Methods of reducing type 2 cytokine-mediated inflammation using neuromedin peptides
By using Nmb protein or its encoded nucleic acid molecule, the activity of IL-5 and IL-13 is regulated, and the problem of difficulty in reducing type 2 cytokine-mediated inflammation in the prior art is solved, and effective treatment for diseases such as asthma and allergic reactions is achieved.
Patent Information
- Application Number
- CN201980080467.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2018-10-04
- Filing Date
- 2019-10-03
- Publication Date
- 2025-06-06
- Estimated Expiration
- 2039-10-03
AI Technical Summary
The prior art is difficult to effectively reduce type 2 cytokine-mediated inflammation, especially in diseases such as asthma and allergic reactions.
By using interneutron B (Nmb) protein or its encoded nucleic acid molecule, the activity of IL-5 and IL-13 is regulated, and the response of ILC2 and TH2 cells is reduced, thereby reducing eosinophil growth and inflammatory response.
Effectively reduce the activity of IL-5 and IL-13, reduce the response of ILC2 and TH2 cells, reduce the increase in eosinophils and inflammatory response, thereby treating diseases such as asthma and allergic reactions.
Smart Images

Figure CN113164552B_ABST
Abstract
Description
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS
[0002] This application claims priority to U.S. Application No. 62 / 741,188, filed on October 4, 2018, the entire contents of which are incorporated herein by reference. Technical Field
[0003] The present application provides methods for reducing type 2 cytokine-mediated inflammation, such as reducing interleukin (IL)-5 and IL-13 activity by using natural and variant neuromedin peptides. In some examples, such methods are used to treat inflammatory diseases, such as asthma or allergic reactions.
[0004] Thanks to the government for its support
[0005] This invention was made with government support under R01 AI131634-01 awarded by the National Institutes of Health (NIH). The government has certain rights in this invention. Background Art
[0006] Type 2 cytokine responses, characterized by the production of interleukins (IL)-4, 5, 9, and 13, promote immunity to helminth parasites, initiate tissue repair, and regulate metabolic health, but also contribute to the inflammation associated with allergy and asthma (1-4). Cross-talk between specialized innate immune cell populations may direct the magnitude of type 2 cytokine responses (5). For example, basophils provide signals to type 2 innate lymphoid cells (ILC2s) that promote their production of IL-5 and IL-13 (6,7). In addition, the neuron-derived peptide neuromedin U (NMU) directly activates ILC2s to promote immunity to the roundworm Nippostrongylus brasiliensis (Nb) (8,9). However, whether the immune and nervous systems communicate to limit type 2 inflammation and promote tissue integrity remains incompletely defined. Summary of the invention
[0007] This article shows that in the absence of basophils, Nb-induced ILC2 responses are exaggerated, leading to increased inflammation and reduced lung function. In addition, it is shown that ILC2s from basophil-deficient mice express reduced levels of neuromedin B (Nmb) receptors associated with their enhanced activation. In vivo administration of Nmb peptides reduces infection-induced ILC2 responses, lung eosinophils, and parasite clearance. In addition, treatment with Nmb is sufficient to reduce IL-5 and IL-13 expression in sorted and purified lung ILC2s from control mice but not basophil-deficient mice. In addition, Nmb is also sufficient to activate type 2 helper cells (T H2) T cells reduce IL-5 and IL-13 expression. Collectively, these data suggest that basophils mediate the ability of ILC2s to respond to neuron-derived signals necessary to limit inflammation and maintain tissue integrity. Furthermore, these data suggest that NMB treatment is sufficient to reduce both innate and adaptive sources of IL-5 and IL-13 that promote type 2 inflammation.
[0008] Based on these observations, provided herein are methods for treating a disorder (e.g., an inflammatory disorder, such as a disorder associated with undesirable interleukin 5 (IL-5) and / or IL-13 production / activity) in a mammalian subject. In some examples, such methods reduce IL-5 activity, reduce IL-13 activity, reduce ILC2 responses, reduce T cells, reduce IL-13 activity ... H 2 response, reduce eosinophilia or a combination thereof, thereby treating the condition. Exemplary conditions that can be treated include airway conditions (e.g., asthma, sinusitis, idiopathic pulmonary fibrosis, rhinitis, eosinophilic granulomatosis with polyangiitis, eosinophilic esophagitis or COPD) and skin conditions (e.g., eczema, atopic dermatitis or urticaria). Table 1 provides other exemplary conditions.
[0009] The method comprises administering to a mammalian subject (e.g., a human or veterinary subject) a therapeutically effective amount of at least one neuromedin B (Nmb) protein, or at least one nucleic acid molecule encoding at least one Nmb protein, thereby treating a disorder. In some instances, at least one Nmb protein has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37. In some examples, instead of using Nmb protein, neuromedin C (Nmc) protein or a nucleic acid molecule encoding Nmc protein is used, such as a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% sequence identity to SEQ ID NO: 38. In some examples, at least one nucleic acid molecule encodes an Nmb protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37. In other examples, the nucleic acid molecule encodes a Nmc protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% sequence identity to SEQ ID NO:38. In some examples, at least two different Nmb proteins are used, such as (1) at least one Nmb protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% sequence identity to SEQ ID NO:3, 4, 5, 6, 11, 12, 13, 14, 20, 22, 26, 27, 28, 29, 30, 31, 32, 35, 36 or 37, which is not SEQ ID NO:1 and (2) at least one Nmb protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% sequence identity to SEQ ID NO:26, 27, 29, 35 or 36, which is not SEQ ID NO:1.In some examples, at least two different Nmb proteins are used, such as (1) SEQ ID NO: 1, and (2) at least one Nmb protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% sequence identity with SEQ ID NO: 3, 4, 5, 6, 11, 12, 13, 14, 20, 22, 26, 27, 28, 29, 30, 31, 32, 35, 36 or 37, which is not SEQ ID NO: 1. In further examples, at least one Nmb protein and at least one Nmc protein are used. In some examples, at least one nucleic acid molecule has at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity with SEQ ID NO: 2, and can be part of a plasmid or viral vector (e.g., a lentiviral vector or an adeno-associated viral vector). In the example where the nucleic acid molecule is used, such a nucleic acid molecule can be operably linked to a promoter (e.g., a constitutive promoter). In some examples, use includes injection (e.g., iv, im, ip or intradermal), oral administration, inhalation administration or topical administration.
[0010] In some embodiments, the method upregulates the expression of one or more of the first group of genes comprising Sprr2a2, Serpinb2, Il1b, Xist and Tsix. In other embodiments, the method downregulates the expression of one or more of the second group of genes comprising Hgs2, Nkg7, Klra7, P2rx7, Ly6c2 and Mcpt2. In further embodiments, the method upregulates the expression of one or more of the first group of genes comprising Sprr2a2, Serpinb2, Il1b, Xist and Tsix, and downregulates the expression of one or more of the second group of genes comprising Hgs2, Nkg7, Klra7, P2rx7, Ly6c2 and Mcpt2. In other embodiments, the method reduces the level of cell infiltration in the lungs of a subject (e.g., a subject suffering from an inflammatory or airway condition).
[0011] At least one Nmb or Nmc protein or at least one nucleic acid molecule encoding at least one Nmb or Nmc protein can be present in a pharmaceutical composition, such as a pharmaceutical composition comprising a pharmaceutically acceptable carrier such as water or saline. Such a composition can include other therapeutic molecules. In some instances, at least two separate administrations of at least one Nmb or Nmc protein or at least one nucleic acid molecule encoding at least one Nmb or Nmc protein are provided to the subject for treatment, such as at least one separate administration of at least one week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 1 month, at least 2 months, at least 3 months, at least 6 months, at least 9 months or at least one year at intervals. In some instances, administration is carried out within 5 minutes of the onset of symptoms, within 10 minutes, within 30 minutes, within 1 hour, within 2 hours, within 3 hours, within 4 hours, within 5 hours, within 6 hours, within 12 hours, within 24 hours, within 48 hours, within 72 hours, within 96 hours, within 1 week, within 2 weeks, within 3 weeks, within 4 weeks, within 1 month, within 2 months or within 3 months. The method can include administering to the subject a therapeutically effective amount of another therapeutic agent (eg, see Table 1). In some examples, the additional therapeutic agent is prostaglandin E2 (PGE2).
[0012] Also provided is a composition comprising an isolated Nmb protein and a liposome, wherein the isolated Nmb protein comprises a sequence identity of at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% to SEQ ID NO: 1, wherein the Nmb protein is encapsulated in the liposome. Also provided is a composition comprising an isolated Nmb protein and a pharmaceutically acceptable carrier, wherein the isolated Nmb protein comprises a sequence identity of at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% to SEQ ID NO: 1. Also provided are compositions comprising an isolated protein comprising at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37, which is not SEQ ID NO: 1 or 38, and a pharmaceutically acceptable carrier. In some examples, such compositions comprise liposomes, wherein the non-native Nmb protein is encapsulated in the liposomes. Also provided are compositions comprising: (1) at least one protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% sequence identity to SEQ ID NO:3, 4, 5, 6, 11, 12, 13, 14, 20, 22, 26, 27, 28, 29, 30, 31, 32, 35, 36 or 37, which is not SEQ ID NO:1 and / or (2) at least one protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% sequence identity to SEQ ID NO:26, 27, 29, 35 or 36, which is not SEQ ID NO:1 or 38.
[0013] Disclosed methods and compositions can also utilize fusion proteins or chimeric proteins (or nucleic acid molecules encoding the protein), wherein Nmb protein or Nmc protein or non-natural Nmb protein is a fusion protein comprising Nmb protein or Nmc protein or non-natural Nmb protein and a cell penetrating peptide. Nmb protein or Nmc protein or non-natural Nmb protein can be at the N or C-terminal of a cell penetrating peptide. In addition, Nmb protein or Nmc protein or non-natural Nmb protein and a cell penetrating peptide can be separated by a joint.
[0014] The foregoing and other objects, features and advantages of the present disclosure will become more apparent from the following detailed description made with reference to the accompanying drawings. BRIEF DESCRIPTION OF THE DRAWINGS
[0015] Figures 1A-1F .Basophils regulate helminth-induced inflammation. (A) Quantification of intestinal worm burden in control or basophil-deficient mice (baso-dep) at day 7 after Nb infection. (B) Type 2 cytokine expression in the lungs of control and baso-dep mice was determined by real-time PCR at day 7 after Nb infection. (C) Lung-resident basophils were determined by in vivo staining with CD200R. (D) Quantification of the percentage of lung-resident basophils after Nb infection. (E) Assessment of lung pathology by hematoxylin and eosin staining at day 7 after Nb infection. (F) Oxygen levels in control and baso-dep mice after Nb infection were measured by pulse oximetry. P values were determined by two-tailed Student's t test.
[0016] Figure 2A-2B Lung pathology was assessed by (A) periodic acid-Schiff staining and (B) hematoxylin and eosin staining at day 7 after .Nb infection. (A), Individual images were digitally stitched together to provide a greater overview.
[0017] Figures 3A-3H . Basophils negatively regulate ILC2 responses. (A) Neutrophils, (B) eosinophils, and (C) ILC2s in bronchoalveolar lavage (BAL) of control or baso-dep mice were quantified at day 7 after Nb infection. Lineage-negative, CD90+, CD127+ ILC2s in BAL were stained for (D) IL-5 and (E) IL-13 intracellular cytokines, and cytokine-positive cells were quantified at day 7 after Nb infection. Basophils were adoptively transferred (it) into baso-dep mice after Nb infection, and the number of (F) ILC2s, (G) IL-5+ILC2s, and IL-13+ILC2s, and (H) eosinophils in BAL were quantified. P values were determined by two-tailed Student's t test.
[0018] Figures 4A-4GQuantification of (A) neutrophils, (B) eosinophils, and (C) ILC2s in the lungs of control or baso-dep mice at day 7 after Nb infection. Intracellular cytokine staining of lineage-negative, CD90+, CD127+ ILC2s in the lungs for (D) IL-5 and IL-13, and cytokine-positive cells were quantified at day 7 after Nb infection. Basophils were adoptively transferred (it) into baso-dep mice after Nb infection, and the number of (E) ILC2s, (F) IL-5+ILC2s, and IL-13+ILC2s, and (G) eosinophils in the lungs were quantified. P values were determined by two-tailed Student's t test.
[0019] Figures 5A-5H .Basophils promote the expression of Nmb receptor (Nmbr) on ILC2. Rag2-deficient mice were treated with the basophil-deficient antibody Ba103, and the number of (A) IL-5+ILC2, IL-13+ILC2, and (B) eosinophils in the BAL was quantified at day 7 after Nb infection. At day 7 after Nb, sorted and purified ILC2s from the lungs of control or basophil-deficient mice were subjected to ribonucleic acid (RNA) sequencing analysis. (C), Venn diagram showing genes differentially expressed at 2.0-fold or higher between control or baso-dep ILC2s. DAVID pathway analysis was performed on 899 genes enriched in control ILC2s. (D), Genes enriched in control ILC2s that define the rhodopsin pathway. At day 7 after Nb, (E) Mcpt8, (F) Nmb, and (G) Nmbr expression in the lungs of control or baso-dep mice was determined by real-time PCR. (H) Expression of Nmbr by control or baso-dep ILC2s sorted and purified from lungs at day 7 after Nb. P values were determined by two-tailed Student's t test.
[0020] Figures 6A-6E .Nmb inhibits type 2 cytokine responses. (A) Nb-infected mice were treated (it) with PBS or Nmb, and ILC2s in BAL were quantified. (B) Expression of IL-5 and IL-13 in the lungs of PBS- or Nmb-treated mice was determined by real-time PCR on day 7 after Nb. (C) Eosinophils in BAL were quantified, and (D) worm burden was determined on day 7 after Nb infection. ILC2s were sorted and purified from the lungs of control or baso-dep mice on day 7 after Nb and cultured with IL-2 and IL-7 in the presence or absence of Nmb (O / N), and (E) IL-5 and IL-13 levels in the culture supernatant were determined by ELISA. P values were determined by two-tailed Student's t test.
[0021] Figures 7A-7I.Nmb treatment is sufficient to inhibit allergic airway inflammation. Papain-challenged mice were treated with PBS or Nmb(it) and evaluated for (A) lung ILC2, (B) IL-5+ and IL-13+ ILC, and (C) eosinophils. (B) Mesenteric lymph nodes (MLN) were isolated on day 7 after Nb, single cell suspensions were treated with anti-CD3 and anti-CD28 for 48 hours in the presence or absence of Nmb, and (E) IL-5 and (F) IL-13 were quantified in cell-free supernatants by ELISA. (FI), modified forms of Nmb (see Table 2) were detected to alter the ability of anti-CD3 and anti-CD28 MLN cells isolated on day 7 after Nb to produce IL-5 and IL-13. P values were determined by two-tailed Student's t test. Blue asterisks indicate comparisons between medium-treated controls and native Nmb. Red asterisks indicate comparisons between medium-treated controls and modified forms of Nmb, as shown in Table 2. (*, p<0.05), (**, p<0.01), (***, p<0.001) or (FI).
[0022] Figures 8A-8B Mesenteric lymph nodes (MLN) were isolated on day 7 after Nb, single cell suspensions were treated with anti-CD3 and anti-CD28 for 48 h in the presence or absence of native Nmb or modified forms of the peptide, and (A) IL-5 and (B) IL-13 in the cell-free supernatant were quantified by ELISA. P values were determined by two-tailed Student's t-test. Blue asterisks indicate comparisons between medium-treated controls and native Nmb. Red asterisks indicate comparisons between medium-treated controls and modified forms of Nmb, as shown in Table 2. (*, p<0.05), (**, p<0.01), (***, p<0.001).
[0023] Fig. 9 .Basophils regulate NMBR expression. ILC2s were sorted and purified from the lungs of Nb-infected mice (day 7) and stimulated overnight with survival cytokines (IL-7 and IL-2) as well as activated basophils, IL-4 or IL-33. NMBR expression was monitored by flow cytometry analysis after culture. Data are expressed as geometric mean fluorescence intensity (GMFI). Statistical comparisons were performed using the Student t test.
[0024] Figures 10A-10B NMB inhibits type 2 cytokine production from IL-33-activated ILC2s. ILC2s were sorted and purified from the lungs of Nb-infected mice (day 7) and cultured with survival cytokines (IL-2, IL-7) in the presence or absence of NMB and / or IL-33. After overnight culture, supernatants were assayed for IL-5 ( Fig. 10A) and IL-13( Fig. 10B Statistical comparisons were performed using the Student t test.
[0025] Figures 11A-11B NMBR-mediated signaling on hematopoietic cells is required for regulation of type 2 cytokine production. ILC2s isolated from the BAL of naive or Nb-infected (day 7) Vav1-Cre, NMBR-floxed, or Vav1-Cre-NMBR-floxed mice were subjected to IL-5 ( Fig.11A ) and IL-13( Fig. 11B ) Intracellular staining. Statistical comparisons were performed using the Student t test.
[0026] Fig.12 NMBR-mediated signaling on hematopoietic cells is required to regulate cellular infiltration in the lung. Lung pathology (H&E staining) was evaluated in naive or Nb-infected (day 7), Vav1-Cre, NMBR-floxed, or Vav1-Cre-NMBR-floxed mice.
[0027] Fig.13 NMBR is expressed by several immune cell populations. The expression of NMBR on various immune cell populations was evaluated in naive (filled symbols) and Nb-infected mice (day 7) (open symbols). Lymphocytes (lymphs), alveolar macrophages (Alv Macs), non-alveolar macrophages (NAMs), eosinophils (Eos), and neutrophils (Neuts).
[0028] Fig.14 .Prostaglandin E2 upregulates the expression of NMBR on lymphocytes. Pulmonary ILC2 was sorted and purified from mouse lungs on the 7th day after Nb, and co-cultured with survival cytokines (IL-2 and IL-7) and / or activation cytokines (IL-25 and IL-33). In addition, cultures were treated with NMB or prostaglandin E2 (PGE2), and the expression of NMBR was measured by flow cytometry analysis on the 4th day after culture. Statistical analysis was performed using the Student t test. Negative NMBR staining (Isot) determined by isotype control antibodies is also shown.
[0029] Sequence Listing
[0030] The nucleic acid and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases and three letter codes for amino acids as defined in 37 CFR 1.822. Each nucleic acid sequence shows only one strand, but the complementary strand is understood to include any reference to the displayed strand.
[0031] SEQ ID NO: 1 is an exemplary native human Nmb protein sequence.
[0032] SEQ ID NO: 2 is an exemplary coding sequence of native human Nmb.
[0033] SEQ ID NOs: 3-37 are exemplary non-native Nmb protein sequences.
[0034] SEQ ID NO: 38 is an exemplary native human neuromedin C protein sequence.
[0035] SEQ ID NOs: 39-58 are exemplary cell penetrating peptides. DETAILED DESCRIPTION
[0036] Unless otherwise indicated, technical terms are used according to conventional usage. Definitions of commonly used terms in molecular biology can be found in Benjamin Lewin, Genes VII, published by Oxford University Press, 1999; Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994; and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995; and other similar references.
[0037] As used herein, the singular forms "a", "an", and "the" refer to both the singular and the plural, unless the context clearly indicates otherwise. As used herein, the term "comprising" means "including". Therefore, "comprising an Nmb peptide" means "including an Nmb peptide" without excluding other elements. It should be further understood that any and all base sizes given for nucleic acids are approximate and are provided for descriptive purposes unless otherwise indicated. Although many methods and materials similar or equivalent to those described herein can be used, particularly suitable methods and materials are described below. In the event of a conflict, the present specification (including explanations of terms) shall prevail. In addition, the materials, methods, and examples are illustrative only and are not intended to be limiting. All references, including patent applications and patents, as well as those listed herein, are incorporated herein by reference. The entire contents of the sequences associated with the accession numbers (as of October 4, 2018) are incorporated herein by reference.
[0038] To facilitate review of the various embodiments of the present disclosure, the following explanations of specific terms are provided:
[0039] I. Terminology
[0040] Administration: Provide or administer reagents, such as Nmb nucleic acid molecules or proteins, to a subject by any effective route. Exemplary routes of administration include, but are not limited to, injection (e.g., intravenous, intramuscular, intradermal, intraperitoneal, or injection into CNS, such as injection into the spine or brain), oral, nasal, transdermal, vaginal, rectal, or inhalation.
[0041] Aerosol: Any gaseous suspension of fine solid or liquid particles. Therefore, the term "atomized" refers to the form of microscopic solid or liquid particles dispersed or suspended in air or gas. In one example, the microscopic solid has a mass median aerodynamic diameter of 1 μm to 20 μm. The term "spray" refers to the act of converting (liquid) into a fine mist or atomization. Therefore, the term "dry powder aerosol" refers to any microscopic solid suspended in a gas (usually air). It is also possible that the disclosed compositions (such as those including Nmb nucleic acid molecules or proteins) are formulated as sustained-release preparations. Aerosol delivery refers to the administration (e.g., to the airways) of an agent (e.g., Nmb nucleic acid molecules or proteins) formulated as an aerosol.
[0042] Airway disorder or disease: In general, an airway disorder / disease includes any disorder / disease related to the airways of the lungs. In specific non-limiting examples, the pulmonary disorder / disease is asthma or chronic obstructive pulmonary disease (COPD).
[0043] Allergen: Any substance that causes an allergic response or reaction. Common allergens include dust, pollen, plants, pets (e.g., cat or dog dander), medications, certain foods (e.g., eggs, milk, peanuts, shellfish), insect venom, viruses, or bacteria. The (unwelcome) reaction may be caused by exposure of the subject by ingestion, inhalation, injection, or contact with the skin. Any allergen can be treated using the disclosed methods.
[0044] Allergic reaction: A form of hypersensitivity reaction (e.g., to a normally harmless entity) characterized by excessive activation of mast cells and basophils by IgE, resulting in an extreme inflammatory response. Common allergic reactions include eczema, urticaria, hay fever, asthma, food allergies, and reactions to the venom of stinging insects (such as wasps and bees).
[0045] Amidation or amide derivative: A post-translational modification to form an amide, such as an Nmb peptide (e.g., any one of SEQ ID NOs: 1 and 3-37) or an Nmc peptide (e.g., SEQ ID NO: 38). Thus, in some examples, the Nmb or Nmc peptides provided herein are amidated and can be used in the disclosed methods. In amidation, the C-terminal amino acid (peptide-COOH) is modified to form an amide (peptide-CONH 2 ). Amides can be formed by post-translational C-terminal amidation. The amino acid to be modified can be followed by glycine, which provides an amide group. In some examples, amides increase the biological activity of Nmb or Nmc peptides.
[0046] Anaphylaxis: A clinical syndrome representing the most severe systemic allergic reaction. It is due to the immune-induced release of mast cell and / or basophil mediators (including type 2 cytokines) following exposure to specific antigens in previously sensitized individuals. Although any substance has the potential to cause anaphylaxis, the most common causes of IgE-mediated anaphylaxis are insect stings, drugs, latex, peanuts and tree nuts (e.g., walnuts, hazelnuts, almonds, cashews, pecans, and pistachios), shellfish and fish, milk, eggs, and wheat. When activated by ILC2 and T H When type 2 cytokines are produced by Nmb cells, IgE is produced, thereby initiating the response of basophils and mast cells to subsequent exposure to allergens. Exercise-induced anaphylaxis and idiopathic anaphylaxis also occur, mediated by different mechanisms. In some instances, the disclosed methods (e.g., administration of Nmb peptides) are used to treat or prevent anaphylaxis.
[0047] Asthma: Asthma is an umbrella term that describes many syndromes or phenotypes of the respiratory system. In these conditions, the airways are constricted, inflamed, and accompanied by excess mucus, usually in response to one or more "trigger factors", such as exposure to environmental irritants (or allergens), chemicals, cold air, exercise, or viruses, or for completely unknown reasons. This airway narrowing causes symptoms such as wheezing, shortness of breath, chest tightness, and coughing. The condition is a chronic or recurrent inflammatory condition in which the airways are more reactive to various stimuli, characterized by bronchial hyperresponsiveness, inflammation, increased mucus production, and intermittent airway obstruction. In more severely affected patients, the obstruction may become fixed rather than intermittent. In a typical allergic asthma reaction, IgE antibodies formed by the Th2 inflammatory process are primarily attached to mast cells located in the lung interstitium closely associated with the bronchioles and bronchioles. Triggering cells cause the release of a variety of substances, including but not limited to cytokines, chemokines, and arachidonic acid-derived mediators, leading to bronchoconstriction, airway hyperresponsiveness, excessive mucus secretion, and airway inflammation. However, not all asthma is allergic, and there is good evidence that patients with more severe forms of asthma develop not only Th2 inflammation, but also Th1 inflammation.
