Method for quantitative determination of phosphoethanolamine, oxidoreductase for quantitative determination, composition for quantitative determination, kit for quantitative determination, and sensor for quantitative determination

Abstract

A novel quantitative method, an enzyme for quantitative determination, a quantitative kit, and a quantitative sensor for quantitative determination of the concentration of EAP, which is a biomarker of depression, are provided. A quantitative method for quantifying phosphoethanolamine is provided, wherein an oxidoreductase is added to a sample containing phosphoethanolamine. A mediator can be reduced by adding the oxidoreductase, and the reduced mediator can be reacted with a reagent to determine the concentration of the phosphoethanolamine. Alternatively, as the oxidoreductase, hydrogen peroxide generated by adding an oxidase can be reacted with a reagent to determine the concentration of the phosphoethanolamine.

Description

Technical Field

[0001] The present invention relates to a quantitative method for phosphoethanolamine, an oxidoreductase for quantitative determination, a composition for quantitative determination, a kit for quantitative determination or a sensor for quantitative determination. Background Art

[0002] Human blood contains phosphoethanolamine (EAP). Patent Document 1 describes that EAP is a biomarker for diagnosing depression. Non-Patent Document 1 describes that depression can be diagnosed using an EAP concentration of 1.5 μM or less as a reference value.

[0003] In addition, Patent Document 2 describes a method for measuring the EAP concentration using EAP phosphorylase and acetaldehyde dehydrogenase.

[0004] (Prior art literature)

[0005] (Patent Document)

[0006] Patent Document 1: International Publication No. 2011 / 019072

[0007] Patent Document 2: International Publication No. 2013 / 069645

[0008] (Non-patent literature)

[0009] Non-patent literature 1: Kawamura N, "Plasma metabolome analysis of patients with major depressive disorder." Psychiatry Clin Neurosci. 2018 May; 72(5): 349-361 Summary of the invention

[0010] (Problems to be solved by the invention)

[0011] To date, no method for measuring EAP concentration other than the method disclosed in Patent Document 2 has been reported, and development of a new measuring method has been desired.

[0012] One of the objects of the present invention is to provide a new quantification method, an enzyme for quantification, a composition for quantification, a kit for quantification, or a sensor for quantification for quantifying the concentration of EAP, which is a biomarker for depression.

[0013] (Measures taken to solve the problem)

[0014] According to one embodiment of the present invention, there is provided a method for quantifying phosphoethanolamine, comprising adding an oxidoreductase to a sample containing phosphoethanolamine.

[0015] The concentration of phosphoethanolamine can be determined by adding an oxidoreductase to reduce the mediator and reacting the reduced mediator with a reagent.

[0016] According to one embodiment of the present invention, there is provided an oxidoreductase used in a method for quantifying phosphoethanolamine.

[0017] The oxidoreductase may be an oxidoreductase belonging to EC number 1.4 or EC number 1.5.

[0018] The oxidoreductase belonging to EC number 1.4 or EC number 1.5 can be an oxidoreductase selected from primary amine dehydrogenase, monoamine dehydrogenase, diamine dehydrogenase, polyamine dehydrogenase, ethanolamine dehydrogenase, tyramine dehydrogenase, phenylethylamine dehydrogenase, benzylamine dehydrogenase, histamine dehydrogenase, 5-hydroxytryptamine dehydrogenase, spermine dehydrogenase, spermidine dehydrogenase, β-alanine dehydrogenase, γ-aminobutyric acid (GABA) dehydrogenase, taurine dehydrogenase, cadaverine dehydrogenase and agmatine dehydrogenase.

[0019] Taurine dehydrogenase may also comprise a large subunit.

[0020] The oxidoreductase belonging to EC number 1.4 or EC number 1.5 may also be an oxidase belonging to EC number 1.4.3 or EC number 1.5.3.

[0021] The oxidase can be an oxidase selected from primary amine oxidase, monoamine oxidase, diamine oxidase, polyamine oxidase, ethanolamine oxidase, tyramine oxidase, phenylethylamine oxidase, benzylamine oxidase, histamine oxidase, 5-hydroxytryptamine oxidase, spermine oxidase, spermidine oxidase, β-alanine oxidase, γ-aminobutyric acid (GABA) oxidase, taurine oxidase, cadaverine oxidase and agmatine oxidase.

[0022] According to one embodiment of the present invention, there is provided a composition for determining the amount of phosphoethanolamine containing any one of the above-mentioned oxidoreductases.

[0023] The composition for determining the amount of phosphoethanolamine may contain a medium that is reduced by adding an oxidoreductase and a reagent that reacts with the reduced medium.

[0024] According to one embodiment of the present invention, there is provided a kit for quantifying phosphoethanolamine, comprising any one of the above-mentioned oxidoreductases, a medium that is reduced by adding the oxidoreductase, and a reagent that reacts with the reduced medium.

[0025] In the quantitative method of phosphoethanolamine, the oxidoreductase is an oxidase, and the concentration of phosphoethanolamine can be determined by reacting hydrogen peroxide generated by adding the oxidase with the reagent.

[0026] According to one embodiment of the present invention, there is provided an oxidase used as an oxidoreductase in a method for determining phosphoethanolamine.

[0027] The oxidase may be an oxidase belonging to EC number 1.4.3 or EC number 1.5.3.

[0028] The oxidase can be an oxidase selected from primary amine oxidase, monoamine oxidase, diamine oxidase, polyamine oxidase, ethanolamine oxidase, tyramine oxidase, phenylethylamine oxidase, benzylamine oxidase, histamine oxidase, 5-hydroxytryptamine oxidase, spermine oxidase, spermidine oxidase, β-alanine oxidase, γ-aminobutyric acid (GABA) oxidase, taurine oxidase, cadaverine oxidase and agmatine oxidase.

[0029] According to one embodiment of the present invention, there is provided a composition for determining the amount of phosphoethanolamine containing any one of the above-mentioned oxidases.

[0030] The composition for determining the amount of phosphoethanolamine may contain a reagent that reacts with hydrogen peroxide generated by adding an oxidase.

[0031] According to one embodiment of the present invention, there is provided a kit for quantifying phosphoethanolamine, comprising any one of the above-mentioned oxidases and a reagent that reacts with hydrogen peroxide generated by adding the oxidase.

[0032] According to one embodiment of the present invention, there is provided an electrode comprising any one of the oxidoreductases described above or any one of the oxidases described above.

[0033] According to one embodiment of the present invention, there is provided a sensor chip including the electrode as a working electrode.

[0034] According to one embodiment of the present invention, a sensor including the sensor chip is provided.

[0035] (Effects of the Invention)

[0036] According to the present invention, there are provided a novel quantification method, a quantification enzyme, a quantification composition, a quantification kit, or a quantification sensor for quantifying the concentration of EAP, which is a biomarker for depression. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 This is a graph showing the correlation between the EAP concentration and the enzyme activity (U / ml) in Examples of the present invention.

[0038] Figure 2 is the relationship between the EAP concentration and the absorbance (A 438 , mAbs).

[0039] Figure 3 This is a graph showing the pH dependency of the enzymatic reaction in Examples of the present invention.

[0040] Figure 4 is the relationship between the EAP concentration and the absorbance (A 555 , mAbs).

[0041] Figure 5 is the relationship between the EAP concentration and the absorbance (A 555 , mAbs).

[0042] Figure 6 This is a graph showing the relationship between the EAP concentration and the current value (μA) in Examples of the present invention.

[0043] Figure 7 This is a graph showing the relationship between the EAP concentration and the current value (μA) in Examples of the present invention.

[0044] Figure 8 (a) is a schematic diagram of a sensor chip 10 according to one embodiment of the present invention. Figure 8 (b) to (d) are schematic diagrams showing components constituting the sensor chip 10 .

[0045] Fig. 9 (a) is a schematic diagram of a sensor 100 according to one embodiment of the present invention, Fig. 9 (b) is a block diagram of the sensor 100 according to one embodiment of the present invention. DETAILED DESCRIPTION

[0046] Hereinafter, the novel quantitative method, the enzyme for quantitative use, the quantitative composition, the quantitative kit, and the quantitative sensor of the present invention for quantitatively determining the concentration of EAP, which is a biomarker for depression, will be described. However, the novel quantitative method, the enzyme for quantitative use, the quantitative composition, the quantitative kit, and the quantitative sensor of the present invention for quantitatively determining the concentration of EAP, which is a biomarker for depression, are not to be interpreted as limited to the contents of the embodiments and examples shown below.

[0047] In one embodiment, the oxidoreductase used in the present invention is a dehydrogenase that acts on EAP as a substrate. The oxidoreductase used in the present invention is believed to be most suitable for use with EAP dehydrogenase. However, as of the time of filing this application, EAP dehydrogenase has not yet been identified.

[0048] Therefore, a dehydrogenase that effectively acts on a substrate having a structure similar to that of EAP can be used as a substitute for the oxidoreductase used in the present invention. A similar structure refers to a physicochemical structure that is considered to be similar from the viewpoints of structure, electronics, stereochemistry, and the like.

[0049] For example, as a substrate similar in structure to EAP, there is a substrate having a CH-NH2 bond or a CH-NH bond, and as an enzyme for the substrate, there is an oxidoreductase belonging to EC number 1.4 or EC number 1.5.

[0050] For example, as oxidoreductases belonging to EC number 1.4 or EC number 1.5, there are primary amine dehydrogenase, monoamine dehydrogenase, diamine dehydrogenase, polyamine dehydrogenase, ethanolamine dehydrogenase, tyramine dehydrogenase, phenylethylamine dehydrogenase, benzylamine dehydrogenase, histamine dehydrogenase, 5-hydroxytryptamine dehydrogenase, spermine dehydrogenase, spermidine dehydrogenase, β-alanine dehydrogenase, γ-aminobutyric acid (GABA) dehydrogenase, taurine dehydrogenase, cadaverine dehydrogenase, and agmatine dehydrogenase. In particular, as a substrate similar in structure to EAP, there is taurine, and as a dehydrogenase for this substrate, taurine dehydrogenase (TDH) can be preferably used.

[0051] The oxidoreductase used in the present invention may be a polymer or a monomer. For example, in the case where a dehydrogenation reaction in which hydrogen is extracted from a substrate and transferred to a hydrogen acceptor can be catalyzed by only one of several subunits constituting the oxidoreductase as a polymer (monomer), the oxidoreductase used in the present invention may be a polymer or the subunit (monomer).

[0052] More specifically, the TDH used in the present invention comprises a large subunit (LaTDH) having a base sequence of sequence number 2 and a small subunit (SmTDH) having a base sequence of sequence number 4, and the dehydrogenation reaction of extracting hydrogen from a substrate and transferring it to a hydrogen acceptor can be catalyzed not only by a polymer having LaTDH and SmTDH, but also by LaTDH alone. Therefore, the TDH used in the present invention can have LaTDH and SmTDH, or can have only LaTDH.

[0053] Furthermore, the oxidoreductase belonging to EC number 1.4 or EC number 1.5 may be an oxidase belonging to EC number 1.4.3 or EC number 1.5.3.

[0054] For example, as oxidases belonging to EC number 1.4.3 or EC number 1.5.3, there are primary amine oxidase, monoamine oxidase, diamine oxidase, polyamine oxidase, ethanolamine oxidase, tyramine oxidase, phenylethylamine oxidase, benzylamine oxidase, histamine oxidase, 5-hydroxytryptamine oxidase, spermine oxidase, spermidine oxidase, β-alanine oxidase, γ-aminobutyric acid (GABA) oxidase, taurine oxidase, cadaverine oxidase, and Agmatine Oxidase. In particular, phenylethylamine oxidase (PEAOX) can be preferably used.

[0055] The reaction conditions of the oxidoreductase used in the present invention can be any conditions that act on EAP and effectively catalyze the oxidation reaction. However, enzymes generally have an optimum temperature and an optimum pH for exhibiting the highest activity. Therefore, the reaction conditions are preferably near the optimum temperature and the optimum pH. For example, the reaction conditions of TDH can preferably use the temperature 30°C and pH 8.5 described later, but are not limited thereto. In addition, for example, the reaction conditions of PEAOX can preferably use the temperature 37°C and pH 8.5 described later, but are not limited thereto.

[0056] The oxidoreductase of the present invention may be an oxidoreductase produced by a microorganism existing in nature, or may be an oxidoreductase produced by a transformed microorganism. From the viewpoint of efficiently expressing a large amount of enzyme, the enzyme can be efficiently expressed in a large amount by using a transformed microorganism.

[0057] The microorganism that produces the oxidoreductase of the present invention is not particularly limited, but preferably used are Paracoccus, Methylarcula, Martelella, Rhodobacter, Roseobacter, Gemmobacter, Arthrobacter, Paenarthrobacter, Pseudarthrobacter, Cryobacterium, Bacillus, Sinomonas, Tersicoccus, CoxiellaKocuria, Micrococus, Brevibacterium, Zhihengliuella, Citricoccus, Geodematophilus, Rhodococcus, Amycolatopsis, Nocardia, Modestobacter, Glutamicibacter, Psudonocardia, Gordonia, Streptomyces , Geodermatophilus, Cellulomonas, Mycobacterium, Mycolicibacterium, Psudoglutamicibacter, Corynebacterium, Nocardiopsis, Nonomuraea, Saccharomonospora, Prauserella, Amnibacterium, Actinobacteria, Tripterygium wilfordii SaccharopolysporaSaccharopolyspora, Leifsonia, Agromyces, Streptacidiphilus, Xylanimonas, Tsukamurella, Williamsia, Asanoa, Plantactinospora, Salinispora, Agreia, Cryocola , Curtobacterium, Murinocardiopsis, Subtercola, Microbispora, Jiangella, Blastococcus, Actinomadura, Actinoplanes, Catenulispora, Lichtheimia, and Syncephalastrum.

[0058] For example, the oxidoreductase of the present invention can be TDH produced by Paracoccus denitrificans, or TDH produced by Escherichia coli transformed by a plasmid containing the TDH gene from Bifidobacterium, but by using Escherichia coli transformed by a plasmid containing the TDH gene from Bifidobacterium, the oxidoreductase can be efficiently expressed in large quantities.

[0059] In addition, for example, the oxidoreductase of the present invention can be PEAOX produced by Arthrobacter globiformis, or it can be PEAOX produced by Escherichia coli transformed by the action of a plasmid containing the PEAOX gene from Arthrobacter globiformis, but by using Escherichia coli transformed by the action of a plasmid containing the PEAOX gene from Arthrobacter globiformis, the oxidoreductase can be efficiently expressed in large quantities.

[0060] In addition, for example, the oxidoreductase of the present invention can be an amine oxidase (LcAOX) produced by Lichtheimiacorymbifera, or it can be an amine oxidase produced by Escherichia coli transformed by the action of a plasmid containing the LcAOX gene from Lichtheimiacorymbifera having the base sequence of sequence number 16, but by using Escherichia coli transformed by the action of a plasmid containing the LcAOX gene from Lichtheimiacorymbifera, the oxidoreductase can be efficiently expressed in large quantities.

[0061] In addition, for example, the oxidoreductase of the present invention can be a hypothetical protein (LrHP) produced by Lichtheimia ramosa, or it can be a hypothetical protein produced by Escherichia coli transformed by a plasmid containing the LrHP gene from Lichtheimia ramosa having the base sequence of sequence number 21, but by using Escherichia coli transformed by a plasmid containing the LrHP gene from Lichtheimia ramosa, the oxidoreductase can be efficiently expressed in large quantities.

[0062] In addition, for example, the oxidoreductase of the present invention can be an amine oxidase (SrAOX3925) produced by Syncephalastrum racemosum, or it can be an amine oxidase produced by Escherichia coli transformed by the action of a plasmid containing the SrAOX3925 gene from Syncephalastrum racemosum having the base sequence of sequence number 26, but by using Escherichia coli transformed by the action of a plasmid containing the SrAOX3925 gene from Syncephalastrum racemosum, the oxidoreductase can be efficiently expressed in large quantities.

[0063] In addition, for example, the oxidoreductase of the present invention can be an amine oxidase (SrAOX3926) produced by Synechocystis racemosus, or it can be an amine oxidase produced by Escherichia coli transformed by the action of a plasmid containing the SrAOX3926 gene from Synechocystis racemosus having the base sequence of sequence number 31, but by using Escherichia coli transformed by the action of a plasmid containing the SrAOX3926 gene from Synechocystis racemosus, the oxidoreductase can be efficiently expressed in large quantities.

[0064] In addition, for example, the oxidoreductase of the present invention can be the ethanolamine oxidase (SrEAOX) produced by Synechocystis racemosus, or it can be the ethanolamine oxidase produced by Escherichia coli transformed by the action of a plasmid containing the SrEAOX gene from Synechocystis racemosus having the base sequence of sequence number 36, but by using Escherichia coli transformed by the action of a plasmid containing the SrEAOX gene from Synechocystis racemosus, the oxidoreductase can be efficiently expressed in large quantities.

[0065] In one embodiment, the oxidoreductase of the present invention can be an oxidoreductase having a high sequence identity (e.g., 70% or more, 71% or more, 72% or more, 73% or more, 74% or more, 75% or more, 76% or more, 77% or more, 78% or more, 79% or more, 80% or more, 81% or more, 82% or more, 83% or more, 84% or more, 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, for example, 99% or more) to the amino acid sequence of LaTDH produced by Paracoccus denitrificans (SEQ ID NO: 1), and an oxidoreductase having an amino acid sequence in which one or more amino acids are altered or mutated, or are deleted, substituted, added and / or inserted.

[0066] In one embodiment, the oxidoreductase of the present invention can be listed as an oxidoreductase having a high sequence identity (e.g., 70% or more, 71% or more, 72% or more, 73% or more, 74% or more, 75% or more, 76% or more, 77% or more, 78% or more, 79% or more, 80% or more, 81% or more, 82% or more, 83% or more, 84% or more, 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, for example, 99% or more) to the amino acid sequence of PEAOX produced by Arthrobacter sphaeroides (SEQ ID NO: 9), and an oxidoreductase having an amino acid sequence in which one or more amino acids are changed or mutated, or are deleted, substituted, added and / or inserted.

[0067] In one embodiment, the oxidoreductase of the present invention can be listed as an oxidoreductase having a high sequence identity (e.g., 70% or more, 71% or more, 72% or more, 73% or more, 74% or more, 75% or more, 76% or more, 77% or more, 78% or more, 79% or more, 80% or more, 81% or more, 82% or more, 83% or more, 84% or more, 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, for example, 99% or more) to the amino acid sequence of LcAOX produced by Mucor agaricus (SEQ ID NO: 15), and an oxidoreductase having an amino acid sequence in which one or more amino acids are changed or mutated, or are deleted, substituted, added and / or inserted.

[0068] In one embodiment, the oxidoreductase of the present invention can be listed as an oxidoreductase having a high sequence identity (e.g., 70% or more, 71% or more, 72% or more, 73% or more, 74% or more, 75% or more, 76% or more, 77% or more, 78% or more, 79% or more, 80% or more, 81% or more, 82% or more, 83% or more, 84% or more, 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, for example, 99% or more) to the amino acid sequence of LrHP produced by Pseudomonas racemosus (SEQ ID NO: 20), and an oxidoreductase having an amino acid sequence in which one or more amino acids are changed or mutated, or are deleted, substituted, added and / or inserted in the amino acid sequence of SEQ ID NO: 20.

[0069] In one embodiment, the oxidoreductase of the present invention can be listed as an oxidoreductase having a high sequence identity (e.g., 70% or more, 71% or more, 72% or more, 73% or more, 74% or more, 75% or more, 76% or more, 77% or more, 78% or more, 79% or more, 80% or more, 81% or more, 82% or more, 83% or more, 84% or more, 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, for example, 99% or more) to the amino acid sequence of SrAOX3925 produced by Synechocystis racemosus (SEQ ID NO: 25), and an oxidoreductase having an amino acid sequence in which one or more amino acids are changed or mutated, or deleted, substituted, added and / or inserted.

[0070] In one embodiment, the oxidoreductase of the present invention can be listed as an oxidoreductase having a high sequence identity (e.g., 70% or more, 71% or more, 72% or more, 73% or more, 74% or more, 75% or more, 76% or more, 77% or more, 78% or more, 79% or more, 80% or more, 81% or more, 82% or more, 83% or more, 84% or more, 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, for example, 99% or more) to the amino acid sequence of SrAOX3926 produced by Synechocystis racemosus (SEQ ID NO: 30), and an oxidoreductase having an amino acid sequence in which one or more amino acids are changed or mutated, or deleted, substituted, added and / or inserted.

[0071] In one embodiment, the oxidoreductase of the present invention can be listed as an oxidoreductase having a high sequence identity (e.g., 70% or more, 71% or more, 72% or more, 73% or more, 74% or more, 75% or more, 76% or more, 77% or more, 78% or more, 79% or more, 80% or more, 81% or more, 82% or more, 83% or more, 84% or more, 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, for example, 99% or more) to the amino acid sequence of SrEAOX produced by Synechocystis racemosus (SEQ ID NO: 35), and an oxidoreductase having an amino acid sequence in which one or more amino acids are changed or mutated, or deleted, substituted, added and / or inserted.

[0072] (amino acid sequence identity)

[0073] The identity of the amino acid sequence can be calculated by programs such as maximum match and search for homology of GENETYX (registered trademark) (Genetyx Corporation), maximum match, multiple alignment of DNASIS (registered trademark) Pro (Hitachi Solutions), or multiple alignment of CLUSTAL W. When comparing the amino acid sequences of more than two oxidoreductases in order to calculate the identity of the amino acid sequence, the positions of the amino acids that are consistent in the two or more oxidoreductases can be checked. Based on this information, the consistent regions in the amino acid sequence can be determined. Here, for more than two amino acid sequences, the consistency % refers to the percentage when the total number of amino acids in the region that can be compared is used as the denominator and the number of positions occupied by the same amino acid is used as the numerator when the comparison of more than two amino acid sequences is performed using algorithms such as Blosum62. Therefore, usually, when there are regions with completely inconsistent identities in two or more amino acid sequences, for example, when there are additional sequences with completely inconsistent identities in the amino terminus (N-terminus) or carbon terminus (C-terminus) in one of the amino acid sequences, it is impossible to align the inconsistent regions and therefore they are not used to calculate the % identity.

[0074] (Method for preparing enzyme)

[0075] Hereinafter, the method for producing the oxidoreductase of the present invention will be described.

[0076] (Construction of expression plasmid)

[0077] The plasmid for expressing the oxidoreductase of the present invention is obtained by a commonly used method. For example, DNA is extracted from a microorganism that produces the oxidoreductase of the present invention to prepare a DNA library. The DNA fragment encoding the oxidoreductase of the present invention is identified and separated from the prepared DNA library. The DNA fragment is amplified by polymerase chain reaction (PCR) using complementary primers using the separated DNA fragment as a template, and the gene encoding the oxidoreductase of the present invention is cloned. The amplified DNA fragment is connected to a vector to obtain a plasmid having a DNA fragment encoding the oxidoreductase of the present invention.

[0078] Alternatively, a DNA fragment encoding the oxidoreductase of the present invention is chemically synthesized and ligated to a vector to obtain a plasmid having a DNA encoding the oxidoreductase of the present invention.

[0079] The obtained plasmid is used to transform a strain of Escherichia coli or the like to obtain a strain of Escherichia coli or the like having a DNA encoding the oxidoreductase of the present invention.

