the interaction of LAG-3 with MHC-II using a LAG-3 / MHC-II bioassay, wherein disruption of the interaction of LAG-3 with MHC-II is indicated by the expression of a luciferase reporter gene. Figure 4A As shown, the expression of the luciferase reporter gene generally increased with increasing tetramer concentrations. Even under conditions where less LAG-3 tetramer (250 nM) was used in the assay relative to the anti-LAG-3 antibody (333 nM), several LAG-3 aptamer tetramers induced more luciferase expression than the anti-LAG-3 antibody. Figure 4A These results suggest that LAG-3 tetramers display higher blocking activity on the binding of LAG-3 to MHC-II than anti-LAG-3 antibodies.

[0183] To verify that LAG-3 tetramers bind to LAG-3, in vitro binding assays were performed using recombinant LAG-3 and LAG-3 tetramers. It was observed that LAG-3 tetramers bind to LAG-3 in a dose-dependent manner. Figure 4B CD4 is structurally similar to LAG-3 and also binds to MHC-II. However, no binding of LAG-3 tetramer to CD4 was detected, indicating that the binding between LAG-3 aptamer tetramer and LAG-3 is specific. Figure 4B .

[0184] The binding of LAG-3 aptamers (free or tetrameric form) to LAG-3 of different species (e.g., rat, mouse, and human) was also tested using the in vitro binding assay described herein. The results showed that LAG-3 aptamers can cross-react with rat, mouse, and human LAG-3. Figure 4C .

[0185] Taken together, these results indicate that LAG-3 aptamers in free or tetrameric form bind to LAG-3 of various species and that binding of LAG-3 aptamers to LAG-3 inhibits the interaction of LAG-3 with MHC-II.

[0186] Example 3 : LAG-3 tetramers prevent tumor formation in mice

[0187] The anti-tumor activity of the tetrameric form of the LAG-3 aptamer was studied as follows. Mice were subcutaneously inoculated with CT26 colon cancer cells to allow the formation of tumor xenografts. The mice were then administered anti-PD-L1 antibodies alone or in combination with the tetrameric form of the LAG-3 aptamer or vehicle control. LAG-3 tetramers were formed using the backbone and B4-SL3 aptamer sequences. The molar ratio of the backbone to the aptamer determined using size exclusion chromatography confirmed the formation of LAG-3 tetramers with the B4-SL3 aptamer ( Figure 5 ).

[0188] Mice were administered one dose of LAG-3 tetramer on day 3 or 10 doses of LAG-3 tetramer once daily from day 3 to day 12. Fig. 6A A description of the treatment regimen is provided. Mice treated with LAG-3 tetramer and PD-L1 antibody showed a significant reduction in tumor growth compared to mice treated with PD-L1 antibody alone or vehicle control. Figure 6B A reduction in tumor growth was observed in mice treated with 1 dose of the LAG-3 aptamer compared to mice treated with 10 doses of the LAG-3 aptamer, and a greater reduction was observed with 1 mg / kg of LAG-3 tetramer compared to dosing with 10 mg / kg of LAG-3 tetramer. Figure 6C Shown are tumors surgically removed from mice given the different treatments.

[0189] In a related study, mice were subcutaneously inoculated with CT26 colon cancer cells to allow the formation of tumor xenografts. The mice were randomly divided into 5 groups (each containing 6 mice), and each group received the following treatments: (A) vehicle control (6 injections at 3-day intervals before the last injection), (B) anti-PD-L1 antibody (10 mg / kg; 6 injections at 3-day intervals), (C) LAG-3 aptamer (1 mg / kg, single dose), (D) anti-PD-L1 antibody (10 mg / kg; 6 injections at 3-day intervals) + LAG3 tetramer (1 mg / kg; single dose), and (E) anti-PD-L1 antibody (10 mg / kg; 6 injections at 3-day intervals) and LAG3 tetramer (1 mg / kg; single dose); according to Fig. 10A The administration regimen shown in . Fig. 10B As shown in , co-administration of anti-PD-L1 antibody and LAG3 tetramer significantly reduced tumor volume in xenograft mice compared to vehicle control. Unexpectedly, a single dose of LAG3 tetramer was sufficient to achieve an anti-tumor effect.

[0190] Taken together, these results suggest that LAG-3 tetramers prevent tumor formation in CT26 colon cancer cells.