[0048] International guidelines define mild asthma as intermittent symptoms, relatively normal lung function and few exacerbations. The disclosed Nmb nucleic acid molecules and peptides can be used to treat mild asthma, for example, in combination with low doses of inhaled corticosteroids (CS) or bronchodilators. Moderate asthma is defined as more persistent and more severe symptoms, occasional exacerbations and / or worsening lung function. The disclosed Nmb nucleic acid molecules and peptides can be used to treat moderate asthma, for example, in combination with higher doses of inhaled CS and long-acting beta agonists (LABA) or leukotriene antagonists. Severe asthma is defined in the ATS-ERS severe asthma guidelines as requiring treatment with high doses of inhaled CS combined with a controller (LABA or leukotriene antagonist), or the use of systemic CS to maintain disease control (lower exacerbations, fewer symptoms, better lung function), or asthma that cannot be controlled even with these treatments. The disclosed Nmb nucleic acid molecules and peptides can be used to treat severe asthma, for example, in combination with such agents.
[0049] Bronchodilator: An antispasmodic or other agent that dilates the bronchi or bronchioles. Bronchodilators relax the smooth muscle of the airways, allowing the airways to dilate. Bronchodilators generally do not fight inflammation. Examples include short-acting (e.g., albuterol) and long-acting (e.g., formoterol) beta-2 adrenergic agonists, and anticholinergics (e.g., tiotropium and ipratropium).
[0050] Cell permeability: The ability of a molecule to pass through a cell membrane (e.g., a mammalian cell). In some instances, cell permeability includes permeability through various modes of transport, such as passive diffusion and transporter-mediated permeation. Certain agents can enhance cell permeability (i.e., cell permeability enhancers), including peptides, such as cell penetrating peptides, such as those included in the tag; protein-based agents, such as pore or channel forming proteins; virus-based agents; lipid- or polymer-based agents; or inorganic agents. In one example, an Nmb peptide (such as any one of SEQ ID NOs: 1 and 3-37) includes a tag that increases its cell permeability, such as a peptide tag (also called a cell penetrating peptide (CPP)) (e.g., transcriptional transactivator TAT, such as TAT 48-57 、TAT 47-57 or TAT 49-57 ; penetratin; Pep-1; substance P, SP; polyarginine, such as R5-R12; pVEC; transportan; MAP; diatos peptide vector 1047, DPV1047, MPG; ADP-ribosylation factor, ARF, such as ARF 1-22 ; BPrPr (e.g. BPrPr 1-28 ); p28; VT5; Bac 7, for example Bac 1-24; C105Y; PFVYLI (SEQ ID NO:58); Pep-7, SynB1 [RGGRLSYSRRRFSTSTGR; SEQ ID NO:39], SynB3 [RRLSYSRRRF; SEQ ID NO:40], PTD-4 [PIRRRKKLRRLK; SEQ ID NO:41], PTD-5 [RRQRRTSKLMKR; SEQ ID NO:42], FHV Coat-(35-49) [RRRRNRTRRNRRRVR; SEQ ID NO:43], BMV Gag-(7-25) [KMTRAQRRAAARRNRWTAR; SEQ ID NO:44], HTLV-II Rex-(4-16) [TRRQRTRRARRNR; SEQ ID NO:45], D-Tat [GRKKRRQRRRPPQ; SEQ ID NO:46], R9-TatGRRRRRRRRRPPQ [SEQ ID NO:47] and a cell-penetrating peptide [RQIKWFQNRRMKWKK; SEQ ID NO:48]), amphiphilic polypeptides (e.g., MAP [KLALKLALKLALALKLA; SEQ ID NO:49], SBP [MGLGLHLLVLAAALQGAWSQPKKKRKV; SEQ ID NO:50], FBP [GALFLGWLGAAGSTMGAWSQPKKKRKV; SEQ ID NO:51], MPG ac-GALFLGFLGAAGSTMGAWSQPKKKRKV-cya; SEQ ID NO:52], MPG(ΔNLS) [ac-GALFLGFLGAAGSTMGAWSQPKSKRKV-cya; SEQ ID NO:53], Pep-2 [ac-KETWFETWFTEWSQPKKKRKV-cya; SEQ ID NO:54] and transportan [GWTLNSAGYLLGKINLKALAALAKKIL; SEQ ID NO:55]), cyclic sequences (e.g., pVec, polyarginine RxN (4 < N < 17) chimeras, polylysine KxN (4 < N < 17) chimeras, (RAca)6R, (RAbu)6R, (RG)6R, (RM)6R, (RT)6R, (RS)6R, R10, (RA)6R, R7 and pep-1 [ac-KETWWETWWTEWSQPKKKRKV-cya; SEQ ID NO:56]) and Cr10 (cyclic poly-arginine CPP), or a nucleic acid encoding such peptide tags.
[0051] Chimeric or fusion protein: a protein comprising a first peptide (e.g., Nmb) and a second peptide (e.g., a cell penetrating peptide), wherein the first and second proteins are different. Chimeric polypeptides also include polypeptides comprising two or more discontinuous portions derived from the same polypeptide. In some instances, chimeric proteins include Nmb / cell penetrating peptide fusion proteins, wherein the cell penetrating peptide is located at the N or C terminus of Nmb. Two or more different peptides can be connected directly or indirectly, for example using a linker (e.g., 1-30 amino acids).
[0052] Chronic obstructive pulmonary disease: A type of obstructive lung disease characterized by long-term breathing problems and poor ventilation. The limited ventilation is usually progressive and is associated with an abnormal inflammatory response of the lungs to noxious particles or gases. The main symptoms include shortness of breath and cough with sputum production. Smoking is the most common cause of COPD. The disclosed Nmb nucleic acid molecules and peptides can be used to treat COPD, for example in combination with bronchodilators, corticosteroids, antibiotics, supplemental oxygen, or a combination thereof.
[0053] cDNA (complementary DNA): A DNA fragment that lacks the internal, non-coding regions (introns) and regulatory sequences that determine transcription. cDNA can be synthesized by reverse transcription from messenger RNA.
[0054] Contact: Placed in direct physical association, including solid or liquid form. Contact can occur in vitro or ex vivo, for example, by adding an agent to a sample (e.g., one containing ILC2 cells), or in vivo by administration to a subject.
[0055] Control: reference standard. In some embodiments, the control is a healthy subject. In other embodiments, the control is a subject suffering from the conditions listed in Table 1. In other embodiments, the control is a historical control or a standard reference value or a range of values (e.g., a control subject of a previous test with a known prognosis or outcome or a subject group representing a baseline or normal value). The difference between the test subject and the control can increase or decrease. The difference can be a qualitative difference or a quantitative difference, such as a statistically significant difference. In some instances, the difference is an increase or decrease of at least about 5% relative to the control, such as at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, at least about 300%, at least about 350%, at least about 400%, at least about 500% or more than 500%.
[0056] Degenerate variants: Nucleotides encoding peptides, such as Nmb, which contain sequences that are degenerate due to the genetic code. There are 20 natural amino acids, most of which are specified by more than one codon. Therefore, all degenerate nucleotide sequences are included in the present disclosure as long as the amino acid sequence of the peptide encoded by the nucleotide sequence remains unchanged.
[0057] Effective amount or therapeutically effective amount: the amount of an agent (e.g., Nmb protein or nucleic acid molecules encoding Nmb) sufficient to produce a beneficial or desired result in, for example, a subject to be treated. For example, this can be the amount of the Nmb protein or nucleic acid molecules encoding Nmb necessary for alleviating or suppressing inflammation (e.g., type 2 cytokine-mediated inflammation), asthma attacks, allergic reactions, improving symptoms and lung function or a combination thereof. When administered to a subject, a dosage reaching a target tissue concentration (e.g., in the airway) will generally be used, which has been shown to achieve a desired in vivo effect.
[0058] The therapeutically effective amount may vary depending on one or more of the following: the subject and the disease condition to be treated, the subject's weight and age, the severity of the disease condition, the mode of administration, etc., which can be determined by one of ordinary skill in the art. Beneficial therapeutic effects may include amelioration of a disease, symptom, disorder, or pathological condition; reduction or prevention of the onset of a disease, symptom, disorder, or condition; and generally combating a disease, symptom, disorder, or pathological condition. In one embodiment, an "effective amount" is an amount sufficient to achieve the following: (1) reduce inflammation (e.g., in the lungs or at the site of an allergic reaction), e.g., relative to not administering the Nmb protein or nucleic acid molecule, for example, by at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75%, or at least 90%, (2) reduce IL-5 (e.g., in ILC2 and / or T cells), e.g., relative to not administering the Nmb protein or nucleic acid molecule, for example, by at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75%, or at least 90%, (3) reduce IL-13 (e.g., in ILC2 and / or T cells), e.g., relative to not administering the Nmb protein or nucleic acid molecule, for example, by at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75%, or at least 90%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75% or at least 90%, (4) reducing ILC2 and / or T cell responses, such as the number of ILC2 and / or T cells present, proliferating and / or activated, for example, relative to not administering the Nmb protein or nucleic acid molecule, for example, by at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75% or at least 90%, and / or (5) reducing eosinophilia (e.g., in the lungs or peripheral blood), for example, relative to not administering the Nmb protein or nucleic acid molecule, for example, by at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75% or at least 90%.
[0059] Eosinophilia: A condition in which the eosinophil count in the peripheral blood exceeds about 450-500 cells / μL (e.g., as determined by a complete blood count (CBC)) or an increased eosinophil count in non-blood tissues observed on histopathological examination. Eosinophils normally account for less than 5-7% of circulating leukocytes. Exemplary causes include allergic reactions and parasitic infections.
[0060] Expectorant: A drug or chemical that induces the expulsion of mucus, phlegm, and other fluids from the lungs and airways (e.g., by coughing). An example of such an agent is guaifenesin.
[0061] Increase or decrease: relative to the control value (for example, the value before treatment with Nmb protein or nucleic acid molecule, or the value in the subject with similar illness without Nmb protein or nucleic acid molecule treatment) quantity respectively statistically significant positive or negative change.Increase is a positive change, for example, compared with the control value, increase by at least 50%, at least 100%, at least 200%, at least 300%, at least 400% or at least 500%.Reduce is a negative change, for example, compared with the control value, reduce by at least 20%, at least 25%, at least 50%, at least 75%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99% or at least 100%.In some instances, reduce less than 100%, for example, reduce not more than 90%, not more than 95% or not more than 99%.
[0062] Type 2 innate lymphoid cells (ILC2): A type of innate lymphoid cell that is derived from a common lymphoid progenitor cell. These cells lack antigen-specific B or T cell receptors due to the absence of recombination-activating genes. ILC2s produce type 2 cytokines (e.g., IL-4, IL-5, IL-9, IL-13).
[0063] Interleukin 5 (IL-5): (e.g., OMIM 147850): An interleukin produced by type 2 helper cells (Th2 cells), ILC2 cells, and mast cells. IL-5 stimulates B cell growth and increases immunoglobulin secretion, primarily IgA. It also mediates eosinophil activation. IL-5 is associated with the etiology of a variety of allergic diseases, including allergic rhinitis and asthma. Exemplary drugs targeting IL-5 include mepolizumab, benralizumab, and reslizumab, which can be used in combination with the Nmb proteins or nucleic acid molecules disclosed herein, for example, to treat asthma (e.g., eosinophilic asthma) or eosinophilic granulomatosis with polyangiitis (EGPA).
[0064] The IL-5 sequence is publicly available, for example, from Sequence databases (e.g., Accession Nos. NP_000870.1 (mature peptide aa 20-134), CAA29607.1, and NP_001006951.1 provide exemplary IL-5 protein sequences, while Accession Nos. NM_000879.2, X06271.1, and NM_001006950.1 provide exemplary IL-5 nucleic acid sequences) are publicly available. IL-5 variants are contemplated, such as those having at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity to these accession numbers.
[0065] Interleukin 13 (IL-13) (e.g., OMIM 147683): A cytokine secreted by Th2 cells, CD4 cells, natural killer T cells, mast cells, basophils, eosinophils, and ILC2 cells. IL-13 is a major regulator of IgE synthesis, goblet cell hyperplasia, mucus hypersecretion, airway hyperresponsiveness, fibrosis, and chitinase upregulation. It is a mediator of allergic inflammation and various diseases, including asthma. Exemplary drugs targeting IL-13 include tralokinumab and lebrikizumab, which can be used in combination with the Nmb proteins or nucleic acid molecules disclosed herein, for example, to treat asthma, atopic dermatitis, or Hodgkin's lymphoma.
[0066] The IL-13 sequence is publicly available, for example, from Sequence databases (e.g., Accession Nos. NP_002179.2 (mature peptide aa 21-132), NP_032381.1 (mature peptide aa 22-131), and NP_446280.1 (mature peptide aa 21-131) provide exemplary IL-13 protein sequences, while Accession Nos. NM_002188.2, NM_008355.3, and NM_001003384.1 provide exemplary IL-13 nucleic acid sequences) are publicly available. IL-13 variants are contemplated, such as those having at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity to these Accession Nos.
[0067] Inhaler: a device for applying steam or volatile drugs by inhalation. Inhalers are generally used for topical administration of drugs in the airway, for example to treat asthma. In some instances, the inhaler is a dry powder inhaler. In other instances, the inhaler is a metered dose inhaler. In some instances, the inhaler includes Nmb protein disclosed herein (for example SEQ ID NO:1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, any one of 36 or 37) or encoding such nucleic acid molecules (for example SEQ ID NO:2) (or containing a carrier such as a nucleic acid molecule).
[0068] Inhibit: To reduce, limit or block the action or function of a molecule. In an example, IL-5 and / or IL-13 activity (e.g., protein expression) is reduced or inhibited by a Nmb protein disclosed herein (e.g., any one of SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37) or a nucleic acid molecule encoding such (e.g., SEQ ID NO: 2) (or a vector containing such a nucleic acid molecule). For example, an Nmb protein disclosed herein (e.g., any one of SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) or a nucleic acid molecule encoding such (e.g., SEQ ID NO: 2) (or a vector comprising such a nucleic acid molecule) reduces or inhibits IL-5 and / or IL-13 activity, e.g., by at least 10%, at least 20%, at least 40%, at least 45%, at least 50%, at least 60%, at least 75%, or at least 90%, relative to no administration of the Nmb protein or nucleic acid molecule.
[0069] Isolated: An "isolated" biological component (e.g., a protein or nucleic acid or cell) has been substantially separated, produced separately, or purified from other biological components (e.g., other cells, chromosomal and extrachromosomal DNA and RNA, and proteins) in the cells or tissues of the organism in which the component is present. Nucleic acid molecules and proteins that have been "isolated" include nucleic acid molecules and proteins purified by standard purification methods. The term also encompasses nucleic acids and proteins (e.g., Nmb proteins and nucleic acid molecules) prepared by recombinant expression in host cells and chemically synthesized nucleic acids and proteins. In some instances, the purity of the isolated Nmb protein, Nmb nucleic acid or cell (e.g., ILC2 cell) is at least 50%, for example, at least 75%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 100% purity.
[0070] Linker or spacer: a molecule that connects (e.g., covalently) two or more parts (e.g., one of which is a Nmb peptide) together but does not have a specific biological activity and does not adversely affect the activity or function of the part. The linker is preferably biocompatible. The linker can be selected to provide or affect the properties of the connected part, such as the folding, conformation, hydrophobicity and / or spatial formation of the part. In some instances, the linker includes a reactive site at each end, and each end can form a covalent bond with one of the parts included in the compound described herein. In some instances, the linker includes a peptide, a straight or branched carbon linker or a heterocyclic carbon linker.
[0071] Nebulizer: A device that converts a liquid form of a drug into a fine mist (aerosol) that can be inhaled, e.g., for delivering drugs (e.g., drugs containing Nmb proteins or nucleic acids) deep into the respiratory tract.
[0072] Neuromedin B (Nmb): (e.g., OMIM 162340): Part of the neuromedin family of peptides that includes neuromedin A, B, C, K, L, N, S, and U. Nmb is a bombesin-related peptide expressed in the central nervous system, lungs, gastrointestinal tract, and adipose tissue of mammals. Nmb acts by binding to its high affinity cell surface receptor, the neuromedin B receptor (NMBR). Upon binding to its receptor, Nmb reportedly regulates cell growth, body temperature, blood pressure, and glucose levels. It is demonstrated herein that Nmb can also reduce type II cytokine-mediated inflammation, such as by reducing the expression of IL-5 and IL-13.
[0073] The sequence of the Nmb decapeptide is highly conserved among mammalian species: GNLWATGHFM (SEQ ID NO: 1), and can be encoded by the sequence ggcaacctctgggccaccggtcacttcatg (SEQ ID NO: 2). This decapeptide is sometimes referred to as neuromedin B or neuromedin B 23-32.
[0074] The full-length Nmb sequences from the decapeptides that can be identified are publicly available, for example from Sequence databases (e.g., Accession Nos. AAA59934.1, AAH28490.1, and A37178 provide exemplary protein sequences, while Accession Nos. BC007407.2, BC028490.1, and EU375564.1 provide exemplary nucleic acid sequences). Using the methods provided herein, Nmb variants can be generated, such as those having at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NO: 1, e.g., SEQ ID NO: 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, and 37, and used to generate therapeutic recombinant nucleic acid molecules and proteins, e.g., to treat inflammatory diseases, such as those listed in Table 1.
[0075] Non-naturally occurring or engineered: terms used interchangeably herein, and represent human intervention. When referring to nucleic acid molecules or polypeptides (e.g., Nmb molecules), the term represents that nucleic acid molecules or polypeptides are at least substantially free of at least one other component naturally associated with them in nature and as found in nature. In addition, these terms can indicate that nucleic acid molecules or polypeptides, such as variant Nmb molecules, are nucleic acid molecules or polypeptides with sequences not found in nature.
[0076] Operably linked: A first nucleic acid sequence is operably linked to a second nucleic acid sequence when the first nucleic acid sequence is in a functional relationship with the second nucleic acid sequence. For example, if a promoter affects the transcription or expression of a coding sequence (e.g., a Nmb decapeptide coding sequence), the promoter is operably linked to the coding sequence. Typically, operably linked DNA sequences are continuous and, in the case of needing to connect two protein coding regions, are in the same reading frame.
[0077] Pharmaceutically acceptable carriers: The pharmaceutically acceptable carriers used are conventional. Remington's Pharmaceutical Sciences, by EW Martin, Mack Publishing Co., Easton, PA, 22nd Edition, 2013 describes compositions and formulations suitable for drug delivery of the Nmb proteins disclosed herein.
[0078] Usually, the property of carrier will depend on the specific mode of administration adopted.For example, parenteral preparations usually include injectable fluids, which include pharmaceutically and physiologically acceptable fluids, such as water, normal saline, balanced salt solution, aqueous glucose solution, glycerol, etc. as solvents.For solid compositions (such as powders, pills, tablets or capsule forms), conventional non-toxic solid carriers can include, for example, pharmaceutical grade mannitol, lactose, starch or magnesium stearate.Except for biological neutral carriers, pharmaceutical compositions to be administered can also include a small amount of non-toxic auxiliary substances, such as wetting agents or emulsifiers, preservatives and pH buffers, such as sodium acetate or sorbitan monolaurate.
[0079] Polypeptide, peptide and protein: These terms are used interchangeably herein and refer to polymers of amino acids of any length, such as amino acids chemically bound together by amide bonds (CONH). The polymer can be linear or branched, it can contain modified amino acids, and can be interrupted by non-amino acids. The term also encompasses amino acid polymers that have been modified (e.g., disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other operation, such as conjugation with a labeling component). As used herein, the term "amino acid" includes natural and / or non-natural or synthetic amino acids, including glycine and D or L optical isomers, as well as amino acid analogs and peptidomimetics. In some instances, the peptide is an Nmb peptide, such as an Nmb decapeptide.
[0080] Purified: The term "purified" does not require absolute purity; on the contrary, it is intended to be a relative term. Thus, for example, a purified nucleic acid is one in which nucleic acid is more enriched in a cell than in its natural environment. Similarly, a purified peptide preparation is a peptide preparation in which protein is more enriched than, for example, a protein in a cell. Substantially purified means purified from other proteins or cell components. In one embodiment, the purified (or separated) preparation makes the Nmb protein disclosed herein (e.g., any one of SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, and 37) represent at least 50% (e.g., but not limited to, 70%, 80%, 90%, 95%, 98%, or 99%) of the total protein content of the preparation. The Nmb proteins disclosed herein (e.g., any one of SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, and 37) can be purified (and / or synthesized) by any method (see, e.g., Guide to Protein Purification, ed. Deutscher, Meth. Enzymol. 185, Academic Press, San Diego, 2 nd Edition, 2009; and Scopes, Protein Purification: Principles and Practice, Springer Verlag, New York, 3 rd Edition, 1994).
[0081] Sequence identity / similarity: The similarity between amino acid (or nucleotide) sequences is expressed as the similarity between the sequences, otherwise known as sequence identity. Sequence identity is often measured as a percentage identity (or similarity or homology); the higher the percentage, the more similar the two sequences are.
[0082] Sequence alignment methods used for comparison and alignment algorithms are described in: Smith and Waterman, Adv. Appl. Math. 2:482, 1981; Needleman and Wunsch, J. Mol. Biol. 48:443, 1970; Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85:2444, 1988; Higgins and Sharp, Gene 73:237, 1988; Higgins and Sharp, CABIOS 5:151, 1989; Corpet et al., Nucleic Acids Research 16:10881, 1988; and Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85:2444, 1988. Altschul et al., Nature A detailed consideration of sequence alignment methods and homology calculations is presented in Genet. 6:119, 1994.
[0083] The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al., J. Mol. Biol. 215:403, 1990) is available from a number of sources, including the National Center for Biotechnology Information (NCBI, Bethesda, MD) and the Internet, for use in conjunction with the sequence analysis programs blastp, blastn, blastx, tblastn, and tblastx. Instructions on how to use this program to determine sequence identity are provided on the NCBI website on the Internet.
[0084] Variants of protein and nucleic acid sequences (including Nmb sequences provided herein) are generally characterized by having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity counted in the full-length comparison with the amino acid sequence using NCBI Blast 2.0 with gapped blastp set to default parameters. In order to compare amino acid sequences greater than about 30 amino acids, the default BLOSUM62 matrix is set to default parameters, using the Blast 2 sequence function (gap existence cost is 11, and each residue gap cost is 1). When comparing short peptides (less than about 30 amino acids), the Blast 2 sequence function can be used for comparison, using the PAM30 matrix to be set to default parameters (open gap 9, extension gap 1 penalty). The method for determining sequence identity on such a short window can be obtained on the NCBI website on the Internet. These sequence identity ranges are only for guidance; it is entirely possible to obtain very important homologues beyond the provided range.
[0085] Subject: mammal, such as a human or veterinary subject. Mammals include, but are not limited to, rodents, apes, humans, farm animals, sports animals, and pets. In one embodiment, the subject is a non-human mammalian subject, such as a monkey or other non-human primate, mouse, rat, rabbit, pig, goat, sheep, dog, cat, wild boar, bull, horse, or cow. In some instances, the subject is a laboratory animal / organism, such as a mouse, rabbit, or rat. In some instances, the subject suffers from an inflammatory condition, such as an inflammatory condition listed in Table 1 (e.g., asthma, COPD, or allergic reaction).
[0086] Treating or treatment: refers to therapeutic intervention to improve the signs or symptoms of a disease or pathological condition associated with a disease or pathology (e.g., those listed in Table 1, such as airway disorders, such as asthma or chronic obstructive pulmonary disease or allergic reactions). Treatment can also induce remission or cure of the condition. In specific examples, treatment includes reducing inflammation.
[0087] Reduction or inhibition of signs or symptoms associated with a disease (e.g., an airway disease or other condition listed in Table 1) can be demonstrated, for example, by a delayed onset of clinical symptoms of the disease in a susceptible subject, a reduction in the severity of some or all clinical symptoms of the disease, a slower progression of the disease (e.g., by extending the lifespan of a subject with the disease), a reduction in the number of relapses of the disease, an improvement in the subject's overall health or well-being, or by other parameters known in the art that are specific to a particular disease.