[0080] In addition, for example, yeast strains such as yeast can be transformed with the obtained plasmid to obtain yeast strains such as yeast having DNA encoding the oxidoreductase of the present invention. As a method for transforming into yeast, a known method can be preferably used, such as a method using lithium acetate (Methods Mol. Cell. Biol., 5, 255-269 (1995)), electroporation (J Microbiol Methods 55 (2003) 481-484), etc., but it is not limited thereto, and various arbitrary methods including spheroplast method, glass bead method, etc. can be used for transformation. As microorganisms classified as yeast, for example, yeast belonging to the genus Zygosaccharomyces, the genus Saccharomyces, the genus Pichia, the genus Candida, etc. can be cited. The plasmid having the DNA encoding the oxidoreductase of the present invention can also contain a marker gene for realizing the selection of the transformed cells. As a marker gene, a gene complementary to the auxotrophy of the host can be cited, such as URA3 and TRP1. In addition, the plasmid having the DNA encoding the oxidoreductase of the present invention desirably contains a promoter or other regulatory sequences (e.g., a secretion signal sequence, an enhancer sequence, a terminator sequence, or a polyadenylation sequence, etc.) capable of expressing the oxidoreductase gene of the present invention in a host cell. Specific examples of promoters include, for example, the GAL1 promoter, the ADH1 promoter, and the like.

[0081] In addition, as other examples of host cells, filamentous fungi such as Aspergillus and Trichoderma can be cited. The method for preparing the transformant of filamentous fungi is not particularly limited. For example, according to a conventional method, a method in which the DNA encoding the oxidoreductase of the present invention is inserted into the host filamentous fungi in an expression manner is cited. Specifically, a DNA construct (construct) in which the gene encoding the oxidoreductase of the present invention is inserted between an expression-inducing promoter and a terminator is prepared, and then the host filamentous fungi is transformed with a DNA construct containing the gene encoding the oxidoreductase of the present invention, thereby obtaining a transformant that overexpresses the gene encoding the oxidoreductase. In this specification, a DNA fragment composed of an expression-inducing promoter-a gene encoding an oxidoreductase-a terminator and a recombinant vector containing the DNA fragment prepared for transforming the host filamentous fungi are collectively referred to as a DNA construct.

[0082] The method for inserting the gene encoding the oxidoreductase into the host filamentous fungus in an expressible manner is not particularly limited, and examples thereof include a method of directly inserting the gene into the chromosome of the host organism using homologous recombination, or a method of introducing the gene into the host filamentous fungus by ligating the gene to a plasmid vector.

[0083] In the method utilizing homologous recombination, the DNA construct can be connected between the sequences identical to the upstream region and the downstream region of the recombination site on the chromosome, and inserted into the genome of the host filamentous fungus. Under the control of the high expression promoter of the host filamentous fungus itself, overexpression is carried out in the host filamentous fungus, thereby obtaining a transformant produced by self-cloning. The high expression promoter is not particularly limited, for example, the promoter region of the TEF1 gene (tef1) as a translation elongation factor, the promoter region of the α-amylase gene (amy), the promoter region of the alkaline protease gene (alp), etc. can be cited.

[0084] In the method using a vector, the DNA construct can be incorporated into a plasmid vector for transforming filamentous fungi by conventional methods, and the corresponding host filamentous fungi can be transformed by conventional methods.

[0085] Such a preferred vector-host system is not particularly limited as long as it can produce the oxidoreductase of the present invention in the host filamentous fungi. Examples thereof include pUC19 and a system of filamentous fungi, pSTA14 (Mol. Gen. Genet. 218, 99-104, 1989) and a system of filamentous fungi, etc.

[0086] The DNA construct is preferably used after being introduced into the chromosome of the host filamentous fungus. However, as another method, the DNA construct can be used without being introduced into the chromosome by integrating it into an autonomously replicating vector (Ozeki et al. Biosci. Biotechnol. Biochem. 59, 1133 (1995)).

[0087] The DNA construct may also contain a marker gene for realizing the selection of transformed cells. The marker gene is not particularly limited, and for example, genes that complement the host's nutritional deficiency such as pyrG, niaD, and adeA can be cited; resistance genes for drugs such as pyrithiamin, hygromycin B, and oligomycin, etc. In addition, the DNA construct preferably contains a promoter, a terminator, and other regulatory sequences (such as enhancers, polyadenylation sequences, etc.) that can realize overexpression of the gene encoding the oxidoreductase of the present invention in the host cell. The promoter is not particularly limited, and appropriate expression-inducible promoters and constitutive promoters can be cited, such as tef1 promoter, alp promoter, amy promoter, etc. The terminator is also not particularly limited, and for example, alp terminator, amy terminator, tef1 terminator, etc. can be cited.

[0088] In the DNA construct, regarding the expression regulatory sequence of the gene encoding the oxidoreductase of the present invention, the inserted DNA fragment containing the gene encoding the oxidoreductase of the present invention does not necessarily have a sequence with an expression regulatory function. In addition, when transformation is performed by the co-transformation method, the DNA construct may not have a marker gene.

[0089] One embodiment of the DNA construct is a DNA construct obtained by, for example, ligating the tef1 gene promoter, a gene encoding an oxidoreductase, the alp gene terminator, and the pyrG marker gene to the In-Fusion Cloning Site located in the multiple cloning site of pUC19.

[0090] As a method for transformation into filamentous fungi, methods known to those skilled in the art can be appropriately selected, for example, after preparing the protoplasts of the host filamentous fungi, the protoplast PEG method using polyethylene glycol and calcium chloride can be adopted (for example, with reference to Mol. Gen. Genet. 218, 99-104, 1989, Japanese Patent Publication No. 2007-222055, etc.). According to the host filamentous fungi and the transformation marker gene used, a suitable culture medium for regenerating the transformed filamentous fungi is used. For example, when Aspergillus sojae is used as the host filamentous fungi and the pyrG gene is used as the transformation marker gene, the regeneration of the transformed filamentous fungi can be carried out, for example, with Czapek-Dox minimal medium (manufactured by Difco) containing 0.5% agar and 1.2M sorbitol.

[0091] (Recombinant expression of enzymes)

[0092] A strain of Escherichia coli or the like having a DNA encoding the oxidoreductase of the present invention is cultured in a culture medium. When culturing microbial host cells, deep culture, shaking culture, static culture, etc. can be performed at a culture temperature of 10°C to 42°C, preferably at a culture temperature of about 25°C for several hours to several days, more preferably at a culture temperature of about 25°C for 1 day to 7 days. As a culture medium for culturing the above-mentioned microbial host cells, for example, one or more nitrogen sources such as yeast extract, trypsin (tryptone), peptone (peptone), meat extract, corn steep liquor, or soybean or wheat bran extract are used, and one or more inorganic salts such as sodium chloride, monopotassium phosphate, dipotassium phosphate, magnesium sulfate, magnesium chloride, ferric chloride, ferric sulfate or manganese sulfate are added, and sugar is appropriately added as needed. Quality raw materials , vitamins, etc. The bacterial cells are separated from the culture solution obtained by culturing by centrifugation. The separated bacterial cells are subjected to ultrasonic pulverization, grinding, etc., or treated with lysozyme such as lysozyme and yatalase to prepare a suspension, and the suspension is centrifuged to obtain a crude enzyme solution from the obtained fractions.

[0093] (Enzyme purification)

[0094] The enzyme purification method may be any method as long as it can purify the enzyme from a crude enzyme solution. For example, the enzyme can be purified from a crude enzyme solution by a commonly used method such as ion exchange chromatography or gel filtration chromatography.

[0095] (Enzyme activity assay)

[0096] The method for measuring the activity of an enzyme may be any method as long as it is a method for directly or indirectly measuring the product produced by the redox reaction catalyzed by the enzyme. For example, the enzyme catalyzes a redox reaction to produce a reduction product, and the reduction product transfers electrons to an electrode to produce a current value, and the enzyme activity can be measured by measuring the current value. Preferably, the enzyme activity can be measured by reacting the reduction product produced by the redox reaction catalyzed by the enzyme with a reagent containing a light-absorbing substance that reacts with the reduction product (hereinafter referred to as a "light-absorbing reagent") and performing absorbance measurement.

[0097] (Quantification of EAP)

[0098] The oxidoreductase acting on EAP is allowed to act on a sample containing EAP. The concentration of EAP in the sample is not particularly limited, and may be, for example, 0.1 μM to 1000 μM. The action time may be, for example, 5 seconds to 120 minutes, preferably 0.5 minutes to 60 minutes, more preferably 1 minute to 30 minutes, and even more preferably 1 minute to 10 minutes. The action temperature also depends on the optimal temperature of the enzyme used, and for example, a temperature of 20° C. to 45° C. used for a common enzyme reaction may be appropriately selected.

[0099] The appropriate amount of the oxidoreductase used in the present invention to act on EAP is, for example, added so that the final concentration is 0.001U / ml to 50U / ml, preferably 0.01U / ml to 10U / ml. Generally, the lower the concentration of the substrate contained in the sample solution, the higher the final concentration of the added oxidoreductase. Considering the optimal pH of the oxidoreductase, it is preferred to use a buffering agent to adjust the pH value during the action so that the pH value becomes a pH value suitable for the reaction, but the pH value is not limited thereto, as long as it is a pH value that can act. For example, pH3 to pH11, preferably pH5 to pH9. Examples of the buffer that can be used include N-[tris(hydroxymethyl)methyl]glycine, phosphates, acetates, carbonates, tris(hydroxymethyl)-aminomethane, borates, citrates, dimethylglutamate, tricine, HEPES, MES, Bis-Tris, ADA, PIPES, ACES, MOPSO, BES, MOPS, TES, DIPSO, TAPSO, POPSO, HEPPSO, EPPS, tricine, N-bicine, TAPS, phthalic acid, tartaric acid, and the like.

[0100] The present invention provides a method for measuring EAP by reducing a mediator by acting on an oxidoreductase of EAP and reacting the reduced mediator with a coloring or fading reagent. As coloring or fading substrates used in the present invention, in addition to DCIP (2,6-Dichlorophenolindophenol), tetrazole compounds (Tetrazolium blue, Nitro-tetrazolium blue, water soluble tetrazolium (WST)-1, WST-3, WST-4, WST-5, WST-8, WST-9) and the like can be cited.

[0101] The sample used in the EAP measurement method of the present invention may be any biological sample that may contain EAP, such as blood, plasma, etc. The sample may be processed appropriately, for example, it may be concentrated by a centrifugal concentrator.

[0102] (Composition containing oxidoreductase and kit for quantification of phosphoethanolamine)

[0103] The quantitative method of EAP using oxidoreductase of the present invention can be performed by providing a composition containing an oxidoreductase and a product reaction reagent, or by combining an oxidoreductase with a commercially available product reaction reagent. For example, it can be provided as a composition for quantitative determination of phosphoethanolamine containing an oxidoreductase, and further containing a mediator reduced by adding an oxidoreductase and a reagent that reacts with the reduced mediator. In addition, it can be provided as a kit for quantitative determination of phosphoethanolamine containing an oxidoreductase, a mediator reduced by adding an oxidoreductase, and a reagent that reacts with the reduced mediator.

[0104] The mediator (also referred to as an artificial electron mediator, an artificial electron acceptor or an electron mediator) used in the assay method or quantitative kit of the present invention is not particularly limited, as long as it is a mediator that can accept electrons from an oxidoreductase. Examples of the mediator include quinones, phenolazines, viologens, cytochromes, phenoxazines, phenothiazines, ferrocyanides, such as potassium ferrocyanide, ferredoxins, ferrocene, osmium complexes and their derivatives, and examples of phenolazine compounds include, but are not limited to, 5-methylphenazine methosulfate (PMS) and methoxy PMS.

[0105] (Sensor chip and electrodes)

[0106] Figure 8 (a) is a schematic diagram of a sensor chip 10 according to one embodiment of the present invention. Figure 8 (b)~ Figure 8 (d) is a schematic diagram showing components constituting the sensor chip 10. The sensor chip 10 includes two or more electrodes disposed on a substrate 11. The substrate 11 is made of an insulating material. Figure 8 (a) and Figure 8 In (b), as an example, the working electrode 1, the counter electrode (relative electrode) 3 and the reference electrode 5 are arranged on the substrate 11. Each electrode is electrically connected to the wiring portion 7, and the wiring portion 7 is electrically connected to the terminal 9 located on the opposite side of the wiring direction of each electrode. The working electrode 1, the counter electrode 3 and the reference electrode 5 are arranged separately from each other. In addition, the working electrode 1, the counter electrode 3 and the reference electrode 5 are preferably formed integrally with the wiring portion 7 and the terminal 9. In addition, the counter electrode 3 and the reference electrode 5 can also be integrated together.

[0107] like Figure 8 (a) and Figure 8As shown in (c), a spacer 13 is arranged at the end of the substrate 11 parallel to the wiring portion 7, and a cover 15 covering the working electrode 1, the counter electrode 3, the reference electrode 5 and the spacer 13 is arranged. The spacer 13 and the cover 15 are made of insulating material. The spacer 13 has a thickness substantially the same as that of the working electrode 1, the counter electrode 3 and the reference electrode 5, and is preferably in close contact with the working electrode 1, the counter electrode 3 and the reference electrode 5. In addition, the spacer 13 and the cover 15 can be integrally formed. The cover 15 is a protective layer that prevents the wiring portion 7 from being exposed to the outside air and deteriorating, and prevents a short circuit caused by the infiltration of the measurement sample.

[0108] In one embodiment, the oxidoreductase of the present invention can be coated, adsorbed or fixed to an electrode. Preferably, the oxidoreductase of the present invention is coated, adsorbed or fixed to a working electrode. In another embodiment, a mediator can also be coated, adsorbed or fixed to an electrode together with the oxidoreductase. The oxidoreductase, or the oxidoreductase and the mediator can be included in a reaction layer 19 configured on the working electrode 1, the counter electrode 3 and the reference electrode 5. As electrodes, metal electrodes such as carbon electrodes, platinum, gold, silver, nickel and palladium can be used. In the case of a carbon electrode, as materials, pyrolytic graphite (PG), glassy carbon (GC), carbon paste and foamed plastic carbon (PFC) can be cited. The measurement system can be a two-electrode system or a three-electrode system. For example, the enzyme can be fixed to the working electrode. As reference electrodes, standard hydrogen electrodes, reversible hydrogen electrodes, silver-silver chloride electrodes (Ag / AgCl), palladium hydrogen electrodes and saturated calomel electrodes can be cited. From the perspective of stability and reproducibility, Ag / AgCl is preferably used.

[0109] The enzyme can be immobilized on the electrode by cross-linking, dialysis membrane coating, encapsulation in a polymer matrix, use of a photocross-linked polymer, use of a conductive polymer, use of an oxidation / reduction polymer, etc. In addition, the enzyme can be immobilized in a polymer together with a mediator or immobilized on an electrode by adsorption, or these methods can be combined.

[0110] The mediator (also referred to as an artificial electron mediator, an artificial electron acceptor or an electron mediator) used in the composition, the kit, the electrode or the sensor chip is not particularly limited, as long as it can accept electrons from the redox enzyme. Examples of the mediator include quinones, phenolazines, viologens, cytochromes, phenoxazines, phenothiazines, ferrocyanides, such as potassium ferrocyanide, ferredoxins, ferrocene, osmium complexes and their derivatives, and examples of phenolazines include PMS and methoxy PMS, but are not limited thereto.

[0111] The oxidoreductase of the present invention can be applied to various electrochemical determination methods by using a constant potential meter, a constant current meter, etc. As an electrochemical determination method, various methods such as amperometry, potentiometry, and coulometric method can be exemplified. For example, by using the amperometric method, the concentration of EAP in the sample can be calculated by measuring the current value generated by applying +600mV to +1000mV (vs.Ag / AgCl) to the hydrogen peroxide electrode generated when the oxidoreductase reacts with the EAP. For example, the current value is measured for a known EAP concentration (0, 50, 100, 150, 200 μM), and the current value relative to the EAP concentration is plotted, thereby creating a calibration curve. By measuring the current value of an unknown EAP, the EAP concentration can be obtained from the calibration curve. As a hydrogen peroxide electrode, for example, a carbon electrode or a platinum electrode can be used. Alternatively, an electrode immobilized with a reductase such as peroxidase or catalase may be used instead of a hydrogen peroxide electrode to measure the reduction current value generated by applying -400 mV to +100 mV (vs. Ag / AgCl), thereby quantifying the amount of hydrogen peroxide and determining the value of EAP.

[0112] In addition, a mediator is mixed into the reaction solution, and the electrons generated when the redox enzyme reacts with the EAP are transferred to the oxidized mediator by, for example, the amperometric method to generate a reduced mediator, and then the current value generated by applying -1000mV to +500mV (vs.Ag / AgCl) is measured, thereby calculating the concentration of EAP in the sample. As the counter electrode, a carbon electrode or a platinum electrode is preferred. For example, the current value is measured for a known EAP concentration (0, 50, 100, 150, 200 μM), and the current value relative to the EAP concentration is plotted, thereby creating a calibration curve. By measuring the current value of an unknown EAP, the EAP concentration can be obtained from the calibration curve.

[0113] In addition, printed electrodes (sensor chips) can be used to reduce the amount of solution required for determination. In this case, the electrode is preferably formed on a substrate consisting of an insulating substrate. Specifically, it is desirable to form electrodes on a substrate by photolithography, printing techniques such as screen printing, gravure printing, and flexographic printing. In addition, as the material of the insulating substrate, silicon, glass, ceramics, polyvinyl chloride, polyethylene, polypropylene, and polyester etc. can be cited, but it is preferred to use a material with strong resistance to various solvents and chemicals.

[0114] [EAP measurement sensor]

[0115] In one embodiment, there is provided an EAP measurement sensor using the oxidoreductase of the present invention. Fig. 9(a) is a schematic diagram of a sensor 100 according to one embodiment of the present invention. The sensor is an EAP measuring device using the oxidoreductase of the present invention, and includes a sensor chip containing the oxidoreductase and a measuring unit. The measuring unit 30 may also include, for example, a switch 31 as an input unit and a display 33 as a display unit. The switch 31 may be used, for example, to control the on / off of the power supply of the measuring unit 30, and may also be used to control the start and interruption of the EAP measurement in the sensor 100. The display 33 may, for example, display the measured value of the EAP, and may also include a touch panel as an input unit for controlling the measuring unit 30.

[0116] Fig. 9 (b) is a block diagram of a sensor 100 according to one embodiment of the present invention. The sensor 100 may include a control unit 110, a display unit 120, an input unit 130, a storage unit 140, a communication unit 150, and a power supply 160 in a measuring unit 30, and they may be electrically connected to each other through a wire 190. In addition, the terminals of the sensor chip 10 described later are electrically connected to the terminals of the measuring unit 30, and the current generated by the sensor chip 10 is detected by the control unit 110. The control unit 110 is a control device for controlling the sensor 100, and is composed of, for example, a well-known central processing unit (CPU) and an operating program for controlling the sensor 100. Alternatively, the control unit 110 includes a central processing unit and an operating system (OS), and may also include an application or module for performing EAP measurement.

[0117] The display unit 120 includes, for example, a well-known display 33, and can display the measured value of the EAP, the state of the measuring unit 30, and the operation request to the measurer. The input unit 130 is an input device for the measurer to operate the sensor 100, and can be, for example, a switch 31 or a touch panel arranged on the display 33. A plurality of switches 31 can be arranged on the measuring unit 30.

[0118] The storage unit 140 is composed of a main storage device (memory), and an auxiliary storage device (hard disk) may be configured externally. The main storage device (memory) may also be composed of a read-only memory (ROM) and / or a random access memory (RAM). The operating program, operating system, application program or module is stored in the storage unit 140 and executed by the central processing unit to constitute the control unit 110. In addition, the measured value and the current value may be stored in the storage unit 140.

[0119] The communication unit 150 is a well-known communication device that connects the sensor 100 or the measuring unit 30 with an external device (computer, printer or network). The communication unit 150 and the external device are connected through wired or wireless communication. In addition, the power supply 160 is a well-known power supply device that supplies power to the sensor 100 or the measuring unit 30.

[0120] As described above, the EAP quantification method, oxidoreductase for quantification, composition for quantification, and kit for quantification of the present invention can provide a new quantification method, enzyme for quantification, composition for quantification, kit for quantification, and sensor for quantification for quantifying the concentration of EAP, which is a biomarker for depression, by containing an oxidoreductase.

[0121] (Quantitative method of EAP using oxidase activity)

[0122] The oxidase used in the present invention is an oxidase that acts on EAP as a substrate. As for the oxidase used in the present invention, it is considered that EAP oxidase is most suitable. However, until the filing of this application, EAP oxidase has not been identified. As a substrate similar in structure to EAP, there are substrates having a CH-NH2 bond or a CH-NH bond, and as an enzyme for the substrate, there is an amine oxidase.

[0123] More specifically, as substrates similar in structure to EAP, there are phenylethylamine, ethanolamine, tyramine, benzylamine, histamine, 5-hydroxytryptamine, spermine, spermidine, β-alanine, γ-aminobutyric acid (GABA), taurine, cadaverine, agmatine and the like, and as oxidases for the substrates, phenylethylamine oxidase (PEAOX), ethanolamine oxidase, tyramine oxidase, benzylamine oxidase, 5-hydroxytryptamine oxidase, spermine oxidase, spermidine oxidase, β-alanine oxidase, γ-aminobutyric acid (GABA) oxidase, taurine oxidase, cadaverine oxidase, agmatine oxidase and the like can be preferably used.

[0124] The reaction conditions of the oxidase used in the present invention may be any conditions that act on EAP and effectively catalyze the oxidation reaction. However, enzymes generally have an optimum temperature and an optimum pH for exhibiting the highest activity. Therefore, the reaction conditions are preferably near the optimum temperature and the optimum pH. For example, as the reaction conditions of PEAOX, the temperature of 37° C. and pH 8.5 described later can be preferably used, but are not limited thereto.

[0125] In the reaction process of the oxidase used in the present invention, when the oxidase of the present invention acts on EAP, various chemical substances may participate in it. For example, when the oxidase of the present invention acts on EAP, oxygen may participate in it as an electron acceptor of the redox reaction.

[0126] The oxidase may be an oxidase produced by a microorganism existing in nature or an oxidase produced by a transformed microorganism. From the viewpoint of efficiently expressing an enzyme in large quantities, the enzyme can be efficiently expressed in large quantities by using a transformed microorganism.

[0127] For example, the oxidase of the present invention can be an oxidase (AgPEAOX) produced by Arthrobacter sphaeroides, or it can be an oxidase produced by Escherichia coli transformed by the action of a plasmid containing the PEAOX gene from Arthrobacter sphaeroides. However, by using Escherichia coli transformed by the action of a plasmid containing the PEAOX gene from Arthrobacter sphaeroides, the oxidase can be efficiently expressed in large quantities.

[0128] In addition, for example, the oxidase of the present invention can be LcAOX produced by Mucor agglomerans, or it can be an amine oxidase produced by Escherichia coli transformed by the action of a plasmid containing the LcAOX gene from Mucor agglomerans having the base sequence of sequence number 16, but by using Escherichia coli transformed by the action of a plasmid containing the LcAOX gene from Mucor agglomerans, the oxidase can be efficiently expressed in large quantities.

[0129] In addition, for example, the oxidase of the present invention can be LrHP produced by Escherichia racemosus, or it can be a hypothetical protein produced by Escherichia coli transformed by the action of a plasmid containing the LrHP gene from Escherichia racemosus having the base sequence of sequence number 21, but by using Escherichia coli transformed by the action of a plasmid containing the LrHP gene from Escherichia racemosus, the oxidase can be efficiently expressed in large quantities.