[0191] Example 4 : Construction of LAG-3 tetramers using identical backbone sequences annealed by palindromic sequences

[0192] LAG-3 tetramers were constructed using backbone sequences with palindromic residues that allow two identical backbone sequences to anneal by base pairing of palindromic residues. Tetramer formation was tested by agarose gel analysis and size exclusion chromatography for backbone sequences with 8, 10, 12, and 16 palindromic residues. Aptamer sequences and backbone sequences with palindromic residues are shown in bold and underlined in Table 5.

[0193] Table 5. Exemplary aptamer and bridge sequences.

[0194]

[0195] *Palindromic residues are shown in bold and underlined.

[0196] With 8 palindromic residues ( Fig. 7A ) and 12 palindromic residues ( Figure 7C ) showed a single band in the backbone-only lane, indicating a duplex formed by annealing of two identical backbone sequences. In contrast, the 10 palindromic residues ( Figure 7B ) and 16 palindromic residues ( Fig.7D ) showed two bands in the backbone-only lane, indicating that no duplexes of the same backbone sequence were formed for these sequences.

[0197] The above results were confirmed using size exclusion chromatography. A single peak ( Fig. 8A ), indicating that a single tetrameric structure was formed. Two peaks of similar size were observed in the chromatogram of the LAG-3 tetramer formed using a backbone sequence with 8 palindromic residues ( Figure 8B ), indicating that duplexes of the same backbone sequence were not formed. These results indicate that LAG-3 tetramers were formed using the same backbone sequence annealed through 12 palindromic residues.

[0198] Then, the annealing of backbone sequences with different 12-residue palindromes was analyzed by agarose gel and free energy analysis. 4 (C / G) 4 (A / T) 4 Various combinations of palindrome sequences.

[0199] like Fig. 9 As shown in Table 6, the palindromic sequences ATATCGCGATAT (SEQ ID NO: 17) and ATATCCGGATAT (SEQ ID NO: 18) showed more than 90% dimer formation by agarose gel analysis, which was the highest among the tested sequences. The palindromic sequences detected by agarose gel analysis and the dimer percentage and / or monomer formation percentage are shown in Table 6 below.

[0200] Table 6. Exemplary palindromic sequences and agarose gel analysis results.

[0201]

[0202] Similar results were obtained by free energy analysis of palindromic sequences. As shown in Table 7 below, based on free energy calculations, the palindromic sequences ATATCGCGATAT (SEQ ID NO: 17) and ATATCCGGATAT (SEQ ID NO: 18) favor dimer formation among the sequences analyzed.

[0203] Table 7. Free energy analysis of exemplary palindromic sequences.

[0204]

[0205] Taken together, these results demonstrate the formation of LAG-3 tetramers using the same backbone sequence annealed through 12 palindromic residues with the general formula (A / T) 4 (C / G) 4 (A / T) 4 .

[0206] Other embodiments

[0207] All features disclosed in this specification may be combined in any combination. Each feature disclosed in this specification may be replaced by an optional feature for the same, equivalent or similar purpose. Therefore, unless otherwise expressly stated, each feature disclosed is merely an example of a general series of equivalent or similar features.

[0208] According to the above description, those skilled in the art can easily determine the basic characteristics of the present invention, and without departing from its spirit and scope, various changes and modifications can be made to the present invention to adapt it to various uses and conditions. Therefore, other embodiments are also within the scope of the claims.

[0209] Equivalent

[0210] Although several inventive embodiments have been described and illustrated herein, a person of ordinary skill in the art will readily conceive of a variety of other devices and / or structures for performing the functions described herein and / or obtaining the results and / or one or more advantages, and each of these changes and / or modifications is considered to be within the scope of the inventive embodiments described herein. More generally, it will be readily understood by those skilled in the art that all parameters, dimensions, materials, and configurations described herein are intended to be exemplary, and that actual parameters, dimensions, materials, and / or configurations will depend on the specific application in which the teachings of the present invention are used. Those skilled in the art will recognize or be able to determine many equivalents of the specific inventive embodiments described herein using only routine experiments. Therefore, it should be understood that the foregoing embodiments are presented only by way of example, and within the scope of the appended claims and their equivalents, the inventive embodiments may be practiced in a manner different from that specifically described and claimed. The inventive embodiments of the present disclosure relate to each individual feature, system, article, material, kit, and / or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and / or methods, if such features, systems, articles, materials, kits, and / or methods are not inconsistent with each other, is included in the inventive scope of the present disclosure.