[0088] Treatment can be assessed by objective or subjective parameters; including the results of physical examination and other clinical tests. In one example, treatment using the disclosed methods (1) reduces inflammation (e.g., in the lungs or at the site of an allergic reaction), for example, relative to no administration of Nmb protein or nucleic acid molecules, for example, by at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75% or at least 90%, (2) reduces IL-5 (e.g., in ILC2 and / or T cells), for example, relative to no administration of Nmb protein or nucleic acid molecules, for example, by at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75% or at least 90%, (3) reduces IL-13 (e.g., in ILC2 and / or cells), for example, relative to no administration of Nmb protein or nucleic acid molecules, for example, by at least 5%, at least 1 0%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75% or at least 90%, (4) reducing ILC2 and / or T cell responses, such as the number of ILC2 and / or T cells present, proliferating and / or activated, such as by at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75% or at least 90% relative to not administering the Nmb protein or nucleic acid molecule, and / or (5) reducing eosinophilia (e.g., in the lungs or peripheral blood), such as by at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75% or at least 90% relative to not administering the Nmb protein or nucleic acid molecule.
[0089] Under conditions sufficient to carry out the following: a phrase used to describe any environment that allows the desired activity. In one example, this includes administering a composition sufficient to allow the desired activity (e.g., reducing inflammation associated with IL-5 and / or IL-13) in an effective amount, the composition comprising one or more Nmb proteins disclosed herein (e.g., SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, and 37) or a nucleic acid molecule encoding such (e.g., SEQ ID NO: 2) (or a vector containing such a nucleic acid molecule).
[0090] Unit dose: A physically discrete unit containing a predetermined quantity of active materials calculated to produce, individually or collectively, a desired effect, such as a therapeutic effect. A single unit dose or multiple unit doses may be used to provide the desired effect, such as treatment of a condition, such as those listed in Table 1, such as asthma, COPD, or allergic reactions.
[0091] Vector: a nucleic acid molecule introduced into a cell to produce a transformed cell. A vector may include a nucleic acid sequence that allows it to replicate in a host cell, such as an origin of replication. A vector may also include one or more therapeutic genes (such as one encoding the Nmb peptide provided herein) and / or selective marker genes and other genetic elements. A vector may transduce, transform or infect a cell so that the cell expresses nucleic acids and / or proteins that are different from those inherent to the cell. The vector optionally includes materials that help to achieve the entry of nucleic acids into the cell, such as viral particles, liposomes, protein coatings, etc. In an example, the vector is a viral vector, such as an AAV or a lentiviral vector.
[0092] II. Overview
[0093] Basophils are able to amplify type 2 cytokine responses by producing IL-4 and have the ability to promote the activation of other cell types, including ILC2 and TH2 cells (2,5,10). Furthermore, basophils are a common feature of type 2 cytokine-mediated inflammation following helminth infection or induced allergic inflammation (2,10). Although basophil responses are a hallmark of type 2 inflammation, the role or roles played by these mysterious cells in regulating type 2 responses remains controversial. For example, although the basophil population rapidly expands after Nb infection, the absence of these cells has little effect on anti-helminth immunity and parasite clearance (2,11). Therefore, Nb-induced basophils do not contribute to parasite clearance but may perform other unidentified functions.
[0094] The data presented here identify a family of proteins that negatively regulate ILC2 and T HPreviously unrecognized aspects of the crosstalk between the nervous and immune systems in type 2 cytokine responses. Previous studies have shown that expression of neuromedin U by cholinergic neurons can promote ILC2 activation and enhance immunity to helminth parasites (8,9), suggesting that the nervous and immune systems can collaborate in a manner that allows for optimal sensing and clearance of pathogens. The studies presented here suggest that as the nervous and immune systems co-evolved, they also developed mechanisms to negatively regulate inflammatory responses through neuromedin B signaling to help maintain tissue integrity. Furthermore, the data herein identify an additional level of complexity and suggest that basophils promote expression of Nmbr by immune cells, thereby enabling them to receive neuron-derived signals. Thus, other specific innate immune cells help mediate communication between neurons and immune cells that produce type 2 cytokines. The data further demonstrate that prostaglandin E2 (PGE2) promotes expression of Nmbr by lymphocytes. Since basophils are a potent source of PGE2, these data suggest that basophils modulate the ability of Nmb to suppress inflammation through PGE2. These data reveal the highly coordinated cellular events required to initiate and carefully regulate the persistence of inflammation at mucosal sites following exposure to infectious agents or allergens. In addition, the data provided herein identify a previously unrecognized role for Nmb as a negative regulator of type 2 cytokine responses that can be therapeutically used to treat various forms of allergic diseases and chronic inflammation, as well as other diseases.
[0095] III. Treatment Methods
[0096] Provided herein is a method for treating a disorder in a mammalian subject, such as an inflammatory disorder, such as an inflammatory disorder caused by type 2 cytokines. In some instances, the disorder is related to undesirable interleukin 5 (IL-5) and / or IL-13 activity. The example of such a disorder is provided in Table 1, and includes allergy, airway disorders (for example, asthma, sinusitis, idiopathic pulmonary fibrosis, rhinitis, eosinophilic granuloma with polyangiitis, eosinophilic esophagitis and COPD), skin disorders (for example, eczema, atopic dermatitis and urticaria) and eosinophilic disorders (for example, eosinophilic esophagitis, eosinophilic gastritis, eosinophilic gastroenteritis, eosinophilic enteritis, eosinophilic colitis, eosinophilic asthma, eosinophilic gastrointestinal disorders (EGID), eosinophilic fasciitis, EGPA, eosinophilic lung disease, high eosinophilic syndrome (HES) or eosinophilic leukemia). In one example, the disorder treated is Hodgkin's lymphoma. Thus, a mammalian subject, such as a human or veterinary subject, suffering from such a disorder can be treated with the disclosed methods.
[0097] Administration of a therapeutically effective amount of one or more Nmb or Nmc proteins, or one or more nucleic acid molecules encoding one or more Nmb or Nmc proteins, can (1) reduce inflammation (e.g., in the lungs or at the site of an allergic reaction), e.g., by at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75%, or at least 90% relative to no administration of the Nmb protein or nucleic acid molecule, (2) reduce IL-5 activity (e.g., nucleic acid or protein expression), e.g., in ILC2 and / or cells, e.g., by at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75%, or at least 90% relative to no administration of the Nmb protein or nucleic acid molecule, (3) reduce IL-13 activity (e.g., nucleic acid or protein expression), e.g., in ILC2 and / or cells, e.g., by at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75%, or at least 90% relative to no administration of the Nmb protein or nucleic acid molecule For example, a decrease of at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75% or at least 90% relative to no administration of Nmb protein or nucleic acid molecule, (4) a decrease in ILC2 and / or T cell response, such as the number of ILC2 and / or T cells present, proliferating and / or activated, such as a decrease of at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75% or at least 90% relative to no administration of Nmb protein or nucleic acid molecule, and / or (5) a decrease in eosinophilia (e.g., in the lungs or peripheral blood), such as a decrease of at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75% or at least 90% relative to no administration of Nmb protein or nucleic acid molecule, thereby treating the condition.
[0098] The disclosed method of treatment comprises administering to a subject a therapeutically effective amount of at least one neuromedin B (Nmb) protein or neuregulin C (Nmc) protein, or at least one nucleic acid molecule encoding at least one Nmb protein or Nmc protein, thereby treating a condition. The Nmb or Nmc protein (one or more) or nucleic acid molecule (one or more) may be present in a pharmaceutical composition, such as a pharmaceutical composition comprising saline or water.
[0099] Thus, in some instances, at least two different Nmb proteins are administered, e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10 different Nmb proteins (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, and 37). In some examples, at least one of the administered Nmb proteins has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% sequence identity to SEQ ID NO: 3, 4, 5, 6, 11, 12, 13, 14, 20, 22, 26, 27, 28, 29, 30, 31, 32, 35, 36, or 37. In some examples, at least one of the administered Nmb proteins has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% sequence identity to SEQ ID NO: 26, 27, 29, 35, or 36. In some examples, at least two Nmb proteins are administered, wherein (1) has at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% sequence identity to SEQ ID NO:3, 4, 5, 6, 11, 12, 13, 14, 20, 22, 26, 27, 28, 29, 30, 31, 32, 35, 36 or 37, and (2) has at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% sequence identity to SEQ ID NO:26, 27, 29, 35 or 36. In some examples, at least two Nmb proteins are administered, wherein (1) they have at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% sequence identity to SEQ ID NO:3, 4, 6, 7, 9, 10, 11, 12, 14, 15, 19, 21, 22, 26, 27, 28, 29, 30, 32, 34, 35, 36 or 37, and (2) they have at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% sequence identity to SEQ ID NO:3, 4, 5, 6, 9, 11, 12, 13, 14, 18, 19, 20, 21, 22, 23 (wherein the two Nmb proteins are different).In some examples, at least two Nmb proteins are administered, wherein (1) comprises or consists of SEQ ID NO: 1 and (2) comprises or consists of SEQ ID NO: 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37.
[0100] In some instances, the nucleic acid molecule encoding at least one Nmb protein encodes more than one Nmb protein, such as 2,3,4,5,6,7,8,9 or 10 different Nmb proteins. In some instances, the method includes using a variety of different nucleic acid molecules, each encoding at least one Nmb protein. The one or more nucleic acid molecules used can be a plasmid or viral vector, such as a part of a slow virus or adeno-associated virus vector. In addition, the one or more nucleic acid molecules used can be operably connected to a promoter, such as a constitutive promoter or other enhancer elements.
[0101] The exemplary mode of administration includes injection (for example, iv, im, ip or intradermal), oral administration, nasal administration, inhalation administration or topical administration. One or more doses can be administered, for example, at least two doses, at least 3 doses, at least 4 doses or at least 5 doses of therapeutically effective amount of at least one Nmb protein or Nmc protein or at least one nucleic acid molecule encoding at least one Nmb protein or Nmc protein. For example, the method can include at least two separate administrations, at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 1 month, at least 2 months, at least 3 months, at least 6 months, at least 9 months or at least one year. In some instances, administration is carried out within 5 minutes of the onset of symptoms, within 10 minutes, within 30 minutes, within 1 hour, within 2 hours, within 3 hours, within 4 hours, within 5 hours, within 6 hours, within 12 hours, within 24 hours, within 48 hours, within 72 hours, within 96 hours, within 1 week, within 2 weeks, within 3 weeks, within 4 weeks, within 1 month, within 2 months or within 3 months.
[0102] In some examples, at least one Nmb protein administered has at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% sequence identity to SEQ ID NO:1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37. In some examples, the at least one nucleic acid molecule administered encodes at least one Nmb protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37. In some examples, the at least one Nmb nucleic acid molecule administered encodes a sequence having at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 2, wherein the encoding sequence can be inserted into or be part of a vector. In some examples, the neuromedin C (Nmc) protein has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% sequence identity to SEQ ID NO: 38. In some examples, the nucleic acid molecule encodes a sequence that has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% sequence identity to SEQ ID NO: 38.
[0103] In some examples, the method includes administering to the subject a therapeutically effective amount of another therapeutic agent, such as one or more provided in Table 1. In one example, the method includes administering to the subject a therapeutically effective amount of PGE2.
[0104] Table 1: Exemplary Conditions and Additional Therapeutic Agents
[0105]
[0106]
[0107]
[0108]
[0109]
[0110] A.Neuromedin
[0111] Exemplary Nmb decapeptides are shown in SEQ ID NO: 1 (human), and variants thereof in SEQ ID NO: 3-37. In some examples, the Nmb protein comprises or consists of a protein sequence of SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37. An exemplary Nmb coding sequence is shown in SEQ ID NO: 2. In some examples, the Nmb nucleic acid sequence comprises or consists of a sequence of SEQ ID No: 2, which in some examples is part of a plasmid or vector, and in some examples is operably linked to a promoter (e.g., a constitutive promoter).
[0112] In one example, the disclosed method utilizes Nmb protein (e.g., mammalian Nmb protein), that is, Nmb protein is administered to a subject. Examples of such proteins are shown in SEQ ID NO: 1 (natural Nmb protein). Natural or variant Nmb proteins can be used. In one example, variant Nmb peptides are produced by manipulating Nmb nucleotide sequences. In some examples, variant Nmb sequences are used, such as Nmb sequences including one or more amino acid replacements, additions, deletions, or combinations thereof, as long as the protein retains the ability to reduce IL-5 activity, reduce IL-13 activity, reduce eosinophilia, reduce inflammation, reduce ILC2 responses, or combinations thereof. Exemplary methods for measuring IL-5 activity (e.g., measuring DNA or protein expression), IL-13 activity (e.g., measuring DNA or protein expression), eosinophilia, inflammation, and ILC2 responses are described herein. Nmb regions that are more likely to tolerate substitution can be determined by comparing sequences, wherein conservative amino acids between species are less likely to tolerate substitution, and amino acids that change at specific positions are more likely to tolerate substitution. In addition, alanine scanning and truncation scanning (see Example 7) can be utilized.
[0113] Variant Nmb protein, such as SEQ ID NO:1 variant, can include one or more mutations, such as single insertion, single deletion or single amino acid replacement. In some instances, the Nmb protein of mutation includes 1 to 5 insertions, 1 to 5 deletions, 1 to 5 replacements or any combination thereof (e.g., single insertion together with 1 to 5 replacements). In some instances, variant Nmb protein (e.g., SEQ ID NO:1) has 1,2,3,4 or 5 amino acid changes, such as 1,2,3,4 or 5 amino acid replacements (e.g., conservative amino acid replacements), 1,2,3,4 or 5 amino acid insertions, or 1,2 or 3 amino acid deletions, or a combination thereof. In some examples, SEQ ID NO:1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 has 1, 2, 3, 4 or 5 amino acid changes, such as 1, 2, 3, 4 or 5 amino acid insertions, 1, 2 or 3 amino acid deletions, 1, 2, 3, 4 or 5 amino acid substitutions or any combination thereof (e.g., 1 or 2 amino acid deletions together with 1, 2, 3, 4 or 5 amino acid substitutions). In one example, SEQ ID NO:1 includes amino acid substitutions at amino acids 1, 2, 3, 4, 10, such as alanine or conservative amino acid substitutions. In one example, SEQ ID NO: 1 includes 2, 3, 4 or 5 amino acid substitutions, such as alanine or conservative amino acid substitutions, at amino acids 1, 2, 3, 4 and / or 10. In one example, SEQ ID NO: 1 includes 1, 2, 3 or 4 amino acid deletions, such as at amino acids 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10, such as aa 5 and / or aa 7. In one example, SEQ ID NO: 1 includes 2, 3 or 4 consecutive amino acid deletions, such as at amino acids 1 and 2, 1-3, 1-4, 2-3, 2-4, 2-5, etc. In one example, SEQ ID NO: 1 includes amino acid substitutions, such as alanine or conservative amino acid substitutions, at amino acids 1, 2, 3, 4, 10, and 1 or 2 amino acid deletions at amino acids 5 and / or 7. In one example, SEQ ID NO: 1 includes a cap at the N or C terminus, such as a mesyl cap, NHMe, cap or OH cap.
[0114] A type of modification or mutation includes replacing amino acids with amino acid residues having similar biochemical properties, i.e. conservative substitutions (e.g., 1, 2, 3, 4, or 5 conservative substitutions). Typically, conservative substitutions have little effect on the activity of the resulting Nmb peptide. For example, conservative substitutions are SEQ ID NO:1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37 amino acid substitutions, which do not substantially affect the ability of the Nmb peptide to reduce IL-5 activity, reduce IL-13 activity, reduce eosinophilia, reduce inflammation, reduce ILC2 responses, or a combination thereof in mammals. Alanine scanning can be used to identify which amino acid residues in Nmb proteins, such as SEQ ID NO:1, can tolerate amino acid substitutions (see Example 7). In one example, when 1, 2, 3, 4 or 5 natural amino acids are replaced with alanine or other conservative amino acids, the activities of Nmb (e.g., SEQ ID NO: 1) are changed by no more than 25%, such as no more than 20%, such as no more than 10%. Examples of amino acids that can replace the original amino acids in the protein (e.g., Nmb) and are considered to be conservative replacements include: Ser replaces Ala; Lys replaces Arg; Gln or His replaces Asn; Glu replaces Asp; Ser replaces Cys; Asn replaces Gln; Asp replaces Glu; Pro replaces Gly; Asn or Gln replaces His; Leu or Val replaces Ile; Ile or Val replaces Leu; Arg or Gln replaces Lys; Leu or Ile replaces Met; Met, Leu or Tyr replaces Phe; Thr replaces Ser; Ser replaces Thr; Tyr replaces Trp; Trp or Phe replaces Tyr; and Ile or Leu replaces Val.
[0115] More substantial changes can be made by using less conservative substitutions, such as selecting residues that differ more significantly in their effect on maintaining: (a) the structure of the polypeptide backbone in the area of the substitution, such as a sheet or helical configuration; (b) the charge or hydrophobicity of the polypeptide at the target site; or (c) the bulk of the side chain. Substitutions that are generally expected to produce the greatest changes in polypeptide function are those in which: (a) a hydrophilic residue, such as serine or threonine, is substituted for (or replaced by) a hydrophobic residue, such as leucine, isoleucine, phenylalanine, valine, or alanine; (b) a cysteine or proline is substituted for (or replaced by) any other residue; (c) a residue with a positively charged side chain, such as lysine, arginine, or histidine, is substituted for (or replaced by) a negatively charged residue, such as glutamic acid or aspartic acid; or (d) a residue with a bulky side chain, such as phenylalanine, is substituted for (or replaced by) a residue without a side chain, such as glycine. The effects of these amino acid substitutions (or other deletions or additions) can be evaluated by analyzing the function of the Nmb protein (e.g., SEQ ID NO: 1), by analyzing the ability of the variant Nmb protein to reduce IL-5 activity, reduce IL-13 activity, reduce eosinophilia, reduce inflammation, reduce ILC2 response, or a combination thereof in a mammal.
[0116] In some examples, the Nmb protein (e.g., SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37) or Nmc protein (e.g., SEQ ID NO: 38) used in the disclosed method or composition is PEGylated at one or more positions. In some examples, the Nmb protein or Nmc protein used in the disclosed method or composition includes an immunoglobulin FC domain. The conservative FC fragment of the antibody can be incorporated into the N-terminal or C-terminal of the Nmb protein or Nmc protein, and the stability of the protein can be enhanced and thus the serum half-life can be enhanced. The FC domain can also be used as a means of purifying the protein on protein A or protein G agarose beads.
[0117] Nmb protein (e.g., SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37) or Nmc protein (e.g., SEQ ID NO: 38) can be labeled with a cell penetrating peptide (CPP) to promote cellular uptake. Thus, in some instances, the Nmb protein or Nmc protein used is a fusion protein comprising (1) an Nmb protein or an Nmc protein, and (2) a cell penetrating peptide. The cell penetrating peptide can be at the N or C terminus of the Nmb or Nmc protein. Cell penetrating peptides are typically short peptides (40 amino acids or less) that are highly cationic and are typically rich in arginine and lysine, which can promote cellular uptake / protein uptake.Exemplary cell-penetrating peptides that can be used include hydrophilic peptides (e.g., TAT [YGRKKRRQRRR; SEQ ID NO:57], SynB1 [RGGRLSYSRRRFSTSTGR; SEQ ID NO:39], SynB3 [RRLSYSRRRF; SEQ ID NO:40], PTD-4 [PIRRRKKLRRLK; SEQ ID NO:41], PTD-5 [RRQRRTSKLMKR; SEQ ID NO:42], FHV Coat-(35-49) [RRRRNRTRRNRRRVR; SEQ ID NO:43], BMV Gag-(7-25) [KMTRAQRRAAARRNRWTAR; SEQ ID NO:44], HTLV-II Rex-(4-16) [TRRQRTRRARRNR; SEQ ID NO:45], D-Tat [GRKKRRQRRRPPQ; SEQ ID NO:46], R9-TatGRRRRRRRRRPPQ [SEQ ID NO:47] and penetratin [RQIKWFQNRRMKWKK; SEQ ID NO:48]), amphiphilic polypeptides (e.g., MAP [KLALKLALKLALALKLA; SEQ ID NO:49], SBP [MGLGLHLLVLAAALQGAWSQPKKKRKV; SEQ ID NO:50], FBP [GALFLGWLGAAGSTMGAWSQPKKKRKV; SEQ ID NO:51], MPG ac-GALFLGFLGAAGSTMGAWSQPKKKRKV-cya; SEQ ID NO:52], MPG(ΔNLS) [ac-GALFLGFLGAAGSTMGAWSQPKSKRKV-cya; SEQ ID NO:53], Pep-2 [ac-KETWFETWFTEWSQPKKKRKV-cya; SEQ ID NO:54] and transportan [GWTLNSAGYLLGKINLKALAALAKKIL; SEQ ID NO:55]), cyclic sequences (e.g., pVec, polyarginine RxN (4 < N < 17) chimeras, polylysine KxN (4 < N < 17) chimeras, (RAca)6R, (RAbu)6R, (RG)6R, (RM)6R, (RT)6R, (RS)6R, R10, (RA)6R, R7 and pep-1 [ac-KETWWETWWTEWSQPKKKRKV-cya; SEQ ID NO:56), Cr10 (cyclic poly-arginine CPP), TAT. 48-57 , TAT 47-57 or TAT49-57 ; transmembrane peptide; Pep-1; substance P, SP; polyarginine, such as R5-R12; pVEC; transporter; MAP; diatos peptide vector 1047, DPV1047, MPG; ADP-ribosylation factor, ARF, such as ARF 1-22 ; BPrPr (e.g. BPrPr 1-28 ); p28; VT5; Bac 7, for example Bac 1-24 ; C105Y; PFVYLI (SEQ ID NO:58); and Pep-7.
[0118] The Nmb protein (e.g., SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37) or the Nmc protein (e.g., SEQ ID NO: 38) can include an N-terminal cap, such as formyl, acetyl, acyl of 2-18 carbons, aryl acyl (such as benzoyl), heteroaryl acyl (such as 2-acetylpyridine), carbamate (such as tert-butylcarbamate), succinyl, alkyl or aryl sulfonamide and / or a C-terminal group, such as amides, acids, aldehydes and esters (aryl, alkyl, heteroaryl, heteroalkyl, such as 2 to 20 repeating units of polyethylene glycol).
[0119] B. Protein production
[0120] Isolation and purification of recombinantly expressed Nmb or Nmc proteins can be performed by conventional methods, such as preparative chromatography and immunoseparation. Once expressed, Nmb or Nmc proteins can be purified according to standard procedures, including ammonium sulfate precipitation, affinity columns, column chromatography, etc. (see generally R.Scopes, Protein Purification, Springer-Verlag, NY, 1982). Substantially pure compositions having at least about 90 to 95% homogeneity are disclosed herein, and 98 to 99% or higher homogeneity can be used for pharmaceutical purposes.
[0121] In addition to recombinant methods, standard peptide synthesis can also be used to construct all or part of Nmb or Nmc proteins (or variants thereof as described above). In one example, Nmb or Nmc proteins are synthesized by condensation of the amino and carboxyl termini of shorter fragments. Peptide bonds can be formed by activating the carboxyl termini (e.g., by using a coupling agent N, N'-diylhexylcarbodiimide).
[0122] C. Protein modification
[0123] The Nmb peptides that can be used in the disclosed methods and compositions include synthetic embodiments of the Nmb peptides described herein. In addition, analogs (non-peptide organic molecules), derivatives (chemically functionalized peptide molecules obtained from the disclosed peptide sequences) and variants (homologues) of these peptides can be used in the methods described herein. Each Nmb peptide Nmc peptide of the present disclosure comprises naturally occurring and otherwise existing amino acid sequences, which can be L- and / or D-amino acids.
[0124] Nmb and Nmc peptides can be modified by a variety of chemical techniques to produce derivatives having substantially the same activity as unmodified Nmb and Nmc peptides and optionally having other desired properties. For example, the carboxylic acid group of the peptide, whether the carboxyl terminus or the side chain, can be provided in the form of a salt of a pharmaceutically acceptable cation or be esterified to form a C 1 -C 16 Esters, or converted to formula NR 1 R 2 An amide, wherein R 1 and R 2 Each independently is H or C 1 -C 16 The amino group of the peptide, whether the amino terminal or the side chain, can be in the form of a pharmaceutically acceptable acid addition salt, such as HCl, HBr, acetic acid, benzoic acid, toluenesulfonic acid, maleic acid, tartaric acid and other organic salts, or can be modified to C 1 -C 16 Alkyl or dialkylamino groups may be further converted to amides to incorporate certain bonding functions of the ligand molecule.