[0130] In addition, for example, the oxidase of the present invention can be SrAOX3925 produced by Synechocystis racemosus, or it can be an amine oxidase produced by Escherichia coli transformed by the action of a plasmid containing the SrAOX3925 gene from Synechocystis racemosus having the base sequence of sequence number 26, but by using Escherichia coli transformed by the action of a plasmid containing the SrAOX3925 gene from Synechocystis racemosus, the oxidase can be efficiently expressed in large quantities.

[0131] In addition, for example, the oxidase can be SrAOX3926 produced by Synechocystis racemosus, or it can be an amine oxidase produced by Escherichia coli transformed by the action of a plasmid containing the SrAOX3926 gene from Synechocystis racemosus having the base sequence of sequence number 31, but by using Escherichia coli transformed by the action of a plasmid containing the SrAOX3926 gene from Synechocystis racemosus, the oxidase can be efficiently expressed in large quantities.

[0132] In addition, for example, the oxidase can be SrEAOX produced by Synechocystis racemosus, or it can be ethanolamine oxidase produced by Escherichia coli transformed by the action of a plasmid containing the SrEAOX gene having the base sequence of sequence number 36 from Synechocystis racemosus, but by using Escherichia coli transformed by the action of a plasmid containing the SrEAOX gene from Synechocystis racemosus, the oxidase can be efficiently expressed in large quantities.

[0133] In one embodiment, the oxidase of the present invention can be listed as an oxidase having a high sequence identity (such as 70% or more, 71% or more, 72% or more, 73% or more, 74% or more, 75% or more, 76% or more, 77% or more, 78% or more, 79% or more, 80% or more, 81% or more, 82% or more, 83% or more, 84% or more, 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, for example, 99% or more) to the amino acid sequence of PEAOX produced by spherical Bacillus (SEQ ID NO: 9), and an oxidase having an amino acid sequence in which one or more amino acids are changed or mutated, or deleted, substituted, added and / or inserted in the amino acid sequence of SEQ ID NO: 9.

[0134] In one embodiment, the oxidase of the present invention can be listed as an oxidase having a high sequence identity (such as 70% or more, 71% or more, 72% or more, 73% or more, 74% or more, 75% or more, 76% or more, 77% or more, 78% or more, 79% or more, 80% or more, 81% or more, 82% or more, 83% or more, 84% or more, 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, for example, 99% or more) to the amino acid sequence of LcAOX produced by Mucor umbelliferae (SEQ ID NO: 15), and an oxidase having an amino acid sequence in which one or more amino acids are changed or mutated, or deleted, substituted, added and / or inserted.

[0135] In one embodiment, the oxidase of the present invention can be listed as an oxidase having a high sequence identity (e.g., 70% or more, 71% or more, 72% or more, 73% or more, 74% or more, 75% or more, 76% or more, 77% or more, 78% or more, 79% or more, 80% or more, 81% or more, 82% or more, 83% or more, 84% or more, 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, for example, 99% or more) to the amino acid sequence of LrHP produced by Pseudomonas racemosus (SEQ ID NO: 20), and an oxidase having an amino acid sequence in which one or more amino acids are changed or mutated, or deleted, substituted, added and / or inserted in the amino acid sequence of SEQ ID NO: 20.

[0136] In one embodiment, the oxidase of the present invention can be listed as an oxidase having a high sequence identity (e.g., 70% or more, 71% or more, 72% or more, 73% or more, 74% or more, 75% or more, 76% or more, 77% or more, 78% or more, 79% or more, 80% or more, 81% or more, 82% or more, 83% or more, 84% or more, 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, for example, 99% or more) to the amino acid sequence of SrAOX3925 produced by Synechocystis racemosus (SEQ ID NO: 25), and an oxidase having an amino acid sequence in which one or more amino acids are changed or mutated, or deleted, substituted, added and / or inserted.

[0137] In one embodiment, the oxidase of the present invention can be listed as an oxidase having a high sequence identity (e.g., 70% or more, 71% or more, 72% or more, 73% or more, 74% or more, 75% or more, 76% or more, 77% or more, 78% or more, 79% or more, 80% or more, 81% or more, 82% or more, 83% or more, 84% or more, 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, for example, 99% or more) to the amino acid sequence of SrAOX3926 produced by Synechocystis racemosus (SEQ ID NO: 30), and an oxidase having an amino acid sequence in which one or more amino acids are changed or mutated, or deleted, substituted, added and / or inserted in the amino acid sequence of SEQ ID NO: 30.

[0138] In one embodiment, the oxidase of the present invention can be listed as an oxidase having a high sequence identity (e.g., 70% or more, 71% or more, 72% or more, 73% or more, 74% or more, 75% or more, 76% or more, 77% or more, 78% or more, 79% or more, 80% or more, 81% or more, 82% or more, 83% or more, 84% or more, 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, for example, 99% or more) to the amino acid sequence of SrEAOX produced by Synechocystis racemosus (SEQ ID NO: 35), and an oxidase having an amino acid sequence in which one or more amino acids are changed or mutated, or deleted, substituted, added and / or inserted.

[0139] In addition, since the identity of the amino acid sequences of these oxidases is calculated by the same method as the identity of the amino acid sequences of oxidoreductases, a detailed description is omitted.

[0140] (Method for preparing enzyme)

[0141] Hereinafter, the method for producing the oxidase of the present invention will be described.

[0142] (Construction of expression plasmid)

[0143] The oxidase expression plasmid of the present invention is obtained by a commonly used method. For example, DNA is extracted from a microorganism that produces the oxidase of the present invention to prepare a DNA library. The DNA fragment encoding the oxidase of the present invention is identified and separated from the prepared DNA library. The DNA fragment is amplified by polymerase chain reaction (PCR) using complementary primers using the separated DNA fragment as a template, and the gene encoding the oxidase of the present invention is cloned. The amplified DNA fragment is connected to a vector to obtain a plasmid having a DNA fragment encoding the oxidase of the present invention.

[0144] Alternatively, a DNA fragment encoding the oxidase of the present invention is chemically synthesized and ligated to a vector to obtain a plasmid having the DNA fragment encoding the oxidase of the present invention.

[0145] The obtained plasmid is used to transform a strain of Escherichia coli or the like to obtain a strain of Escherichia coli or the like having a DNA encoding the oxidase of the present invention.

[0146] Yeast or filamentous fungi can be used as host cells for the expression of the oxidase of the present invention. This method can follow the same method as the expression of the above-mentioned oxidoreductase, and detailed description is omitted.

[0147] The oxidase of the present invention may have an amino acid substitution that increases the reactivity to EAP. For example, it may have an amino acid substitution at a position corresponding to phenylalanine at position 105 and / or at a position corresponding to leucine at position 358 of PEAOX from Arthrobacter sphaeroides having the amino acid sequence of SEQ ID NO: 9.

[0148] (Recombinant expression and purification of enzymes)

[0149] The expression and purification of the oxidase can be performed by the same method as the expression and purification of the oxidoreductase described above, and detailed description thereof will be omitted.

[0150] (Enzyme activity assay)

[0151] The method for measuring enzyme activity may be any method as long as it is a method for directly or indirectly measuring the product produced by the reaction catalyzed by the enzyme. For example, if the product produced by the reaction catalyzed by the enzyme is reacted with a reagent that reacts with the product (hereinafter referred to as "product reaction reagent"), and the light absorbing substance produced by the reaction is measured, the activity of the enzyme can be measured by measuring the absorbance.

[0152] (Quantification of EAP)

[0153] The oxidase acting on EAP is allowed to act on a sample containing EAP. The concentration of EAP in the sample is not particularly limited, and may be, for example, 0.1 μM to 1000 μM. The action time may be, for example, 5 seconds to 120 minutes, preferably 0.5 minutes to 60 minutes, more preferably 1 minute to 30 minutes, and even more preferably 1 minute to 10 minutes. The action temperature also depends on the optimal temperature of the enzyme used, and may be, for example, a temperature of 20° C. to 45° C. used for a common enzyme reaction.

[0154] The appropriate amount of the oxidase used in the present invention to act on EAP is, for example, added so that the final concentration is 0.001U / ml to 50U / ml, preferably 0.01U / ml to 10U / ml. Generally, the lower the concentration of the substrate contained in the sample solution, the higher the final concentration of the added oxidase. Considering the optimal pH of the oxidase, it is preferred to use a buffer to adjust the pH value during the action so that the pH value becomes a pH value suitable for the reaction, however, the pH value is not limited thereto, as long as it is a pH value that can act. For example, it is pH3 to pH11, preferably pH5 to pH9. The buffer that can be used is the same as the case of quantifying EAP by oxidoreductase.

[0155] The present invention provides a method for measuring EAP by measuring a product or a consumed product of the action of an oxidase acting on EAP, and hydrogen peroxide is cited as a substance that is a product that is easy to measure and is preferably a substance to be measured. Hydrogen peroxide generated by the action of an oxidase can be detected by a color substrate, etc. As a color substrate used in the present invention, in addition to 4-aminoantipyrine, ADOS (N-ethyl-N-(2-hydroxy-3-sulfopropyl)-m-anisidine), ALOS (N-ethyl-N-(2-hydroxy-3-sulfopropyl) aniline), TOOS (N-ethyl-N-(2-hydroxy-3-sulfopropyl)-m-toluidine sodium), DA-67 (10-(carboxymethylaminocarbonyl)-3,7-bis(dimethylamino)-phenothiazine), DA-64 (N-(carboxymethylaminocarbonyl)-4,4'-bis(dimethylamino)-diphenylamine) and the like can be cited. ADOS, ALOS, and TOOS develop color when condensed with 4-aminoantipyrine. DA-64 and DA-67 do not require 4-aminoantipyrine and can develop color when used alone. In either case, the color development reaction is catalyzed by peroxidase. In addition, as a consumable to be measured, dissolved oxygen is mentioned, and a dissolved oxygen meter or the like can be used to measure the amount of dissolved oxygen in the reaction solution. For example, the degree of color development (absorbance change) of the above-mentioned assay reagent can be measured by a spectrophotometer or a biochemical automatic analyzer, and compared with the absorbance of a standard sample, thereby measuring the EAP contained in the sample.

[0156] The sample used in the EAP measurement method of the present invention may be any biological sample that may contain EAP, such as blood, plasma, etc. The sample may be processed appropriately, for example, it may be concentrated by a centrifugal concentrator.

[0157] (Composition containing oxidase and kit for quantification of phosphoethanolamine)

[0158] The quantitative method of EAP using oxidase of the present invention can be performed by providing a composition containing oxidase and a product reaction reagent, or by combining oxidase with a commercially available product reaction reagent. For example, it can be provided as a quantitative composition for phosphoethanolamine containing oxidase, and further containing a reagent for reacting with hydrogen peroxide generated by adding oxidase. In addition, phosphoric acid can be provided as a quantitative kit for phosphoethanolamine containing oxidase and a reagent for reacting with hydrogen peroxide generated by adding oxidase.

[0159] (Sensor chip and electrodes)

[0160] In one embodiment, the oxidase of the present invention can be coated, adsorbed or fixed to an electrode. Preferably, the oxidase of the present invention is coated, adsorbed or fixed to a working electrode. The structure of the electrode can be applied to the same structure as that described for the electrode using the oxidoreductase, so a detailed description is omitted. In addition, the oxidase can be fixed to the electrode by crosslinking, covering with a dialysis membrane, encapsulating in a polymer matrix, using a photocrosslinked polymer, using a conductive polymer, using an oxidation / reduction polymer, etc.

[0161] The oxidase of the present invention can be applied to various electrochemical measurement methods by using a constant potential meter, a constant current meter, etc. As electrochemical measurement methods, various methods such as amperometry, potentiometry, and coulometric methods can be cited. For example, by using the amperometry method, the concentration of EAP in the sample can be calculated by measuring the current value generated by applying +600mV to +1000mV (vs.Ag / AgCl) to the hydrogen peroxide electrode when the oxidase reacts with the EAP. For example, the current value is measured for a known EAP concentration (0, 50, 100, 150, 200 μM), and the current value relative to the EAP concentration is plotted, thereby creating a calibration curve. By measuring the current value of an unknown EAP, the EAP concentration can be obtained from the calibration curve. As a hydrogen peroxide electrode, for example, a carbon electrode or a platinum electrode can be used. Alternatively, an electrode immobilized with a reductase such as peroxidase or catalase may be used instead of a hydrogen peroxide electrode to measure the reduction current value generated by applying -400 mV to +100 mV (vs. Ag / AgCl), thereby quantifying the amount of hydrogen peroxide and determining the value of EAP.

[0162] In addition, printed electrodes (sensor chips) can be used to reduce the amount of solution required for determination. In this case, the electrode is preferably formed on a substrate consisting of an insulating substrate. The structure of the sensor chip using an oxidase can be the same structure as the sensor chip using an oxidoreductase, and detailed description is omitted.

[0163] [EAP measurement sensor]

[0164] In one embodiment, an EAP measurement sensor using the oxidase of the present invention is provided. The sensor is an EAP measurement device using the oxidase of the present invention, comprising: a sensor chip containing an oxidase; and a measurement unit. The structure of the EAP measurement sensor using the oxidase may be the same as that of the EAP measurement sensor using the redox enzyme, and detailed description thereof is omitted.

[0165] As described above, the quantification method, oxidase for quantification, composition for quantification, and kit for quantification of EAP of the present invention can provide a new quantification method, quantification enzyme, quantification composition, kit, and quantification sensor for quantifying the concentration of EAP, which is a biomarker for depression, by containing an oxidase.

[0166] Example

[0167] Specific examples and test results of the quantitative determination method, the oxidoreductase for quantitative determination, the composition for quantitative determination, and the kit for quantitative determination of the present invention described above are shown and described in more detail.

[0168] (Preparation of recombinant plasmid peT22b(+)-LaTDH DNA)

[0169] The LaTDH gene having the base sequence of sequence number 2 containing restriction endonuclease sites NdeI and BamHI at both ends and the SmTDH gene having the base sequence of sequence number 4 were fully synthesized. First, the LaTDH gene was inserted between the restriction endonuclease sites NdeI and BamHI of peT22b(+), and it was used to transform Escherichia coli JM109.

[0170] The E. coli JM109 (peT22b(+)-LaTDH) strain carrying the recombinant plasmid was inoculated into 2.5 ml LB-amp medium [1% (W / V) bacterial trypsin Peptone (Bacto Tryptone), 0.5% (W / V) yeast extract, 0.5% (W / V) NaCl, 50 μg / ml ampicillin], and cultured with shaking at 37°C for 20 hours to obtain a culture.

[0171] The culture was centrifuged at 7000 rpm for 5 minutes to collect the bacteria and then extract and purify the recombinant plasmid peT22b(+)-LaTDH from the bacteria using QIAGEN (registered trademark) tip-100 (manufactured by QIAGEN) to obtain 2.5 μg of DNA of the recombinant plasmid peT22b(+)-LaTDH.

[0172] (Preparation of recombinant plasmid peT22b(+)-LaTDH-SmTDH DNA)

[0173] Using the SmTDH gene having the base sequence of sequence number 4 as a template, the synthetic oligonucleotides of sequence numbers 5 and 6, and PrimeSTAR (registered trademark) Max DNA Polymerase (manufactured by Takara Bio) were used to perform PCR reaction under the following conditions. That is, 25 μl of PrimeSTAR Max Premix (2×), 100 pg of the SmTDH gene as a template, and 15 pmol of each of the above-mentioned synthetic oligonucleotides were added, and the total amount was set to 50 μl with sterile water. The prepared reaction solution was incubated at 98°C for 2 minutes using a thermal cycler (manufactured by Eppendorf AG), and then the cycle of "98°C, 10 seconds" - "55°C, 5 seconds" - "72°C, 35 seconds" was repeated 30 times. Similarly, using the obtained recombinant plasmid peT22b (+) -LaTDH as a template, the synthetic oligonucleotides of sequence numbers 7 and 8 were used for PCR reaction. The reaction solution was subjected to 1.0% agarose gel electrophoresis, and the amplified target DNA was cut and purified.

[0174] Then, the obtained DNA fragments were ligated using In-Fusion (registered trademark) HD ​​Cloning Kit (manufactured by Clontech) to prepare a co-expression vector in which the SmTDH gene was inserted into the 3' end side of LaTDH in peT22b(+)-LaTDH.

[0175] Escherichia coli JM109 was transformed in the same manner as described above to obtain 2.5 μg of DNA of the recombinant plasmid peT22b(+)-LaTDH-SmTDH.

[0176] (Production of LaTDH and SmTDH)

[0177] The above-mentioned recombinant plasmid obtained by the above steps was used to transform the Escherichia coli BL21 (DE3) strain. Each Escherichia coli BL21 (DE3) strain was cultured in 2.5 ml ZYP-5052 culture medium (0.5% glycerol, 0.05% glucose, 0.2% lactose, 50 mM (NH4)2SO4, 50 mM KH2PO4, 50 mM Na2HPO4, 1 mM MgSO4) at 25°C for 27 hours.

[0178] Thereafter, each bacterial cell was washed with 0.05 M CHES-NaOH acid buffer at pH 8.5, ultrasonically disrupted, and centrifuged at 15,000 rpm for 10 minutes to prepare 1.5 ml of a crude enzyme solution containing LaTDH having the amino acid sequence of sequence number 1 and 1.5 ml of a crude enzyme solution containing LaTDH and SmTDH having the amino acid sequence of sequence number 3.

[0179] Similarly, Escherichia coli BL21(DE3) strain transformed with only the peT22b(+) vector was cultured and subjected to ultrasonic disruption to prepare 1.5 ml of a crude enzyme solution.

[0180] (Evaluation of substrate specificity of various crude enzyme solutions)

[0181] Activity assay using 2,6-Dichlorophenolindophenol (DCIP) was performed in a 96-well plate. As shown in Table 1, 145 μl of a reagent made of potassium phosphate buffer pH 8.0, 5-Methylphenazinium methosulfate (PMS, manufactured by Fujifilm Wako Pure Chemical Industries, Ltd.), 2,6-Dichlorophenolindophenol (DCIP, manufactured by Sigma-Aldrich Co., Ltd.) and a substrate was mixed with 5 μl of a crude enzyme solution, and the disappearance (color change) of the blue color from DCIP caused by dehydrogenase activity was observed. Taurine (manufactured by Fujifilm Wako Pure Chemical Industries, Ltd.), phosphoethanolamine (EAP, manufactured by Fujifilm Wako Pure Chemical Industries, Ltd.), ethanolamine (manufactured by Tokyo Chemical Industry Co., Ltd.) and benzylamine (manufactured by Tokyo Chemical Industry Co., Ltd.) were used as substrates.

[0182] [Table 1]

[0183]

[0184] (LaTDH activity assay)

[0185] The buffer in the compounds in Table 1 was changed from potassium phosphate buffer pH 8.0 to CHES-NaOH acid buffer pH 8.5, the substrate was set to EAP, and the reagents with EAP concentrations adjusted to 5mM, 10mM, 30mM, and 100mM were mixed with the crude enzyme solution of LaTDH-SmTDH or LaTDH, and the absorbance change at 600nm was measured to calculate the enzyme activity of LaTDH-SmTDH or LaTDH.

[0186] The change in absorbance was determined as follows: 1400 μl of a reagent containing CHES-NaOH acid buffer, DCIP, and EAP was incubated at 30°C for 5 minutes, 50 μl of PMS and 50 μl of crude enzyme solution were added, and the absorbance change per minute at 30°C was measured using a spectrophotometer (U-3900, manufactured by Hitachi High-Tech Science Corporation). 600 Change (ΔA S ).

[0187] Next, 50 μl of 0.05 M CHES-NaOH acid buffer was added instead of the substrate solution and mixed, and the A per minute at 30°C was measured. 600 Amount of change (ΔA0).

[0188] The dehydrogenase activity was calculated according to the following formula.

[0189] Dehydrogenase activity (U / ml)

[0190] =(ΔA S -ΔA0)×1.5×df / (21.4×0.05)

[0191] =1.4×(ΔA S -ΔA0)×df

[0192] 21.4: Millimolar extinction coefficient of DCIP pigment for light with a wavelength of 600 nm (mM -1 cm -1 )

[0193] Df: dilution rate of enzyme solution

[0194] (Test results: Evaluation of substrate specificity of various crude enzyme solutions)

[0195] By observing the degree of disappearance of the blue color from DCIP, it was found that both the crude enzyme solution co-expressing LaTDH-SmTDH and the crude enzyme solution expressing LaTDH reacted most with taurine and also reacted with phosphoethanolamine. On the other hand, it was found that the crude enzyme solution co-expressing LaTDH-SmTDH and the crude enzyme solution expressing LaTDH did not react with ethanolamine or benzylamine. In other words, it was found that LaTDH-SmTDH and LaTDH can recognize EAP as a substrate.

[0196] (Test results: EAP measurement results based on LaTDH)

[0197] Figure 1 This is a graph showing the correlation between the EAP concentration and the enzyme activity (U / ml) in Examples of the present invention. Figure 1The results show that in the range of 5 mM to 100 mM, the coefficient of determination (R) as a correlation index between EAP concentration and enzyme activity (U / ml) 2 ) was 0.9995, and thus the result that there was a correlation between the EAP concentration (mM) and the enzyme activity (U / ml) was obtained. That is, the result that the EAP concentration (mM) could be measured in the range of 5 mM to 100 mM was obtained by using LaTDH.

[0198] (Construction of AgPEAOX expression plasmid)

[0199] An expression plasmid (pKK223-3-AgPEAOX) of phenylethylamine oxidase (AgAPEAOX, UniProt ID P46881) derived from Arthrobacter sphaeroides having the amino acid sequence of SEQ ID NO: 9 was prepared using In-Fusion (registered trademark) HD ​​Cloning Kit (manufactured by Cloning Technologies).

[0200] The fragment of the vector (pKK223-3) was prepared by PCR using pKK223-3-CFP-T7 (see WO2007 / 125779) as a template and pKK223-3 HindIII 3Fw (5′-AAGCTTGGCT GTTTTGGCGG ATGAGAGAAG-3′) and pKK223-3 EcoRI 5Rv (5′-GAATTCTGTT TCCTGTGTGA AATTGTTATC-3′) as primers.

[0201] 1.0 μl of DpnI (manufactured by New England BioLabs) was added to the solution after PCR, and the mixture was treated at 37°C for 1 hour. The mixture was then subjected to agarose gel electrophoresis, and the gel containing the target fragment (about 4.6 kbp) was cut out and extracted from the gel using illustra (registered trademark) GFX PCR DNA and Gel Band Purification Kit (manufactured by GE Healthcare).

[0202] The AgPEAOX gene having the base sequence of sequence number 10 was divided into the first half (agpeaox_1-325) in which the DNA sequences of sequence number 11 and sequence number 12 were sequentially combined from the 5' end to the 3' end, and the second half (agpeaox_321-638) in which the DNA sequences of sequence number 13 and sequence number 14 were sequentially combined from the 5' end to the 3' end, and was commissioned to Integrated DNA Technologies for synthesis. The 15 bases on the 5' end side of agpeaox_1-325 (sequence number 11: CAGGAAACAGAATTC) and the 15 bases on the 3' end side of agpeaox_321-638 (sequence number 14: AAGCTTGGCTGTTTT) represent sequences derived from the pKK223-3 vector. The 15 bases (ATCACGTACCTGTCC) at the 3' end of agpeaox_1-325 and the 15 bases (ATCACGTACCTGTCC) at the 5' end of agpeaox_321-638 represent sequences overlapping the first half and the second half of the AgPEAOX gene.