[0211] All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and / or ordinary meanings of the defined terms.

[0212] All references, patents, and patent applications disclosed herein are incorporated by reference, in some cases in their entirety, with respect to the subject matter for which they are cited.

[0213] As used herein in the specification and claims, the indefinite article "a", "an" should be understood to mean "at least one", unless clearly indicated to the contrary.

[0214] The phrase "and / or" as used herein in the specification and claims should be understood to refer to "either or both" of the elements so combined, i.e., elements that are present in conjunction in some cases and separately in other cases. Multiple elements listed with "and / or" should be interpreted in the same manner, i.e., "one or more" of the elements so combined. In addition to the elements specifically indicated by the "and / or" clause, other elements may optionally be present, whether related or unrelated to those specifically indicated. Thus, as a non-limiting example, when used in conjunction with open language such as "including", references to "A and / or B" may refer to only A (optionally including elements other than B) in one embodiment; to only B (optionally including elements other than A) in another embodiment; to both A and B (optionally including other elements) in yet another embodiment; etc.

[0215] As used in the specification and claims herein, "or" should be understood to have the same meaning as "and / or" defined above. For example, when separating the items in a list, "or" or "and / or" should be interpreted as inclusive, that is, including at least one of a plurality of elements or a list of elements, but also including more than one, and optionally, other unlisted items. Only terms with clear opposite indications, such as "only one" or "exactly one" or, when used in the claims, "consisting of..." will refer to including exactly one element in a plurality of elements or a list of elements. Usually, when there is an exclusive term before the term "or" used in this article, such as "either", "one", "only one" or "exactly one", it should only be interpreted as indicating an exclusive alternative (i.e. "one or another but not two"). When used in the claims, "consisting essentially of..." should have its ordinary meaning used in the field of patent law.

[0216] As used in the specification and claims of this application, the phrase "at least one" with respect to a list of one or more elements shall be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including each and every element specifically listed in the list of elements and at least one of each element, and not excluding any combination of the elements in the list of elements. This definition also allows elements other than those specifically recited in the list of elements to which the phrase "at least one" refers to optionally exist, whether related or unrelated to those specifically recited elements. Thus, as a non-limiting example, "at least one of A and B" (or, equivalently, "at least one of A or B", or, equivalently, "at least one of A and / or B") can, in one embodiment, refer to at least one, optionally including more than one, A, where no B exists (and optionally including elements other than B); in another embodiment, at least one, optionally including more than one, B, where no A exists (and optionally including elements other than A); in yet another embodiment, at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); and so on.