[0125] The hydroxyl groups of the peptide side chains can be converted to C 1 -C 16 Alkoxy or C 1 -C 16 The side chains of the peptides may be esterified to introduce hydrophobic properties into the peptides. Alternatively, the hydroxyl groups may be sulfated or phosphorylated to introduce negative charges and increase water solubility. Alternatively, the side chain hydroxyl groups or / and the asparagine and / or aspartic acid side chains may be glycosylated, such as serine / threonine glycopeptides or N-acetyl glycopeptides, which may modulate the properties of the peptides. The phenyl and phenol rings of the peptide side chains may be substituted with one or more halogen atoms, such as fluorine, chlorine, bromine or iodine, or with C 1 -C 16 Alkyl, C 1 -C 16 The methylene group of the peptide side chain may be extended to a homologous C 2 -C 4Alkylene. Thiols can be protected with any of a number of recognized protecting groups, such as an acetamide group. Thiols can be reacted with maleimides or disulfides.
[0126] Embodiments of peptoids and pseudo-organics are envisioned, whereby the three-dimensional arrangement of the chemical components of such peptoids and pseudo-organics simulates the three-dimensional arrangement of the peptide backbone and the component amino acid side chains, resulting in such peptoids and pseudo-organics of Nmb or Nmc peptides having a measurable or enhanced ability to reduce type 2 cytokine production and inflammation caused. For computer modeling applications, the pharmacophore is an ideal three-dimensional definition of the structural requirements for biological activity. Peptoids and pseudo-organics can be designed using computer modeling software (using computer-aided drug design or CADD) to fit each pharmacophore. For a description of the techniques used in CADD, see Walters, "Computer-Assisted Modeling of Drugs," in Klegerman & Groves, eds., 1993, Pharmaceutical Biotechnology, Interpharm Press: Buffalo Grove, IL, pp. 165174 and Principles of Pharmacology, Munson (ed.) 1995, Ch. 102. Also included are mimetics prepared using such techniques.
[0127] In some examples, the Nmb protein (e.g., SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37) or Nmc protein (e.g., SEQ ID NO: 38) used in the disclosed methods or compositions includes one or more modified amino acids (e.g., 1, 2, 3, 4 or 5 modified amino acids). Exemplary Nmb or Nmc peptides are derived peptides that can be modified by glycosylation, pegylation, phosphorylation or any similar process that retains at least one biological function of the peptide from which it is derived (e.g., reducing IL-5 activity, reducing IL-13 activity, reducing eosinophilia, reducing inflammation, reducing ILC2 response or a combination thereof). Nmb or Nmc peptides can also include one or more non-naturally occurring amino acids. For example, non-classical amino acids or chemical amino acid analogs can be introduced as replacements or additions into Nmb peptides (e.g., SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) or Nmc peptides (e.g., SEQ ID NO: 38). Non-classical amino acids include but are not limited to D-isomers of common amino acids, 2,4-diaminobutyric acid, α-aminoisobutyric acid, 4-aminobutyric acid, Abu, 2-aminobutyric acid, γ-Abu, ε-Ahx, 6-aminocaproic acid, Aib, 2-aminoisobutyric acid, 3-aminopropionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, homocitrulline, cysteic acid, tert-butylglycine, tert-butylalanine, phenylglycine, cyclohexylalanine, β-alanine, fluoroamino acids, designer amino acids such as β-methyl amino acids, Cα-methyl amino acids, Nα-methyl amino acids and common amino acid analogs. In addition, amino acids can be D (dextral) or L (levorotatory). In other specific examples, branched forms of the Nmb peptides and Nmc peptides listed herein are provided, for example, by replacing one or more amino acids in the sequence with an amino acid or amino acid analog having a free side chain that can form a peptide bond (therefore being able to form a "branch") using one or more amino acids. Cyclic peptides are also contemplated.
[0128] Also included are peptide derivatives that are differentially modified during or after synthesis, for example by benzylation, glycosylation, acetylation, phosphorylation, amidation, pegylation, derivatization by protecting / blocking groups, proteolytic cleavage, attachment to antibody molecules or other cellular ligands, etc. In specific embodiments, the Nmb peptide (e.g., SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) or the Nmc peptide (e.g., SEQ ID NO: 38) is acetylated at the N-terminus and / or amidated at the C-terminus. In one example, the Nmb peptide (e.g., SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) or Nmc peptide (e.g., SEQ ID NO: 38) includes a carboxyl terminal amide.
[0129] Peptoids are compounds based on or derived from peptides and proteins. Peptoids can be obtained by structural modification of known peptide sequences using unnatural amino acids, conformational restrictions, isosteric substitutions, etc. The peptoids of the present invention constitute a continuum of structural space between peptides and non-peptide synthetic structures; therefore, peptoids can be used to describe pharmacophores and facilitate the conversion of peptides into non-peptide compounds with the activity of the parent peptide.
[0130] Other mimetics of Nmb peptides (e.g., SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) or Nmc peptides (e.g., SEQ ID NO: 38) are included in the present disclosure. Such mimetics can have properties such as being non-hydrolyzable (e.g., increased stability to proteases or other physiological conditions that degrade the peptide).For illustrative purposes, peptide analogs can be generated using, for example, benzodiazepines (e.g., see Freidinger et al. in Peptides: Chemistry and Biology, GR Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988), substituted lactam rings (Garvey et al. in Peptides: Chemistry and Biology, GR Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988, p123), C-7 mimetics (Huffman et al. in Peptides: Chemistry and Biology, GR Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988, p. 105), ketomethylene pseudopeptides (Ewenson et al. (1986) J Med Chem 29:295; and Ewenson et al. in Peptides: Structure and Function (Proceedings of the 9th American Peptide Symposium) Pierce Chemical Co. Rockland, Ill., 1985), β-turn dipeptide core (Nagai et al. (1985) Tetrahedron Lett 26:647; and Sato et al. (1986) J Chem Soc Perkin Trans 1:1231), β-amino alcohols (Gordon et al. (1985) Biochem Biophys Res Commun 126:419; and Dann et al. (1986) Biochem Biophys Res Commun 134:71), diaminoketones (Natarajan et al. (1984) Biochem Biophys Res Commun 124:141) and methyleneamino modifications (Roark et al. in Peptides: Chemistry and Biology, GR Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988, p134).See also generally Session III: Analytic and synthetic methods, in Peptides: Chemistry and Biology, GR Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988).
[0131] In addition to the various side chain substitutions that can be performed to generate peptoids, the present disclosure also contemplates the use of conformationally constrained mimetics of peptide secondary structures. Alternatives to the amide bonds of peptides have been developed. Common alternatives to amide bonds include the following groups (i) trans-olefins, (ii) fluoroolefins, (iii) methyleneamino, (iv) phosphoramides and (v) sulfonamides. In addition, peptoids based on a larger amount of modifications of the peptide backbone can be used. Peptoids belonging to this class include (i) retro-inverse analogs, and (ii) N-alkylglycine analogs (so-called peptoids). In addition, combinatorial chemistry methods can be used to produce peptoids. For example, one embodiment of the so-called "peptide deformation" strategy focuses on randomly generating a library of peptide analogs containing a large number of peptide bond substitutes. In an exemplary embodiment, a peptidomimetic of an Nmb peptide (e.g., SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) or an Nmc peptide (e.g., SEQ ID NO: 38) can be derived as a retro-inverse analog of the peptide. Such retro-inverse analogs can be prepared according to known methods, such as the methods described in Sisto et al. U.S. Pat. No. 4,522,752. Retro-inverse analogs can be produced as described in, for example, PCT Publication No. WO 00 / 01720. Hybrid peptides can be produced, such as hybrid peptides containing some normal peptide bonds. As a general guide, the sites most sensitive to proteolysis are usually changed, while less sensitive amide bonds are optional for mimetic conversion. The final product or its intermediates may be purified.
[0132] Nmb peptide (e.g., SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) or Nmc peptide (e.g., SEQ ID NO: 38) may include at least one amino acid or each amino acid that is a D stereoisomer. Nmb peptide or Nmc peptide may include at least one reversed amino acid. The reversed amino acid may be a D stereoisomer. Each amino acid of the peptide may be reversed and / or each amino acid may be a D stereoisomer. In another exemplary embodiment, the peptidomimetic may be derived as a reverse enantiomer analog of the peptide. Such reverse enantiomer analogs can be synthesized using commercially available D-amino acids (or their analogs) and standard solid phase or solution phase peptide synthesis techniques, such as described in PCT Publication No. WO 00 / 01720. The final product can be purified by HPLC to produce pure reverse enantiomer analogs. In another illustrative embodiment, trans-olefin derivatives of the subject peptide can be prepared. Trans-olefin analogs can be synthesized according to YK Shue et al. (1987) Tetrahedron Letters 28: 3225 and the methods described in PCT Publication WO 00 / 01720. Pseudo-dipeptides synthesized by the above method can also be coupled with other pseudo-dipeptides to prepare peptide analogs having several olefin functional groups replacing amide functional groups. Another class of peptidomimetic derivatives includes phosphonate derivatives. The synthesis of such phosphonate derivatives can be modified according to known synthetic schemes (see, for example, Loots et al. in Peptides: Chemistry and Biology, (Escom Science Publishers, Leiden, 1988, p. 118)); Petrillo et al. in Peptides: Structure and Function (Proceedings of the 9th American Peptide Symposium, Pierce Chemical Co. Rockland, Ill., 1985).
[0133] Other peptoid structures are known and can be readily adapted to the subject peptoids. For example, peptoids can incorporate 1-azabicyclo[4.3.0]nonane surrogates (see Kim et al. (1997) J.Org.Chem.62:2847), or N-acylpiperazinic acids (see Xi et al. (1998) J.Am.Chem.Soc.120:80) or 2-substituted piperazine moieties as constrained amino acid analogs (see Williams et al. (1996) J.Med.Chem.39:1345-1348). In other embodiments, certain amino acid residues of Nmb peptides (e.g., SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) or Nmc peptides (e.g., SEQ ID NO: 38) may be substituted with aryl and biaryl moieties, such as monocyclic or bicyclic aromatic or heteroaromatic cores, or biaromatic, aromatic-heteroaromatic, or biheteroaromatic cores. The subject peptoids may be optimized, for example, by combinatorial synthesis techniques in conjunction with high throughput screening. In addition, other examples of peptoids include, but are not limited to, protein-based compounds, carbohydrate-based compounds, lipid-based compounds, nucleic acid-based compounds, natural organic compounds, synthetically derived organic compounds, anti-idiotypic antibodies, and / or catalytic antibodies or fragments thereof. For example, a pseudo-position can be obtained by screening a library of natural and synthetic compounds for compounds that can inhibit fibrosis. It is also possible, for example, to obtain a pseudo-position from a library of natural and synthetic compounds, particularly a chemical or combinatorial library (e.g., a library of compounds that are different in sequence or size but have the same structural unit). The pseudo-position can also be obtained by, for example, rational drug design. In a rational drug design program, the three-dimensional structure of the compound of the invention can be analyzed by, for example, nuclear magnetic resonance (NMR) or X-ray crystallography. Then, the three-dimensional structure can be used to predict the structure of a potential pseudo-position by, for example, computer modeling. The predicted pseudo-position structure can then be generated by, for example, chemical synthesis, recombinant DNA technology, or by isolating the pseudo-position from a natural source (e.g., plants, animals, bacteria, and fungi).
[0134] D. Neuromedin nucleic acid molecules and vectors
[0135] An exemplary Nmb coding sequence is shown in SEQ ID NO:2. In some instances, the Nmb nucleic acid molecule encoding Nmb includes or consists of the sequence of SEQ ID NO:2. In some instances, the Nmb nucleic acid molecule encodes a protein of SEQ ID NO:1, or a variant thereof (e.g., those described above). In some instances, the Nmb nucleic acid sequence includes or consists of SEQ ID NO:2, which is a part of a plasmid or vector in some instances, and is operably connected to a promoter (e.g., a constitutive promoter) in some instances.
[0136] In one example, the disclosed method utilizes Nmb nucleic acid sequence or Nmc nucleic acid sequence (e.g., cDNA, genome or RNA sequence), i.e., Nmb or Nmc nucleic acid molecules are administered to a subject, and the encoded Nmb or Nmc protein is expressed in the cell into which the nucleic acid molecules are introduced. As described above, Nmb or Nmc nucleic acid molecules can encode natural or variant Nmb or Nmc proteins.
[0137] Based on the genetic code, a nucleic acid sequence encoding any Nmb protein (e.g., SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37) or Nmc protein (e.g., SEQ ID NO: 38) can be generated. In some examples, such sequences are optimized to be expressed in a host cell (e.g., a host cell for expressing Nmb or Nmc protein). Such nucleic acids can be used directly (e.g., administered to a subject), or used to produce an Nmb or Nmc protein administered to a subject.
[0138] In one example, the nucleic acid molecule encoding the Nmb protein comprises or consists of the sequence of SEQ ID NO: 2. Also provided are cells, plasmids and viral vectors comprising such nucleic acids, which may also include a promoter operably linked to the Nmb or Nmc coding sequence.
[0139] In one example, the nucleic acid sequence encoding the Nmb protein has at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 99% or at least 99% sequence identity with SEQ ID NO:2. Using the amino acid sequence and genetic code provided herein, such sequences can be easily produced. In addition, the technician can easily construct various clones comprising functionally equivalent nucleic acids, such as nucleic acids with different sequences but the same Nmb protein sequence encoded therein.
[0140] Nucleic acid molecules include DNA, cDNA, mRNA and RNA sequences encoding Nmb or Nmc proteins. Silent mutations in coding sequences are produced by the degeneracy (i.e., redundancy) of the genetic code, whereby more than one codon can encode the same amino acid residue. Thus, for example, leucine can be encoded by CTT, CTC, CTA, CTG, TTA or TTG; serine can be encoded by TCT, TCC, TCA, TCG, AGT or AGC; asparagine can be encoded by AAT or AAC; aspartic acid can be encoded by GAT or GAC; cysteine can be encoded by TGT or TGC; alanine can be encoded by GCT, GCC, GCA or GCG; glutamine can be encoded by CAA or CAG; tyrosine can be encoded by TAT or TAC; and isoleucine can be encoded by ATT, ATC or ATA. Tables showing standard genetic codes can be found in various sources (see, e.g., Stryer, 1988, Biochemistry, 3 rd Edition, WH5 Freeman and Co., NY).
[0141] The codon preference and codon usage table of a particular species can be used to engineer an isolated nucleic acid molecule encoding an Nmb protein (e.g., one encoding a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) or an Nmc protein (e.g., one encoding a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% sequence identity to SEQ ID NO: 38) using the codon usage preference of that particular species. For example, the Nmb proteins used in the disclosed methods can be designed to have codons that are preferentially used by a particular target organism (eg, human or mouse).
[0142] A nucleic acid molecule encoding an Nmb protein (e.g., a nucleic acid molecule having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 2, or encoding a nucleic acid molecule having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 2 NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity) or a Nmc protein (e.g., encoding a protein having a sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity) NO:38 A nucleic acid having a protein with at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity can be cloned or amplified by in vitro methods, such as polymerase chain reaction (PCR), ligase chain reaction (LCR), transcription-based amplification system (TAS), self-sustaining sequence replication system (3SR) and Qβ replicase amplification system (QB).In addition, a nucleic acid molecule encoding an Nmb protein (e.g., having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 2, or encoding a nucleic acid molecule encoding an Nmb protein (e.g., having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 2 NO: 1, 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity) or a Nmc protein (e.g., encoding a protein having a sequence identity to SEQ ID NO: 1, 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity) NO:38 has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity) nucleic acid can be prepared by cloning techniques (for example, those found in Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring, Harbor, NY, 1989, and Ausubel et al., (1987) in "Current Protocols in Molecular Biology," John Wiley and Sons, New York, NY).
[0143] A nucleic acid molecule encoding an Nmb protein (e.g., a nucleic acid molecule having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 2, or encoding a nucleic acid molecule having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 2 NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity) or a Nmc protein (e.g., encoding a protein having a sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity) NO:38) can be prepared by any suitable method, including, for example, cloning the appropriate sequence, or by the phosphotriester method such as Narang et al., Meth. Enzymol. 68:90-99, 1979; Brown et al., Meth. Enzymol. 68:109-151, 1979; Beaucage et al., Meth. Enzymol. 68:109-151, 1979; al., Tetra. Lett. 22: 1859-1862, 1981; direct chemical synthesis by the solid phase phosphoramidite triester method described by Beaucage & Caruthers, Tetra. Lett. 22 (20): 1859-1862, 1981, for example, using an automated synthesizer as described, for example, in Needham-Van Devanter et al., Nucl. Acids Res. 12: 6159-6168, 1984; and the solid support method of U.S. Pat. No. 4,458,066. Chemical synthesis produces single-stranded oligonucleotides. They can be converted into double-stranded DNA by hybridization with a complementary sequence, or by polymerization using a DNA polymerase using a single strand as a template.
[0144] In one example, an Nmb protein (e.g., one having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) or an Nmc protein (e.g., one having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, NO:38 has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity) by inserting a cDNA encoding an Nmb protein (e.g., a nucleic acid molecule having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:2) or an Nmc protein into a vector. The insertion can be performed so that the Nmb or Nmc protein is read in frame, thereby producing the Nmb or Nmc protein.
[0145] Nmb nucleic acid coding sequence (e.g., a nucleic acid molecule having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:2, or encoding a nucleic acid molecule having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:2 NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity) or a Nmc nucleic acid sequence (e.g., encoding a protein having a sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 NO:38 has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity of a protein) can be inserted into an expression vector, the expression vector includes but is not limited to plasmids, viruses or other solvents, which can be manipulated to allow insertion or incorporation of sequences and can be expressed in prokaryotes or eukaryotes. Hosts can include microorganisms, yeast, insects, plants and mammalian organisms. The vector can encode a selection marker, such as a thymidine kinase gene, an antibiotic resistance gene or a fluorescent protein.
[0146] A nucleic acid molecule encoding an Nmb protein (e.g., a nucleic acid molecule having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 2, or encoding a nucleic acid molecule having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 2 NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity) or a Nmc protein (e.g., encoding a protein having a sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity) NO:38 has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity of a protein) nucleotide sequence can be operably connected to the expression control sequence. The expression control sequence operably connected to the Nmb or Nmc protein coding sequence is connected so that the expression of the Nmb or Nmc coding sequence is achieved under conditions compatible with the expression control sequence. Exemplary expression control sequences include, but are not limited to, promoters, enhancers, transcription terminators, Nmb or Nmc protein coding gene before the start codon (that is, ATG), intronic splicing signals, maintaining the correct reading frame of the gene to allow correct translation of mRNA and termination codons.
[0147] In one embodiment, the vector is used for expression in yeast, such as S. cerevisiae, P. pastoris, or Kluyveromyces lactis. Exemplary promoters for yeast expression systems include constitutive promoters, plasma membrane H +-ATPase (PMA1), glyceraldehyde-3-phosphate dehydrogenase (GPD), phosphoglycerate kinase-1 (PGK1), alcohol dehydrogenase-1 (ADH1) and pleiotropic drug resistance pump (PDR5). In addition, inducible promoters such as GAL1-10 (induced by galactose), PHO5 (induced by low extracellular inorganic phosphate) and tandem heat shock HSE elements (induced by temperature increase to 37°C) can also be used. Promoters that direct variable expression in response to titratable inducers include methionine-responsive MET3 and MET25 promoters and copper-dependent CUP1 promoter. Any of these promoters can be cloned into multi-copy (2μ) or single-copy (CEN) plasmids to provide additional levels of expression level control. Plasmids can include nutritional markers for selection in yeast (e.g., URA3, ADE3, HIS1, etc.), as well as antibiotic resistance (AMP) for propagation in bacteria. Plasmids for expression in K. lactis are known, for example pKLAC1. Thus, in one example, after amplification in bacteria, the plasmid can be introduced into the corresponding yeast auxotrophic form by methods similar to bacterial transformation. Encoding Nmb protein (e.g., one having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with SEQ ID NO: 2, or encoding a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with SEQ ID NO: 2) ... NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity) or an Nmc protein (e.g., encoding a protein having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10 NO:38) a nucleic acid sequence having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity can also be designed to be expressed in insect cells.
[0148] 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity) or an Nmc protein (e.g., one having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity) to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity) NO:38 has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity) can be expressed in yeast strains. For example, seven pleiotropic drug resistance transporters YOR1, SNQ2, PDR5, YCF1, PDR10, PDR11 and PDR15 and their activating transcription factors PDR1 and PDR3 are simultaneously deleted in yeast host cells, thereby making the resulting strain sensitive to drugs. Yeast strains with altered lipid composition of the plasma membrane can also be used, such as erg6 mutants defective in ergosterol biosynthesis. Proteins that are highly sensitive to proteolysis can be expressed in yeast cells lacking the main vacuolar endopeptidase Pep4, which controls the activation of other vacuolar hydrolases. If the corresponding null mutant cannot survive, heterologous expression in strains carrying temperature-sensitive (ts) alleles of the gene can be used.
[0149] Viral vectors can also be prepared that encode Nmb proteins (e.g., those comprising nucleic acid molecules having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 2, or encoding nucleic acid molecules having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 2). ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity) or a nucleic acid molecule encoding a protein having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10 NO:38 has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity). Exemplary viral vectors include polyoma, SV40, adenovirus, vaccinia virus, adeno-associated virus (AAV), herpes virus (including HSV and EBV), Sindbis virus, alphavirus, and avian, murine and human retroviruses. Baculovirus (Autographa californica multinuclear polyhedrosis virus; AcMNPV) vectors can also be used. Other suitable vectors include retroviral vectors, orthopox vectors, fowlpox vectors, fowlpox vectors, sheeppox vectors, swinepox vectors, adenovirus vectors, herpesvirus vectors, alphavirus vectors, baculovirus vectors, Sindbis virus vectors, vaccinia virus vectors and poliovirus vectors. Specific exemplary vectors are poxvirus vectors, such as cowpox virus, fowlpox virus and highly attenuated cowpox virus (MVA), adenovirus, baculovirus, etc. Poxviruses used include orthopoxvirus, swinepox virus, fowlpox virus and sheeppox virus. Orthopox includes cowpox, mousepox and raccoonpox. An example of using orthopox is cowpox. Fowlpox includes fowlpox, canarypox and pigeonpox. Sheeppox includes goatpox and sheeppox. In one example, suipox is swinepox. Other viral vectors that can be used include other DNA viruses, such as herpes virus and adenovirus, and RNA viruses, such as retrovirus and polio.
[0150] Encoding Nmb protein (e.g., those including nucleic acid molecules having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:2, or encoding a nucleic acid molecule having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:2 NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity) or a nucleic acid molecule encoding a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 IDNO:38 has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity protein nucleic acid molecule) virus vector can include at least one expression control element operably connected with the nucleic acid sequence encoding Nmb protein or Nmc protein. The expression control element is inserted into the vector to control and regulate the expression of the nucleic acid sequence. The example of the expression control element used in these vectors includes but is not limited to the lac system, the operator and promoter region of bacteriophage λ, yeast promoter and the promoter derived from polyoma virus, adenovirus, retrovirus or SV40. Other operating elements include but are not limited to the appropriate transcription of the nucleic acid sequence encoding Nmb protein in the leader sequence, stop codon, polyadenylation signal and the host system and any other sequence necessary for subsequent translation. The expression vector can be included in the host system to transfer and subsequently replicate the expression vector containing the nucleic acid sequence necessary for other elements. The example of such elements includes but is not limited to replication origin and selectable marker. Such vectors can be constructed using conventional methods (Ausubel et al., (1987) in "Current Protocols in Molecular Biology," John Wiley and Sons, New York, NY) and are commercially available.
[0151] In one example, a nucleic acid molecule encoding an Nmb protein (e.g., comprising nucleic acid molecules having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 2, or a nucleic acid molecule encoding a nucleic acid ... NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity) or a Nmc protein (e.g., encoding a protein having a sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity) NO:38 has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity of the protein nucleic acid molecule) the viral vector is a lentivirus or AAV vector, and includes a promoter operably connected to the Nmb coding sequence. In some instances, the promoter is a constitutive promoter, such as CMV, β-actin or T7, or a tissue-specific promoter, such as a lung-specific promoter (e.g., lung-specific surfactant protein B gene promoter, SP-B promoter, or CC10 promoter) or a skin-specific promoter (e.g., kerain 14 promoter, filamentous protein promoter or transglutaminase 3 promoter).
[0152] Preparation of nucleic acid molecules encoding Nmb protein (e.g., those comprising nucleic acid molecules having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 2, or encoding a nucleic acid molecule having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 2) NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity) or a Nmc protein (e.g., encoding a protein having a sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity) NO:38 has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity of the nucleic acid molecule of the protein) of the heterologous DNA sequence of recombinant virus is known. Such technology relates to, for example, the homologous recombination between the viral sequence flanking the Nmb or Nmc coding sequence in the donor plasmid and the homologous sequence present in the parental virus. The vector can be constructed to insert the heterologous DNA, for example, by using a unique restriction endonuclease site naturally present or artificially inserted into the parental viral vector.