[0203] The vector fragment of pKK223-3 and two AgPEAOX gene fragments were used to perform in-fusion reaction (50°C, 15 minutes) according to the composition of Table 2 to obtain an AgPEAOX expression plasmid (pKK223-3-AgPEAOX). The obtained plasmid was used to transform E. coli JM109 strain.

[0204] [Table 2]

[0205]

[0206]

[0207] (Recombinant expression of AgPEAOX)

[0208] The AgPEAOX production strain was inoculated into 2.5 ml of LB-amp medium (ampicillin concentration 50 μg / ml) in a test tube and cultured overnight at 37°C and 160 rpm. 1 ml of the seed culture was inoculated into 150 ml of LB-amp medium (ampicillin concentration 50 μg / ml) containing 0.1 mM CuSO4 and 0.1 mM IPTG in a Sakaguchi flask and cultured at 25°C for 16 hours.

[0209] The culture broths of six Sakaguchi flasks were centrifuged at 6500×g for 10 minutes and the pellets were resuspended in 20 mM Tris-HCl pH 8.0 containing 2 mM CuSO 4 .

[0210] The bacterial cell suspension was ultrasonically pulverized and then centrifuged at 20400×g for 15 minutes. The supernatant was buffer exchanged with 20 mM Tris-HCl, pH 8.0 using Amicon (registered trademark) Ultra Ultracel-30K (manufactured by Millipore) to obtain a crude enzyme solution of AgPEAOX.

[0211] (Purification of AgPEAOX)

[0212] The crude enzyme solution of AgPEAOX was applied to HiScreen (registered trademark) Capto Q (manufactured by GE Healthcare, resin content 4.7 ml) equilibrated with 20 mM Tris-HCl pH 8.0 to bind to the anion exchange resin.

[0213] Then, the resin was washed with 20 mM Tris-HCl (pH 8.0) containing 47 ml (10CV) of 150 mM NaCl. While the NaCl concentration in 20 mM Tris-HCl (pH 8.0) was linearly increased from 150 mM to 500 mM, 164.5 ml (35CV) of solution was infused to elute the AgPEAOX bound to the resin.

[0214] The eluted fraction was concentrated using Amicon Ultracel-30K and purified using a HiLoad (registered trademark) 26 / 60 Superdex 200 column. 20 mM Tris-HCl (pH 8.0) was used for equilibration of the resin and elution.

[0215] The purity of each eluted fraction was evaluated by SDS-PAGE, and the fraction containing no impurity protein was recovered as a purified standard product of AgPEAOX.

[0216] (Determination of dehydrogenase activity of AgPEAOX)

[0217] After incubating 609 μl of the reagent having the composition shown in Table 3 at 37°C for 5 minutes, 21 μl of the substrate solution (1500 mM EAP) was added and mixed, and the A per minute at 37°C was measured using a spectrophotometer (U-3900, manufactured by Hitachi High-Technologies Corporation). 438 Change (ΔA S ).

[0218] Next, 21 μl of ion exchange water was added instead of the substrate solution and mixed, and the A per minute at 37° C. was measured. 438Amount of change (ΔA0): 1-Methoxy PES (1-MPES) and 2-(4-iodobenzene)-3-(4-nitrobenzene)-5-(2,4-disulfonylbenzene)-2H-tetrazolium sodium salt (WST-1) produced by Dojindo Chemical Research Laboratories were used.

[0219]

Table 3

[0220]

[0221] The dehydrogenase activity was calculated according to the following formula.

[0222] Dehydrogenase activity (U / ml)

[0223] =(ΔA S -ΔA0)×630×df / (37.0×x)

[0224] =17.0×(ΔA S -ΔA0)×df / x

[0225] 37.0:WST-1A Millimolar extinction coefficient of (formazan) pigment for light of wavelength 438nm (mM -1 cm -1 )

[0226] df: dilution rate of enzyme solution

[0227] (Quantification of EAP based on AgPEAOX)

[0228] After incubating 609 μl of the reagent having the composition shown in Table 4 at 37°C for 5 minutes, 21 μl of EAP solution (30 mM to 300 mM) or ion exchange water was added and mixed, and the absorbance (A) at 37°C for 10 minutes was measured using a spectrophotometer (U-3900). 438 ) changes. The A 438 The vertical axis is EAP concentration, and the horizontal axis is EAP concentration. 438 Correlation with EAP concentrations.

[0229] [Table 4]

[0230]

[0231] *The activity (U) was measured at a final concentration of 50 mM EAP at pH 8.5.

[0232] (Test results: EAP measurement results based on AgPEAOX)

[0233] Figure 2It is the relationship between EAP concentration and absorbance after 10 minutes (A 438 , mAbs). Figure 2 , in the range of 1mM to 10mM, as the EAP concentration and the absorbance after 10 minutes (A 438 , mAbs) 2 ) is 0.975, so the EAP concentration (mM) and absorbance (A 438 In other words, the results showed that there was a correlation between the concentration of EAP (mAbs) and the concentration of EAP (mM) in the range of 1mM to 10mM were obtained by utilizing the dehydrogenase activity of AgPEAOX. It is conceivable that increasing the amount of AgPEAOX used makes it easier to quantify low-concentration EAP, and decreasing the amount of AgPEAOX used makes it easier to quantify high-concentration EAP.

[0234] As described above, through the method for quantifying EAP by adding oxidoreductase to a sample containing EAP, the oxidoreductase for quantifying EAP added to a sample containing EAP, the composition for quantifying EAP containing the oxidoreductase added to a sample containing EAP, the kit for quantifying EAP containing the oxidoreductase added to a sample containing EAP, and the sensor for quantifying EAP containing the oxidoreductase added to a sample containing EAP of the present invention, a new quantification method, quantification enzyme, quantification composition, quantification kit and quantification sensor for quantifying the concentration of EAP as a biomarker for depression can be provided.

[0235] (Determination of oxidase activity of AgPEAOX)

[0236] The oxidase activity of AgPEAOX expressed and purified by the above method was measured. After incubating 609 μl of the reagent composed of the composition in Table 5 at 37°C for 5 minutes, 21 μl of substrate solution (1500 mM EAP) was added and mixed, and the A per minute at 37°C was measured using a spectrophotometer (U-3900, manufactured by Hitachi High-Technologies Corporation). 555 Change (ΔA S ).

[0237] Next, 21 μl of ion exchange water was added instead of the substrate solution and mixed, and the A per minute at 37° C. was measured. 555 Amount of change (ΔA0): 4-aminoantipyrine (4-AA) and EAP manufactured by Fujifilm Wako Pure Chemical Industries, Ltd., N-ethyl-N-(2-hydroxy-3-sulfopropyl)-3-methylaniline (TOOS) manufactured by Dojindo Chemical Laboratories, and horseradish peroxidase (POD) manufactured by Toyobo were used.

[0238] [Table 5]

[0239]

[0240] The oxidase activity was calculated according to the following formula.

[0241] Oxidase activity (U / ml)

[0242] =(ΔA S -ΔA0)×630×df / (39.2×0.5×x)

[0243] =32.1×(ΔA S -ΔA0)×df / x

[0244] 39.2: Millimolar extinction coefficient of 4-AA-TOOS condensed pigment for light of wavelength 555 nm (mM -1 cm -1 )

[0245] Df: dilution rate of enzyme solution

[0246] (Determination of pH dependence of the catalytic reaction of AgPEAOX)

[0247] When measuring the pH dependence of the catalytic reaction of AgPEAOX, the activity was measured by replacing the Bicine-NaOH buffer pH 8.5 contained in the activity measurement reagent in Table 5 with a potassium phosphate buffer, MOPS-NaOH buffer or Bicine-NaOH adjusted to a predetermined pH.

[0248] (Quantification of EAP based on AgPEAOX)

[0249] After incubating 609 μl of the reagent having the composition of Table 6 at 37°C for 5 minutes, 21 μl of EAP solution (6, 12, 18, 24 or 30 mM) or ion exchange water was added and mixed, and the A value at 37°C for 5 minutes was measured using a spectrophotometer (U-3900). 555 Change. Take A 5 minutes after the measurement 555 The vertical axis is EAP concentration, and the horizontal axis is EAP concentration. 555 Correlation with EAP concentrations.

[0250]

Table 6

[0251]

[0252] *The activity (U) was measured at pH 8.5 using EAP at a final concentration of 50 mM.

[0253] (Test results: pH dependence of the catalytic reaction of AgPEAOX)

[0254] Figure 3 This is a graph showing the pH dependence of the enzyme reaction of the embodiment of the present invention. The vertical axis represents the relative activity (Relative activity (%)) of AgPEAOX, and the horizontal axis represents the pH value. The relative activity refers to the relative oxidase activity when the oxidase activity of Bicine-NaOH buffer pH 8.5 is taken as 100%. Figure 3 The result showed that the optimum pH for the catalytic reaction of AgPEAOX was 8.5. Therefore, a reagent at pH 8.5 was prepared and the EAP concentration was measured using the reagent.

[0255] (Test results: EAP measurement results based on AgPEAOX)

[0256] Figure 4 It is the relationship between EAP concentration and absorbance after 5 minutes (A 555 , mAbs). Figure 4 , in the range of 200 μM to 1000 μM, as the EAP concentration and the absorbance after 5 minutes (A 555 , mAbs) 2 ) is 0.993, so the EAP concentration (μM) and absorbance (A 555 In other words, the results showed that there was a correlation between the EAP concentrations of AgPEAOX and EAP (mAbs). That is, the results showed that the EAP concentration can be measured in the range of 200 μM to 1000 μM by using AgPEAOX. It is conceivable that increasing the amount of AgPEAOX used will make it easier to quantify low-concentration EAPs, and decreasing the amount of AgPEAOX used will make it easier to quantify high-concentration EAPs.

[0257] As described above, through the method for quantifying EAP by adding oxidase to a sample containing EAP, the oxidase for quantifying EAP added to a sample containing EAP, the composition for quantifying EAP containing the oxidase added to a sample containing EAP, the kit for quantifying EAP containing the oxidase added to a sample containing EAP, and the sensor for quantifying EAP containing the oxidase added to a sample containing EAP of the present invention, a new quantification method, quantification enzyme, quantification composition, quantification kit and quantification sensor for quantifying EAP concentration as a biomarker for depression can be provided.

[0258] (Construction of LcAOX expression plasmid)

[0259] An expression plasmid (pKK223-3-LcAOX) of the amine oxidase derived from Mucor agaricus having the amino acid sequence of SEQ ID NO: 15 (LcAOX, GenBank ID CDH56199.1) was prepared using In-Fusion (registered trademark) HD ​​Cloning Kit (manufactured by Clontech).

[0260] The fragments of the vector (pKK223-3) were prepared according to the method described in (Construction of Expression Plasmid of AgPEAOX).

[0261] The LcAOX gene having the base sequence of sequence number 16 was divided into the first half (lcaox_frag1) in which the DNA sequences of sequence number 11 and sequence number 17 were sequentially combined from the 5' end to the 3' end, the middle part (lcaox_frag2) described in sequence number 18, and the second half (lcaox_frag3) in which the DNA sequences of sequence number 19 and sequence number 14 were sequentially combined from the 5' end to the 3' end, and the synthesis was entrusted to Integrated DNA Technologies. In order to utilize the in-fusion reaction, 15 bases (CCCGAACACCTTGGT) at the 3' end side of lcaox_frag1 and the 5' end side of lcaox_frag2, and 15 bases (CAGCATCATCAACAT) at the 3' end side of lcaox_frag2 and the 5' end side of lcaox_frag3 were repeated.

[0262] An in-fusion reaction (50°C, 15 minutes) was carried out using the vector fragment of pKK223-3 and three LcAOX gene fragments according to the composition of Table 7 to obtain an expression plasmid of LcAOX (pKK223-3-LcAOX). The obtained plasmid was used to transform the E. coli JM109 strain.

[0263] [Table 7]

[0264]

[0265] (Construction of LrHP expression plasmid)

[0266] An expression plasmid (pKK223-3-LrHP) of a hypothetical protein derived from L. racemosus having the amino acid sequence of SEQ ID NO: 20 (LrHP, GenBank IDCDS02610.1) was prepared using In-Fusion (registered trademark) HD ​​Cloning Kit (manufactured by Clontech).

[0267] The fragments of the vector (pKK223-3) were prepared according to the method described in (Construction of Expression Plasmid of AgPEAOX).

[0268] The LrHP gene having the base sequence of sequence number 21 was divided into the first half (lrhp_frag1) in which the DNA sequences of sequence number 11 and sequence number 22 were sequentially combined from the 5' end to the 3' end, the middle part (lrhp_frag2) recorded in sequence number 23, and the second half (lrhp_frag3) in which the DNA sequences of sequence number 24 and sequence number 14 were sequentially combined from the 5' end to the 3' end, and was commissioned to Integrated DNA Technologies for synthesis. In order to utilize the in-fusion reaction, 15 bases (CATTTAGGGCAAGAT) at the 3' end side of lrhp_frag1 and the 5' end side of lrhp_frag2, and 15 bases (CACCATCAACATTTG) at the 3' end side of lrhp_frag2 and the 5' end side of lrhp_frag3 were repeated.

[0269] The vector fragment of pKK223-3 and three LrHP gene fragments were used to perform an in-fusion reaction (50°C, 15 minutes) according to the composition of Table 8 to obtain an LrHP expression plasmid (pKK223-3-LrHP). The obtained plasmid was used to transform E. coli JM109 strain.

[0270] [Table 8]

[0271]

[0272] (Construction of expression plasmid of SrAOX3925)

[0273] An expression plasmid (pKK223-3-SrAOX3925) of the amine oxidase derived from Synechocystis racemosus having the amino acid sequence of SEQ ID NO: 25 (SrAOX3925, GenBank ID ORZ03925.1) was prepared using In-Fusion (registered trademark) HD ​​Cloning Kit (manufactured by Cloning Technologies).

[0274] The fragments of the vector (pKK223-3) were prepared according to the method described in (Construction of Expression Plasmid of AgPEAOX).

[0275] The SrAOX3925 gene having the base sequence of sequence number 26 was divided into the first half (sraox3925_frag1) in which the DNA sequences of sequence number 11 and sequence number 27 were sequentially combined from the 5' end to the 3' end, the middle part (sraox3925_frag2) described in sequence number 28, and the second half (sraox3925_frag3) in which the DNA sequences of sequence number 29 and sequence number 14 were sequentially combined from the 5' end to the 3' end, and the synthesis was entrusted to Integrated DNA Technologies. In order to utilize the in-fusion reaction, the 15 bases (CAGTTTTTACCAGAG) at the 3' end side of sraox3925_frag1 and the 5' end side of sraox3925_frag2, and the 15 bases (GTCGTAGGCCAGCAT) at the 3' end side of sraox3925_frag2 and the 5' end side of sraox3925_frag3 were overlapped repeatedly.

[0276] The expression plasmid of SrAOX3925 (pKK223-3-SrAOX3925) was obtained by performing an in-fusion reaction (50°C, 15 minutes) with the composition shown in Table 9 using the vector fragment of pKK223-3 and the three SrAOX3925 gene fragments. The obtained plasmid was used to transform the E. coli JM109 strain.

[0277] [Table 9]

[0278]

[0279] (Construction of expression plasmid of SrAOX3926)

[0280] An expression plasmid (pKK223-3-SrAOX3926) of the amine oxidase derived from Synechocystis racemosus having the amino acid sequence of SEQ ID NO: 30 (SrAOX3926, GenBank ID ORZ03926.1) was prepared using In-Fusion (registered trademark) HD ​​Cloning Kit (manufactured by Cloning Technologies).

[0281] The fragments of the vector (pKK223-3) were prepared according to the method described in (Construction of Expression Plasmid of AgPEAOX).

[0282] The SrAOX3926 gene having the base sequence of sequence number 31 was divided into the first half (sraox3926_frag1) in which the DNA sequences of sequence number 11 and sequence number 32 were sequentially combined from the 5' end to the 3' end, the middle part (sraox3926_frag2) described in sequence number 33, and the second half (sraox3926_frag3) in which the DNA sequences of sequence number 34 and sequence number 14 were sequentially combined from the 5' end to the 3' end, and the synthesis was entrusted to Integrated DNA Technologies. In order to utilize the in-fusion reaction, 15 bases (TTGCGCAAAGATATT) at the 3' end side of sraox3926_frag1 and the 5' end side of sraox3926_frag2, and 15 bases (GATCCGATGGTAGAC) at the 3' end side of sraox3926_frag2 and the 5' end side of sraox3926_frag3 were repeated.

[0283] An in-fusion reaction (50°C, 15 minutes) was carried out using the vector fragment of pKK223-3 and three SrAOX3926 gene fragments according to the composition of Table 10 to obtain an expression plasmid of SrAOX3926 (pKK223-3-SrAOX3926). The obtained plasmid was used to transform E. coli JM109 strain.

[0284] [Table 10]

[0285]

[0286] (Construction of SrEAOX expression plasmid)

[0287] An expression plasmid (pKK223-3-SrEAOX) of the ethanolamine oxidase from Synechocystis racemosus having the amino acid sequence of SEQ ID NO: 35 (SrEAOX, GenBank ID BAU20376.1) was prepared using In-Fusion (registered trademark) HD ​​Cloning Kit (manufactured by Cloning Technologies).

[0288] The fragments of the vector (pKK223-3) were prepared according to the method described in (Construction of Expression Plasmid of AgPEAOX).

[0289] The SrEAOX gene having the base sequence of SEQ ID NO: 36 was divided into the first half (sreaox_frag1) in which the DNA sequences of SEQ ID NO: 11 and SEQ ID NO: 37 were sequentially combined from the 5' end to the 3' end, the middle part (sreaox_frag2) described in SEQ ID NO: 38, and the second half (sreaox_frag3) in which the DNA sequences of SEQ ID NO: 39 and SEQ ID NO: 14 were sequentially combined from the 5' end to the 3' end, and the synthesis was entrusted to Integrated DNA Technologies. In order to utilize the in-fusion reaction, 15 bases (CTCCGCAAAGATATA) at the 3' end side of sreaox_frag1 and the 5' end side of sreaox_frag2, and 15 bases (CCAATGGTAGATGGA) at the 3' end side of sreaox_frag2 and the 5' end side of sreaox_frag3 were repeated.

[0290] An in-fusion reaction (50°C, 15 minutes) was carried out using the vector fragment of pKK223-3 and three SrEAOX gene fragments according to the composition of Table 11 to obtain an expression plasmid of SrEAOX (pKK223-3-SrEAOX). The obtained plasmid was used to transform E. coli JM109 strain.

[0291] [Table 11]

[0292]

[0293] (Recombinant expression of enzymes)

[0294] The LcAOX, LrHP, SrAOX3925, SrAOX3926 and SrEAOX production strains were inoculated into 2.5 ml LB-amp medium (ampicillin concentration 50 μg / ml) in a test tube and cultured overnight at 37°C and 160 rpm. 1.5 ml of the seed culture was inoculated into 150 ml LB-amp medium (ampicillin concentration 50 μg / ml) containing 0.02 mM CuSO4 and 0.1 mM IPTG in a Sakaguchi flask and cultured at 25°C for 16 hours.

[0295] 150 ml of the culture solution was centrifuged at 6500×g for 10 minutes, and the pellet obtained was resuspended in 20 mM Tris-HCl pH 7.5. The bacterial suspension was ultrasonically disrupted, and then centrifuged at 20400×g for 15 minutes to recover the supernatant as a crude enzyme solution.

[0296] (Purification of LcAOX, LrHP, and SrAOX3925)

[0297] A crude enzyme solution of LcAOX, LrHP or SrAOX3925 was applied to HiScreen (registered trademark) Capto Q (manufactured by GE Healthcare, resin content 4.7 ml) equilibrated with 20 mM Tris-HCl, pH 7.5, and bound to an anion exchange resin.

[0298] Then, the resin was washed with 47 ml (10 CV) of 20 mM Tris-HCl (pH 7.5), and while the NaCl concentration in 20 mM Tris-HCl (pH 7.5) was linearly increased from 0 mM to 500 mM, 117.5 ml (25 CV) of solution was infused to elute LcAOX, LrHP or SrAOX3925 bound to the resin.

[0299] The eluted fraction was diluted 3-fold with ion exchange water to reduce the salt concentration, and then applied to HiScreen (registered trademark) Capto Q InpRes (manufactured by GE Healthcare, resin content 4.7 ml) equilibrated with 20 mM Tris-HCl, pH 7.5, to bind to the anion exchange resin.

[0300] Then, the resin was washed with 23.5 ml (5 CV) of 20 mM Tris-HCl (pH 7.5), and while the NaCl concentration in 20 mM Tris-HCl (pH 7.5) was linearly increased from 0 mM to 300 mM, 141 mL (30 CV) of solution was infused to elute LcAOX, LrHP or SrAOX3925 bound to the resin.

[0301] The eluted fraction was concentrated using Amicon Ultracel-30K and purified using a HiLoad (registered trademark) 26 / 60 Superdex 200 column. 10 mM Bis-Tris-HCl (pH 7.0) containing 150 mM NaCl was used for equilibration of the resin and elution.

[0302] The purity of each eluted fraction was evaluated by SDS-PAGE, and the fraction containing no impurity protein was recovered as a purified standard product of LcAOX, LrHP or SrAOX3925.

[0303] (Determination of oxidase activity of LcAOX, LrHP, SrAOX3925, SrAOX3926, and SrEAOX)

[0304] The oxidase activity of LcAOX, LrHP, SrAOX3925, SrAOX3926, and SrEAOX expressed by the above method was measured. 580 μl of the reagent composed of the composition of Table 12 was incubated at 37°C for 5 minutes, 20 μl of substrate solution (1500 mM EAP) was added and mixed, and the A per minute at 37°C was measured using a spectrophotometer (U-3900, manufactured by Hitachi High-Technologies Corporation). 555 Change (ΔA S ). Next, 20 μl of ion exchange water was added instead of the substrate solution and mixed, and the A per minute at 37°C was measured. 555 Amount of change (ΔA0).

[0305] [Table 12]

[0306]

[0307] The oxidase activity was calculated according to the following formula.

[0308] Oxidase activity (U / ml)

[0309] =(ΔA S -ΔA0)×600.0×df / (39.2×0.5×x)

[0310] =30.6×(ΔA S -ΔA0)×df / x

[0311] 39.2: Millimolar extinction coefficient of 4-AA-TOOS condensed pigment for light of wavelength 555 nm (mM -1 cm -1 )

[0312] Df: dilution rate of enzyme solution

[0313] (Quantification of EAP based on LrHP)

[0314] After incubating 580.0 μl of the reagent having the composition of Table 13 at 37°C for 5 minutes, 20.0 μl of EAP solution (3, 6, 18 or 30 mM) or ion exchange water was added and mixed, and the A value at 37°C for 20 minutes was measured using a spectrophotometer (U-3900). 555 Change. Take A 20 minutes after the start of measurement 555 The vertical axis is EAP concentration, and the horizontal axis is EAP concentration. 555 Correlation with EAP concentrations.

[0315] [Table 13]

[0316]

[0317] *The activity (U) was measured at a final concentration of 50 mM EAP and pH 7.5.

[0318] (Quantification of EAP of LrHP by electrochemical method)

[0319] On the screen-printed electrodes (SCREEN-PRINTED ELECTRODES) (manufactured by DropSens, product number DRP-C110), 20 μl of 150 mM Bicine-NaOH buffer (pH 7.5), 5 μl of 1.5 M potassium chloride solution, 15 μl of LrHP solution (0.14 U / ml) were coated and mixed. Then, a dedicated connector (DRP-CAC) was used to connect to the ALS electrochemical analyzer 814D. Chronoamperometry was performed at +600 mV (Ag / AgCl). Next, 2 μl of EAP solution of each concentration was added, and the current value was recorded 100 seconds after the start of the measurement. As a control experiment, the same experiment was performed using 5 μl of ultrapure water (ion exchange water) instead of the LrHP solution.