[0217] It should also be understood that, unless clearly indicated to the contrary, in any method claimed herein that includes more than one step or act, the order of the steps or acts of the method need not be limited to the order in which the steps or acts of the method are recited. Sequence Listing <110> Fountain Biopharma Inc. CHANG, Yi-Chung KAO, Yi-Wei CHIANG, Chien-Hao <120> Nucleic Acid Aptamers Targeting Lymphocyte Activation Gene 3 (LAG-3) and Their Uses <130> 103282-627708 (S1926.70005WO00) <150> 62 / 740,751 <151> 2018-10-03 <150> 62 / 684,139 <151> 2018-06-12 <160> 60 <170> PatentIn version 3.5 <210> 1 <211> 11 <212> DNA <213> Artificial sequence <220> <223> synthesis <220> <221> misc_feature <222> (2)..(2) <223> n is g, c or does not exist <220> <221> misc_feature <222> (6) <223> n is g, c or does not exist <220> <221> misc_feature <222> (10)..(10) <223> n is t or c <400> 1 gngggnggtn a 11 <210> 2 <211> 11 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 2 ggggggggtt a 11 <210> 3 <211> 5 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 3 ggggg 5 <210> 4 <211> 6 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 4 gggggg 6 <210> 5 <211> 7 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 5 ggggggg 7 <210> 6 <211> 8 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 6 gggggggg 8 <210> 7 <211> 9 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 7 ggggggggg 9 <210> 8 <211> 30 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 8 tggggggggt tagttcaata catgcgggcg 30 <210> 9 <211> 31 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 9 tgggggggggg ttagacttac actcttattc g 31 <210> 10 <211> 30 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 10 agaggggggg gttagctgct ttaactcatg 30 <210> 11 <211> 30 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 11 agggggggggg ttactgcgca tgtatctcag 30 <210> 12 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 12 tggggggggt tagttcaata catg 24 <210> 13 <211> 62 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 13 tccctacggc gctaactggg gggggttagt tcaatacatg cgggcggcca ccgtgctaca 60 ac 62 <210> 14 <211> 35 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 14 acggcgctaa ctgggggggg ttagttcaat acatg 35 <210> 15 <211> 35 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 15 gctaactggg gggggttagt tcaatacatg cgggc 35 <210> 16 <211> 35 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 16 ctgggggggg ttagttcaat acatgcgggc ggcca 35 <210> 17 <211> 12 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 17 atatcgcgat at 12 <210> 18 <211> 12 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 18 atatccggat at 12 <210> 19 <211> 12 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 19 cgcgatatcg cg 12 <210> 20 <211> 12 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 20 atatatatat at 12 <210> twenty one <211> 12 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> twenty one cgcgcgcgcg cg 12 <210> twenty two <211> 12 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> twenty two atcgcgcgcg at 12 <210> twenty three <211> 12 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> twenty three atatagctat at 12 <210> twenty four <211> 9 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> twenty four ggggggtta 9 <210> 25 <211> 10 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 25 gggggggtta 10 <210> 26 <211> 12 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 26 gggggggggt ta 12 <210> 27 <211> 10 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 27 ggggggttaa 10 <210> 28 <211> 10 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 28 gggggggtta 10 <210> 29 <211> 11 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 29 ggggggggtt a 11 <210> 30 <211> 32 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 30 tccctacggc gctaactccc tacggcgcta ac 32 <210> 31 <211> 16 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 31 gccaccgtgc tacaac 16 <210> 32 <211> 63 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 32 tccctacggc gctaactggg ggggggttag acttacactc ttattcggcc accgtgctac 60 aac 63 <210> 33 <211> 62 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 33 tccctacggc gctaacagag gggggggtta gctgctttaa ctcatggcca ccgtgctaca 60 ac 62 <210> 34 <211> 62 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 34 tccctacggc gctaacaggg ggggggttac tgcgcatgta tctcaggcca ccgtgctaca 60 ac 62 <210> 35 <211> 8 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 35 tcagctga 8 <210> 36 <211> 10 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 36 atcagctgat 10 <210> 37 <211> 12 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 37 atatcgcgat at 12 <210> 38 <211> 16 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 38 atatgacgcg tcatat 16 <210> 39 <211> 35 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 39 gggggttagt tcaatacatg cgggcggcca ccgtg 35 <210> 40 <211> 35 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 40 ttagttcaat acatgcgggc ggccaccgtg ctaca 35 <210> 41 <211> 51 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 41 gctaactggg gggggttagt tcaatacatg cgggcgccac cgtgctacaa c 51 <210> 42 <211> 46 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 42 gctaactggg gggggttagt tcaatacatg gccaccgtgc tacaac 46 <210> 43 <211> 41 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 43 gctaactggg gggggttagt tcaatgccac cgtgctacaa c 41 <210> 44 <211> 45 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 44 gctaactggg gggggttagt tcaatacatg cgggcgtgct acaac 45 <210> 45 <211> 40 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 45 gctaactggg gggggttagt tcaatacatg gtgctacaac 40 <210> 46 <211> 35 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 46 gctaactggg gggggttagt tcaatgtgct acaac 35 <210> 47 <211> 60 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 47 gttgtagcac ggtggctttt tatttaggtg acactatagt ttttgttgta gcacggtggc 60 <210> 48 <211> 52 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 48 gttgtagcac ggtggctttt taggtgacac ttttttgttg tagcacggtg gc 52 <210> 49 <211> 80 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 49 gttgtagcac tttttaggtg acactttttt gttgtagcac gttgtagcac tttttaggtg 60 acactttttt gttgtagcac 80 <210> 50 <211> 48 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 50 gttgtagcac tttttattta ggtgacacta tagtttttgt tgtagcac 48 <210> 51 <211> 50 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 51 gttgtagcac ggtggctttt ttcagctgat ttttgttgta gcacggtggc 50 <210> 52 <211> 52 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 52 gttgtagcac ggtggctttt tatcagctga ttttttgttg tagcacggtg gc 52 <210> 53 <211> 54 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 53 gttgtagcac ggtggctttt tatatcgcga tattttttgt tgtagcacgg tggc 54 <210> 54 <211> 58 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 54 gttgtagcac ggtggctttt tatatgacgc gtcatatttt ttgttgtagc acggtggc 58 <210> 55 <211> 12 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 55 ttatgcgcat aa 12 <210> 56 <211> 12 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 56 atatggccat at 12 <210> 57 <211> 12 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 57 ttaaggcctt aa 12 <210> 58 <211> 12 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 58 aaaagcgctt tt 12 <210> 59 <211> 12 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 59 taaagcgctt ta 12 <210> 60 <211> 12 <212> DNA <213> Artificial sequence <220> <223> synthesis <400> 60 tataccggta ta 12