[0153] When the cell into which the Nmb or Nmc coding sequence is introduced is a eukaryotic cell, the transfection method includes calcium phosphate coprecipitation, mechanical procedures (e.g., microinjection, electroporation, insertion of a plasmid encapsulated in liposomes) or viral vectors. Eukaryotic cells can also be transfected with a nucleic acid molecule encoding an Nmb protein (e.g., comprising those of the following nucleic acid molecules: a nucleic acid molecule having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 2, or a nucleic acid molecule encoding a protein ... NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity) or a Nmc protein (e.g., encoding a protein having a sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity) NO:38 has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity of the protein of nucleic acid molecule) polynucleotide sequence, and the second exogenous DNA molecule encoding the optional phenotype, such as herpes simplex thymidine kinase gene co-transformation. Another method is to use eukaryotic virus vectors, such as simian virus 40 (SV40) or bovine papilloma virus, to transiently infect or transform eukaryotic cells and express proteins (see, for example, Eukaryotic Viral Vectors, Cold Spring Harbor Laboratory, Gluzman ed., 1982). Expression systems (such as plasmids and vectors) can be used to produce Nmb proteins in cells (including higher eukaryotic cells, such as COS, CHO, HeLa and myeloma cell lines).
[0154] E. Administration and Dosing
[0155] Depending on the particular mode of administration selected, the composition comprises an Nmb protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) or an Nmc protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, ID NO:38 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity) or encoding an Nmb protein (e.g., a nucleic acid molecule having at least 50%, at least 60%, at least 70%, at least 80%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:2, or encoding an Nmb protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:38, or encoding an Nmb protein (e.g., a nucleic acid molecule having at least 50%, at least 60%, at least 70%, at least 80%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity) or a Nmc protein (e.g., encoding a protein having a sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity) NO:38 has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity) of the nucleic acid of the pharmaceutical composition can be prepared with suitable pharmaceutically acceptable carrier (such as water or saline). Such compositions can be used to the experimenter suffering from neurological disorder using disclosed method.In an example, the pharmaceutical composition is suitable for injection, for example, is injected into skin, vein or muscle.
[0156] In some embodiments, the pharmaceutical composition consists essentially of an Nmb protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37), an Nmc protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, NO:38 has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity), or encodes an Nmb protein (e.g., a nucleic acid molecule having at least 50%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:2, or encodes an Nmb protein (e.g., a nucleic acid molecule having at least 50%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:38), or encodes an Nmb protein (e.g., a nucleic acid molecule having at least 50%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:2 ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity) or a nucleic acid molecule encoding a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 NO:38 has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity of the protein nucleic acid molecule) nucleic acid, and pharmaceutically acceptable carrier composition. In these embodiments, do not include other therapeutically effective agents in the composition.
[0157] In other embodiments, the pharmaceutical composition comprises an Nmb protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37), an Nmc protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, ID NO:38 has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity), or encodes an Nmb protein (e.g., a nucleic acid molecule having at least 50%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID No:2, or encodes an Nmb protein having at least 50%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID No:38), or encodes an Nmb protein (e.g., a nucleic acid molecule having at least 50%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID No:2 ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity), or a Nmc protein (e.g., encoding a protein having a sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity). NO:38 has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity of the protein nucleic acid molecule) nucleic acid, and pharmaceutically acceptable carrier.Other therapeutic agents can be included, such as for treating the reagent (such as the illness shown in Table 1) of the inflammatory disorder caused by Type 2 cytokines.Therefore, pharmaceutical composition can include another reagent of therapeutically effective amount.The example of such reagent includes but is not limited to PGE2, those listed in " F " part and Table 1 below or its combination.
[0158] Pharmaceutically acceptable carriers and excipients useful in the present disclosure are conventional. See, for example, Remington: The Science and Practice of Pharmacy, The University of the Sciences in Philadelphia, Editor, Lippincott, Williams, & Wilkins, Philadelphia, PA, 22 st Edition (2013). For example, parenteral formulations typically contain an injectable fluid that is a pharmaceutically and physiologically acceptable fluid carrier, such as water, saline, other balanced salt solutions, aqueous glucose, glycerol, etc. For solid compositions (e.g., in the form of powders, pills, tablets, or capsules), conventional non-toxic solid carriers may include, for example, pharmaceutical grade mannitol, lactose, starch, or magnesium stearate. In addition to the biologically neutral carrier, the pharmaceutical composition to be administered may also contain a small amount of non-toxic auxiliary substances, such as wetting agents or emulsifiers, preservatives, pH buffers, etc., such as sodium acetate or sorbitan monolaurate. Excipients that may be included are, for example, other proteins, such as human serum albumin or plasma products.
[0159] In some embodiments, an Nmb protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37), an Nmc ... NO:38 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity), or encoding an Nmb protein (e.g., a nucleic acid molecule having at least 50%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:2, or encoding an Nmb protein having at least 50%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38), or encoding an Nmb protein (e.g., a nucleic acid molecule having at least 50%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity) or a Nmc protein (e.g., encoding a protein having a sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity) NO:38 Nucleic acids having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to a protein) are included in controlled release formulations, such as microencapsulated formulations. Various types of biodegradable and biocompatible polymers, methods, and methods for encapsulating various synthetic compounds, proteins and nucleic acids can be used (see, e.g., U.S. Patent Publication Nos. 2007 / 0148074; 2007 / 0092575; and 2006 / 0246139; U.S. Patent Nos. 4,522,811; 5,753,234; and 7,081,489; PCT Publication No. WO / 2006 / 052285; Benita, Microencapsulation: Methods and Industrial Applications, 2 nd ed.,CRC Press, 2006).
[0160] In some embodiments, an Nmb protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) or an Nmc protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, NO:38 has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity), or encodes an Nmb protein (e.g., a nucleic acid molecule having at least 50%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:2, or encodes an Nmb protein having at least 50%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38), or encodes an Nmb protein (e.g., a nucleic acid molecule having at least 50%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity) or a Nmc protein (e.g., encoding a protein having a sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity) NO:38 A nucleic acid having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to a protein) is included in the nanodispersion system. See, for example, U.S. Patent No. 6,780,324; U.S. Patent Publication No. 2009 / 0175953. For example, the nanodispersion system includes a bioactive agent and a dispersant (e.g., a polymer, a copolymer or a low molecular weight surfactant). Exemplary polymers or copolymers that can be used include polyvinylpyrrolidone (PVP), poly (D, L-lactic acid) (PLA), poly (D, L-lactic acid-glycolic acid) copolymer (PLGA), poly (ethylene glycol). Exemplary low molecular weight surfactants include sodium dodecyl sulfate, cetylpyridinium chloride, polysorbates, sorbitan, poly (oxyethylene) alkyl ethers, poly (oxyethylene) alkyl esters and combinations thereof. In one example, the nanodispersion system includes PVP and ODP or variations thereof (eg, 80 / 20 w / w).In some examples, nanodispersions are prepared using solvent evaporation methods, see, for example, Kanaze et al., Drug Dev. Indus. Pharm. 36:292-301, 2010; Kanaze et al., J. Appl. Polymer Sci. 102:460-471, 2006. Regarding administration of nucleic acids, one method of nucleic acid administration is direct treatment with viral vectors such as lentiviral or AAV vectors. As described above, a nucleotide sequence encoding an Nmb protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37), e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37 ID NO: 2 has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity, or encodes a nucleic acid molecule having a sequence identity of at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% to SEQ ID NO: 3 NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity) or a nucleic acid molecule encoding an Nmc protein (e.g., encoding a protein having a sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity) NO:38 A nucleic acid molecule that is a protein with at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity can be placed under the control of a promoter to increase the expression of Nmb or Nmc protein.
[0161] An Nmb protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) or an Nmc protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) NO:38 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity), or Nmb nucleic acid coding sequence (e.g., a nucleic acid molecule having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:2), or Nmc coding sequence (e.g., a nucleic acid molecule encoding a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38) can be administered alone or in various combinations and used in conjunction with other therapeutic compositions.In addition, Nmb protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) or Nmc ... NO:38 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity), or Nmb nucleic acid encoding sequence (e.g., a nucleic acid molecule having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:2), or Nmc encoding sequence (e.g., a nucleic acid molecule encoding a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38) can be administered systemically or locally.
[0162] Various types of release delivery systems can be used. Examples include polymer-based systems such as poly (lactide-glycolide), copolyoxalates, polycaprolactones, polyesteramides, polyorthoesters, polyhydroxybutyric acid, and polyanhydrides. The aforementioned drug-containing polymer microcapsules are described, for example, in U.S. Patent No. 5,075,109. Delivery systems also include non-polymer systems such as lipids, including sterols such as cholesterol, cholesterol esters, and fatty acids, or neutral fats such as monoglycerides, diglycerides, and triglycerides; hydrogel release systems; silicone rubber systems; peptide-based systems; wax coatings; compressed tablets using conventional adhesives and excipients; partially fused implants, etc.Specific examples include, but are not limited to: (a) an erosion system, wherein an Nmb protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) or an Nmc protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: NO:38 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity), or a nucleic acid encoding the Nmb protein (e.g., a nucleic acid molecule having at least 50%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:2, or a nucleic acid molecule encoding the Nmb protein having at least 50%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38), or a nucleic acid encoding the Nmb protein NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity) or a Nmc coding sequence (e.g., encoding a protein having a sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity NO:38 has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity of the protein) in the form of containing in matrix, such as those described in U.S. Patent Nos. 4,452,775; 4,667,014; 4,748,034; 5,239,660; and 6,218,371; and (b) diffusion system, wherein active ingredient is penetrated from polymer with controlled rate, such as described in U.S. Patent Nos. 3,832,253 and 3,854,480. In addition, hardware delivery system based on pump can be used, some of which are suitable for implantation.
[0163] Long-term sustained release implants may be suitable for treating chronic conditions, such as inflammatory conditions (e.g., see Table 1). As used herein, long-term release refers to that the implant is configured and arranged to deliver the active ingredient of the therapeutic level within at least 30 days or at least 60 days. Long-term sustained release implants include the above-mentioned release systems. These systems have been described for use with nucleic acids (see U.S. Patent number 6,218,371). For in vivo use, nucleic acids and peptides are relatively tolerant to degradation (e.g., by endonucleases and exonucleases). Therefore, the modification of Nmb or Nmc protein can be used, such as comprising C-terminal amides.
[0164] In some examples, an Nmb protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) or an Nmc protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: NO:38 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity), or a nucleic acid encoding the Nmb protein (e.g., a nucleic acid molecule having at least 50%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:2, or a nucleic acid molecule encoding the Nmb protein having at least 50%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38), or a nucleic acid encoding the Nmb protein NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity) or a Nmc coding sequence (e.g., encoding a protein having a sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity NO:38 has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity) by using a propellant (e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas) in the form of an aerosol spray (which may include solid or liquid particles), for example, from a pressurized pack or nebulizer. In the case of a pressurized aerosol, the dosing unit can be determined by providing a valve to deliver a metered amount. Capsules and cartridges for use in an inhaler or insufflator can be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
[0165] In some embodiments, an Nmb protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) or an Nmc protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, NO:38 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity), or a nucleic acid encoding the Nmb protein (e.g., a nucleic acid molecule having at least 50%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:2, or a nucleic acid molecule encoding the Nmb protein having at least 50%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38), or a nucleic acid encoding the Nmb protein NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity) or a Nmc coding sequence (e.g., encoding a protein having a sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity NO:38 has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to a protein) by inhalation.For example, an Nmb protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) or an Nmc protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, ID NO:38 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity), or a nucleic acid encoding the Nmb protein (e.g., a nucleic acid molecule having at least 50%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:2, or a nucleic acid molecule encoding the Nmb protein having at least 50%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38), or a nucleic acid encoding the Nmb protein NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity) or a Nmc coding sequence (e.g., encoding a protein having a sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity NO:38 has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity) is administered in aerosolized form, such as using a nebulizer, metered dose inhaler (MDI) or dry powder inhaler (DPI). The technology used includes micropump nebulizer (e.g., AEROGEN). systems), jet nebulizers designed to produce larger fine particle fractions (e.g. PARI LC ), jet atomizers that generate less shear force during atomization (such as HUDSON ) and ultrasonic nebulizers (such as DeVilbiss ).
[0166] The preparation that is suitable for use with jet or ultrasonic sprayer can include the Nmb protein or nucleic acid molecule dissolved in water with a concentration of about 0.1 to 25mg per mL solution. The preparation can also include buffer and monosaccharide (for example, for protein stabilization and regulating osmotic pressure). The sprayer preparation can also include surfactant, to reduce or prevent the surface-induced aggregation (U.S. Patent Application Publication No. 2007 / 0065367) of Nmb or Nmc protein or nucleic acid molecule caused by the atomization of solution in forming aerosol.
[0167] The preparation used with the MDI device generally includes a finely divided powder, which contains Nmb or Nmc proteins or nucleic acid molecules suspended in a propellant by means of a surfactant. The propellant can be any conventional material for this purpose, such as hydrochlorofluorocarbons, hydrofluorocarbons or hydrocarbons, including trichlorofluoromethane, dichlorodifluoromethane, dichlorotetrafluoroethanol and 1,1,1,2-tetrafluoroethane, or a combination thereof. Suitable surfactants include sorbitan trioleate and soybean lecithin. Oleic acid can also be used as a surfactant (U.S. Patent Application Publication No. 2007 / 0065367). The device of the inhalation system can deliver a single dose (e.g., by blister packaging), or it can be designed to multiple doses. In order to ensure the accuracy of administration, the delivery of the preparation can be programmed by a microprocessor so that it occurs at a certain point in the inhalation cycle. In some cases, MDI is a portable handheld type.
[0168] Dry powder inhalers (DPIs) can also be used as aerosol delivery devices. The basic design of a DPI includes a metering system, a powdered composition, and a method for dispersing the composition. Forces such as rotation and vibration can be used to disperse the composition. The metering and dispersing system can be mechanical or electrically driven and can be microprocessor programmable. The device can be portable and handheld. Inhalers can be designed for multiple doses or single doses, and options such as hard gelatin capsules or blister packs can be used to obtain accurate unit doses. Nmb or Nmc proteins or nucleic acid molecules can be dispersed from the device by passive inhalation (e.g., the patient's own inhalation efforts), or an active dispersion system can be used. The dry powder of the therapeutic composition can be sized by methods such as jet milling, spray dyeing, and supercritical fluid manufacturing. Acceptable excipients, such as sugars, mannitol, and maltose, can be used to prepare powdered preparations.
[0169] 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity) or an Nmc protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity) to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity) to SEQ ID NO: NO:38 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity), or a nucleic acid encoding the Nmb protein (e.g., a nucleic acid molecule having at least 50%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:2, or a nucleic acid molecule encoding the Nmb protein having at least 50%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38), or a nucleic acid encoding the Nmb protein NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity) or a Nmc coding sequence (e.g., encoding a protein having a sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity NO:38 A nucleic acid molecule having a protein with at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity) can be dissolved in a carrier (such as saline) and aerosolized using the above-mentioned device. (NGI) (MSP Corp., Shoreview, Mn) collects relevant aerosols, which use a series of aerodynamic stages to separate and collect aerosols into separate fractions based on droplet size, such as those that will deposit in the small airways and alveoli.
[0170] Aerosol particle size is usually expressed in terms of mass median aerodynamic diameter (MMAD), a parameter based on particle size, shape, and density. For spherical particles, MMAD is equal to MMD (p 1 / 2 ), where MMD is the mass median diameter and r is the volume density. For non-spherical particles, MMAD is equal to MMD(p / x)1 / 2 , where X is the shape factor. Therefore, a particle with a density greater than unity will have an actual diameter smaller than its MMAD.
[0171] According to the position of particle deposition in the respiratory tract of particle size division.In an example, utilize approximately 1 to approximately 500 microns of particle, for example utilize approximately 25 to approximately 250 microns or approximately 10 to approximately 25 microns of particle.In other embodiments, use approximately 1 to 50 microns of particle.In order to use in metered dose inhaler, can be less than approximately 10 microns of particle, for example approximately 2 to approximately 8 microns of particle, for example approximately 1 to approximately 5 microns of particle, for example 2 to 3 microns of particle are applied to lung.
[0172] The dosage form of the pharmaceutical composition can be determined by the selected mode of administration. For example, in addition to injection, topical, inhalation, oral and suppository preparations can also be used. Topical preparations can include eye drops, ointments, sprays, patches, etc. Inhalation preparations can be liquids (e.g., solutions or suspensions), and include mist, sprays, etc. Oral preparations can be liquids (e.g., syrups, solutions or suspensions), or solids (e.g., powders, pills, tablets or capsules). Suppository preparations can also be solid, gel or suspension forms. For solid compositions, conventional nontoxic solid carriers can include pharmaceutical grade mannitol, lactose, cellulose, starch or magnesium stearate.
[0173] In some examples, an Nmb protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) or an Nmc protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: NO:38 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity), or Nmb nucleic acid coding sequence (e.g., a nucleic acid molecule having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:2), or Nmc coding sequence (e.g., a nucleic acid molecule encoding a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38), or Nmb nucleic acid coding sequence (e.g., a nucleic acid molecule having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:2), NO:38 A therapeutically effective amount of a protein or nucleic acid molecule having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity is (1) reducing inflammation (e.g., in the lungs or at the site of an allergic reaction), e.g., by at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75% or at least 90% relative to not administering the Nmb or Nmc protein or nucleic acid molecule, (2) reducing IL-5 (e.g., in ILC2 and / or T cells), e.g., by at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75% or at least 90% relative to not administering the Nmb or Nmc protein or nucleic acid molecule. (3) reducing IL-13 (e.g., in ILC2 and / or T cells), for example, by at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75% or at least 90% relative to not administering Nmb protein or Nmc protein or nucleic acid molecule, (4) reducing ILC2 and / or T response, for example, the number of ILC2 and / or T cells present, proliferating and / or activated, for example, by at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75% or at least 90% relative to not administering Nmb protein or Nmc protein or nucleic acid molecule,and / or (5) reducing eosinophilia (e.g., in the lungs or peripheral blood), for example, by reducing the amount of Nmb or Nmc protein or nucleic acid molecule encoding Nmb or Nmc by at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75%, or at least 90% relative to not administering Nmb protein or Nmc protein or nucleic acid molecule.
[0174] The invention relates to a protein comprising an Nmb protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) or an Nmc ... NO:38) can be formulated in unit dosage form for individual administration of precise dosages. In one non-limiting example, a unit dose comprises about 1 μg to about 1 g of an Nmb protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) or an Nmc protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: NO:38 has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity), such as about 1 mg to 100 mg, 10 mg to about 100 mg, about 50 mg to about 500 mg, about 50 mg to about 100 mg, about 100 mg to about 900 mg, about 250 mg to about 750 mg, or about 400 mg to about 600 mg.In other examples, an Nmb protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) or an Nmc protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: NO:38 (a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity) is from about 0.01 mg / kg to about 50 mg / kg, e.g., from about 0.1 mg / kg to about 10 mg / kg, from about 0.1 mg / kg to about 1 mg / kg or from about 1 mg / kg to about 10 mg / kg. In other examples, an Nmb protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) or an Nmc protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: NO:38 has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity) The therapeutically effective amount is about 0.1ug / kg to about 10ug / kg, about 0.1ug / kg to about 1ug / kg, for example about 0.8ug / kg.In particular examples, an Nmb protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) or an Nmc protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: NO:38 has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity) in a therapeutically effective amount of about 1 mg / kg to about 10 mg / kg, for example about 2 mg / kg.
[0175] Other suitable scopes include from about 100 μ g / kg body weight to 10mg / kg body weight or higher Nmb or Nmc protein dosage (for example, about 0.1-10mg / kg, about 1-20mg / kg, about 5-50mg / kg or about 10-100mg / kg). In certain embodiments, effective dose will be selected in the narrower range of for example 5-40mg / kg, 10-35mg / kg or 20-25mg / kg. In other examples, dosage is about 1-100mg, for example, about 1-10mg, about 5-25mg, about 10-50mg, about 25-60mg or about 50-100mg (for example, about 1mg, 5, mg, 10mg, 15mg, 20mg, 25mg, 30mg, 35mg, 40mg, 45mg, 50mg, 55mg, 60mg, 70mg, 80mg, 90mg or 100mg). In certain examples, the dosage is about 20-60 mg, and in one non-limiting example, about 25 mg.
[0176] A method comprising an Nmb coding sequence (e.g., one encoding a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37), e.g., one encoding a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, NO:2 has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity) or Nmc coding sequence (e.g., encoding a nucleic acid molecule with at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:38) pharmaceutical composition can be formulated into a unit dosage form suitable for individual administration of precise dosage. Typically, the amount of recombinant viral vector carrying the nucleic acid coding sequence of the Nmb protein to be administered is based on the titer of the viral particles. In one non-limiting example, for example, when a viral vector is used to administer a nucleic acid encoding an Nmb protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) or an Nmc coding sequence (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: NO:38 has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity), for example, a vector containing a nucleic acid molecule having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:2, a unit dose (e.g., 0.5-1.5 μl) containing about 10 per mammal 5 to about 10 10Thus, in some examples, about 10 plaque forming units (pfu) per mammal are administered to a recipient subject. 5 to about 10 10 pfu / ml of the recombinant virus in the composition. In some examples, at least 10 5 pfu / ml / mammal, at least 10 6 pfu / ml / mammal, at least 10 7 pfu / ml / mammal, at least 10 8 pfu / ml / mammal, at least 10 9 pfu / ml / mammal, or at least 10 10 pfu / ml / dose of mammal. Examples of methods of administering the composition to a mammal include, but are not limited to, injecting the composition into a diseased tissue (eg, skin or lung) or administering it intravenously, subcutaneously, intradermally, or intramuscularly.
[0177] The invention relates to a protein comprising an Nmb protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) or an Nmc ... NO:38 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity), or Nmb coding sequence (e.g., a nucleic acid molecule having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:2), or Nmc coding sequence (e.g., a nucleic acid molecule encoding a nucleic acid having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38), or Nmb coding sequence (e.g., a nucleic acid molecule having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:2), NO:38 has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity of the protein nucleic acid molecule) of the present disclosure can be by any mode (including oral, intravenous, intramuscular, intraperitoneal, intranasal, intradermal, intraparenchymal, intraventricular, intrathecal (such as cerebral cistern and lumbar), subcutaneous, by inhalation or by suppository) is applied to human or other animals. In a non-limiting example, the composition is administered by injection. In some instances, site-specific administration of the composition can be used, for example, by applying Nmb or Nmc protein or coding sequence to skin tissue or lung (for example, by inhalation).
[0178] Treatment can involve a single administration or multiple administrations (e.g., at least two separate administrations), for example, administration over a period of days to months or even years. For example, a Nmb protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) or a Nmc protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: NO:38 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity), or Nmb encoding sequence (e.g., one having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:2) or Nmc encoding sequence (e.g., a nucleic acid molecule encoding a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38) can be administered in a single dose or in multiple doses during the course of treatment, for example, daily, weekly, monthly, or yearly. In specific non-limiting examples, treatment involves administration once a month, once a year, or once every other month. In some examples, in the case of multiple dosing, at least two separate administrations may be separated by at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 1 month, at least 2 months, at least 3 months, at least 6 months, at least 9 months, or at least one year.
[0179] In some examples, the first dose (and in some examples the only dose) administered occurs within 1 minute, within 10 minutes, within 15 minutes, within 30 minutes, within 1 hour, within 2 hours, within 3 hours, within 4 hours, within 5 hours, within 6 hours, within 12 hours, within 24 hours, within 48 hours, within 72 hours, within 96 hours, within 1 week, within 2 weeks, within 3 weeks, within 4 weeks, within 1 month, within 2 months, or within 3 months of onset of a condition (e.g., type 2 cytokine inflammation), for example, within 1 to 24 hours, within 2 to 24 hours, within 4 to 24 hours, or within 1 to 96 hours of onset of the condition.