[0320] (Test results: Determination of oxidase activity of LcAOX, LrHP, SrAOX3925, SrAOX3926, and SrEAOX)

[0321] The crude enzyme solutions of LcAOX, LrHP, SrAOX3925, SrAOX3926, and SrEAOX had oxidase activities for EAP of 1.8, 5.8, 2.6, 0.2, and 16 U / L, respectively. After purification, LcAOX, LrHP, and SrAOX3925 also showed activities of 0.11, 0.31, and 0.16 U / ml, respectively. Therefore, it is indicated that LcAOX, LrHP, and SrAOX3925 each catalyze the reaction of oxidizing EAP to generate hydrogen peroxide. SrAOX3926 and SrEAOX are believed to also show oxidase activity for EAP after purification to a level free of impurity proteins.

[0322] (Test results: EAP measurement results based on LrHP)

[0323] Figure 5 It is the relationship between EAP concentration and absorbance after 20 minutes (A 555 , mAbs). Figure 5 , in the range of 100 μM to 1000 μM, as the EAP concentration and the absorbance after 20 minutes (A 555 , mAbs) 2 ) is 0.908, so the EAP concentration (μM) and absorbance (A555 The results showed that there was a correlation between the two (mAbs)). That is, the results obtained showed that by using LrHP, the EAP concentration (μM) could be measured in the range of 100μM to 1000μM. It is conceivable that if the amount of LrHP used is increased, it is easier to quantify low-concentration EAP, and if the amount of LrHP used is reduced, it is easier to quantify high-concentration EAP. It is believed that the EAP concentration (μM) can be measured even when LcAOX, SrAOX3925, SrAOX3926 or SrEAOX is used instead of LrHP.

[0324] (Test results: Quantification of EAP of LrHP based on electrochemical method)

[0325] Figure 6 This is a graph in which current values ​​100 seconds after the start of measurement are plotted when 0 μM to 1400 μM of EAP are added. Figure 7 This is a graph that plots the current value 100 seconds after the start of the measurement when 0μM to 170μM EAP is added. Both results show that the current value increases with the increase in EAP concentration. As a control, the same experiment was performed using 5μl ultrapure water (ion exchange water) instead of the EAPOX solution, but no increase in the response current was observed when EAP was added. Therefore, EAP can also be quantified by electrochemical measurement. It can be assumed that if the amount of LrHP used is increased, it will be easier to quantify low-concentration EAP, and if the amount of LrHP used is reduced, it will be easier to quantify high-concentration EAP. It is believed that the EAP concentration (μM) can be measured even when AgPEAOX, LcAOX, SrAOX3925, SrAOX3926 or SrEAOX is used instead of LrHP.

[0326] As described above, through the method for quantifying EAP by adding oxidase to a sample containing EAP, the oxidase for quantifying EAP added to a sample containing EAP, the composition for quantifying EAP containing the oxidase added to a sample containing EAP, the kit for quantifying EAP containing the oxidase added to a sample containing EAP, and the sensor for quantifying EAP containing the oxidase added to a sample containing EAP of the present invention, a new quantification method, quantification enzyme, quantification composition, quantification kit and quantification sensor for quantifying EAP concentration as a biomarker for depression can be provided.

[0327] (Explanation of Reference Numerals)

[0328] 1: working electrode; 3: counter electrode; 5: reference electrode; 7: wiring part; 9: terminal;

[0329] 10: sensor chip; 11: substrate; 13: spacer; 15: cover;

[0330] 19: reaction layer; 30: measuring unit; 31: switch; 33: display; 100: sensor;

[0331] 110: control unit; 120: display unit; 130: input unit; 140: storage unit;