Claims

1. A nucleic acid molecule comprising an aptamer segment that binds to human lymphocyte activation gene 3 (LAG-3), wherein the aptamer segment comprises a motif of GGGGGGGGTTA (SEQ ID NO: 2); and wherein the nucleic acid molecule consists of 35-70 nucleotides; The aptamer segment is as follows: (i) TGGGGGGGGTTAGTTCAATACATGCGGGCG (SEQ ID NO: 8); (ii) TGGGGGGGGGTTAGACTTACACTCTTATTCG (SEQ ID NO: 9); (iii) AGAGGGGGGGGTTAGCTGCTTTAACTCATG (SEQ ID NO: 10); (iv) AGGGGGGGGGTTACTGCGCATGTATCTCAG (SEQ ID NO: 11); (v)TGGGGGGGGTTAGTTCAATACATG (SEQ ID NO: 12); or (vi) TCCCTACGGCGCTAACTGGGGGGGGTTAGTTCAATACATGCGGGCGGCCACCG TGCTACAAC (SEQ ID NO: 13), or a fragment thereof, which is shown below: ACGGCGCTAACTGGGGGGGGTTAGTTCAATACATG (SEQ ID NO: 14); GCTAACTGGGGGGGGTTAGTTCAATACATGCGGGC (SEQ ID NO: 15); or CTGGGGGGGGTTAGTTCAATACATGCGGGCGGCCA (SEQ ID NO: 16). 2 . The nucleic acid molecule of claim 1 , further comprising an anchor segment at the 5′ end of the aptamer segment, the 3′ end of the aptamer segment, or both.

3. The nucleic acid molecule according to claim 1 or claim 2, which is a multimeric nucleic acid complex.

4. A pharmaceutical composition comprising the nucleic acid molecule according to claim 1 or claim 2. The pharmaceutical composition according to claim 4 , wherein the nucleic acid molecule is a multimeric nucleic acid complex.

6. Use of a pharmaceutical composition in the preparation of a medicament for treating cancer in a subject in need thereof; wherein the pharmaceutical composition comprises a nucleic acid molecule comprising an aptamer segment that binds to human lymphocyte activation gene 3 (LAG-3), wherein the aptamer segment comprises a motif of GGGGGGGGTTA (SEQ ID NO: 2); and wherein the nucleic acid molecule consists of 35-70 nucleotides.

7. The use according to claim 6, wherein the nucleic acid molecule is as shown in claim 1.

8. The use according to claim 7, wherein the nucleic acid molecule further comprises an anchor segment at the 5' end of the aptamer segment, the 3' end of the aptamer segment, or both.

9. The use according to claim 7, wherein the nucleic acid molecule is a multimeric nucleic acid complex.

10. The use according to any one of claims 6-9, wherein the subject is a human patient suffering from cancer.

11. The use according to claim 10, wherein the cancer is selected from the group consisting of lung cancer, melanoma, colorectal cancer, renal cell carcinoma, urothelial carcinoma and Hodgkin's lymphoma.

12. An in vitro method for detecting the presence of LAG-3 positive cells for non-diagnostic purposes, comprising: (i) contacting a cell suspected of expressing LAG-3 with a nucleic acid molecule, wherein the nucleic acid molecule is conjugated to a detection agent; as well as (ii) measuring a signal released from a detection agent conjugated to a nucleic acid molecule bound to a cell; wherein the intensity of the signal indicates the presence or level of LAG-3 positive cells; wherein the nucleic acid molecule comprises an aptamer segment that binds to human lymphocyte activation gene 3 (LAG-3), wherein the aptamer segment comprises a motif of GGGGGGGGTTA (SEQ ID NO: 2); and wherein the nucleic acid molecule consists of 35-70 nucleotides.

13. The in vitro method according to claim 12, wherein the aptamer segment is as shown in claim 1 or claim 2.

Images