[0180] In some embodiments, an Nmb protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) or an Nmc protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, NO:38 having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity), or Nmb encoding sequence (e.g., a nucleic acid molecule having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:2), or Nmc encoding sequence (e.g., a nucleic acid molecule encoding a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38) is administered prophylactically prior to exposure to an allergic trigger. For example, asthmatics can be treated with Nmb or Nmc protein or nucleic acid molecules before exercise or exposure to environmental triggers (such as pollution or allergens). Preventive treatment can also be used to treat subjects with chemical exposure risks, such as first responders to chemical accidents. Nmb or Nmc protein or nucleic acid molecules can also be prophylactically applied to asymptomatic individuals, and the asymptomatic individuals are repeatedly exposed to reagents known to trigger asthma attacks in subjects. In one example, an effective amount of Nmb or Nmc protein or nucleic acid molecules can be applied to healthy individuals, and the healthy individuals are repeatedly exposed to allergens known to induce asthma attacks. In other embodiments, Nmb or Nmc protein or nucleic acid molecules can be applied to subjects who need corticosteroid (CS) treatment or have been treated with CS in the past. Nmb or Nmc protein or nucleic acid molecules can be applied to patients with asthma before participating in activities that trigger asthma attacks to reduce the severity of asthma attacks or completely avoid asthma attacks. Therefore, in some embodiments, the application of Nmb or Nmc protein or nucleic acid molecules prevents asthma attacks. In some embodiments, Nmb or Nmc protein or nucleic acid molecules are applied to improve the symptoms of patients with daily symptoms for a long time.
[0181] In some examples, the method comprises detecting or measuring (1) reducing inflammation (e.g., in the lungs or at the site of an allergic reaction), e.g., by at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75% or at least 90% relative to not administering an Nmb protein or an Nmc protein or a nucleic acid molecule, (2) reducing IL-5 (e.g., in ILC2 and / or T cells), e.g., by at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75% or at least 90% relative to not administering an Nmb protein or an Nmc protein or a nucleic acid molecule, (3) reducing IL-13 (e.g., in ILC2 and / or T cells), e.g., by at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75% or at least 90% relative to not administering an Nmb protein or an Nmc protein or a nucleic acid molecule, 0%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75% or at least 90%, (4) reducing ILC2 and / or T responses, such as the number of ILC2 and / or T cells present, proliferating and / or activated, such as by at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75% or at least 90% relative to not administering Nmb protein or Nmc protein or nucleic acid molecule, and / or (5) reducing eosinophilia (e.g., in the lungs or peripheral blood), such as by at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75% or at least 90% relative to not administering Nmb protein or Nmc protein or nucleic acid molecule.
[0182] In some instances, the effectiveness of treatment is measured by monitoring lung function. For example, various measurable parameters of lung function can be studied before, during or after treatment. Pulmonary function can be monitored by testing any of several physically measurable operations of the lungs, including but not limited to inspiratory flow rate, expiratory flow rate and lung volume. A statistically significant increase in one or more of these parameters indicates that the treatment has effectiveness. Symptom relief, worsening of asthma, use of rescue inhalers or inflammatory measures are also evidence of efficacy.
[0183] The most commonly used method for measuring lung function in clinical practice involves timed measurement of inspiratory and expiratory maneuvers to measure specific parameters. For example, FVC measures the total volume (in liters) that a patient has forced to expire from their initial deep inspiration. When assessed together with FEV1, this parameter allows for a quantitative assessment of bronchoconstriction. A statistically significant increase, as determined by a mathematical formula in either FVC or FEV1, reflects a reduction in bronchoconstriction and indicates that the therapy is effective.
[0184] In addition to measuring the volume of air exhaled as an indicator of lung function, flow in liters per minute measured at different parts of the expiratory cycle can also be used to determine the patient's lung function status. In particular, peak expiratory flow (the highest airflow rate in liters per minute during forced maximum exhalation) is closely related to overall lung function in patients with asthma and other respiratory diseases. Therefore, a statistically significant increase in peak expiratory flow after administration of a TPO inhibitor indicates that the therapy is effective.
[0185] F. Administration of Additional Treatments
[0186] In some examples, an Nmb protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) or an Nmc protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: NO:38 has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity), Nmb coding sequence (e.g., one having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:2), or Nmc coding sequence (e.g., one encoding a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38), Nmb coding sequence (e.g., one having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:2), NO:38 has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity) and one or more other agents (such as those that can be used to treat inflammatory disorders or other disorders listed in Table 1) are administered in combination (e.g., sequentially, simultaneously or concurrently). The term "administered in combination" or "co-administered" refers to concurrent and sequential administration of active agents.
[0187] In some instances, Nmb or Nmc protein or Nmb or Nmc coding sequence is used to combine effective dose of corticosteroid (for example methylprednisolone or prednisone), antihistamine or both to the subject. In some instances, Nmb protein or Nmb coding sequence is used to combine effective dose of IL-4 inhibitor (for example, Dupilumab), IL-5 inhibitor (for example, Mepolizumab, Benralizumab and Reslizumab) and Il-13 inhibitor (for example, Tralocitum and Lerui group monoclonal antibody) or its combination to the subject. In another example, Nmb or Nmc protein or Nmb or Nmc coding sequence is used to combine effective dose of PGE2 to the subject.
[0188] In some examples, Nmb or Nmc protein or Nmb or Nmc coding sequence is administered to a subject in combination with an effective dose of an agent for preventing or treating one or more signs or symptoms associated with an airway disorder (e.g., asthma or COPD). For example, one or more beta-agonists, including beta-2 agonists (e.g., salbutamol), one or more leukotriene antagonists / formation inhibitors (e.g., zileuton, Abbott Laboratories,monteleukast, Merck and Company, and others), antibodies that block IgE, expectorants, or a combination thereof.
[0189] In some examples, Nmb or Nmc protein or Nmb or Nmc coding sequence is administered to a subject with an inflammatory disease (e.g., allergy or allergic reaction, sinusitis, asthma (mild, moderate or severe, including eosinophilic asthma), COPD, idiopathic pulmonary fibrosis (IPF), rhinitis, EGPA, eosinophilic esophagitis, eczema, urticaria, chronic pruritus, angioedema, conjunctivitis or atopic dermatitis) in combination with an effective dose of one or more other therapeutic agents. For example, if the subject has allergies (e.g., seasonal allergies, or allergic reactions to dust / mold, foods (e.g., shellfish, eggs, milk, nuts, wheat), animals (e.g., dander), plants, drugs (e.g., antibiotics such as sulfonamides or penicillin, aspirin, NSAIDs, anticonvulsants, chemotherapy drugs), insects (e.g., cockroaches and venom of bees, hornets, wasps, yellow jackets, fire ants), pathogens (e.g., viruses, bacteria, fungi, parasites), or chemicals (e.g., latex), the methods may further include administering a therapeutically effective amount of one or more decongestants, antihistamines, corticosteroids, immunotherapy, and epinephrine. For example, if the subject has sinusitis, the methods may further include administering a therapeutically effective amount of an antibiotic (e.g., amoxicillin) and / or a corticosteroid. For example, if the subject has asthma (mild, moderate, or severe, including eosinophilic asthma), the method can further include administering a therapeutically effective amount of one or more corticosteroids, glucocorticoids, bronchodilators (e.g., short-acting (e.g., albuterol) or long-acting (e.g., formoterol) beta-2 adrenergic agonists, anticholinergics (e.g., tiotropium and ipratropium), long-acting beta agonists (LABAs) leukotriene antagonists, IL-4 inhibitors (e.g., dupilumab), mepolizumab, benralizumab, reslizumab, trorocirumab, and lerizumab. For example, if the subject has COPD, the method can further include administering a therapeutically effective amount of one or more corticosteroids, glucocorticoids, bronchodilators (e.g., short-acting (e.g., albuterol) or long-acting (e.g., formoterol) beta-2 adrenergic agonists, anticholinergics (e.g., tiotropium and ipratropium), long-acting beta agonists (LABAs) leukotriene antagonists, IL-4 inhibitors (e.g., dupilumab), mepolizumab, benralizumab, reslizumab, trorocirumab, and lerizumab. Steroids, bronchodilators (e.g., short-acting (e.g., albuterol) or long-acting (e.g., formoterol) beta-2 adrenergic agonists, anticholinergics (e.g., tiotropium and ipratropium), antibiotics (e.g., erythromycin), and supplemental oxygen. For example, if the subject has idiopathic pulmonary fibrosis (IPF), the method can further include administering a therapeutically effective amount of pirfenidone and / or an angiokinase inhibitor (e.g., nintedanib). For example, if the subject has rhinitis, the method can further include administering a therapeutically effective amount of one or more antihistamine nasal sprays, corticosteroid nasal sprays, anticholinergic nasal sprays (e.g., ipratropium), decongestants (e.g., pseudoephedrine or phenylephrine).For example, if the subject suffers from EGPA, the method may further include administering a therapeutically effective amount of one or more mepolizumabs, glucocorticoids (e.g., prednisolone), immunosuppressants (e.g., azathioprine and cyclophosphamide) and methotrexate. For example, if the subject suffers from eosinophilic esophagitis, the method may further include administering a therapeutically effective amount of topical corticosteroids (e.g., budesonide, fluticasone) and / or proton pump inhibitors (e.g., omeprazole, lansoprazole, right lansoprazole, esomeprazole, pantoprazole, rabeprazole, ilaprazole). For example, if the subject suffers from eczema, the method may further include administering a therapeutically effective amount of corticosteroids (e.g., hydrocortisone, clobetasol propionate) and / or immunosuppressants (e.g., pimecrolimus, tacrolimus). For example, if the subject suffers from urticaria, the method may further include administering a therapeutically effective amount of one or more antihistamines (e.g., diphenhydramine, hydroxyzine, loratadine, cetirizine, desloratadine), leukotriene antagonists (e.g., montelukast and zafirlukast), oral glucocorticoids, anti-inflammatory drugs, omalizumab, immunosuppressants. For example, if the subject suffers from chronic pruritus, the method may further include administering a therapeutically effective amount of one or more corticosteroids (e.g., cortisone and prednisone), calcineurin inhibitors (e.g., pimecrolimus and tacrolimus) and antidepressants (e.g., Prozac and Zoloft). For example, if the subject suffers from angioedema, the method may further include administering a therapeutically effective amount of an antihistamine (e.g., cetirizine) and / or androgen. For example, if the subject suffers from conjunctivitis, the method may further include administering a therapeutically effective amount of one or more antihistamines (e.g., diphenhydramine), mast cell stabilizers (e.g., cromoglycine) or antibiotics. For example, if the subject suffers from atopic dermatitis, the method may further include administering a therapeutically effective amount of one or more trorocirumab, topical corticosteroids (e.g., hydrocortisone), topical calcineurin inhibitors (e.g., tacrolimus or pimecrolimus), systemic immunosuppressants (e.g., ciclospoin, methotrexate, interferon gamma-1b). For example, if the subject suffers from eosinophilic disorders (e.g., eosinophilic esophagitis, eosinophilic gastritis, eosinophilic gastroenteritis, eosinophilic enteritis, eosinophilic colitis, eosinophilic asthma, eosinophilic gastrointestinal disorders (EGID), eosinophilic fasciitis, EGPA, eosinophilic lung disease, high eosinophilic syndrome (HES)), the method may further include administering a therapeutically effective amount of one or more topical or systemic steroids (e.g., corticosteroids, glucocorticoids, such as prednisone), amino acid-based diets, and immunosuppressants (e.g., azathioprine and cyclophosphamide).In some examples, Nmb or Nmc proteins or Nmb or Nmc coding sequences are administered to a subject having a parasitic or fungal infection, and the method may further include administering a therapeutically effective amount of an antifungal agent (e.g., polyenes (e.g., amphotericin B, nystatin, natamycin), azoles (e.g., fluconazole, itraconazole, voriconazole), allylamines (e.g., terbinafine), and echinocandins (e.g., caspofungin) and / or an antiparasitic agent (e.g., anthelmintics, antiprotozoal agents, antiamoebic agents).
[0190] In some examples, Nmb or Nmc protein or Nmb or Nmc coding sequence is administered to a subject with eosinophilic leukemia (chronic, acute or clonal), and the method may further include administering a therapeutically effective amount of one or more chemotherapies (e.g., cytarabine, anthracyclines, histamine dihydrochloride, interleukin 2), Gleevec, tyrosine kinase inhibitors (e.g., sorafenib, midostaruin, ponatinib) and hematopoietic stem cell transplantation.
[0191] In some examples, Nmb or Nmc protein or Nmb or Nmc coding sequence is administered to a subject with Hodgkin lymphoma, and the method may further include administering a therapeutically effective amount of one or more of: levofloxacin, MOPP, radiation therapy, ABVD (doxorubicin, bleomycin, vinblastine, dacarbazine), Stanford V (doxorubicin, bleomycin, vinblastine, vincristine, mechlorethamine, etoposide, prednisone) and BEACOPP (doxorubicin, bleomycin, vincristine, cyclophosphamide, procarbazine, etoposide, prednisone).
[0192] IV. Composition
[0193] Compositions that can be used with the disclosed methods are also provided. In one example, the composition includes an isolated Nmb protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 1, or an isolated Nmc protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 38 and liposomes, wherein the Nmb or Nmc protein is encapsulated in the liposomes. In one example, the composition comprises an Nmb fusion protein consisting of: (1) an Nmb protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:1, or an Nmc protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:38, and (2) a cell penetrating peptide (or a nucleic acid molecule encoding such a fusion protein). In one example, the composition includes an isolated non-natural Nmb protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 (which is not SEQ ID NO:1), a pharmaceutically acceptable carrier, and optionally a liposome. In one example, the composition comprises at least one non-natural Nmb protein, such as one having at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% sequence identity to SEQ ID NO:3, 4, 5, 6, 11, 12, 13, 14, 20, 22, 26, 27, 28, 29, 30, 31, 32, 35, 36 or 37 (which is not SEQ ID NO:1); and / or one having at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% sequence identity to SEQ ID NO:26, 27, 29, 35 or 36 (which is not SEQ ID NO:1).In one example, the composition includes (1) a naturally occurring Nmb protein (e.g., SEQ ID NO: 1) and (2) a non-natural Nmb protein, e.g., one comprising a sequence identity of at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% to SEQ ID NO: 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 (which is not SEQ ID NO: 1). In one example, the composition includes (1) one or more of SEQ ID NOs: 3, 4, 6, 7, 9, 10, 11, 12, 14, 15 and 19 and (2) one or more of SEQ ID NOs: 3, 4, 5, 6, 9, 11, 12, 13, 14, 18, 19, 20, 21, 22 and 23 (wherein the composition may further include a native Nmb protein, such as SEQ ID NO: 1).
[0194] In one example, the composition includes an isolated non-natural Nmb protein (which is not SEQ ID NO: 1) having at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37 and a pharmaceutically acceptable carrier (e.g., water or saline). In some examples, the non-natural Nmb protein is encapsulated in a liposome. In some examples, the non-natural Nmb protein is part of a fusion protein consisting of (1) a non-natural Nmb protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 or 37, and (2) a cell penetrating peptide (or a nucleic acid molecule encoding such a fusion protein). In some examples, the composition comprises a non-natural Nmb coding sequence in place of the non-natural Nmb protein. In other examples, the Nmc protein is part of a fusion protein consisting of (1) an Nmb protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 38 and (2) a cell penetrating peptide (or a nucleic acid molecule encoding such a fusion protein). Such a composition may further include other materials, such as a pharmaceutically acceptable carrier, such as water or saline. In some examples, the composition includes an Nmb or Nmc coding sequence in place of an Nmb or Nmc protein.
[0195] Exemplary cell-penetrating peptides that can be used include hydrophilic peptides (e.g., TAT [YGRKKRRQRRR; SEQ ID NO: 57], SynB1 [RGGRLSYSRRRFSTSTGR; SEQ ID NO: 39], SynB3 [RRLSYSRRRF; SEQ ID NO: 40], PTD-4 [PIRRRKKLRRLK; SEQ ID NO: 41], PTD-5 [RRQRRTSKLMKR; SEQ ID NO: 42], FHV Coat-(35-49) [RRRRNRTRRNRRRVR; SEQ ID NO: 43], BMV Gag-(7-25) [KMTRAQRRAAARRNRWTAR; SEQ ID NO: 44], HTLV-II Rex-(4-16) [TRRQRTRRARRNR; SEQ ID NO: 45], D-Tat [GRKKRRQRRRPPQ; SEQ ID NO: 46], R9-Tat GRRRRRRRRRPPQ [SEQ ID NO: 47] and penetratin [RQIKWFQNRRMKWKK; SEQ ID NO: 48]), amphiphilic polypeptides (e.g., MAP [KLALKLALKLALALKLA; SEQ ID NO: 49], SBP [MGLGLHLLVLAAALQGAWSQPKKKRKV; SEQ ID NO: 50], FBP [GALFLGWLGAAGSTMGAWSQPKKKRKV; SEQ ID NO: 51], MPG ac-GALFLGFLGAAGSTMGAWSQPKKKRKV-cya; SEQ ID NO: 52], MPG(ΔNLS) [ac-GALFLGFLGAAGSTMGAWSQPKSKRKV-cya; SEQ ID NI: 53], Pep-2 [ac-KETWFETWFTEWSQPKKKRKV-cya; SEQ ID NO: 54] and transportan [GWTLNSAGYLLGKINLKALAALAKKIL; SEQ ID NI: 55]), cyclic sequences (e.g., pVec, polyarginine RxN (4 < N < 17) chimeras, polylysine KxN (4 < N < 17) chimeras, (RAca)6R, (RAbu)6R, (RG)6R, (RM)6R, (RT)6R, (RS)6R, R10, (RA)6R, R7 and pep-1 [ac-KETWWETWWTEWSQPKKKRKV-cya; SEQ ID NO: 56]), Cr10 (cyclic poly-arginine CPP), TAT 48-57 、TAT 47-57 或TAT49-57 ; transmembrane peptide; Pep-1; substance P, SP; polyarginine, such as R5-R12; pVEC; transporter; MAP; diatos peptide vector 1047, DPV1047, MPG; ADP-ribosylation factor, ARF, such as ARF 1-22 ; BPrPr (e.g. BPrPr 1-28 ); p28; VT5; Bac 7, for example Bac 1-24 ; C105Y; PFVYLI (SEQ ID NO:58); and Pep-7.
[0196] In some instances, the composition is a liquid. In some instances, the composition is freeze-dried or lyophilized.
[0197] Depending on the mode of administration and dosage form, such pharmaceutical compositions may further comprise one or more diluents, fillers, binders and other excipients. Examples of therapeutically inert inorganic or organic carriers include, but are not limited to, lactose, corn starch or its derivatives, talc, vegetable oils, waxes, fats, polyols such as polyethylene glycol, water, sucrose, alcohol, glycerol, etc. Various preservatives, emulsifiers, dispersants, flavoring agents, wetting agents, antioxidants, sweeteners, colorants, stabilizers, salts, buffers, etc. may also be added.
[0198] In some examples, the composition further comprises one or more carriers, auxiliary substances or stabilizers, such as buffers (e.g., phosphate, citrate, tris or sodium acetate and other organic acids); antioxidants such as ascorbic acid; low molecular weight polypeptides (less than about 10 residues), proteins such as serum albumin, gelatin or immunoglobulins; hydrophilic polymers such as polyvinyl pyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine, leucine or lysine; monosaccharides, disaccharides and other carbohydrates such as glucose, sucrose, mannose, lactose, citrate, trehalose, maltodextrin or dextrin; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol); salt-forming counterions such as sodium and / or non-ionic surfactants such as Tweens, Pluronics or polyethylene glycol (PEG).
[0199] In some instances, the composition is included in a nebulizer, a metered dose inhaler (MDI) or a dry powder inhaler (DPI). The preparation for dispensing from a powder inhaler device may include a finely ground dry powder containing the Nmb peptide, or the nucleic acid molecule may also include a swelling agent, such as lactose, sorbitol, sugar or mannitol, which may contribute to the dispersion of the powder from the device, such as 50 to 90% by weight of the preparation. The compound may be prepared into a particle form having an average particle size less than 10 μM (e.g., 0.5 to 5 μM) to be delivered to the distal lung (U.S. Patent Application Publication No. 2007 / 0065367).
[0200] The present disclosure is illustrated by the following non-limiting examples.
[0201] Example
[0202] Example 1
[0203] Materials and methods
[0204] This example provides the materials and methods used in the following examples.
[0205] Mouse
[0206] 8-10 week old C57BL (6) wild type (WT), Mcpt8 tm1(cre)Lksy Mcpt8 was expressed in 2477 cells / mL and 1444 cells / mL, respectively, as described previously (Sullivan et al., Nat Immunol. 2011 Jun; 12(6):527-35, 2011). tm1(cre)Lksy Mice were crossed with ROSA26iDTR mice to obtain basophil-deficient mice. All mice were maintained in a specific pathogen-free facility.
[0207] Nocardia brasiliensis infection and substance administration
[0208] Methods for maintaining, recovering, infecting, and isolating N. brasiliensis larvae were performed as described previously (Camberis et al., 2003, Animal model of Nippostrongylus brasiliensis and Heligmosomoides polygyrus. Current protocols in immunology / edited by John E. Coligan... [et al.] Chapter 19: Unit 19.12.). Mice were infected with approximately 500 N. brasiliensis larvae by subcutaneous injection. For basophil depletion, WT and basophil-depleted mice were treated with 0.375 μg of diphtheria toxin ip every other day; mice were sacrificed 3-7 days after N. brasiliensis larvae infection. For neuromedin B treatment, mice were anesthetized and treated with 10 μg of neuromedin B (MP Biomedicals) dissolved in 50 μL of PBS administered by intratracheal instillation. For antibody-mediated basophil depletion, Rag2-deficient mice were treated ip with 20 μg of anti-FceR1α antibody (clone MAR-1, eBioscience) or anti-CD200R3 antibody (clone Ba103, hycultbiotech) on days 1, 3, and 5 after N. brasiliensis infection.
[0209] Adoptive transfer
[0210] WT mice were injected (ip) with a combination of recombinant IL-3 (1 μg) and α-IL-3 antibody (0.5 μg) (BioLegend: clone MP2-8F8) in 200 μL of PBS every 3 days for 8 days. At necropsy, single cell suspensions of spleens were prepared and the basophil population was sorted and purified. 15,000 basophils were resuspended in 50 μL of PBS and transferred to each mouse by tracheal instillation on days 3, 4, 5, and 6 after infection.
[0211] intravascular in vivo staining
[0212] The intravascular in vivo staining protocol was performed as described previously (Laidlaw et al. Immunity 41:633-645, 2014). Briefly, 5 minutes before euthanasia, mice were injected with 3 μg of fluorescently labeled antibody targeting CD200R (clone OX110, eBioscience) diluted in 300 μL of PBS.
[0213] Preparation of lung and bronchoalveolar lavage (BAL) cell suspensions
[0214] For BAL collection after autopsy, 5 mL of PBS was injected and aspirated from the trachea of each mouse, and the volume of the collected BAL was recorded after collection. After BAL collection, lungs were collected at autopsy, and single cell suspensions for flow cytometry analysis were prepared as previously described (Jungblut et al., J Vis Exp 29:1266, 2009). In brief, lung tissue was minced and incubated at 37 ° C for 30 minutes in HBSS containing 2.5% FBS, collagenase D (2 mg / mL, Roche) and DNAse I (80 U / mL, Roche). The cell suspension was filtered through a 100 μM filter and analyzed by flow cytometry. In addition, lung tissue sections were collected for real-time PCR and histological analysis.
[0215] Flow cytometry and cell sorting
[0216] Cells were stained with monoclonal anti-mouse fluorescent conjugated antibodies: from eBioscience or BD Biosciences' B220(RA3-6B2), c-Kit(ACK2), CD3(145-2C11), CD4(GK1.5), CD5(53–73), CD 19(1D3), NK1.1(PK136), CD11b(MI / 70), CD11c(N418), IgE(23G3), FcεRI(MAR-1), CD49b(D X5), CD45(30-F11), CD90(5E10), CD127(A7R34), F4 / 80(BM8), γδTCR(eBioGL3), Siglec-F( E50-2440), Ly6G(1A8), Ly6C(AL-21), IL-5(TRFK5), IL-13(eBio13A), Ter-119(TER-119). For intracellular staining, cells were incubated with Leukocyte Activation Mix and BD GolgiPlug TM (BD Biosciences) at 37°C for 5 hours. Basophils were analyzed as CD45 + CD3 - CD19 - FqV + CD49b + Eosinophils were analyzed as CD45 + CD11b + Siglec-F + CD11c - Neutrophils were analyzed as live CD45 + CD11b + 6G + ILC2 was analyzed as CD45+ CD3 - CD19 - CD11b - CD11c - NK1.1 - B220 - CD5 - Ter-119 - γδTCR - CD90 + CD127 + IL-5 + IL-13 + Samples were collected on a BD Fortessa flow cytometer (BD Biosciences) and analyzed using FlowJo software (v10.0.5, Tree Star). Cell sorting was performed using a FACSAriaII (BD Bioscience).