[0332] 150: communication unit; 160: power supply; 190: wire. Sequence Listing <110> KIKKOMAN CORPORATION <120> Method for quantitative determination of phosphoethanolamine, oxidoreductase for quantitative determination, composition for quantitative determination, kit for quantitative determination, and sensor for quantitative determination <130> KM18I001 <160> 39 <170> PatentIn Version 3.5 <210> 1 <211> 463 <212> PRT <213> Paracoccus denitrificans <400> 1 Met Gln Ala Ile Glu Lys Arg Ala Gly Ala Leu Pro Tyr Asp Pro Leu 1 5 10 15 Tyr Asp Pro Val Thr Ala Arg Gly Leu Gly Pro Arg Ser Asp Tyr Ala 20 25 30 Pro Thr Tyr Trp Ile Gly Thr Ala Gly Ala Pro Pro Pro Asp Asp Gly 35 40 45 Pro Val Thr Gly Asp Met Asp Ala Asp Val Val Val Ile Gly Ser Gly 50 55 60 Tyr Thr Gly Leu Ser Cys Ala Leu His Leu Ala Lys Met His Gly Ile 65 70 75 80 Lys Ala Val Val Leu Glu Ala Asn Gly Val Ala Tyr Gly Cys Ser Thr 85 90 95 Arg Asn Gly Gly Gln Ala Gln Val Ser Ser Gly Arg Leu Lys Arg Ser 100 105 110 Gln Trp Ile Glu Arg Trp Gly Leu Asp Val Ala Arg Arg Leu His Ala 115 120 125 Glu Val Cys Glu Gly Phe Asp Leu Phe Arg Gly Leu Ile Arg Asp His 130 135 140 Ala Ile Asp Cys Asp Pro Gln Asp Gly Gly His Tyr Tyr Ile Ala His 145 150 155 160 Lys Ala Ser Ala Met Pro Ala Leu Glu Lys Glu Thr Ala Leu Leu Arg 165 170 175 Asp Thr Phe Gly Tyr Asp Ala Arg Met Ile Ser Arg Asp Glu Leu His 180 185 190 Glu Thr Val Ala Arg Asp Gln Glu Ala His Gly Ala Met Trp Glu Ala 195 200 205 Asp Gly Val Gly Ile His Ala Ala Lys Leu Ala Phe Gly Tyr Leu Arg 210 215 220 Ala Ala Arg Glu Leu Gly Ala Arg Val His Val Asp Ser Pro Val Gln 225 230 235 240 Gly Trp Glu Tyr Arg Asn Gly Val His His Leu Arg Thr Pro Gly Gly 245 250 255 Thr Val Arg Ala Arg Arg Val Ala Val Ala Thr Ala Ala Tyr Ala Pro 260 265 270 Arg Ser Leu His Pro Arg Leu Arg Asp Arg Leu Met Pro Ile Met Ser 275 280 285 Asn Ser Ile Val Thr Arg Val Leu Thr Pro Ala Glu Leu Glu Ala Val 290 295 300 Gly Ile Arg Lys Leu Ser Pro Leu Thr Asp Thr Arg Thr Leu Arg His 305 310 315 320 Tyr Tyr Arg Leu Leu Pro Asp Asn Arg Leu Gln Ile Gly Ser Arg Ala 325 330 335 Ala Ile Thr Gly Arg Asp Ala Ala Asn Pro Ala His Leu Asp Ala Leu 340 345 350 Arg Glu Gly Met Ala Arg Lys Phe Pro Ala Leu Arg Gly Ile Ala Leu 355 360 365 Asp Tyr Ser Trp Trp Gly Trp Val Asp Val Ser His Asp Met Met Pro 370 375 380 Arg Ile Thr Gly Leu Pro Asp Leu Pro Gly Ala Phe Tyr Ala Leu Gly 385 390 395 400 Tyr Gly Gly Asn Gly Val Met Tyr Ser Ala Met Ala Gly Arg Arg Met 405 410 415 Ala Gln Leu Val Ala Gly Glu Ala Val Pro Asp Leu Pro Ile Phe Asn 420 425 430 Asn Glu Leu Pro His Glu Gly Trp Arg Thr Pro Phe Arg Arg Leu Gly 435 440 445 Gln Trp Gly Leu Tyr Lys Phe Tyr His Tyr Arg Asp Glu Arg Arg 450 455 460 <210> 2 <211> 1392 <212> DNA <213> Paracoccus denitrificans <400> 2 atgcaagcta ttgaaaaacg tgcaggcgcc ttgccttacg accctcttta tgatcctgtt 60 accgcacgtg gactgggtcc gcgctccgat tatgctccga cctactggat cggcaccgca 120 ggagcacctc ccccggatga tggcccggtt accggtgata tggacgcaga tgtagttgtt 180 attgggagcg gttacaccgg gctgtcatgc gctttacatc tggcaaaaat gcatgggatc 240 aaggcagtgg tcttggaggc caatggtgtt gcctatggct gctctactcg gaatggcggc 300 caggcgcagg tttcatctgg ccgccttaag agatctcaat ggattgaacg ctggggtctt 360 gatgtcgccc gtcgtcttca cgccgaagtt tgtgagggtt tcgatctgtt ccgtggcctt 420 attcgtgatc acgctatcga ttgtgatccg caagacggtg ggcattatta tatcgcacat 480 aaagcaagcg ctatgccggc cttagagaag gagacagccc tgctgcgtga tacttttgga 540 tatgacgccc gtatgattag ccgtgacgag ttgcatgaaa ccgttgcgcg tgaccaggaa 600 gcacatggtg ccatgtggga agccgatggt gtgggtatac acgcggcaaa attagccttc 660 ggttatttac gtgccgcaag agagctgggg gcccgtgttc acgtagacag cccggtgcaa 720 ggctgggaat accgtaatgg tgtgcatcac ctgcgcaccc cgggcggaac tgttcgcgcg 780 cgtcgcgtgg cagtggccac agcggcctac gcgccgcgtt cattacatcc tcgccttcgt 840 gaccgtctga tgcctatcat gagtaacagc atcgtgacac gcgtgcttac tccggcggaa 900 cttgaagcag tcggtattag aaaactgagt ccgctgacgg atacacggac actgcgccat 960 tattatcggt tgttaccaga caatcgcctg cagattggta gtagagcagc gataacgggt 1020 cgggacgcgg ctaatcctgc gcatctggac gcgctgcgcg agggtatggc gcgcaaattt 1080 cccgctctga gaggcattgc tctggattac tcctggtggg gttgggtaga tgtctcgcac 1140 gatatgatgc cacgcataac ggggttaccc gatctgcccg gagcttttta cgctttaggg 1200 tatggcggca acggagtaat gtattcggct atggctggcc gccggatggc gcagttggta 1260 gcggggggaag ctgtcccaga tttaccaatt tttaacaacg aactgccaca cgaaggatgg 1320 cggacgccat ttcgccggct gggacagtgg ggattgtata aattttatca ttatagagat 1380 gaaagacggt aa 1392 <210> 3 <211> 139 <212> PRT <213> Paracoccus denitrifans <400> 3 Put Pro Arg Thr Leu Thr Ala Ala Asp Leu Gln Ala Thr Phe Asp Ala 1 5 10 15 Phe Asn Arg His Asp Ile Asp Gly Val Met Thr His Phe Ala Asp Asp 20 25 30 Cys Val Phe Tyr Thr Val Ser Gly Glu His Glu Tyr Gly Asn Arg Ile 35 40 45 Glu Gly Lys Ala Ala Ile Ala Arg Ala Phe Glu Ala Val Trp Thr Thr 50 55 60 Met Pro Asp Val Gln Trp Ala Glu His Thr His Phe Leu Ser Glu Asp 65 70 75 80 Gly Thr Arg Gly Val Ser Gln Trp Thr Phe Arg Ala Thr Asn Pro Asp 85 90 95 Gly Ser Arg Thr Glu Val Gln Gly Val Asp Leu Phe Arg Ile Ala Asp 100 105 110 Gly Arg Ile Val Glu Lys Gln Ala Ile Arg Lys Gln Arg Pro Ala Ile 115 120 125 Pro Ala Ala Thr Ala Pro Ala Leu Ala Gly Lys 130 135 <210> 4 <211> 420 <212> DNA <213> Paracoccus denitrificans <400> 4 atgccacgta ctttgaccgc tgccgactta caggccacat tcgacgcatt taacagacac 60 gatattgacg gtgtcatgac gcactttgcc gatgattgtg tattctatac cgtttccggc 120 gaacatgagt acggcaatcg cattgaaggc aaagcggcga tagcgcgtgc attcgaagcc 180 gtttggacca ccatgcccga tgtgcaatgg gcagaacata cacattttct gagcgaagac 240 ggaactcgcg gtgttagtca gtggacgttt cgcgcgacta atccggatgg atcacgtacg 300 gaggtgcagg gggtggatct gtttcgtatc gcggatgggc ggattgtcga gaaacaagca 360 attcggaagc agagacctgc aatcccggct gctacagcac cggctcttgc cggtaaataa 420 <210> 5 <211> 30 <212> DNA <213> Artificial sequence <220> <223> Artificially synthesized primer sequences <400> 5 agacggtaaggatccatgccacgtactttg 30 <210> 6 <211> 30 <212> DNA <213> Artificial sequence <220> <223> Artificially synthesized primer sequences <400> 6 acggagctcg aattcttatt taccggcaag 30 <210> 7 <211> 30 <212> DNA <213> Artificial sequence <220> <223> Artificially synthesized primer sequences <400> 7 ggatccttac cgtctttcat ctctataatg 30 <210> 8 <211> 30 <212> DNA <213> Artificial sequence <220> <223> Artificially synthesized primer sequences <400> 8 gaattcgagc tccgtcgaca agcttgcggc 30 <210> 9 <211> 638 <212> PRT <213> Arthrobacter globiformis <400> 9 Met Thr Pro Ser Thr Ile Gln Thr Ala Ser Pro Phe Arg Leu Ala Ser 1 5 10 15 Ala Gly Glu Ile Ser Glu Val Gln Gly Ile Leu Arg Thr Ala Gly Leu 20 25 30 Leu Gly Pro Glu Lys Arg Ile Ala Tyr Leu Gly Val Leu Asp Pro Ala 35 40 45 Arg Gly Ala Gly Ser Glu Ala Glu Asp Arg Arg Phe Arg Val Phe Ile 50 55 60 His Asp Val Ser Gly Ala Arg Pro Gln Glu Val Thr Val Ser Val Thr 65 70 75 80 Asn Gly Thr Val Ile Ser Ala Val Glu Leu Asp Thr Ala Ala Thr Gly 85 90 95 Glu Leu Pro Val Leu Glu Glu Glu Phe Glu Val Val Glu Gln Leu Leu 100 105 110 Ala Thr Asp Glu Arg Trp Leu Lys Ala Leu Ala Ala Arg Asn Leu Asp 115 120 125 Val Ser Lys Val Arg Val Ala Pro Leu Ser Ala Gly Val Phe Glu Tyr 130 135 140 Ala Glu Glu Arg Gly Arg Arg Ile Leu Arg Gly Leu Ala Phe Val Gln 145 150 155 160 Asp Phe Pro Glu Asp Ser Ala Trp Ala His Pro Val Asp Gly Leu Val 165 170 175 Ala Tyr Val Asp Val Val Ser Lys Glu Val Thr Arg Val Ile Asp Thr 180 185 190 Gly Val Phe Pro Val Pro Ala Glu His Gly Asn Tyr Thr Asp Pro Glu 195 200 205 Leu Thr Gly Pro Leu Arg Thr Thr Gln Lys Pro Ile Ser Ile Thr Gln 210 215 220 Pro Glu Gly Pro Ser Phe Thr Val Thr Gly Gly Asn His Ile Glu Trp 225 230 235 240 Glu Lys Trp Ser Leu Asp Val Gly Phe Asp Val Arg Glu Gly Val Val 245 250 255 Leu His Asn Ile Ala Phe Arg Asp Gly Asp Arg Leu Arg Pro Ile Ile 260 265 270 Asn Arg Ala Ser Ile Ala Glu Met Val Val Pro Tyr Gly Asp Pro Ser 275 280 285 Pro Ile Arg Ser Trp Gln Asn Tyr Phe Asp Thr Gly Glu Tyr Leu Val 290 295 300 Gly Gln Tyr Ala Asn Ser Leu Glu Leu Gly Cys Asp Cys Leu Gly Asp 305 310 315 320 Ile Thr Tyr Leu Ser Pro Val Ile Ser Asp Ala Phe Gly Asn Pro Arg 325 330 335 Glu Ile Arg Asn Gly Ile Cys Met His Glu Glu Asp Trp Gly Ile Leu 340 345 350 Ala Lys His Ser Asp Leu Trp Ser Gly Ile Asn Tyr Thr Arg Arg Asn 355 360 365 Arg Arg Met Val Ile Ser Phe Phe Thr Thr Ile Gly Asn Tyr Asp Tyr 370 375 380 Gly Phe Tyr Trp Tyr Leu Tyr Leu Asp Gly Thr Ile Glu Phe Glu Ala 385 390 395 400 Lys Ala Thr Gly Val Val Phe Thr Ser Ala Phe Pro Glu Gly Gly Ser 405 410 415 Asp Asn Ile Ser Gln Leu Ala Pro Gly Leu Gly Ala Pro Phe His Gln 420 425 430 His Ile Phe Ser Ala Arg Leu Asp Met Ala Ile Asp Gly Phe Thr Asn 435 440 445 Arg Val Glu Glu Glu Asp Val Val Arg Gln Thr Met Gly Pro Gly Asn 450 455 460 Glu Arg Gly Asn Ala Phe Ser Arg Lys Arg Thr Val Leu Thr Arg Glu 465 470 475 480 Ser Glu Ala Val Arg Glu Ala Asp Ala Arg Thr Gly Arg Thr Trp Ile 485 490 495 Ile Ser Asn Pro Glu Ser Lys Asn Arg Leu Asn Glu Pro Val Gly Tyr 500 505 510 Lys Leu His Ala His Asn Gln Pro Thr Leu Leu Ala Asp Pro Gly Ser 515 520 525 Ser Ile Ala Arg Arg Ala Ala Phe Ala Thr Lys Asp Leu Trp Val Thr 530 535 540 Arg Tyr Ala Asp Asp Glu Arg Tyr Pro Thr Gly Asp Phe Val Asn Gln 545 550 555 560 His Ser Gly Gly Ala Gly Leu Pro Ser Tyr Ile Ala Gln Asp Arg Asp 565 570 575 Ile Asp Gly Gln Asp Ile Val Val Trp His Thr Phe Gly Leu Thr His 580 585 590 Phe Pro Arg Val Glu Asp Trp Pro Ile Met Pro Val Asp Thr Val Gly 595 600 605 Phe Lys Leu Arg Pro Glu Gly Phe Phe Asp Arg Ser Pro Val Leu Asp 610 615 620 Val Pro Ala Asn Pro Ser Gln Ser Gly Ser His Cys His Gly 625 630 635 <210> 10 <211> 1914 <212> DNA <213> Arthrobacter globiformis <400> 10 atgacaccgt caacgattca aactgccagt ccatttcgtt tagcatcggc tggcgagatc 60 agcgaagtac aaggaatcct gcgcactgca ggcttattgg gtcccgagaa acgcattgct 120 tacttggggg tccttgatcc tgctcgtggg gccggcagcg aagcggaaga tcgccgtttc 180 cgcgttttta tccacgatgt ctcgggagcg cgccctcaag aagtgactgt gtcggtaacg 240 aacggtacgg tcatttccgc cgtcgaattg gatacagccg ccactggtga attaccggta 300 ttggaagaag agttcgaggt tgtagaacaa ctgctggcaa cggatgagcg ttggttaaag 360 gcacttgcgg ctcgtaacct tgatgttagt aaagtacgcg tagctcctct ttctgctggt 420 gtctttgagt acgccgaaga acgcggccgt cgcatccttc gtggcttggc ttttgtacag 480 gacttcccag aagattcggc ttgggcacat cccgtggacg ggcttgtggc ctacgttgac 540 gtggtatcaa aggaagtcac ccgtgtaatt gatactgggg ttttccccgt accggcggaa 600 catgggaact acacagatcc cgagttgaca ggtcctcttc gcacgacaca gaagcctatc 660 agcattacac agcccgaagg tccttcattt acggtgacgg gcggcaacca tatcgagtgg 720 gagaaatggt ccctggacgt cggattcgac gttcgtgagg gtgtggtgct tcataacatt 780 gcttttcgtg acggagatcg ccttcgcccg attatcaacc gcgcgtccat tgctgaaatg 840 gtcgtccctt acggggatcc ttctcccatt cgctcgtggc agaactattt cgatacgggg 900 gagtacttag tcggccagta cgccaactca ttggaacttg gctgtgattg tcttggagat 960 atcacgtacc tgtcccctgt tatctcagat gcgttcggaa accctcgtga aatccgcaac 1020 gggatctgta tgcatgaaga agattggggg attcttgcaa aacattcgga tttatggtcc 1080 ggcatcaact atacgcgtcg caatcgtcgt atggtgattt catttttcac aaccatcggg 1140 aattatgatt atgggtttta ttggtatctg tacctggacg gaacgatcga gtttgaagca 1200 aaggcaactg gagtggtatt cacgtctgcg tttcccgagg gcgggtccga taatattagc 1260 cagcttgccc caggccttgg cgctccgttt catcaacaca tcttctcggc ccgtttagac 1320 atggctatcg atggattcac gaatcgtgtt gaggaagagg atgttgtgcg ccaaacgatg 1380 ggacccggca acgaacgtgg gaatgcgttc agtcgtaaac gtacggttct gacgcgcgaa 1440 tcagaagcgg tacgtgaggc agacgcacgt acaggtcgca cctggatcat ctcaaatccc 1500 gagtctaaga atcgtcttaa tgaacccgta gggtataagt tacacgccca caaccaaccg 1560 accttactgg cggaccctgg aagctcaatc gctcgtcgcg cggccttcgc caccaaagat 1620 ctgtgggtaa cacgttacgc cgacgatgag cgctatccca caggagactt cgtaaaccag 1680 cattccgggg gcgcgggttt gccatcctat attgcccagg accgcgacat cgatggccaa 1740 gacatcgtag tatggcatac atttggactt acccactttc cacgtgtgga ggactggcca 1800 attatgccgg tggacactgt aggtttcaag cttcgcccag aaggattctt tgaccgcagt 1860 cctgtgctgg atgtaccagc caatccctcc caatctggtt cacactgcca tgga 1914 <210> 11 <211> 15 <212> DNA <213> Artificial sequence <220> <223> pKK223-3 <400> 11 caggaaacag aattc 15 <210> 12 <211> 975 <212> DNA <213> Arthrobacter globiformis <400> 12 atgacaccgt caacgattca aactgccagt ccatttcgtt tagcatcggc tggcgagatc 60 agcgaagtac aaggaatcct gcgcactgca ggcttattgg gtcccgagaa acgcattgct 120 tacttggggg tccttgatcc tgctcgtggg gccggcagcg aagcggaaga tcgccgtttc 180 cgcgttttta tccacgatgt ctcgggagcg cgccctcaag aagtgactgt gtcggtaacg 240 aacggtacgg tcatttccgc cgtcgaattg gatacagccg ccactggtga attaccggta 300 ttggaagaag agttcgaggt tgtagaacaa ctgctggcaa cggatgagcg ttggttaaag 360 gcacttgcgg ctcgtaacct tgatgttagt aaagtacgcg tagctcctct ttctgctggt 420 gtctttgagt acgccgaaga acgcggccgt cgcatccttc gtggcttggc ttttgtacag 480 gacttcccag aagattcggc ttgggcacat cccgtggacg ggcttgtggc ctacgttgac 540 gtggtatcaa aggaagtcac ccgtgtaatt gatactgggg ttttccccgt accggcggaa 600 catgggaact acacagatcc cgagttgaca ggtcctcttc gcacgacaca gaagcctatc 660 agcattacac agcccgaagg tccttcattt acggtgacgg gcggcaacca tatcgagtgg 720 gagaaatggt ccctggacgt cggattcgac gttcgtgagg gtgtggtgct tcataacatt 780 gcttttcgtg acggagatcg ccttcgcccg attatcaacc gcgcgtccat tgctgaaatg 840 gtcgtccctt acggggatcc ttctcccatt cgctcgtggc agaactattt cgatacgggg 900 gagtacttag tcggccagta cgccaactca ttggaacttg gctgtgattg tcttggagat 960 atcacgtacc tgtcc 975 <210> 13 <211> 957 <212> DNA <213> Arthrobacter globiformis <400> 13 atcacgtacc tgtcccctgt tatctcagat gcgttcggaa accctcgtga aatccgcaac 60 gggatctgta tgcatgaaga agattggggg attcttgcaa aacattcgga tttatggtcc 120 ggcatcaact atacgcgtcg caatcgtcgt atggtgattt catttttcac aaccatcggg 180 aattatgatt atgggtttta ttggtatctg tacctggacg gaacgatcga gtttgaagca 240 aaggcaactg gagtggtatt cacgtctgcg tttcccgagg gcgggtccga tatattagc 300 cagcttgccc caggccttgg cgctccgttt catcaaca tcttcggc ccgtttagac 360 atggctatcg atggattcac gaatcgtgtt gaggaagagg atgttgtgcg ccaaacgatg 420 ggacccggca acgaacgtgg gaatgcgttc agtcgtaaac gtacggttct gacgcgcgaa 480 tcagaagcgg tacgtgaggc agacgcacgt acaggtcgca cctggatcat ctcaaatccc 540 gagtctaaga atcgtcttaa tgaacccgta gggtataagt tacacgccca caaccaaccg 600 accttactgg cggaccctgg aagctcaatc gctcgtcgcg cggccttcgc caccaaagat 660 ctgtgggtaa cacgttacgc cgacgatgag cgctatccca caggagactt cgtaaaccag 720 cattccgggg gcgcgggttt gccatcctat attgcccagg accgcgacat cgatggccaa 780 gacatcgtag tatggcatac atttggactt acccactttc cacgtgtgga ggactggcca 840 attatgccgg tggacactgt aggtttcaag cttcgcccag aaggattctt tgaccgcagt 900 cctgtgctgg atgtaccagc caatccctcc caatctggtt cacactgcca tggataa 957 <210> 14 <211> 15 <212> DNA <213> Artificial sequence <220> <223> pKK223-3 <400> 14 aagcttggct gtttt 15 <210> 15 <211> 676 <212> PRT <213> Lichtheimia corymbifera <400> 15 Met Ser Ser Ser Ser Ser Ala Thr Pro Lys Pro His Pro Leu Asp Pro 1 5 10 15 Leu Ser Ala Asp Glu Ile Arg Arg Ala Ala Ala Ile Ile Arg Glu Lys 20 25 30 Arg Gly Gln Asp Thr Ser Tyr Val Phe Asn Ser Leu Thr Leu Lys Glu 35 40 45 Pro Ala Lys Gln Gln Met Met Leu Tyr Leu Gly Trp Val Asn Ser Ser 50 55 60 Ser Gln Pro Lys Pro Val Thr Ile Asp Arg Glu Val Phe Ala Val Leu 65 70 75 80 Ile Asp Arg Pro Ser Gly Leu Val His Glu Met Thr Val Asn Leu Asp 85 90 95 Lys Ser Ala Val Thr Ser Trp Asn Lys Val Glu Gly Arg Gln Pro Thr 100 105 110 Ile Asn Ile Phe Glu Met Leu Glu Ala Glu Arg Glu Ile Leu Lys Asp 115 120 125 Glu Arg Val Lys Asp Gln Cys Arg Gln Leu Gly Ile Thr Asp Met Ser 130 135 140 Met Val Tyr Ala Asp Pro Trp Gly Val Gly Tyr His Glu Ile Lys Gly 145 150 155 160 Lys Arg Leu Val Gln Ala Leu Leu Tyr Ala Arg Thr Ser Pro Asp Asp 165 170 175 Asn Gln Tyr Ala His Pro Leu Asp Phe Asn Pro Leu Tyr Asp Leu Asn 180 185 190 Ala Lys Lys Val Leu Asp Ile Val Val Ser Lys Arg Arg Asn Ser Ser 195 200 205 Phe Glu Arg Pro Val Ile Pro Met Ala Asn His His Phe Leu Pro Glu 210 215 220 His Leu Gly Glu Asp Arg Leu Arg Lys Asp Ile Lys Pro Ile Glu Ile 225 230 235 240 Thr Gln Pro Gln Gly Val Ser Phe Ser Ile Arg Asp Gly His Gln Leu 245 250 255 His Trp Gln Lys Trp Asp Met His Leu Ser Phe Asn Tyr Arg Glu Gly 260 265 270 Leu Val Ile Asn Asn Leu Ser Tyr Arg Asp Met Asp Ser Thr Val Arg 275 280 285 Pro Ile Ile Tyr Arg Met Ser Leu Ala Glu Met Val Val Pro Tyr Ala 290 295 300 Asn Pro Tyr Lys Pro Tyr Asn His Lys Met Ala Phe Asp Val Gly Glu 305 310 315 320 Tyr Gly Leu Gly Asn Leu Thr Asn Ser Leu Glu Leu Gly Cys Asp Cys 325 330 335 Val Gly Lys Ile Gly Tyr Leu Asp Ala Val Leu Ser Asp Leu Asn Gly 340 345 350 Asp Pro Trp His Ile Pro Asn Ala Ile Cys Ile His Glu Glu Asp Thr 355 360 365 Gly Leu Leu Phe Lys His Ser Asp Tyr Arg Thr Gly Lys Ala His Ser 370 375 380 Ala Arg Ser Arg Arg Leu Val Ile Ser His Ile Val Thr Ala Ala Asn 385 390 395 400 Tyr Asp Tyr Gly Leu Tyr Tyr Tyr Phe Tyr Gln Asp Gly Thr Ile Gln 405 410 415 Tyr Glu Val Lys Ala Thr Gly Glu Leu Asn Thr Gln Val Leu Ala Glu 420 425 430 Asp Glu Asp Ala Ala Pro Tyr Gly Thr Ile Val Ala Pro Gln Val Asp 435 440 445 Ala Gln His His Gln His Leu Phe Ser Met Arg Ile Asp Pro Met Leu 450 455 460 Asp Gly Pro Asn Asn Ser Val Ala Glu Val Asp Val Val Ala Ser Asp 465 470 475 480 Leu Pro Val Gly His Pro His Asn Ser Val Gly Asn Ser Phe Tyr Pro 485 490 495 Val Thr Lys Val Phe Asn Thr Thr Asp Glu Ala Lys Thr Met Ala Ser 500 505 510 Val Glu Arg His Arg Thr Trp Lys Ile Ile Asn Glu Ser Lys Ile His 515 520 525 Pro Tyr Ala Lys Gln Pro Val Gly Phe Lys Met Met Ala His Pro Thr 530 535 540 Pro Pro Leu Leu Pro Lys Pro Gly Ser Ile Val Tyr Glu Arg Ala Met 545 550 555 560 Phe Ala Ser Lys Thr Leu Trp Val Thr Pro His Asn Asp Lys Gln Leu 565 570 575 Tyr Pro Gly Gly Phe Tyr Cys Tyr Gln Ser Glu Pro Ser Glu Asn Leu 580 585 590 Gly Leu Pro Gln Trp Thr Lys Glu Thr Gln Asn Val Arg Asp Thr Asp 595 600 605 Ile Val Cys Trp Leu Asn Phe Gly Ile Thr His Ile Pro Arg Val Glu 610 615 620 Asp Phe Pro Ile Met Pro Ile Glu Thr Cys Gly Ile Met Leu Lys Pro 625 630 635 640 Ala Asn Phe Phe Leu Cys Asn Pro Gly Ile Asp Ile Pro Pro Ser Thr 645 650 655 Arg Gln Ser Thr Lys Ser Ala Tyr Ala Asn Asp Ala Thr Cys Cys Arg 660 665 670 Lys Asn Asn Leu 675 <210> 16 <211> 2031 <212> DNA <213> Lichtheimia corymbifera <400> 16 atgcctctt cctcaagcgc cacgccaaag cctcatccat tagacccttt gtccgcagat 60 gagatccgcc gcgcagcagc cattatccgc gaaaaacgtg ggcaggatac ttcttatgtg 120 ttcaacagtt taactttgaa ggaacctgcg aaacagcaaa tgatgttgta cttgggttgg 180 gtcaacagtt catcgcagcc taagcccgtt acaattgacc gcgaagtttt cgcagttctt 240 attgatcgtc caagcggtct ggttcacgag atgacagtta acttagataa gtcggcggtt 300 acctcctgga ataaagtgga aggacgccag cccaccatta acatctttga aatgttagag 360 gcggaacgcg aaatcctgaa ggatgagcgt gtcaaggacc aatgtcgcca gctgggcatc 420 accgacatgt caatggtcta tgctgacccg tggggggtag gctatcatga gatcaaaggt 480 aaacgtcttg ttcaagcgtt gttatacgca cgcacgtccc ctgacgacaa tcaatacgcg 540 cacccccttg acttcaatcc cttatacgat ctgaacgcta agaaggtgct tgacatcgtc 600 gtgtccaaac gtcgtaattc ctcatttgag cgccctgtga tccccatggc gaatcatcac 660 tttctgcccg aacaccttgg tgaagaccgt cttcgtaagg atattaagcc aatcgaaatt 720 acacaaccgc agggcgtatc gttttccatt cgtgacggtc atcagcttca ttggcagaag 780 tgggacatgc atttgtcatt caactaccgc gaaggccttg ttatcaataa tcttagctac 840 cgtgatatgg actccaccgt ccgtccaatt atttaccgta tgagccttgc tgagatggtc 900 gtgccgtatg ctaaccccta caaaccgtac aatcataaga tggcgttcga cgtaggagag 960 tacggcttag ggaatttaac gaatagcctt gagttaggtt gtgactgtgt tggtaagatt 1020 ggttatttag atgcggtgtt gtcggattta aacggggatc cctggcatat ccctaatgca 1080 atttgcattc atgaggagga tacggggttg ttatttaaac actcggacta ccgcacaggg 1140 aaggcgcact ctgctcgtag ccgtcgtttg gtaatttcac atatcgtgac ggcggccaac 1200 tatgattatg gactgtacta ctacttctac caggatggta ccatccagta cgaagttaag 1260 gcaacgggtg aattgaacac ccaggtactg gccgaggatg aagacgccgc accctacggc 1320 accattgtgg ctcctcaagt cgatgcccag catcatcaac atttgttctc catgcgtatc 1380 gacccaatgt tagacggacc gaacaactcg gtcgcagagg ttgacgtggt