[0217] ILC2 culture in vitro
[0218] Pneumocytes were isolated from the lungs of WT or basophil-deficient mice at day 7 after N. brasiliensis infection. ILC populations (CD45 + Lin - CD90 + CD127 + ) were sorted and purified, and 10,000 cells were cultured for 24 hours in the presence of 100 ng / mL of IL-2, IL-7 and vehicle (PBS) or 10 μg / mL of interleukin B. IL-5 and IL-13 were quantified in the cell-free supernatant by ELISA.
[0219] RNA isolation and quantitative real-time PCR analysis
[0220] RNA from lung tissue sections was isolated by homogenization in TRIzol (Invitrogen), followed by phenol-chloroform extraction and isopropanol precipitation. cDNA was generated using Superscript reverse transcriptase (Invitrogen) according to standard protocols and used as input for real-time PCR. Real-time data were analyzed using the ΔΔCT method using SYBR green chemistry (Applied Biosystems) with β-actin as the endogenous housekeeping gene. All reactions were run on an ABI 7500 Fast Real-Time PCR System (Applied Biosystems). Samples were normalized to native controls. The following QuantiTech primer assays from Qiagen were used: Mcpt1 (QT00157864), IL-4 (QT00160678), IL-5 (QT00099715), IL-13 (QT00099554), Mcpt8 (QT00131565), Nmb (QT00105945), Nmbr1 (QT00312494), Muc5ac (QT01161104).
[0221] Pulse oximeter.
[0222] MouseOx was used according to the manufacturer's instructions. (Starr Lifesciences Corp.) Briefly, 1 day before N. braziliani infection, hair around the thighs was removed, mice were anesthetized with 5% isoflurane, and oxygen saturation was monitored at approximately 5-min intervals using a thigh sensor.
[0223] statistics
[0224] Results are shown as mean ± standard error of the mean. Statistical analysis was performed using the Student t test in GraphPad Prism version 6.
[0225] Example 2
[0226] Basophils regulate helminth-induced inflammation
[0227] Parameters of type 2 cytokine-mediated inflammation induced by Nb in the presence and absence of basophils were examined.
[0228] Lineage-specific deletion of basophils (11) did not alter gastrointestinal inflammation or helminth excretion ( Figure 1A ), while basophil depletion resulted in a significant increase in type 2 cytokine responses in the lung ( Figure 1BAn in vivo staining protocol for distinguishing blood- versus tissue-resident cells (12) revealed that a population of tissue-resident basophils could be found in the lungs beginning at day 3 post-infection and peaking at day 5 post-infection ( Figure 1C , 1D ).
[0229] Although effector cells activated in response to type 2 cytokines have been reported to promote parasite clearance, they may also promote the integrity of parasite-affected tissues (2). Because Nb larvae exit lung tissue by day 3 post-infection before the arrival of most basophils, basophils may modulate inflammation in an attempt to restore lung function rather than limiting parasite burden. Supporting this hypothesis, Nb-infected basophil-deficient mice exhibit altered lung pathology characterized by increased mucus production ( Figure 2A ) and inflammatory cell infiltration ( Figure 1E , 2B ), oxygen levels were significantly reduced compared with control mice ( Figure 1F Together, these data suggest that basophil populations negatively regulate infection-induced type 2 cytokine responses and contribute to the maintenance of lung function following infection.
[0230] Example 3
[0231] Basophils negatively regulate ILC2 responses
[0232] Microscopic analysis of the lung pathology observed in Example 2 indicated that basophil-deficient mice had an elevated infection-induced eosinophil response.
[0233] Flow cytometric analysis of bronchoalveolar lavage (BAL) fluid and lung infiltrates demonstrated that although infection-induced neutrophils did not significantly change ( Figure 3A , 4A ), but basophil-deficient mice showed significantly increased BAL and lung eosinophil responses ( Figure 3B , 4B ). Nb-induced eosinophil responses and mucus production depend on IL-5 and IL-13 production by type 2 innate lymphoid cells (ILCs2) and / or CD4+ T cells (1-3). When ILC2 responses are important, lung basophil responses occur during the first few days after infection (days 3-5) during the innate window (13, 14). In addition, the ability of basophils to communicate with ILC2s and alter their activation state has been demonstrated (2).
[0234] Therefore, we determined whether basophil-deficient animals exhibit an elevated infection-induced ILC2 response, which is associated with increased mucus production and eosinophilia (14). Interestingly, ILC2 populations were increased in both BAL and lung tissues of basophil-deficient mice compared with controls ( Figure 3C , 4C In addition, an increase in IL-5 and IL-13-producing ILC2s was detected in the BAL and lung tissues of basophil-deficient mice after infection ( Figure 3D , 3E , 4D). To exclude the possibility of off-target deletion effects, a gain-of-function approach was used. Diphtheria toxin receptor (DTR)-negative basophils were introduced into basophil-deficient mice. Intratracheal transfer of DTR-negative basophils into basophil-deficient mice was sufficient to suppress ILC2 responses and eosinophils returning to WT levels in both BAL and lung ( Figure 3F-3H , 4E-4G). Taken together, these loss- and gain-of-function approaches demonstrate that basophils negatively regulate lung ILC2 responses following Nb infection.
[0235] Example 4
[0236] Basophils promote Nmb expression on ILC2s
[0237] To confirm that the effects of basophil depletion occurred independently of adaptive lymphocytes, mice deficient in the recombination activating gene (Rag2) were treated with the basophil-depleting antibody Ba103. Rag2- / - mice treated with Ba103 exhibited significantly elevated Nb-induced ILC2 responses compared with control mice ( Figure 5A ) and elevated eosinophilia ( Figure 5B In conclusion, both loss-of-function and gain-of-function approaches demonstrated that basophils negatively regulate lung ILC2 responses following Nb infection.
[0238] To identify the mechanisms by which basophils regulate ILC2s, genome-wide transcriptional profiling of lung ILC2s was performed after Nb. Compared with ILC2s sorted and purified from basophil-deficient mice, ILC2s from control animals were enriched for pathways associated with sensory transduction, seven-transmembrane domain receptors (7TM), G protein-coupled receptor signaling, and rhodopsin-like signaling ( Figure 5C ).
[0239] Notably, one of the driver genes associated with these pathways is neuromedin B receptor (Nmbr) ( Figure 5D). Neuromedin B (Nmb) is part of the neuromedin peptide family, which includes neuromedin A, B, C, K, L, N, S, and U (15,16). Neuromedin B is a bombesin-like peptide that is expressed in the central nervous system, lungs, gastrointestinal tract, and adipose tissue of mammals (15,17). Previous studies have shown that Nmb and its receptor are localized to neurons found in the submucosa (18). After binding to its receptor, Nmb has been reported to regulate cell growth, body temperature, blood pressure, and glucose levels, however, its ability to modulate immunity and inflammation remains to be determined (15).
[0240] To investigate whether basophils regulate the Nmb signaling pathway in the lung following Nb infection, the expression of Nmb and its receptors (as evidenced by reduced Mcpt8 expression) in the presence or absence of basophils was examined ( Figure 5E No changes in Nmb expression were detected after Nb infection ( Fig. 5F ); however, Nmbr was expressed at significantly higher levels in infected animals. In addition, basophil depletion resulted in a significant decrease in Nmbr expression in the lung ( Figure 5G Consistent with RNAseq analysis, Nmbr expression was also significantly reduced in ILC2s sorted and purified from basophil-deficient mice compared with controls ( Figure 5H ).
[0241] Example 5
[0242] Nmb inhibits type 2 cytokine responses
[0243] To determine whether Nmb acts as a negative regulator of type 2 cytokine responses, mice were infected with hookworms and treated with recombinant native Nmb (SEQ ID NO: 1). Parameters of type 2 cytokine-dependent inflammation were assessed at day 7 post infection.
[0244] Surprisingly, while Nmb treatment had no effect on infection-induced neutrophils, Nmb-treated mice exhibited reduced ILC2 responses ( Fig. 6A , IL-5 and IL-13 expression ( Figure 6B ), eosinophilia ( Figure 6C ) and failed to clear worms as effectively as control mice ( Fig.6D ). These data suggest that Nmb acts as a negative regulator of type 2 cytokine-mediated immunity.
[0245] To determine whether Nmb could directly inhibit Nb-activated ILC2s in the lung and whether basophils modulate this process, lung ILC2s from Nb-infected control and basophil-deficient mice were sorted and purified and cultured overnight in the presence or absence of Nmb. Notably, treatment with Nmb significantly reduced the production of IL-5 and IL-13 by ILC2s isolated from basophil-sufficient mice, but not basophil-deficient mice. Fig. 6E ).
[0246] Example 6
[0247] Nmb treatment is sufficient to suppress allergic airway inflammation
[0248] ILC2 responses are major contributors to type 2 cytokine production, eosinophilia, and mucus production associated with allergic inflammation (14). In addition, activated ILC2s play an important role in activating TH2 cells, which are key regulators of allergic inflammation (13,14). Therefore, ILC2s represent a cell population with significant therapeutic potential that can be targeted to treat multiple forms of allergic diseases. The data presented above demonstrate that Nmb can inhibit ILC2 responses in the setting of parasitic helminth infection. To demonstrate that Nmb can be used to treat allergic inflammation, the following experiments were performed.
[0249] Using a validated model of papain-induced allergic airway inflammation known to be dependent on ILC2s (19,20), mice treated with papain exhibited an increased percentage of ILC2s ( Fig. 7A ), through the elevated expression of IL-5 and IL-13 by ILC2 ( Figure 7B ) and pulmonary eosinophilia ( Figure 7C Crucially, in vivo administration of Nmb was sufficient to reduce papain-induced ILC2 responses and eosinophilia ( Figures 7A-7C ), indicating that Nmb can be used to treat allergic inflammation. Therefore, Nmb negatively regulates ILC2 responses both in vivo and in vitro.
[0250] ILC2s share many features with their adaptive TH2 counterparts, and therefore, Nmbs may also have the ability to suppress TH2 cells (13,14). At the time points assessed after Nb, most type 2 cytokines are ILC2-derived (14), and any effects of Nmbs on TH2 cell responses may be difficult to detect. To address this question, lung-draining LNs were isolated on day 7 after Nb and stimulated with anti-CD3 and anti-CD28 in the presence or absence of recombinant Nmbs to activate T cells. LN cells treated with anti-CD3 and anti-CD28 produced increased amounts of IL-5 and IL-13 ( Fig.7D ,7E Cultures treated with Nmb showed significantly reduced levels of IL-5 and 13 ( Fig.7D , 7E ). These data suggest that Nmb also inhibits activation of T H 2 cells produce cytokines.
[0251] Example 7
[0252] Nmb protein variants
[0253] The above results demonstrate that Nmb acts as a negative regulator in both ILC2 and TH2 cell responses, and is sufficient to reduce type 2 cytokine-mediated inflammation, such as in subjects with parasitic infections and / or allergic airway inflammation. Therefore, Nmb can be used to reduce type 2 cytokine-mediated inflammation. Natural Nmb is a 10-mer peptide (SEQ ID NO: 1) that operates by its ability to bind to Nmb receptors (15). This example describes the results of alanine scanning of various residues of Nmb systematically replaced with alanine (Table 2), and the resulting ability of variant Nmb peptides to inhibit the production of type 2 cytokines by TH2 cells. In addition, a cap is added to the native form of Nmb (SEQ ID NO: 1) and its biological activity is monitored ( Figure 5A ).
[0254] Table 2: Variant Nmb peptides
[0255]
[0256]
[0257] Although peptides C, F, and K (SEQ ID NOs: 5, 8, and 13, respectively) exhibited significantly reduced ability to inhibit IL-5 production compared to the native form of Nmb (SEQ ID NO: 1), none of the Nmb variant peptides showed significantly enhanced ability to inhibit IL-5 production ( Figure 7F In contrast, peptides F and H (SEQ ID NOs: 8 and 10, respectively) had the ability to inhibit IL-13 production, and peptides A, B, C, D, I, J, K, and L (SEQ ID NOs: 3, 4, 5, 6, 11, 12, 13, and 14, respectively) had significantly greater ability to inhibit IL-13 than native Nmb ( Figure 7G ).
[0258] The ability of truncated versions of Nmb (Table 2, SEQ ID NOs: 16-25) to regulate the H 2 cells produce type 2 cytokines. Natural Nmb is sufficient to significantly reduce the H2 cells produced IL-5, however, the truncated peptides N, O, P, R, U, V and W (SEQ ID NOs: 16, 17, 18, 20, 23, 24 and 25, respectively) showed reduced ability to inhibit IL-5 production ( Figure 7H Interestingly, the truncated peptide V (SEQ ID NO: 24) showed reduced ability to inhibit IL-13, while peptides R and T (SEQ ID NO: 20 and 22, respectively) showed enhanced inhibition of T. H 2. The ability of IL-13 in cells ( Fig.7I ).
[0259] The effect of the compensation length (Table 2, SEQ ID NOs: 26-36) on the regulation of H As mentioned above, natural Nmb is sufficient to reduce the production of type 2 cytokines from T cells. H 2 cells produce IL-5 and IL-13. Compensatory peptides X (SEQ ID NO: 26), Y (SEQ ID NO: 27), AA (SEQ ID NO: 29), AG (SEQ ID NO: 35) and AH (SEQ ID NO: 36) have significantly enhanced ability to inhibit the production of IL-5 from activated cells ( Fig. 8A In addition, peptides X (SEQ ID NO: 26), Y (SEQ ID NO: 27), Z (SEQ ID NO: 28), AA (SEQ ID NO: 29), AB (SEQ ID NO: 30), AC (SEQ ID NO: 31), AD (SEQ ID NO: 32), AG (SEQ ID NO: 35), AH (SEQ ID NO: 36) and AI (SEQ ID NO: 37) showed enhanced reduction from T H 2. The ability of cells to produce IL-13 ( Figure 8B ).
[0260] Together, these data suggest that Nmb can be modified to inhibit type 2 cytokine production and that these altered peptides may have greater therapeutic potential for modifying type 2 inflammation compared to the native version of Nmb (SEQ ID NO: 1).
[0261] In addition, these data indicate that combinations of Nmb variant peptides can be used in the disclosed methods, such as a combination of at least one variant peptide that reduces IL-5 and at least one variant peptide that reduces IL-13, such as a combination of peptides shown in Table 3. In addition, these data also indicate that natural Nmb (SEQ ID NO: 1) can be used with one or more Nmb variant peptides, such as (1) a combination of natural Nmb and at least one variant peptide that reduces IL-5, (2) a combination of natural Nmb and at least one variant peptide that reduces IL-13, or (3) a combination of natural Nmb and at least one variant peptide that reduces IL-5 and at least one variant peptide that reduces IL-13 (such as the peptides shown in Table 3). In one example, the method uses at least one Nmb variant peptide with enhanced ability to reduce IL-5, such as one or more of peptides X (SEQ ID NO: 26), Y (SEQ ID NO: 27), AA (SEQ ID NO: 29), AG (SEQ ID NO: 35), and AH (SEQ ID NO: 36). In one example, the method uses at least one Nmb variant peptide with enhanced ability to reduce IL-13, such as one or more of peptides A, B, C, D, I, J, K, L, R, T, X, Y, Z, AA, AB, AC, AD, AG, AH and AI (SEQ ID NOs: 3, 4, 5, 6, 11, 12, 13, 14, 20, 22, 26, 27, 28, 29, 30, 31, 32, 35, 36 and 37, respectively).
[0262] Table 3: Variant Nmb peptides that reduce IL-5 or IL-13
[0263]
[0264] Example 8
[0265] Neuromedin C protein
[0266] In some examples, instead of (or in addition to) using Nmb protein (or its variant) in the disclosed methods and compositions, neuromedin C protein (or its variant) is used. Exemplary natural neuromedin C protein is GNHWAVGHLM (SEQ ID NO: 38). Alternatively, a nucleic acid molecule encoding neuromedin C is used. Therefore, a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% sequence identity with SEQ ID NO: 38, or a nucleic acid molecule encoding at least one neuromedin C protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% sequence identity with SEQ ID NO: 38 can be used in the disclosed method. Previous studies in mammals have shown that Nmb and Nmc can interact with a common receptor (PMID 1720612). Therefore, Nmc and Nmb may initiate a common signal transduction pathway that can inhibit type 2 inflammation.
[0267] Example 9
[0268] Basophils regulate Nmbr expression
[0269] When basophils were depleted after Nb infection, NMBR expression by lung ILC2s was reduced. To determine whether basophils directly mediate the expression of NMBR or whether they operate through an intermediate pathway, ILC2s were sorted and purified from the lungs of Nb-infected mice (day 7) and cultured with the survival cytokines IL-2 and IL-7. Additionally, ILC2s were cultured overnight with activated basophils, IL-4, or IL-33. Subsequently, NMBR expression was monitored by flow cytometric analysis after culture. The data obtained indicated that while ILC2s treated with IL-4 or IL-33 (cytokines known to promote ILC2 activation) (21,23,24) did not show changes in NMBR expression levels, ILC2s cultured with activated basophils showed significantly increased NMBR expression ( Fig. 9 Together, these results suggest that activated basophils are sufficient to regulate NMBR expression directly through ILC2s.
[0270] These studies show that in the absence of basophils, Nb-induced ILC2 responses are amplified. In addition, the data suggest that reduced NMB-NMBR signaling may lead to an enhanced state of ILC2 activation in the absence of basophils. However, after Nb challenge, ILC2 responses are also known to be regulated by several other factors. Specifically, IL-33 has been reported to be a key regulator of lung ILC2 responses after Nb infection (24). To address whether the altered ILC2 activity in the absence of basophils is a result of reduced availability of IL-33 rather than alterations in the NMB-NMBR signaling pathway, ILC2s were sorted and purified from the lungs of Nb-infected mice (day 7) and cultured with survival cytokines (IL-2, IL-7) and / or IL-33 and NMB. After overnight culture, the presence of IL-5 and IL-13 in the supernatant was detected by standard ELISA. Statistical comparisons were performed using the Student t test. The data show that NMB inhibits type 2 cytokine production by activated ILC2. Specifically, NMB was sufficient to significantly reduce steady-state production of IL-5 and IL-13 from ILC2s ( Figures 10A-10B ). Furthermore, these data show that despite the increase in IL-5 and IL-13 levels caused by IL-33 treatment, NMB treatment still resulted in a significant reduction in type 2 cytokines. Taken together, these studies suggest that NMB can act as a negative regulator of ILC2s even in the presence of abundant IL-33.
[0271] Published studies have shown that NMB-NMBR signaling on hematopoietic cells is required for proper regulation of type 2 cytokine responses. To further evaluate this possibility, novel NMBR-floxed mice were generated and crossed with mice expressing Vav1-Cre. Vav1 is expressed by all hematopoietic cells (22), and crossing this with the novel floxed mouse model results in selective deletion of NMBR on all immune cells. Next, these mice were infected with Nb and type 2 cytokine responses and lung pathology were assessed. IL-5( Fig.11A ) and IL-13( Fig. 11B ) was performed on ILC2s isolated from the BAL of naive or Nb-infected (day 7) Vav1-Cre, NMBRfloxed, or Vav1-Cre-NMBRfloxed mice. Statistical comparisons were performed using the Student t-test. The data suggest that NMBR-mediated signaling on hematopoietic cells is required to regulate type 2 cytokine production. Consistent with previous data, genetic deletion of NMBR on immune cells resulted in significantly elevated IL-5 and IL-13 production by ILC2s isolated from the BAL of infected animals ( Figures 11A-11BLung pathology (H&E staining) was evaluated in naive or Nb-infected (day 7), Vav1-Cre, NMBR-floxed, or Vav1-Cre-NMBR-floxed mice. NMBR-floxed-Vav1-Cre mice showed increased cellular infiltration in the lungs and significantly worse lung pathology ( Fig.12 ). This suggests that NMBR-mediated signaling on hematopoietic cells is required to regulate (e.g., reduce) cellular infiltration in the lung. These genetic approaches further confirm the importance of NMB-NMBR signaling on immune cells in the proper regulation of type 2 cytokine-mediated inflammation.
[0272] The data presented above indicate that NMB is an important negative regulator of lymphocyte responses to type 2 cytokines. To further understand how NMB alters lymphocyte activation, ILC2s were sorted and purified from the lungs of Nb-infected mice and cultured overnight with survival cytokines (IL-2, IL-7) with or without Nmb. Gene expression was then assessed by RNA sequencing analysis. Specifically, after culture, the cells were subjected to RNA sequencing, and genes that were significantly upregulated or downregulated (>1.5 times) by NMB treatment were identified (Table 4). This allows the identification of NMB signaling pathways. The results showed that NMB treatment resulted in upregulation of several genes, including Sprr2a2, Serpinb2, Il1b, Xist, and Tsix, among others. In addition, NMB treatment resulted in downregulation of Hgs2, Nkg7, Klra7, P2rx7, Ly6c2, and Mcpt2, among others. In summary, these data indicate that NMB can operate by affecting the genes listed in Table 4, and that these genes may have great therapeutic potential.
[0273] Table 4: NMB signaling pathway
[0274]
[0275] The mouse models discussed above demonstrate that NMBR expression on CD45+ cells is required for proper regulation of type 2 cytokine-mediated inflammation ( Fig.11A -B, 12). To better identify cell types that may require this signaling pathway to be properly regulated, the expression of NMBR on immune cells in the lung was assessed at steady state and 7 days after Nb. The data indicate that NMBR is expressed by several immune cell populations. ILC2, CD4+ and CD4- lymphocytes, alveolar macrophages, non-alveolar macrophages, eosinophils, and neutrophils were found to express different levels of NMBR ( Fig.13 ). These data suggest that NMB can modulate inflammation through multiple cellular targets.
[0276] Example 10
[0277] Prostaglandin E2 upregulates the expression of NMBR on lymphocytes
[0278] To better define the mechanism by which basophils regulate NMBR expression on lymphocytes, ILC2s were cultured with a combination of survival and activation cytokines in the presence or absence of NMBs or prostaglandin E2 (PGE2). While a combination of IL-25, IL-33, and NMBs failed to upregulate NMBR expression by ILC2s, treatment with PGE2 resulted in significantly upregulated levels of NMBR ( Fig.14 These data suggest that basophils, a well-described source of prostaglandins, may regulate NMBR expression through their release of PGE2.
[0279] In view of the data indicating that PGE2 promotes Nmbr expression by lymphocytes, embodiments of methods of treating a disorder (eg, an inflammatory disorder) may include administering to a subject an effective amount of a Nmb peptide or nucleic acid disclosed herein and an effective amount of PGE2.
[0280] References
[0281] 1.Pulendran B,Artis D.New paradigms in type 2immunity.Science.[Research Support,NIH,Extramural Research Support,Non-USGov't Review].2012Jul 27;337(6093):431-5.
[0282] 2. Henry EK, Inclan-Rico JM, Siracusa MC. Type 2cytokine responses: regulating immunity to helminth parasites and allergic inflammation. CurrPharmacol Rep. 2017 Dec; 3(6): 346-59.
[0283] 3. Wynn TA.Type 2cytokines:mechanisms and therapeutic strategies.NatRev Immunol.[Research Support,NIH,Intramural Review].2015May;15(5):271-82.
[0284] 4.Lloyd CM,Snelgrove RJ.Type 2immunity:Expanding our view.SciImmunol.[Review].2018Jul 6;3(25).
[0285] 5.Rivera A,Siracusa MC,Yap GS,Gause WC.Innate cell communicationkick-starts pathogen-specific immunity.Nat Immunol.[Research Support,N.I.H.,Extramural Research Support,Non-U.S.Gov't Review].2016Apr;17(4):356-63.
[0286] 6.Motomura Y,Morita H,Moro K,Nakae S,Artis D,Endo TA,et al.Basophil-derived interleukin-4controls the function of natural helper cells,a memberof ILC2s,in lung inflammation.Immunity.[Research Support,Non-U.S.Gov't].2014May 15;40(5):758-71.
[0287] 7.Kim BS,Wang K,Siracusa MC,Saenz SA,Brestoff JR,Monticelli LA,etal.Basophils promote innate lymphoid cell responses in inflamed skin.JImmunol.[Clinical Trial Research Support,N.I.H.,Extramural].2014Oct 1;193(7):3717-25.