tgcctccgat 1440 cttcccgtcg gacaccctca caattctgtg ggaaacagct tttatccagt aactaaagtc 1500 ttcaacacta ccgacgaggc caaaacaatg gcgtcagttg agcgtcaccg tacatggaaa 1560 atcattaacg aaagtaaaat ccatccctat gccaagcagc cggttggttt taagatgatg 1620 gctcatccca ccccgccgct tctgcctaag ccagggagca tcgtatatga acgcgcaatg 1680 tttgctagta agacgttatg ggtgacgcct cataacgaca agcagttata tcctggcggt 1740 ttttattgct atcagtcaga gccgtcagaa aaccttgggc ttccacaatg gacgaaggag 1800 acacaaaatg tgcgcgatac cgatatcgtc tgttggctga actttggcat cactcatatc 1860 ccacgcgtag aagactttcc tatcatgcct attgaaactt gtggaattat gcttaagccg 1920 gcgaacttct tcttatgtaa tcccgggatc gatatccgc cctccacacg tcaatcgacc 1980 aagagcgcct atgcgaatga tgcaacttgt tgtcgtaaaa acaatttata a 2031 <210> 17 <211> 681 <212> DNA <213> Lichtheimia corymbifera <400> 17 atgcctctt cctcaagcgc cacgccaaag cctcatccat tagacccttt gtccgcagat 60 gagatccgcc gcgcagcagc cattatccgc gaaaaacgtg ggcaggatac ttcttatgtg 120 ttcaacagtt taactttgaa ggaacctgcg aaacagcaaa tgatgttgta cttgggttgg 180 gtcaacagtt catcgcagcc taagcccgtt acaattgacc gcgaagtttt cgcagttctt 240 attgatcgtc caagcggtct ggttcacgag atgacagtta acttagataa gtcggcggtt 300 acctcctgga ataaagtgga aggacgccag cccaccatta acatctttga aatgttagag 360 gcggaacgcg aaatcctgaa ggatgagcgt gtcaaggacc aatgtcgcca gctgggcatc 420 accgacatgt caatggtcta tgctgacccg tggggggtag gctatcatga gatcaaaggt 480 aaacgtcttg ttcaagcgtt gttatacgca cgcacgtccc ctgacgacaa tcaatacgcg 540 cacccccttg acttcaatcc cttatacgat ctgaacgcta agaaggtgct tgacatcgtc 600 gtgtccaaac gtcgtaattc ctcatttgag cgccctgtga tccccatggc gaatcatcac tttctgcccg aacaccttgg t 681 <210> 18 <211> 696 <212> DNA <213> Lichtheimia corymbifera <400> 18 cccgaacacc ttggtgaaga ccgtcttcgt aaggatatta agccaatcga aattacacaa ccgcagggcg tatcgttttc cattcgtgac ggtcatcagc ttcattggca gaagtgggac atgcatttgt cattcaacta ccgcgaaggc cttgttatca ataatcttag ctaccgtgat 240. atggactcca ccgtccgtcc aattatttac cgtatgagcc ttgctgagat ggtcgtgccg tatgctaacc cctacaaacc gtacaatcat aagatggcgt tcgacgtagg aagatcggc 300 ttagggaat taacgaatag ccttgagtta ggttgtgact gtgttggtaa gattggttat ttagatgcgg tgttgtcgga tttaaacggg gatccctggc atatccctaa tgcaatttgc 420 attcatgagg aggatacggg gttgttattt aaacactcgg actaccgcac aggaggcg 480 cactctgctc gtagccgtcg tttggtaatt tcacatatcg tgacggcggc caactatgat 540 tatgactgt actactactt ctaccaggat ggtaccatcc agtacgaagt taaggcaacg 600 ggtgaattga acacccaggt actggccgag gatgaagacg ccgcacccta cggcaccatt 660 gtggctcctc aagtcgatgc ccagcatcat caacat 696 <210> 19 <211> 684 <212> DNA <213> Lichtheimia corymbifera <400> 19 cagcatcatc aacatttgtt ctccatgcgt atcgacccaa tgttagacgg accgaacaac 60 tcggtcgcag aggttgacgt ggttgcctcc gatcttcccg tcggacaccc tcacaattct 120 gtgggaaaca gcttttatcc agtaactaaa gtcttcaaca ctaccgacga ggccaaaaca 180 atggcgtcag ttgagcgtca ccgtacatgg aaaatcatta acgaaagtaa aatccatccc 240 tatgccaagc agccggttgg ttttaagatg atggctcatc ccaccccgcc gcttctgcct 300 aagccaggga gcatcgtata tgaacgcgca atgtttgcta gtaagacgtt atgggtgacg 360 cctcataacg acaagcagtt atatcctggc ggtttttatt gctatcagtc agagccgtca 420 gaaaaccttg ggcttccaca atggacgaag gagacacaaa atgtgcgcga taccgatatc 480 gtctgttggc tgaactttgg catcactcat atcccacgcg tagaagactt tcctatcatg 540 cctattgaaa cttgtggaat tatgcttaag ccggcgaact tcttcttatg taatcccggg 600 atcgatattc cgccctccac acgtcaatcg accaagagcg cctatgcgaa tgatgcaact 660 tgttgtcgta aaaacaattt ataa 684 <210> 20 <211> 673 <212> PRT <213> Lichtheimia ramosa <400> 20 Met Ser Ser Ser Pro Ile Lys Pro Tyr Pro Leu Asp Pro Leu Thr Ala 1 5 10 15 Asp Glu Ile Arg Arg Ala Ala Ala Leu Ile Arg Glu Thr Arg Gly Gln 20 25 30 Asp Thr Thr Tyr Val Phe Asn Ser Leu Thr Leu Lys Glu Pro Ser Lys 35 40 45 Gln Gln Met Met Ser Tyr Leu Gly Trp Thr Asn Ser Pro Ser His Pro 50 55 60 Lys Pro Val Thr Ile Asp Arg Glu Val Phe Ala Val Leu Ile Asp Arg 65 70 75 80 Pro Ser Gly Leu Val His Glu Met Thr Val Asn Leu Asp Lys Asn Gln 85 90 95 Val Thr Arg Trp Asn Lys Val Glu Gly Arg Gln Pro Thr Val Asn Val 100 105 110 Phe Glu Met Leu Glu Ala Glu Arg Glu Ile Leu Lys Asp Glu Arg Val 115 120 125 Lys Glu Gln Cys Arg Gln Leu Gly Ile Asn Asp Met Ser Met Val Phe 130 135 140 Ala Asp Pro Trp Gly Val Gly Tyr His Glu Ile Lys Gly Lys Arg Leu 145 150 155 160 Val Gln Ala Leu Met Tyr Ala Arg Thr Ser Pro Asp Asp Asn Gln Tyr 165 170 175 Ala His Pro Leu Asp Phe Asn Pro Leu Tyr Asp Val Asn Ala Lys Lys 180 185 190 Val Ile Asp Ile Ile Val Ser Lys Arg Arg Asn Ser Ser Phe Asp Arg 195 200 205 Pro Val Ile Pro Met Ala Asn His His Phe Leu Pro Glu His Leu Gly 210 215 220 Gln Asp Arg Leu Arg Lys Asp Ile Lys Pro Ile Glu Ile Thr Gln Pro 225 230 235 240 Gln Gly Val Ser Phe Ser Ile Arg Asp Gly His Gln Leu His Trp Gln 245 250 255 Lys Trp Asp Met His Leu Ser Phe Asn Tyr Arg Glu Gly Leu Val Ile 260 265 270 Asn Asn Leu Ser Tyr Arg Asp Met Asp Gly Thr Val Arg Pro Ile Ile 275 280 285 Tyr Arg Met Ser Leu Ser Glu Met Val Val Pro Tyr Ala Asn Pro Tyr 290 295 300 Lys Pro Tyr Asn His Lys Met Ala Phe Asp Val Gly Glu Tyr Gly Leu 305 310 315 320 Gly Asn Leu Thr Asn Ser Leu Glu Leu Gly Cys Asp Cys Val Gly Lys 325 330 335 Ile Cys Tyr Leu Asp Ala Thr Leu Ser Asp Leu Asn Gly Asp Pro Trp 340 345 350 Gln Ile Pro Asn Ala Ile Cys Ile His Glu Glu Asp Thr Gly Leu Leu 355 360 365 Phe Lys His Thr Asp Tyr Arg Thr Gly Lys Ala His Ser Ala Arg Ser 370 375 380 Arg Arg Leu Val Ile Ser His Ile Val Thr Ala Ala Asn Tyr Asp Tyr 385 390 395 400 Gly Leu Tyr Tyr Tyr Phe Tyr Gln Asp Gly Thr Ile Gln Tyr Glu Val 405 410 415 Lys Ala Thr Gly Glu Leu Asn Thr Gln Val Leu Ala Ala Asp Glu Asp 420 425 430 Ala Ala Pro Tyr Gly Thr Ile Val Ala Pro Gln Val Asp Ala Gln His 435 440 445 His Gln His Leu Phe Ser Met Arg Ile Asp Pro Met Val Asp Gly Pro 450 455 460 Asn Asn Ser Val Ala Glu Val Asp Val Val Ala Ser Asp Leu Pro Val 465 470 475 480 Gly His Pro His Asn Ser Ile Gly Asn Ser Phe Tyr Pro Val Thr Lys 485 490 495 Val Phe Asn Thr Thr Asp Glu Ala Lys Thr Met Ala Ser Ile Glu Arg 500 505 510 His Arg Ser Trp Lys Ile Ile Asn Glu Asn Lys Ile His Pro Tyr Ala 515 520 525 Lys Gln Pro Val Gly Phe Lys Met Met Ala His Pro Thr Pro Pro Leu 530 535 540 Leu Pro Lys Pro Gly Ser Ile Val Tyr Glu Arg Ala Met Phe Ala Ser 545 550 555 560 Lys Thr Leu Trp Val Thr Pro Tyr Asn Glu Glu Gln Arg Tyr Pro Gly 565 570 575 Gly Phe Tyr Cys Tyr Gln Ser Glu Pro Ser Glu Asn Leu Gly Leu Pro 580 585 590 Gln Trp Thr Lys Glu Thr Gln Asn Val Arg Asp Thr Asp Ile Val Cys 595 600 605 Trp Leu Asn Phe Gly Ile Thr His Ile Pro Arg Val Glu Asp Phe Pro 610 615 620 Ile Met Pro Ile Glu Thr Cys Gly Val Met Leu Lys Pro Val Asn Phe 625 630 635 640 Phe Leu Gly Asn Pro Gly Ile Asp Ile Pro Pro Ser Thr Arg Gln Ser 645 650 655 Thr Lys Ser Ala Tyr Ala Thr Glu Ala Thr Cys Cys Arg Lys Asn Asn 660 665 670 Leu <210> 21 <211> 2022 <212> DNA <213> Lichtheimia ramosa <400> 21 atgtcgtcct caccgatcaa gccgtatcct ttagatccat taacagccga tgagattcgc 60 cgcgcagcag cccttatccg tgaaacgcgc gggcaggaca ccacctatgt gttcaactct 120 ctgacactga aggaaccttc gaagcagcaa atgatgtctt accttgggtg gactaactcg 180 cctagtcacc ccaagccggt cactattgac cgcgaagtct ttgcggtgtt aatcgaccgt 240 ccatccgggt tggtccatga aatgaccgtg aacttggata aaaaccaggt gacccgctgg 300 aataaggttg aaggtcgcca acctacggta aatgtattcg agatgttgga ggcggaacgc 360 gagattttga aagacgagcg tgttaaagag caatgccgcc aattggggat taatgatatg 420 agtatggtct ttgccgatcc ctggggtgta ggatatcacg aaattaaagg caaacgtttg 480 gttcaggcct tgatgtatgc acgtacctct ccggatgaca accaatacgc tcatccactg 540 gactttaacc ctctgtacga tgtgaacgcc aagaaagtaa tcgacattat cgtgtcaaaa 600 cgtcgcaaca gtagtttcga tcgtccagtc attcccatgg caaatcatca tttcttgccg 660 gagcatttag ggcaagatcg ccttcgcaaa gacatcaagc ctattgagat cactcaacct 720 cagggggttt ctttcagcat ccgcgatgga caccaattac attggcagaa gtgggacatg 780 catttgtcat ttaattaccg tgaaggactt gtgatcaaca acttgagcta tcgcgacatg 840 gatggcactg tccgccccat tatttatcgt atgtcgcttt ccgagatggt tgtgccctat 900 gcgaatccat ataagccgta taaccacaaa atggccttcg acgttggtga gtacgggctt 960 ggtaacctta caaactctct tgaattaggg tgtgactgcg tcggaaagat ttgctattta 1020 gacgcgacat tgtcggattt gaatggagac ccgtggcaga ttcccaatgc aatctgcatc 1080 catgaagaag acacaggact tctgtttaag cacacggatt accgcacggg aaaagcacac 1140 tcggcgcgtt ctcgtcgttt ggttatctct catatcgtta cggcggcaaa ttacgactac 1200 ggtttatatt attacttcta tcaagacggt accattcagt atgaagttaa agccaccggc 1260 gagttgaaca ctcaggttct tgcggcagac gaagacgctg ctccttacgg aactattgtg 1320 gccccgcagg ttgacgctca acaccatcaa catttgttca gtatgcgtat cgacccaatg 1380 gtcgatggcc cgaataactc agtggcggaa gtcgacgttg tggcatctga tcttccggtc 1440 gggcacccgc acaattctat tggtaacagt ttttaccccg taacgaaagt atttaacacg 1500 actgatgagg caaaaacgat ggcctccatt gaacgccacc gctcatggaa aattattaac 1560 gagaacaaaa ttcatcccta tgcaaagcag cccgtaggtt tcaaaatgat ggcccaccct 1620 acgccgcctc ttctgcccaa accaggttct atcgtctacg aacgcgccat gtttgcgagc 1680 aaaacattgt gggttactcc atacaacgag gagcaacgtt atcccggggg gttttattgt 1740 taccagtcgg aaccttcgga gaacttagga ctgccacagt ggacaaagga aactcagaat 1800 gttcgcgata cggatattgt atgttggttg aattttggca tcacccacat ccctcgcgtt 1860 gaggatttcc caatcatgcc tatcgaaacg tgcggcgtaa tgctgaagcc ggtaaatttt 1920 tttttaggga atcccggcat tgacatcccg ccctccactc gccaaagcac gaagagtgcg 1980 tacgcgacgg aagcgacttg ctgccgcaaa aataatttat aa 2022 <210> 22 <211> 678 <212> DNA <213> Lichtheimia ramosa <400> 22 atgtcgtcct caccgatcaa gccgtatcct ttagatccat taacagccga tgagattcgc 60 cgcgcagcag cccttatccg tgaaacgcgc gggcaggaca ccacctatgt gttcaactct 120 ctgacactga aggaaccttc gaagcagcaa atgatgtctt accttgggtg gactaactcg 180 cctagtcacc ccaagccggt cactattgac cgcgaagtct ttgcggtgtt aatcgaccgt 240 ccatccgggt tggtccatga aatgaccgtg aacttggata aaaaccaggt gacccgctgg 300 aataaggttg aaggtcgcca acctacggta aatgtattcg agatgttgga ggcggaacgc 360 gagattttga aagacgagcg tgttaaagag caatgccgcc aattggggat taatgatatg 420 agtatggtct ttgccgatcc ctggggtgta ggatatcacg aaattaaagg caaacgtttg 480 gttcaggcct tgatgtatgc acgtacctct ccggatgaca accaatacgc tcatccactg 540 gactttaacc ctctgtacga tgtgaacgcc aagaaagtaa tcgacattat cgtgtcaaaa 600 cgtcgcaaca gtagtttcga tcgtccagtc attcccatgg caaatcatca tttcttgccg 660 gagcatttag ggcaagat 678 <210> 23 <211> 693 <212> DNA <213> Lichtheimia ramosa <400> 23 <h2 style=";text-align:left;direction:ltr">catttagggc aagatcgcct tcgcaaagac atcaagccta ttgagatcac tcaacctcag 60<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ggggtttctt tcagcatccg cgatggacac caattacatt ggcagaagtg ggacatgcat 120<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ttgtcattta attaccgtga aggacttgtg atcaacaact tgagctatcg cgacatggat 180<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ggcactgtcc gccccattat ttatcgtatg tcgctttccg agatggttgt gccctatgcg 240<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> aatccatata agccgtataa ccacaaaatg gccttcgacg ttggtgagta cgggcttggt 300<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> aaccttacaa actctcttga attagggtgt gactgcgtcg gaaagatttg ctatttagac 360<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> gcgacattgt cggatttgaa tggagacccg tggcagattc ccaatgcaat ctgcatccat 420<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> gaagaagaca caggacttct gtttaagcac acggattacc gcacgggaaa agcacactcg 480<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> gcgcgttctc gtcgtttggt tatctctcat atcgttacgg cggcaaatta cgactacggt 540<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ttatattatt acttctatca agacggtacc attcagtatg aagttaaagc caccggcgag 600<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ttgaacactc aggttcttgc ggcagacgaa gacgctgctc cttacggaac tattgtggcc 660<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ccgcaggttg acgctcaaca ccatcaacat ttg 693<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <210> 24<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <211> 681<h2 style=";text-align:left;direction:ltr"> <212> DNA <213> Lichtheimia ramosa <400> 24 caccatcaac atttgttcag tatgcgtatc gacccaatgg tcgatggccc gaataactca 60 gtggcggaag tcgacgttgt ggcatctgat cttccggtcg ggcacccgca caattctatt 120 ggtaacagtt tttaccccgt aacgaaagta tttaacacga ctgatgaggc aaaaacgatg 180 gcctccattg aacgccaccg ctcatggaaa attattaacg agaacaaaat tcatccctat 240 gcaaagcagc ccgtaggttt caaaatgatg gcccacccta cgccgcctct tctgcccaaa 300 ccaggttcta tcgtctacga acgcgccatg tttgcgagca aaacattgtg ggttactcca 360 tacaacgagg agcaacgtta tcccgggggg ttttattgtt accagtcgga accttcggag 420 aacttaggac tgccacagtg gacaaaggaa actcagaatg ttcgcgatac ggatattgta 480 tgttggttga attttggcat cacccacatc cctcgcgttg aggatttccc aatcatgcct 540 atcgaaacgt gcggcgtaat gctgaagccg gtaaattttt ttttagggaa tcccggcatt 600 gacatcccgc cctccactcg ccaaagcacg aagagtgcgt acgcgacgga agcgacttgc 660 tgccgcaaaa ataatttata a 681 <210> 25 <211> 668 <212> PRT <213> Syncephalastrum racemosum <400> 25 Met Thr Ile Val Ser Pro Ser His Pro Leu Asp Pro Leu Thr Pro Ser 1 5 10 15 Glu Ile Arg His Val Ala Glu Ile Val Arg Ala Thr Arg Ser Pro Asp 20 25 30 Asp Lys Thr Pro Arg Asp Tyr Ile Phe Ser Ser Ile Cys Leu Lys Glu 35 40 45 Pro His Lys Asp Lys Thr Leu Ala Tyr Leu Gln Ser Val Ser Glu Glu 50 55 60 Ala Ala Ala Leu Met Pro Glu Arg Glu Ala Leu Val Ile Leu Ile Asp 65 70 75 80 Arg Pro Ser Gly Leu Val His Glu Ile Leu Val Ser Ile Thr Asp Glu 85 90 95 Lys Val Lys Ser Ala Lys Thr Leu Lys Asn Val Gln Pro Thr Gln His 100 105 110 Val Leu Glu Met Ile Glu Ala Glu Lys Ile Ile Thr Lys Asp Pro Ser 115 120 125 Val Ile Glu Glu Cys Arg Lys Leu Gly Ile Thr Asp Met Lys Asn Val 130 135 140 Tyr Ala Asp Pro Trp Thr Val Gly Tyr His Ala Gln Phe Lys Ser Ser 145 150 155 160 Lys Arg Leu Met Gln Ala Leu Met Tyr Met Arg Thr Ser Pro Asp Asp 165 170 175 Asn Gln Tyr Ala His Pro Leu Asp Phe Val Pro Ile Tyr Asp Val Asn 180 185 190 Ala Gln Lys Val Val Glu Ile Leu Arg Gln Glu Thr Ser Glu Ala Ser 195 200 205 Lys Tyr Asp Arg Pro Thr Val Pro Leu Glu Asn His Gln Phe Leu Pro 210 215 220 Glu His Ile Gly Val Glu Asn Leu Arg Lys Asp Ile Lys Pro Ile Glu 225 230 235 240 Ile Thr Gln Pro Glu Gly Val Ser Phe Thr Val Arg Gly Arg Glu Ile 245 250 255 Glu Trp Gln Asn Trp Ser Met His Val Gly Phe Asn Tyr Arg Glu Gly 260 265 270 Val Ile Ile Asn Asn Val Ser Tyr Lys Asp Lys Gly Asn Val Arg Pro 275 280 285 Leu Phe Tyr Arg Val Ser Val Ser Glu Met Val Val Pro Tyr Ala His 290 295 300 Pro Lys Glu Pro Phe Asn His Lys Met Ala Phe Asp Val Gly Glu Tyr 305 310 315 320 Gly Leu Gly Asn Leu Thr Asn Ser Leu Glu Leu Gly Cys Asp Cys Leu 325 330 335 Gly Ser Ile Tyr Tyr Met Asp Gly Val Cys Asn Asn Leu Asp Gly Glu 340 345 350 Pro Trp Val Ile Pro Asn Ala Ile Cys Ile His Glu Glu Asp Thr Gly 355 360 365 Leu Leu Phe Lys His Thr Asp Tyr Arg Thr Asp Lys Ala His Ser Ala 370 375 380 Arg Ser Arg Arg Leu Val Ile Ser Gln Ile Val Thr Ala Ala Asn Tyr 385 390 395 400 Asp Tyr Gly Leu Tyr Phe Tyr Phe Tyr Gln Asp Gly Thr Phe Gln Tyr 405 410 415 Glu Val Lys Ala Thr Gly Glu Leu Asn Thr Gln Val Phe Ala Glu Asp 420 425 430 Glu Asn Pro Ala Pro Tyr Gly Thr Ala Val Ala Pro Gln Val Val Gly 435 440 445 Gln His His Gln His Leu Phe Met Met Arg Ile Asp Pro Met Leu Asp 450 455 460 Gly Arg Leu Asn Ser Val Ala Gln Val Asp Val Leu Pro Ser Glu Tyr 465 470 475 480 Pro Val Gly His Val Glu Asn Pro Ile Gly Asn Ala Phe Ser Pro Ile 485 490 495 Thr Thr Ile Tyr Ser Asp Thr Thr Glu Ala Gln Ala His Gly Asn Leu 500 505 510 Glu Ser Ser Arg Thr Trp Lys Ile Ile Asn Glu Ser Lys Leu His Pro 515 520 525 Tyr Thr Lys Glu Pro Val Gly Tyr Lys Leu Val Ser Pro Asn Thr Pro 530 535 540 Pro Met Leu Pro Lys Pro Gly Ser Leu Val Tyr Glu Arg Ala Lys Phe 545 550 555 560 Ala Thr Lys Thr Ile Trp Val Thr Pro Tyr Asp Pro Asp Gln Ile Tyr 565 570 575 Pro Ala Gly Phe Tyr Cys Ser Gln Ser Pro Gly Asp Asp Ser Met Gly 580 585 590 Leu Pro Ala Trp Thr Lys Glu Pro Gln Ser Val Arg Gly Arg Asp Val 595,600,605 Val Val Trp Leu Thr Phe Gly Leu Thr His Ile Pro Arg Val Glu Asp 610 615 620 Phe Pro Val Met Pro Val Glu Thr Cys Gly Trp Ala Leu Lys Ala Cys 625,630,635,640 Asn Phe Phe Leu Gly Asn Pro Gly Ile Asp Ile Pro Ala Ala Gln Lys 645,650,655 Gly Thr Ser Lys Arg Val Asn Gly Ala Cys Cys Ala 660 665 <210> 26 <211> 2007 <212> DNA <213> Syncephalastrum racemosum <400> 26 atgaccattg tctctccttc acacccctta gacccgctta ccctagtga aattcgccac 60 gtagccgaaa tcgtacgcgc cactcgctct cctgatgata agaccccgcg cgattatatt 120 ttttccagca tttgcttaaa agaacctcat aaggacaaga cgttggcata cttgcaatcg 180 gtgtccgaag aagctgccgc tctgatgcct gaacgtgaag ctctggtaat tctgatcgat 240 cgcccgtcgg gccttgtaca cgagatttta gtttctatca cagatgagaa ggtgaaatct 300 gcaagaccc ttaagaatgt tcaactact cagcatgtct tagagatt cgaagcggaa 360 aagatcatca cgaaggatcc ttcagttac gagaatgtc gcaagttagg cattacggat 420 atgaagaatg tctatgctga tccgtggacg gtgggttacc atgctcatt taagtccagt 480 aaacgtttaa tgcaggccct tatgtacatg cgcaccctc ccgacgacaa ccagtatgcg 540 catcctttag attttgtacc gatttatgat gttaacgcac aaaggtcgt cgagattttg 600 cgccaggaaa cttcggaagc aagcaagtat gatcgtccga cagttccgtt agaaaaccat 660 cagttttac cagagcacat tggcgtggaa aacttacgca aggacatcaa gcccatcgaa 720 attack cggaggggt gtctttaca gtgcgcgggc gtgaaatcga atggcaaat 780 tggagtatgc atgtcgggtt caactatcgt gaaggagtta tcattaaca cgtgtcctat 840 aaggacaagg gcaatgtgcg tccgttattc taccgcgtgt cggtaagtga aatggtcgta 900 ccgtacgcac acccaagga gccgttcaac cataagatgg ccttgacgt cggggagtac 960 ggtttgggga accttactaa cagccttgag ctgggctgtg attgttgggg ctcgatttat 1020 tatatggatg gtgtctgtaa taatctggat ggcgaaccct gggtcatccc caatgcaatt 1080 tgcatccatg aagagatac gggtttgtta ttcaaacaca ccgattaccg cactgataaa 1140 gctcacagcg cacgtagccg ccgtttggtt atctcgcaaa ttgtgaccgc cgccaactat 1200 gattatggct tgtatttcta cttctaccaa gacggtacgt ttcagtacga ggtcaaagct 1260 accggggagc tgaacactca agtttttgcg gaagacgaaa acccagcacc ttatggtacc 1320 gcagtcgctc cccaagtcgt aggccagcat catcaacact tatttatgat gcgcattgac 1380 ccaatgttag atggtcgtct gaactctgtt gcccaggttg atgttttacc ctccgagtac 1440 ccagtcggtc acgtcgagaa tccaatcggc aacgccttta gtcctattac gactatttac 1500 agtgacacga ctgaggcgca ggcacatggg aatttagagt cgtcgcgtac atggaagatc 1560 1620 cctaacactc ccccgatgct tcccaaacct ggatcccttg tctatgaacg cgcaaaattc 1680 gctactaaaa ccatctgggt aactccctat gaccccgatc agatttatcc cgccggattc 1740 tattgctcac aatcaccggg tgacgattcg atgggattgc ctgcatggac taaagaacca 1800 caaagcgtac gtggacgtga cgtagttgtg tggcttacct tcggacttac gcacatccca 1860 cgcgtggaag acttccccgt tatgcctgta gagacgtgcg ggtgggcgct gaaagcgtgt 1920 aatttttct tagggaatcc agggatcgac attccggcag cacagaaggg gacctccaag 1980 cgcgtaaatg gtgcatgttg tgcgtaa 2007 <210> 27 <211> 675 <212> DNA <213> Syncephalastrum racemosum <400> 27 atgaccattg tctctccttc acacccctta gacccgctta ccctagtga aattcgccac 60 gtagccgaaa tcgtacgc cactcgctct cctgatgata agaccccgcg cgattatatt 120 ttttccagca tttgcttaaa agaacctcat aaggacaaga cgttggcata cttgcaatcg 180 gtgtccgaag aagctgccgc tctgatgcct gaacgtgaag ctctggtaat tctgatcgat 240 cgcccgtcgg gccttgtaca cgagatttta gtttctatca cagatgagaa ggtgaaatct 300 gcaaagaccc ttaagaatgt tcaacctact cagcatgtct tagagatgat cgaagcggaa 360 aagatcatca cgaaggatcc ttcagttatc gaagaatgtc gcaagttagg cattacggat 420 atgaagaatg tctatgctga tccgtggacg gtgggttacc atgctcaatt taagtccagt 480 aaacgtttaa tgcaggccct tatgtacatg cgcacctctc ccgacgacaa ccagtatgcg 540 catcctttag atttgtacc gatttatgat gttaacgcac aaaaggtcgt cgagatttg 600 cgccaggaaa cttcggaagc aagcaagtat gatcgtccga cagttccgtt agaaaaccat 660 cagtttttac cagag 675 <210> 28 <211> 690 <212> DNA <213> Syncephalastrum racemosum <400> 28 cagtttttac cagagcacat tggcgtggaa aacttacgca aggacatcaa gcccatcgaa 60 attacccaac cggagggggt gtcttttaca gtgcgcgggc gtgaaatcga atggcaaaat 120 tggagtatgc atgtcgggtt caactatcgt gaaggagtta tcattaacaa cgtgtcctat 180 aaggacaagg gcaatgtgcg tccgttattc taccgcgtgt cggtaagtga aatggtcgta 240 ccgtacgcac accccaagga gccgttcaac cataagatgg cctttgacgt cggggagtac 300 ggtttgggga accttactaa