[0288] 8.Klose CSN,Mahlakoiv T,Moeller JB,Rankin LC,Flamar AL,Kabata H,etal.The neuropeptide neuromedin U stimulates innate lymphoid cells and type 2inflammation.Nature.[Research Support,N.I.H.,Extramural Research Support,Non-U.S.Gov't Research Support,U.S.Gov't,Non-P.H.S.].2017 Sep 14;549(7671):282-6.
[0289] 9.Cardoso V,Chesne J,Ribeiro H,Garcia-Cassani B,Carvalho T,BoucheryT,et al.Neuronal regulation of type 2 innate lymphoid cells via neuromedinU.Nature.[Research Support,Non-U.S.Gov't].2017 Sep 14;549(7671):277-81.
[0290] 10.Kubo M.Mast cells and basophils in allergic inflammation.Curr OpinImmunol.[Review].2018 Jun 28;54:74-9.
[0291] 11.Sullivan BM,Liang HE,Bando JK,Wu D,Cheng LE,McKerrow JK,etal.Genetic analysis of basophil function in vivo.Nat Immunol.2011 Jun;12(6):527-35.
[0292] 12.Anderson KG,Mayer-Barber K,Sung H,Beura L,James BR,Taylor JJ,etal.Intravascular staining for discrimination of vascular and tissueleukocytes.Nature protocols.[Research Support,N.I.H.,Extramural
[0293] Research Support,N.I.H.,Intramural
[0294] Research Support,Non-U.S.Gov't].2014 Jan;9(1):209-22.
[0295] 13.Colonna M.Innate Lymphoid Cells:Diversity,Plasticity,and UniqueFunctions in Immunity.Immunity.[Review].2018 Jun 19;48(6):1104-17.
[0296] 14.Tait Wojno ED,Artis D.Emerging concepts and future challenges ininnate lymphoid cell biology.J Exp Med.[Review Research Support,Non-U.S.Gov'tResearch Support,N.I.H.,Extramural].2016 Oct 17;213(11):2229-48.
[0297] 15.Ohki-Hamazaki H.Neuromedin B.Prog Neurobiol.[Review].2000Oct;62(3):297-312.
[0298] 16.Gajjar S,Patel BM.Neuromedin:An insight into its types,receptorsand therapeutic opportunities.Pharmacol Rep.[Review].2017 Jun;69(3):438-47.
[0299] 17.Ohki-Hamazaki H,Iwabuchi M,Maekawa F.Development and function ofbombesin-like peptides and their receptors.Int J Dev Biol.[Review].2005;49(2-3):293-300.
[0300] 18.Ma Z,Su J,Guo T,Jin M,Li X,Lei Z,et al.Neuromedin B and ItsReceptor:Gene Cloning,Tissue Distribution and Expression Levels of theReproductive Axis in Pigs.PLoS One.[Research Support,Non-U.S.Gov't].2016;11(3):e0151871.
[0301] 19.Halim TY,Steer CA,Matha L,Gold MJ,Martinez-Gonzalez I,McNagny KM,et al.Group 2 innate lymphoid cells are critical for the initiation ofadaptive T helper 2 cell-mediated allergic lung inflammation.Immunity.[Research Support,Non-U.S.Gov't].2014Mar 20;40(3):425-35.
[0302] 20.Martinez-Gonzalez I,Matha L,Steer CA,Ghaedi M,Poon GF,TakeiF.Allergen-Experienced Group 2 Innate Lymphoid Cells Acquire Memory-likeProperties and Enhance Allergic Lung Inflammation.Immunity.[Research Support,Non-U.S.Gov't].2016 Jul 19;45(1):198-208.
[0303] 21.Barlow,J.L.,Bellosi,A.,Hardman,C.S.,Drynan,L.F.,Wong,S.H.,Cruickshank,J.P.,and McKenzie,A.N.(2012).Innate IL-13-producing nuocytesarise during allergic lung inflammation and contribute to airwayshyperreactivity.J Allergy Clin Immunol 129,191-198.e191-194.
[0304] 22.Joseph,C.,Quach,J.M.,Walkley,C.R.,Lane,S.W.,Lo Celso,C.,andPurton,L.E.(2013).Deciphering hematopoietic stem cells in their niches:acritical appraisal of genetic models,lineage tracing,and imagingstrategies.Cell stem cell 13,520-533.
[0305] 23.Motomura,Y.,Morita,H.,Moro,K.,Nakae,S.,Artis,D.,Endo,T.A.,Kuroki,Y.,Ohara,O.,Koyasu,S.,and Kubo,M.(2014).Basophil-derived interleukin-4controls the function of natural helper cells,a member of ILC2s,in lunginflammation.Immunity 40,758-771.
[0306] 24.Neill,DR,Wong,SH,Bellosi,A.,Flynn,RJ,Daly,M.,Langford,TK,Bucks,C.,Kane,CM,Fallon,PG,Pannell,R.,et al.(2010).Nuocytes represent a new innate effector leukocyte that mediates type-2immunity.Nature 464,1367-1370.
[0307] In view of the many possible embodiments to which the disclosed principles may be applied, it should be recognized that the illustrated embodiments are merely examples of the invention and should not be viewed as limiting the scope of the invention. Instead, the scope of the invention is defined by the following claims. Therefore, we claim all inventions that fall within the scope and spirit of these claims as our inventions. Sequence Listing <110> Rutgers University of New Jersey <120> Methods for reducing type 2 cytokine-mediated inflammation using neuromedin peptides <130> 7213-101257-02 <150> US 62 / 741,188 <151> 2018-10-04 <160> 58 <170> PatentIn Version 3.5 <210> 1 <211> 10 <212> PRT <213> Artificial sequence <220> <223> Neuromedin B with C-terminal amidation <220> <221> MOD_RES <222> (10)..(10) <223> Amidation <400> 1 Gly Asn Leu Trp Ala Thr Gly His Phe Met 1 5 10 <210> 2 <211> 30 <212> DNA <213> Homo sapiens <400> 2 ggcaacctct gggccaccgg tcacttcatg 30 <210> 3 <211> 10 <212> PRT <213> Artificial sequence <220> <223> Variant neuromedin B peptide <220> <221> MOD_RES <222> (10)..(10) <223> Amidation <400> 3 Ala Asn Leu Trp Ala Thr Gly His Phe Met 1 5 10 <210> 4 <211> 10 <212> PRT <213> Artificial sequence <220> <223> Variant neuromedin B peptide <220> <221> MOD_RES <222> (10)..(10) <223> Amidation <400> 4 Gly Ala Leu Trp Ala Thr Gly His Phe Met 1 5 10 <210> 5 <211> 10 <212> PRT <213> Artificial sequence <220> <223> Variant neuromedin B peptide <220> <221> MOD_RES <222> (10)..(10) <223> Amidation <400> 5 Gly Asn Ala Trp Ala Thr Gly His Phe Met 1 5 10 <210> 6 <211> 10 <212> PRT <213> Artificial sequence <220> <223> Variant neuromedin B peptide <220> <221> MOD_RES <222> (10)..(10) <223> Amidation <400> 6 Gly Asn Leu Ala Ala Thr Gly His Phe Met 1 5 10 <210> 7 <211> 10 <212> PRT <213> Artificial sequence <220> <223> Variant neuromedin B peptide <220> <221> MOD_RES <222> (10)..(10) <223> Amidation <400> 7 Gly Asn Leu Trp Ala Ala Gly His Phe Met 1 5 10 <210> 8 <211> 10 <212> PRT <213> Artificial sequence <220> <223> Variant neuromedin B peptide <220> <221> MOD_RES <222> (10)..(10) <223> Amidation <400> 8 Gly Asn Leu Trp Ala Thr Ala His Phe Met 1 5 10 <210> 9 <211> 10 <212> PRT <213> Artificial sequence <220> <223> Variant neuromedin B peptide <220> <221> MOD_RES <222> (10)..(10) <223> Amidation <400> 9 Gly Asn Leu Trp Ala Thr Gly Ala Phe Met 1 5 10 <210> 10 <211> 10 <212> PRT <213> Artificial sequence <220> <223> Variant neuromedin B peptide <220> <221> MOD_RES <222> (10)..(10) <223> Amidation <400> 10 Gly Asn Leu Trp Ala Thr Gly His Ala Met 1 5 10 <210> 11 <211> 10 <212> PRT <213> Artificial sequence <220> <223> Variant neuromedin B peptide <220> <221> MOD_RES <222> (10)..(10) <223> Amidation <400> 11 Gly Asn Leu Trp Ala Thr Gly His Phe Ala 1 5 10 <210> 12 <211> 10 <212> PRT <213> Artificial sequence <220> <223> Variant neuromedin B peptide <220> <221> Acetylation <222> (1) <220> <221> MOD_RES <222> (10)..(10) <223> Amidation <400> 12 Gly Leu Leu Trp Ala Thr Gly His Phe Met 1 5 10 <210> 13 <211> 10 <212> PRT <213> Artificial sequence <220> <223> Variant neuromedin B peptide <220> <221> MISC_FEATURE <222> (1) <223> Methanesulfonyl <220> <221> MOD_RES <222> (10)..(10) <223> Amidation <400> 13 Gly Asn Leu Trp Ala Thr Gly His Phe Met 1 5 10 <210> 14 <211> 10 <212> PRT <213> Artificial sequence <220> <223> Variant neuromedin B peptide <220> <221> MISC_FEATURE <222> (10)..(10) <223> N-methylation <400> 14 Gly Asn Leu Trp Ala Thr Gly His Phe Met 1 5 10 <210> 15 <211> 10 <212> PRT <213> Artificial sequence <220> <223> Variant neuromedin B peptide <220> <221> MOD_RES <222> (10)..(10) <223> Free acid <220> <221> MOD_RES <222> (10)..(10) <400> 15 Gly Asn Leu Trp Ala Thr Gly His Phe Met 1 5 10 <210> 16 <211> 9 <212> PRT <213> Artificial sequence <220> <223> Variant neuromedin B peptide <220> <221> MOD_RES <222> (9)..(9) <223> Amidation <400> 16 Asn Leu Trp Ala Thr Gly His Phe Met 1 5 <210> 17 <211> 9 <212> PRT <213> Artificial sequence <220> <223> Variant neuromedin B peptide <220> <221> MOD_RES <222> (9)..(9) <223> Amidation <400> 17 Gly Leu Trp Ala Thr Gly His Phe Met 1 5 <210> 18 <211> 9 <212> PRT <213> Artificial sequence <220> <223> Variant neuromedin B peptide <220> <221> MOD_RES <222> (9)..(9) <223> Amidation <400> 18 Gly Asn Trp Ala Thr Gly His Phe Met 1 5 <210> 19 <211> 9 <212> PRT <213> Artificial sequence <220> <223> Variant neuromedin B peptide <220> <221> MOD_RES <222> (9)..(9) <223> Amidation <400> 19 Gly Asn Leu Ala Thr Gly His Phe Met 1 5 <210> 20 <211> 9 <212> PRT <213> Artificial sequence <220> <223> Variant neuromedin B peptide <220> <221> MOD_RES <222> (9)..(9) <223> Amidation <400> 20 Gly Asn Leu Trp Thr Gly His Phe Met 1 5 <210> twenty one <211> 9 <212> PRT <213> Artificial sequence <220> <223> Variant neuromedin B peptide <220> <221> MOD_RES <222> (9)..(9) <223> Amidation <400> twenty one Gly Asn Leu Trp Ala Gly His Phe Met 1 5 <210> twenty two <211> 9 <212> PRT <213> Artificial sequence <220> <223> Variant neuromedin B peptide <220> <221> MOD_RES <222> (9)..(9) <223> Amidation <400> twenty two Gly Asn Leu Trp Ala Thr His Phe Met 1 5 <210> twenty three <211> 9 <212> PRT <213> Artificial sequence <220> <223> Variant neuromedin B peptide <220> <221> MOD_RES <222> (9)..(9) <223> Amidation <400> twenty three Gly Asn Leu Trp Ala Thr Gly Phe Met 1 5 <210> twenty four <211> 9 <212> PRT <213> Artificial sequence <220> <223> Variant neuromedin B peptide <220> <221> MOD_RES <222> (9)..(9) <223> Amidation <400> twenty four Gly Asn Leu Trp Ala Thr Gly His Met 1 5 <210> 25 <211> 9 <212> PRT <213> Artificial sequence <220> <223> Variant neuromedin B peptide <220> <221> MOD_RES <222> (9)..(9) <223> Amidation <400> 25 Gly Asn Leu Trp Ala Thr Gly His Phe 1 5 <210> 26 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Variant neuromedin B peptide <220> <221> MOD_RES <222> (8) <223> Amidation <400> 26 Gly Asn Leu Trp Ala Thr Gly His 1 5 <210> 27 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Variant neuromedin B peptide <220> <221> MOD_RES <222> (8) <223> Amidation <400> 27 Asn Leu Trp Ala Thr Gly His Phe 1 5 <210> 28 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Variant neuromedin B peptide <220> <221> MOD_RES <222> (8) <223> Amidation <400> 28 Leu Trp Ala Thr Gly His Phe Met 1 5 <210> 29 <211> 7 <212> PRT <213> Artificial sequence <220> <223> Variant neuromedin B peptide <220> <221> MOD_RES <222> (7) <223> Amidation <400> 29 Gly Asn Leu Trp Ala Thr Gly 1 5 <210> 30 <211> 7 <212> PRT <213> Artificial sequence <220> <223> Variant neuromedin B peptide <220> <221> MOD_RES <222> (7) <223> Amidation <400> 30 Asn Leu Trp Ala Thr Gly His 1 5 <210> 31 <211> 7 <212> PRT <213> Artificial sequence <220> <223> Variant neuromedin B peptide <220> <221> MOD_RES <222> (7) <223> Amidation <400> 31 Leu Trp Ala Thr Gly His Phe 1 5 <210> 32 <211> 7 <212> PRT <213> Artificial sequence <220> <223> Variant neuromedin B peptide <220> <221> MOD_RES <222> (7) <223> Amidation <400> 32 Trp Ala Thr Gly His Phe Met 1 5 <210> 33 <211> 6 <212> PRT <213> Artificial sequence <220> <223> Variant neuromedin B peptide <220> <221> MOD_RES <222> (6) <223> Amidation <400> 33 Gly Asn Leu Trp Ala Thr 1 5 <210> 34 <211> 6 <212> PRT <213> Artificial sequence <220> <223> Variant neuromedin B peptide <220> <221> MOD_RES <222> (6) <223> Amidation <400> 34 Asn Leu Trp Ala Thr Gly 1 5 <210> 35 <211> 6 <212> PRT <213> Artificial sequence <220> <223> Variant neuromedin B peptide <220> <221> MOD_RES <222> (6) <223> Amidation <400> 35 Leu Trp Ala Thr Gly His 1 5 <210> 36 <211> 6 <212> PRT <213> Artificial sequence <220> <223> Variant neuromedin B peptide <220> <221> MOD_RES <222> (6) <223> Amidation <400> 36 Trp Ala Thr Gly His Phe 1 5 <210> 37 <211> 6 <212> PRT <213> Artificial sequence <220> <223> Variant neuromedin B peptide <220> <221> MOD_RES <222> (6) <223> Amidation <400> 37 Ala Thr Gly His Phe Met 1 5 <210> 38 <211> 10 <212> PRT <213> Homo sapiens <400> 38 Gly Asn His Trp Ala Val Gly His Leu Met 1 5 10 <210> 39 <211> 18 <212> PRT <213> Artificial sequence <220> <223> Cell Penetrating Peptides <400> 39 Arg Gly Gly Arg Leu Ser Tyr Ser Arg Arg Arg Phe Ser Thr Ser Thr 1 5 10 15 Gly Arg <210> 40 <211> 10 <212> PRT <213> Artificial sequence <220> <223> Cell Penetrating Peptides <400> 40 Arg Arg Leu Ser Tyr Ser Arg Arg Arg Phe 1 5 10 <210> 41 <211> 12 <212> PRT <213> Artificial sequence <220> <223> Cell Penetrating Peptides <400> 41 Pro Ile Arg Arg Arg Lys Lys Leu Arg Arg Leu Lys 1 5 10 <210> 42 <211> 12 <212> PRT <213> Artificial sequence <220> <223> Cell Penetrating Peptides <400> 42 Arg Arg Gln Arg Arg Thr Ser Lys Leu Met Lys Arg 1 5 10 <210> 43 <211> 15 <212> PRT <213> Artificial sequence <220> <223> Cell Penetrating Peptides <400> 43 Arg Arg Arg Arg Asn Arg Thr Arg Arg Asn Arg Arg Arg Val Arg 1 5 10 15 <210> 44 <211> 19 <212> PRT <213> Artificial sequence <220> <223> Cell Penetrating Peptides <400> 44 Lys Met Thr Arg Ala Gln Arg Arg Ala Ala Ala Arg Arg Asn Arg Trp 1 5 10 15 Thr Ala Arg <210> 45 <211> 13 <212> PRT <213> Artificial sequence <220> <223> Cell Penetrating Peptides <400> 45 Thr Arg Arg Gln Arg Thr Arg Arg Ala Arg Arg Asn Arg 1 5 10 <210> 46 <211> 13 <212> PRT <213> Artificial sequence <220> <223> Cell Penetrating Peptides <400> 46 Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg Pro Pro Gln 1 5 10 <210> 47 <211> 13 <212> PRT <213> Artificial sequence <220> <223> Cell Penetrating Peptides <400> 47 Gly Arg Arg Arg Arg Arg Arg Arg Arg Arg Pro Pro Gln 1 5 10 <210> 48 <211> 15 <212> PRT <213> Artificial sequence <220> <223> Cell Penetrating Peptides <400> 48 Arg Gln Ile Lys Trp Phe Gln Asn Arg Arg Met Lys Trp Lys Lys 1 5 10 15 <210> 49 <211> 17 <212> PRT <213> Artificial sequence <220> <223> Cell Penetrating Peptides <400> 49 Lys Leu Ala Leu Lys Leu Ala Leu Lys Leu Ala Leu Ala Leu Lys Leu 1 5 10 15 Ala <210> 50 <211> 27 <212> PRT <213> Artificial sequence <220> <223> Cell Penetrating Peptides <400> 50 Met Gly Leu Gly Leu His Leu Leu Val Leu Ala Ala Ala Leu Gln Gly 1 5 10 15 Ala Trp Ser Gln Pro Lys Lys Lys Arg Lys Val 20 25 <210> 51 <211> 27 <212> PRT <213> Artificial sequence <220> <223> Cell Penetrating Peptides <400> 51 Gly Ala Leu Phe Leu Gly Trp Leu Gly Ala Ala Gly Ser Thr Met Gly 1 5 10 15 Ala Trp Ser Gln Pro Lys Lys Lys Arg Lys Val 20 25 <210> 52 <211> 27 <212> PRT <213> Artificial sequence <220> <223> Cell Penetrating Peptides <220> <221> MISC_FEATURE <222> (1) <223> Acetylation <220> <221> MISC_FEATURE <222> (27)..(27) <223> Mercaptoethylamination <400> 52 Gly Ala Leu Phe Leu Gly Phe Leu Gly Ala Ala Gly Ser Thr Met Gly 1 5 10 15 Ala Trp Ser Gln Pro Lys Lys Lys Arg Lys Val 20 25 <210> 53 <211> 27 <212> PRT <213> Artificial sequence <220> <223> Cell Penetrating Peptides <220> <221> MISC_FEATURE <222> (1) <223> Acetylation <220> <221> MISC_FEATURE <222> (27)..(27) <223> Mercaptoethylamination <400> 53 Gly Ala Leu Phe Leu Gly Phe Leu Gly Ala Ala Gly Ser Thr Met Gly 1 5 10 15 Ala Trp Ser Gln Pro Lys Ser Lys Arg Lys Val 20 25 <210> 54 <211> twenty one <212> PRT <213> Artificial sequence <220> <223> Cell Penetrating Peptides <220> <221> MISC_FEATURE <222> (1) <223> Acetylation <220> <221> MISC_FEATURE <222> (21)..(21) <223> Mercaptoethylamination <400> 54 Lys Glu Thr Trp Phe Glu Thr Trp Phe Thr Glu Trp Ser Gln Pro Lys 1 5 10 15 Lys Lys Arg Lys Val 20 <210> 55 <211> 27 <212> PRT <213> Artificial sequence <220> <223> Cell Penetrating Peptides <400> 55 Gly Trp Thr Leu Asn Ser Ala Gly Tyr Leu Leu Gly Lys Ile Asn Leu 1 5 10 15 Lys Ala Leu Ala Ala Leu Ala Lys Lys Ile Leu 20 25 <210> 56 <211> twenty one <212> PRT <213> Artificial sequence <220> <223> Cell Penetrating Peptides <220> <221> MISC_FEATURE <222> (1) <223> Acetylation <220> <221> MISC_FEATURE <222> (21)..(21) <223> Mercaptoethylamination <400> 56 Lys Glu Thr Trp Trp Glu Thr Trp Trp Thr Glu Trp Ser Gln Pro Lys 1 5 10 15 Lys Lys Arg Lys Val 20 <210> 57 <211> 11 <212> PRT <213> Artificial sequence <220> <223> Cell Penetrating Peptides <400> 57 Tyr Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg 1 5 10 <210> 58 <211> 6 <212> PRT <213> Artificial sequence <220> <223> Cell Penetrating Peptides <400> 58 Pro Phe Val Tyr Leu Ile 1 5
Claims
1. Use of neuromedin B (Nmb) protein or a nucleic acid molecule encoding Nmb protein in the preparation of a medicament for treating allergic airway inflammation in a mammalian subject, Wherein the Nmb protein comprises SEQ ID NO:
1.
2. The method according to claim 1, wherein the Nmb protein consists of SEQ ID NO:
1.
3. The method according to claim 1, wherein the nucleic acid molecule comprises SEQ ID NO:
2.
4. The method according to claim 3, wherein the nucleic acid molecule consists of SEQ ID NO:
2.
5. The use according to any one of claims 3 or 4, wherein the nucleic acid molecule is part of a plasmid or a viral vector. The use according to claim 5 , wherein the viral vector is a lentiviral vector or an adeno-associated viral vector.
7. The use according to any one of claims 1 to 4, wherein the nucleic acid molecule is operably linked to a promoter.
8. The use according to any one of claims 1 to 4, wherein the medicament is for injection, oral administration, inhalation administration or topical administration.
9. The use according to any one of claims 1 to 4, wherein the mammalian subject is a human subject.
10. The use according to any one of claims 1 to 4, wherein the medicament is for at least two separate administrations of a therapeutically effective amount of the Nmb protein or the nucleic acid molecule.
11. The use according to claim 10, wherein the at least two separate administrations are separated by at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 1 month, at least 2 months, at least 3 months, at least 6 months, at least 9 months or at least one year.
12. The use according to any one of claims 1 to 4, wherein the medicament is for administration within 5 minutes, within 10 minutes, within 30 minutes, within 1 hour, within 2 hours, within 3 hours, within 4 hours, within 5 hours, within 6 hours, within 12 hours, within 24 hours, within 48 hours, within 72 hours, within 96 hours, within 1 week, within 2 weeks, within 3 weeks, within 4 weeks, within 1 month, within 2 months or within 3 months of the onset of the allergic airway inflammation.
13. The use according to any one of claims 1 to 4, wherein the medicament is for administration in combination with a therapeutically effective amount of another therapeutic agent.
14. The use according to any one of claims 1 to 4, wherein the medicament reduces inflammation, reduces IL-5 activity, reduces IL-13 activity, reduces ILC2 response, reduces eosinophilia, or a combination thereof.
15. The use according to any one of claims 1 to 4, wherein the Nmb protein is a fusion protein comprising the Nmb protein and a cell penetrating peptide or an immunoglobulin Fc domain.
16. The use according to any one of claims 1 to 4, wherein the drug upregulation comprises Sprr2a2 , S erpinb2 , Il1b , Xist and Tsix The expression of one or more genes in the first group.
17. The use according to any one of claims 1 to 4, wherein the drug downregulation comprises Hgs2 , Nkg7 , Klra7 , P2rx , Ly6c2 and Mcpt2 The expression of one or more genes in the second group of genes.
18. The use according to any one of claims 1 to 4, wherein the medicament reduces the level of cellular infiltration in the lungs of the subject.
19. The use according to any one of claims 1 to 4, wherein the medicament is for combined administration with a therapeutically effective amount of prostaglandin E2 (PGE2).
Citation Information
Patent Citations
Bioabsorbable pharmaceutical formulation
US20060246139A1
Method of treating pulmonary disease with interferons
US20070065367A1
Compositions for administering RNAIII-inhibiting peptides
US20070092575A1
Nanoparticle based stabilization of ir fluorescent dyes
US20070148074A1
Nanodispersions
US20090175953A1