cagccttgag ctgggctgtg attgtttggg ctcgatttat 360 tatatggatg gtgtctgtaa taatctggat ggcgaaccct gggtcatccc caatgcaatt 420 tgcatccatg aagaggatac gggtttgtta ttcaaacaca ccgattaccg cactgataaa 480 gctcacagcg cacgtagccg ccgtttggtt atctcgcaaa ttgtgaccgc cgccaactat 540 gattatggct tgtatttcta cttctaccaa gacggtacgt ttcagtacga ggtcaaagct 600 accggggagc tgaacactca agtttttgcg gaagacgaaa acccagcacc ttatggtacc 660 gcagtcgctc cccaagtcgt aggccagcat 690 <210> 29 <211> 672 <212> DNA <213> Syncephalastrum racemosum <400> 29 gtcgtaggcc agcatcatca acacttattt atgatgcgca ttgacccaat gttagatggt 60 cgtctgaact ctgttgccca ggttgatgtt ttaccctccg agtacccagt cggtcacgtc 120 gagaatccaa tcggcaacgc ctttagtcct attacgacta tttacagtga cacgactgag 180 gcgcaggcac atgggaattt agagtcgtcg cgtacatgga agatcattaa cgaatctaaa 240 ctgcatccat atacaaaaga accagtaggt tacaaacttg tgagtcctaa cactcccccg 300 atgcttccca aacctggatc ccttgtctat gaacgcgcaa aattcgctac taaaaccatc 360 tgggtaactc cctatgaccc cgatcagatt tatcccgccg gattctattg ctcacaatca 420 ccgggtgacg attcgatggg attgcctgca tggactaaag aaccacaaag cgtacgtgga 480 cgtgacgtag ttgtgtggct taccttcgga cttacgcaca tcccacgcgt ggaagacttc 540 cccgttatgc ctgtagagac gtgcgggtgg gcgctgaaag cgtgtaattt tttcttaggg 600 aatccaggga tcgacattcc ggcagcacag aaggggacct ccaagcgcgt aaatggtgca 660 tgttgtgcgt aa 672 <210> 30 <211> 683 <212> PRT <213> Syncephalastrum racemosum <400> 30 Put Thr Val Ser Ala Val Ile His Pro Leu Asp Pro Leu Ser Pro Glu 1 5 10 15 Glu Ile Arg His Ala Ser Ala Ile Ile Arg Arg Glu Arg Ser Ala Asp 20 25 30 Lys Thr Ile Phe Ile Phe Asn Ser Ile Ser Leu Arg Glu Pro Pro Lys 35 40 45 Asp Gln Val Leu Ala His Phe Gly Trp Ala Ala Gly Pro Lys Pro Ala 50 55 60 Gln Ile Asp Arg Gln Ala Phe Val Val Leu Ile Asp Arg Pro Ser Gly 65 70 75 80 Leu Val His Glu Ile Ile Val Ser Leu Thr Thr Ser Ser Val Val Ser 85 90 95 Trp Asn Arg Lys Gln Gly Val Gln Pro Thr Leu His Val Gln Glu Met 100 105 110 Leu Glu Ala Glu Glu Val Met Leu Lys Asp Glu Arg Val Ile Glu Glu 115 120 125 Cys Arg Lys Leu Gly Ile Glu Asp Met Ser Leu Val Phe Ala Asp Thr 130 135 140 Trp Gly Val Gly Trp His Lys Thr Lys Gly Lys Arg Leu Met Gln Ala 145 150 155 160 Leu Met Tyr Met Arg Thr Ser Pro Asp Asp Asn Gln Tyr Ala His Pro 165 170 175 Leu Asp Phe Thr Pro Leu Tyr Asp Val Asn Glu Gln Lys Val Ile Asp 180 185 190 Val Leu Val Ala Lys Arg Arg Asn Ser Lys Phe Glu Arg Pro Val Ile 195 200 205 Pro Arg Ala Asp His Gln Phe Leu Pro Glu His Leu Gly Glu Gly Asn 210 215 220 Leu Arg Lys Asp Ile Lys Pro Ile Glu Ile Ile Gln Pro Glu Gly Val 225 230 235 240 Ser Phe Gln Ile Arg Gly His Glu Ile Asp Trp Gln Lys Trp Asn Leu 245 250 255 His Ile Gly Phe Asn Tyr Arg Glu Gly Leu Val Ile Ser Asn Val Ser 260 265 270 Tyr Lys Asp Met Asp Gly Thr Val Arg Pro Val Phe Tyr Arg Val Ser 275 280 285 Leu Ala Glu Met Val Val Pro Tyr Ala Asn Pro Tyr Glu Pro Tyr Asn 290 295 300 His Lys Met Ala Phe Asp Val Gly Glu Tyr Gly Leu Gly Asn Leu Thr 305 310 315 320 Asn Ser Leu Glu Leu Gly Cys Asp Cys Val Gly Ser Ile Phe Tyr Met 325 330 335 Asp Gly Val Cys Ser Asp Leu Lys Gly Asp Ala Trp Val Ile Pro Asn 340 345 350 Ala Ile Cys Ile His Glu Glu Asp Thr Gly Leu Leu Phe Lys His Thr 355 360 365 Asp Phe Arg Asn Asn Lys Ala His Ser Ala Arg Ser Arg Arg Leu Val 370 375 380 Ile Ser His Ile Val Thr Ala Ala Asn Tyr Asp Tyr Gly Leu Tyr Tyr 385 390 395 400 Tyr Phe Tyr Gln Asp Gly Thr Phe Gln Tyr Glu Val Lys Ala Thr Gly 405 410 415 Glu Leu Asn Thr His Val Leu Ala Glu Asp Glu Asn Pro Ala Pro Tyr 420 425 430 Gly Thr Ile Val Ala Pro Gln Ile Asp Ala Gln His His Gln His Leu 435 440 445 Phe Ser Met Arg Ile Asp Pro Met Val Asp Gly Pro Thr Asn Ser Val 450 455 460 Ala Gln Val Asp Val Val Ala Ser Asp Leu Pro Val Gly His Pro Asp 465 470 475 480 Asn Ala Val Gly Asn Ala Phe Ser Pro Ile Thr Thr Ile Tyr Ala Asn 485 490 495 Thr Asp Glu Ala Gln Ala Arg Ala Asn Gly Glu Thr Ser Arg Tyr Trp 500 505 510 Lys Ile Ile Asn Glu Asp Lys Ile His Pro Tyr Thr Arg Glu Pro Val 515 520 525 Gly Phe Lys Leu Met Cys Pro Asn Thr Pro Pro Met Leu Pro Lys Pro 530 535 540 Gly Ser Ile Ala Tyr Glu Arg Ala Val Phe Ala Ser Lys Thr Val Trp 545 550 555 560 Val Thr Pro Tyr Asp Ala Glu Gln Leu Phe Pro Gly Gly Phe Tyr Cys 565 570 575 Tyr Gln Ser Asp Pro Ala Asp Arg Leu Gly Leu Pro Glu Trp Thr Lys 580 585 590 Gly Lys Lys Asp Val Lys Asn Lys Asp Ile Val Leu Trp Leu Thr Phe 595 600 605 Gly Leu Thr His Ile Pro Arg Val Glu Asp Phe Pro Ile Met Pro Val 610 615 620 Glu Thr Cys Gly Phe Met Leu Lys Pro Cys Asn Phe Phe Leu Ala Asn 625 630 635 640 Pro Gly Ile Asp Ile Pro Ala Ser Asp Lys His Ser Thr Lys Ser Ala 645 650 655 Tyr Ala His Ala Leu Thr Asn Gly Ala Asn Gly Thr Gly Asn Gly Ser 660 665 670 Thr Asn Gly Ser Ser Cys Cys Asn Lys Asn Tyr 675 680 <210> 31 <211> 2052 <212> DNA <213> Syncephalastrum racemosum <400> 31 atgacagttt ctgccgtgat tcatcctttg gaccccttgt ctcccgagga gatccgtcat 60 gcatcagcga ttatccgccg cgagcgtagt gccgacaaga caatctttat cttcaacagc 120 atctcgctgc gtgaaccccc caaagaccag gtgcttgcac actttggctg ggctgctggc 180 ccaaaacctg ctcagattga tcgtcaggct ttcgtcgtcc ttatcgatcg cccgtccggc 240 ttagtgcatg aaattatcgt gtccttaacg acgtccagcg tggtttcatg gaaccgtaaa 300 caaggcgtac aaccaacgct gcacgttcag gagatgcttg aggcagaaga ggtgatgttg 360 aaagatgaac gtgtcatcga ggaatgccgc aaattaggaa tcgaagatat gagtcttgtg 420 tttgccgaca cgtggggagt gggctggcat aaaacaaagg gcaaacgtct tatgcaggct 480 ttgatgtata tgcgtacgag ccctgatgat aaccagtatg cgcatccctt ggactttaca 540 ccattatacg atgtcaatga gcaaaaagtc atcgatgtgc ttgtcgccaa gcgccgtaac 600 tcaaagttcg aacgtcccgt catcccccgt gcggaccacc agttctgcc ggaacacctg 660 ggggagggca atttgcgcaa agatattaag cccattgaaa ttattcaacc agagggtgtc 720 agctttcaaa tccgcgggca tgagatcgac tggcaaaagt ggaaccttca catcggattc 780 aattatcgcg agggacttgt tatcagcaac gttagttaca aagacatgga cggcacggta 840 cgtcctgtat tctatcgcgt atctctggca gaaatggtag tccctacgc gaatccttac 900 gaaccctaca accataagat ggccttcgat gtaggagagt acggcctggg caacttgacg 960 aacgtttag aactgggatg tgattgcgta gggagcatct tctacatgga cggggtctgt 1020 tcggatctga agggagacgc gtgggtcatc cccaatgcga tctgcatcca tgaagaggac 1080 accgggttat tgttcaagca cacagatttt cgcaacaaca aagcgcactc agctcgtagt 1140 cgtcgtttgg ttatttccca tatcgttacc gccgccaatt atgattatgg gttgtattac 1200 tatttttacc aggatggtac tttccaatac gaagtcaagg ccacaggaga acttaacact 1260 cacgtcttag cggaggatga gaaccccgct ccctacggaa caattgtggc acctcagatc 1320 gatgcgcaac accaccaaca cttattttcc atgcgcattg atccgatggt agacggaccg 1380 actaactcgg tggctcaggt agacgtggta gctagcgact tgcctgtcgg acaccctgac 1440 aacgccgtgg ggaatgcatt ctcgccaatt accacaatct atgcgaacac agacgaggca 1500 caagcgcgcg ccaatggaga gacttcccgt tactggaaga tcatcaacga agataaaatt 1560 cacccatata cacgtgaacc tgttggtttt aagcttatgt gtccgaacac accacccatg 1620 ctgccgaaac cgggatccat tgcgtatgag cgtgcagtct tcgcttcgaa aacggtctgg 1680 gttaccccgt acgacgcaga acaattgttc ccaggtggtt tctactgtta tcagtcggac 1740 cccgccgatc gtttaggcct gccggagtgg acaaaaggga aaaaggacgt aaagaacaag 1800 gacattgtcc tgtggttaac gttcgggctg acccacattc cgcgtgtgga agactttccc 1860 attatgcccg tagaaacctg cggctttatg cttaaaccct gtaacttctt ccttgcaaac 1920 ccaggaattg acatcccggc ctccgataag cactcgacta aatcggcgta cgctcatgcg 1980 cttacgaatg gagccaatgg gactgggaac ggtagcacaa acggctccag ctgctgcaat 2040 aagaattact aa 2052 <210> 32 <211> 687 <212> DNA <213> Syncephalastrum racemosum <400> 32 atgacagttt ctgccgtgat tcatcctttg gaccccttgt ctcccgagga gatccgtcat 60 gcatcagcga ttatccgccg cgagcgtagt gccgacaaga caatctttat cttcaacagc 120 atctcgctgc gtgaaccccc caaagaccag gtgcttgcac actttggctg ggctgctggc 180 ccaaaacctg ctcagattga tcgtcaggct ttcgtcgtcc ttatcgatcg cccgtccggc 240 ttagtgcatg aaattatcgt gtccttaacg acgtccagcg tggtttcatg gaaccgtaaa 300 caaggcgtac aaccaacgct gcacgttcag gagatgcttg aggcagaaga ggtgatgttg 360 aaagatgaac gtgtcatcga ggaatgccgc aaattaggaa tcgaagatat gagtcttgtg 420 tttgccgaca cgtggggagt gggctggcat aaaacaaagg gcaaacgtct tatgcaggct 480 ttgatgtata tgcgtacgag ccctgatgat aaccagtatg cgcatccctt ggactttaca 540 ccattatacg atgtcaatga gcaaaaagtc atcgatgtgc ttgtcgccaa gcgccgtaac 600 tcaaagttcg aacgtcccgt catcccccgt gcggaccacc agttctgcc ggaacacctg 660 ggggagggca atttgcgcaa agatatt 687 <210> 33 <211> 702 <212> DNA <213> Syncephalastrum racemosum <400> 33 ttgcgcaaag atattaagcc cattgaaatt attcaaccag agggtgtcag ctttcaaatc 60 cgcgggcatg agatcgactg gcaaaagtgg aaccttcaca tcggattcaa ttacgcgag 120 ggacttgtta tcagcaacgt tagttacaaa gacatggacg gcacggtacg tcctgtattc 180 tatcgcgtat ctctggcaga aatggtagtc ccctacgcga atccttacga accctacaac 240 cataagatgg ccttcgatgt aggagagtac ggcctgggca acttgacgaa cagtttagaa 300 ctgggatgtg attgcgtagg gagcatcttc tacatggacg gggtctgttc ggatctgaag 360 ggagacgcgt gggtcatccc caatgcgatc tgcatccatg aagaggacac cgggttattg 420 ttcaagcaca cagatttcg caacaacaaa gcgcactcag ctcgtagtcg tcgtttggtt 480 atttcccata tcgttaccgc cgccaattat gattatgggt tgtattacta tttttaccag 540 gatggtactt tccaatacga agtcaaggcc acaggagaac ttaacactca cgtcttagcg 600 gaggatgaga accccgctcc ctacggaaca attgtggcac ctcagatcga tgcgcaacac 660 caccaacact tatttccat gcgcattgat ccgatggtag ac 702 <210> 34 <211> 693 <212> DNA <213> Syncephalastrum racemosum <400> 34 gatccgatgg tagacggacc gactaactcg gtggctcagg tagacgtggt agctagcgac 60 ttgcctgtcg gacaccctga caacgccgtg gggaatgcat tctcgccaat taccacaatc 120 tatgcgaaca cagacgaggc acaagcgcgc gccaatggag agacttcccg ttactggaag 180 atcatcaacg aagataaaat tcacccatat acacgtgaac ctgttggttt taagcttatg 240 tgtccgaaca caccacccat gctgccgaaa ccgggatcca ttgcgtatga gcgtgcagtc 300 ttcgcttcga aaacggtctg ggttaccccg tacgacgcag aacaattgtt cccaggtggt 360 ttctactgtt atcagtcgga ccccgccgat cgtttaggcc tgccggagtg gacaaaaggg 420 aaaaaggacg taaagaacaa ggacattgtc ctgtggttaa cgtcgggct gacccacatt 480 ccgcgtgtgg aagactttcc cattatgccc gtagaaacct gcggctttat gcttaaaccc 540 tgtaacttct tccttgcaaa cccaggaatt gacatcccgg cctccgataa gcactcgact 600 aaatcggcgt acgctcatgc gcttacgaat ggagccaatg ggactgggaa cggtagcaca 660 aacggctcca gctgctgcaa taagaattac taa 693 <210> 35 <211> 683 <212> PRT <213> Syncephalastrum racemosum <400> 35 Put Thr Leu Pro Thr Thr Ile His Pro Leu Asp Pro Leu Ser Pro Glu 1 5 10 15 Glu Ile Arg His Val Ser Glu Ile Ile Arg Lys Gln Arg Ala Ala Asp 20 25 30 Glu Thr Thr Tyr Ile Phe Asn Ser Ile Ala Leu Arg Glu Pro Pro Lys 35 40 45 Glu Gln Ile Leu Ala His Phe Gly Trp Thr Asp Gly Pro Lys Pro Val 50 55 60 Gln Ile Asp Arg Gln Ala Phe Ala Val Leu Ile Asp Arg Pro Ser Gly 65 70 75 80 Leu Val His Glu Ile Ile Val Ser Ile Thr Thr Ala Ser Ile Val Ser 85 90 95 Trp Glu Thr Lys Glu Gly Val Gln Pro Thr Leu His Val Gln Glu Met 100 105 110 Leu Glu Ala Glu Gln Val Met Leu Lys Asp Glu Arg Val Ile Glu Glu 115 120 125 Cys Arg Lys Leu Gly Ile Glu Asp Met Ser Met Val Phe Ala Asp Thr 130 135 140 Trp Gly Val Gly Trp His Lys Thr Lys Gly Lys Arg Leu Met Gln Ala 145 150 155 160 Leu Met Tyr Met Arg Thr Ser Pro Asp Asp Asn Gln Tyr Ala His Pro 165 170 175 Leu Asp Phe Thr Pro Leu Tyr Asp Val Asn Glu Gln Lys Val Ile Asp 180 185 190 Val Leu Val Ala Lys Arg Arg Asn Ser Lys Phe Glu Arg Pro Val Ile 195 200 205 Pro Arg Ala Asp Arg Gln Phe Leu Pro Glu His Leu Gly Glu Glu Asn 210 215 220 Leu Arg Lys Asp Ile Lys Pro Ile Glu Ile Thr Gln Pro Gln Gly Val 225 230 235 240 Ser Phe Gln Ile Arg Gly His Glu Ile Asp Trp Gln Lys Trp Asn Leu 245 250 255 His Val Gly Phe Asn Tyr Arg Glu Gly Leu Val Ile Asn Asn Val Ser 260 265 270 Tyr Lys Asp Met Asp Gly Thr Val Arg Pro Met Phe Tyr Arg Val Ser 275 280 285 Leu Ala Glu Met Val Val Pro Tyr Ala Asn Pro Tyr Glu Pro Tyr Asn 290 295 300 His Lys Met Ala Phe Asp Val Gly Glu Tyr Gly Leu Gly Asn Leu Thr 305 310 315 320 Asn Ser Leu Glu Leu Gly Cys Asp Cys Val Gly Ser Ile Phe Tyr Met 325 330 335 Asp Gly Val Cys Ser Asp Ile Lys Gly Asp Ala Trp Val Ile Pro Asn 340 345 350 Ala Ile Cys Ile His Glu Glu Asp Thr Gly Leu Leu Phe Lys His Thr 355 360 365 Asp Phe Arg Asn Asn Lys Ala His Ser Ala Arg Ser Arg Arg Leu Val 370 375 380 Ile Ser His Ile Val Thr Ala Ala Asn Tyr Asp Tyr Gly Leu Tyr Tyr 385 390 395 400 Tyr Phe Tyr Gln Asp Gly Thr Phe Gln Tyr Glu Val Lys Ala Thr Gly 405 410 415 Glu Leu Asn Thr His Val Leu Ala Glu Asp Glu Asp Pro Ala Pro Tyr 420 425 430 Gly Thr Ile Val Ala Pro Gln Val Asp Ala Gln His His Gln His Leu 435 440 445 Phe Ser Met Arg Ile Asp Pro Met Val Asp Gly Pro Thr Asn Ser Val 450 455 460 Ala Gln Val Asp Val Val Ala Ser Asp Leu Pro Val Gly His Pro Asp 465 470 475 480 Asn Ala Val Gly Asn Ala Phe Ser Pro Val Thr Thr Ile Tyr Ala Asp 485 490 495 Thr Asp Glu Ala Arg Ala Arg Ala Asn Gly Glu Thr Ser Arg Tyr Trp 500 505 510 Lys Ile Ile Asn Glu Thr Arg Ile His Pro Tyr Thr Lys Glu Pro Val 515 520 525 Gly Phe Lys Leu Met Cys Pro Asn Thr Pro Pro Met Leu Pro Lys Pro 530 535 540 Gly Ser Ile Ala Tyr Glu Arg Ala Val Phe Ala Ser Asn Thr Val Trp 545 550 555 560 Val Thr Pro Tyr Asp Ala Glu Gln Leu Phe Pro Gly Gly Phe Tyr Cys 565 570 575 Tyr Gln Ser Asp Pro Ala Asp Arg Leu Gly Leu Pro Glu Trp Thr Arg 580 585 590 Glu Lys Lys Asp Val Lys Asn Lys Asp Ile Val Leu Trp Leu Thr Phe 595 600 605 Gly Leu Thr His Ile Pro Arg Val Glu Asp Phe Pro Ile Met Pro Val 610 615 620 Glu Thr Cys Gly Phe Met Leu Lys Pro Cys Asn Phe Phe Leu Ala Asn 625 630 635 640 Pro Gly Ile Asp Ile Pro Ala Ser Asp Arg His Ser Ser Lys Ser Ala 645 650 655 Tyr Ala Pro Ala Val Ala Asn Gly Glu Tyr Gly Ile Thr Asn Gly Thr 660 665 670 Thr Asn Gly Ser Ser Cys Cys Ser Lys Gly His 675 680 <210> 36 <211> 2052 <212> DNA <213> Syncephalastrum racemosum <400> 36 atgacactcc ccactactat ccacccattg gatccgctga gtcccgagga aattcgtcat 60 gttagtgaga tcatccgaaa acaacgggcc gccgacgaaa caacctatat attcaactcc 120 atagcactcc gtgaaccgcc taaggaacag atcctcgcgc atttcggttg gacagatgga 180 cctaaaccag ttcagattga tcggcaagcg ttcgctgtcc tcatagaccg cccttcggga 240 ttggtccatg agataattgt gagcatcacg accgcctcca tagttcctg ggagactaag 300 gaaggcgttc agcccactct gcatgtacaa gaaatgctgg aggcagagca agtgatgctc 360 aaggatgaac gtgtcatcga ggaatgccga aaactcggta ttgaagatat gtcgatggta 420 ttcgctgata catggggagt gggttggcac aaaaccaagg gcaaacgatt gatgcaagcc 480 ctcatgtaca tgcgcactag tccagacgac aatcagtatg cccatcccct ggatttcaca 540 cccctgtatg atgtaaacga gcaaaaagtg atagatgttc tggtggcgaa aaggcgaaat 600 tcgaaattcg agcgaccagt cattccacga gccgaccgcc agttcttgcc agagcacctc 660 ggagaggaaa atctccgcaa agatataaaa ccgattgaaa ttacccagcc ccaaggtgtc 720 agtttccaga ttaggggcca cgagatcgac tggcaaaagt ggaacctgca tgtcggattc 780 aattatcgag aaggcctcgt aattaacaat gtcagttaca aggacatgga tggcactgtt 840 aggcccatgt tctatcgagt gagtctggca gaaatggtcg tcccgtatgc gaacccgtac 900 gagccttaca atcacaagat ggctttgac gtgggtgaat atggactcgg taacctcaca 960 atagcttgg agctcggatg tgattgtgta ggtagtatat tttatatgga cggagtgtgt 1020 agcgacatca agggtgacgc ttgggtaatt cccaatgcga tttgcatcca cgaagaagac 1080 acgggcctcc tgttcaagca cactgatttt aggaacaata aggcgcatag cgctcgaagc 1140 cgcaggctgg tgattccca catcgtcaca gcggcaaatt acgattatgg cctgtactat 1200 tattttatc aggacggtac atttcagtac gaagtgaagg cgactggaga gctcaacact 1260 cacgtattgg cggaagacga agaccctgca cttacggca ctattgttgc tcctcaggta 1320 gacgcgcagc atcatcaaca cctctttagt atgcgtattg atccaatggt agatggacct 1380 accaatagtg tggctcaagt agacgtcgtg gccagcgatt tgcccgtcgg tcatcccgat 1440 aacgccgtgg gtaacgcgtt cagtccggtt acaacgattt acgcagacac tgacgaagcg 1500 cgggcacgag ctaatggaga aacctcccgc tactggaaga taattaacga aactcgcata 1560 catccctaca ctaaagaacc agtaggtttc aaactcatgt gccctaatac acctccgatg 1620 cgcccgaaac cgggaagcat tgcgtacgaa cgcgcagtat ttgcctcgaa tacagtttgg 1680 gttactccgt acgatgccga gcaactgttt ccgggtggat tctactgcta tcaaagcgat 1740 cccgccgacc gcctgggtct gccggagtgg actagggaga agaaggacgt gaaaaacaag 1800 gacatagttc tgtggctgac gtttggtctc actcatattc ccagggttga ggattttcca 1860 atcatgccgg tagaaacatg tggattcatg ctgaagcctt gtaatttctt cttggcaaac 1920 ccgggaattg ataccctgc tagcgatcgt catagtagta agtccgcata tgcaccggcg 1980 gttgcaaacg gagaatatgg cataacaaat ggaacgacga atggctcgtc ctgttgcagc 2040 aagggacact aa 2052 <210> 37 <211> 687 <212> DNA <213> Syncephalastrum racemosum <400> 37 atgacactcc ccactactat ccacccattg gatccgctga gtcccgagga aattcgtcat 60 gttagtgaga tcatccgaaa acaacgggcc gccgacgaaa caacctatat attcaactcc 120 atagcactcc gtgaaccgcc taaggaacag atcctcgcgc atttcggttg gacagatgga 180 cctaaaccag ttcagattga tcggcaagcg ttcgctgtcc tcatagaccg cccttcggga 240 ttggtccatg agataattgt gagcatcacg accgcctcca tagttcctg ggagactaag 300 gaaggcgttc agcccactct gcatgtacaa gaaatgctgg aggcagagca agtgatgctc 360 aaggatgaac gtgtcatcga ggaatgccga aaactcggta ttgaagatat gtcgatggta 420 ttcgctgata catggggagt gggttggcac aaaaccaagg gcaaacgatt gatgcaagcc 480 ctcatgtaca tgcgcactag tccagacgac aatcagtatg cccatcccct ggatttcaca 540 cccctgtatg atgtaaacga gcaaaaagtg atagatgttc tggtggcgaa aaggcgaaat 600 tcgaaattcg agcgaccagt cattccacga gccgaccgcc agttcttgcc agagcacctc 660 ggagaggaaa atctccgcaa agatata 687 <210> 38 <211> 705 <212> DNA <213> Syncephalastrum racemosum <400> 38 ctccgcaaag atataaaacc gattgaaatt acccagcccc aaggtgtcag tttccagatt 60 aggggccacg agatcgactg gcaaaagtgg aacctgcatg tcggattcaa ttatcgagaa 120 ggcctcgtaa ttaacaatgt cagttacaag gacatggatg gcactgttag gcccatgttc 180 tatcgagtga gtctggcaga aatggtcgtc ccgtatgcga acccgtacga gccttacaat 240 cacaagatgg cttttgacgt gggtgaatat ggactcggta acctcacaaa tagcttggag 300 ctcggatgtg attgtgtagg tagtattt tatatggacg gagtgtgtag cgacatcaag 360 ggtgacgctt gggtaattc caatgcgatt tgcatccacg aagaagacac gggcctcctg 420 ttcaagcaca ctgattttag gaacaataag gcgcatagcg ctcgaagccg caggctggtg 480 atttcccaca tcgtcacagc ggcaaattac gattatggcc tgtactatta tttttatcag 540 gacggtacat ttcagtacga agtgaaggcg actggagagc tcaacactca cgtattggcg 600 gaagacgaag accctgcacc ttacggcact attgttgctc ctcaggtaga cgcgcagcat 660 catcaacacc tctttagtat gcgtattgat ccaatggtag atgga 705 <210> 39 <211> 690 <212> DNA <213> Syncephalastrum racemosum <400> 39 ccaatggtag atggacctac caatagtgtg gctcaagtag acgtcgtggc cagcgatttg 60 cccgtcggtc atcccgataa cgccgtgggt aacgcgttca gtccggttac aacgatttac 120 gcagacactg acgaagcgcg ggcacgagct aatggagaaa cctcccgcta ctggaagata 180 attaacgaaa ctcgcataca tccctacact aaagaaccag taggtttcaa actcatgtgc 240 cctaatacac ctccgatgct cccgaaaccg ggaagcattg cgtacgaacg cgcagtattt 300 gcctcgaata cagtttgggt tactccgtac gatgccgagc aactgtttcc gggtggattc 360 tactgctatc aaagcgatcc cgccgaccgc ctgggtctgc cggagtggac tagggagaag 420 aaggacgtga aaaacaagga catagttctg tggctgacgt ttggtctcac tcatattccc 480 agggttgagg attttccaat catgccggta gaaacatgtg gattcatgct gaaagccttgt aatttcttct tggcaaaccc gggaattgat atccctgcta gcgatcgtca tagtagtag tccgcatatg caccggcggt tgcaaacgga gaatggca taacaaatgg aacgacgaat ggctcgtcct gttgcagcaa gggacactaa 690

Claims

1. A method for quantifying phosphoethanolamine, which is not a method for diagnosing a disease, characterized in that: adding an oxidoreductase to a sample containing phosphoethanolamine, allowing the oxidoreductase to act on the phosphoethanolamine as a substrate to reduce the mediator, allowing the reduced mediator to react with a reagent to determine the concentration of the phosphoethanolamine, The oxidoreductase is an oxidoreductase selected from the following group and acts on the phosphoethanolamine, The oxidoreductases of the group are: taurine dehydrogenase with amino acid sequence number 1; phenylethylamine oxidase with amino acid sequence number 9; amine oxidase with amino acid sequence number 15; hypothetical protein with amino acid sequence number 20; amine oxidase with amino acid sequence number 25; amine oxidase with amino acid sequence number 30; and ethanolamine oxidase with amino acid sequence number 35.

2. The quantitative method for phosphoethanolamine according to claim 1, wherein The taurine dehydrogenase with amino acid sequence number 1 comprises a large subunit.

Images