Isolated nucleic acid molecule, recombinant vector and its application and method for cultivating Cordyceps militaris fruiting body

Abstract

The present invention discloses an isolated nucleic acid molecule, a recombinant vector and its application and a method for cultivating Cordyceps militaris fruiting body, and relates to the field of genetic engineering technology. The nucleic acid molecule disclosed in the present invention is shown in SEQ ID NO.1. The present invention discloses a new LaeA gene (SEQ ID NO.1) isolated from Cordyceps militaris, which can increase the spore yield and cordycepin content of Cordyceps militaris, can be used to cultivate Cordyceps militaris fruiting body, and improve the quality of Cordyceps militaris fruiting body.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a separated nucleic acid molecule, a recombinant vector and application thereof, and a method for cultivating Cordyceps militaris fruiting bodies. Background Art

[0002] Cordyceps militaris is a well-known edible and medicinal fungus and the model species of the genus Cordyceps. It contains not only a variety of known bioactive ingredients, such as cordycepin, cordycepic acid, cordyceps polysaccharides, but also a new type of carotenoid, pentostatin, which are beneficial to the human body. Summary of the invention

[0003] The object of the present invention is to provide an isolated nucleic acid molecule, a recombinant vector and its application and a method for cultivating Cordyceps militaris fruiting bodies. The present invention provides a new LaeA gene isolated from Cordyceps militaris, as shown in SEQ ID NO.1, which can increase the spore yield and cordycepin content of Cordyceps militaris, can be used to cultivate Cordyceps militaris fruiting bodies, and improve the quality of Cordyceps militaris fruiting bodies.

[0004] The present invention is achieved in that:

[0005] In a first aspect, the present invention provides an isolated nucleic acid molecule, the nucleotide sequence of which is shown as SEQ ID NO.1.

[0006] The nucleotide shown in the above SEQ ID NO.1 is the LaeA gene isolated from Cordyceps militaris, and the function of the gene in Cordyceps militaris has not been studied in detail. The present invention reveals its function through the study of the examples, and the gene can increase the spore yield and cordycepin content of Cordyceps militaris, which can be used to cultivate Cordyceps militaris fruiting bodies and improve the quality of Cordyceps militaris fruiting bodies.

[0007] In a second aspect, the present invention provides a recombinant vector comprising the nucleic acid molecule as described above.

[0008] Optionally, in some embodiments of the present invention, the backbone of the recombinant vector is pDK2.

[0009] For those skilled in the art, they can select a suitable vector backbone to load the above-mentioned nucleic acid molecules according to actual needs. No matter which vector backbone is selected, it can be an expression vector or a cloning vector, as long as it is loaded with the nucleic acid molecules of the present invention, it falls within the protection scope of the present invention.

[0010] In a third aspect, the present invention provides a recombinant cell comprising the recombinant vector as described above.

[0011] For those skilled in the art, they can select suitable host cells to load the above-mentioned nucleic acid molecules or vectors according to actual needs. The host cells can be prokaryotic cells (such as Escherichia coli or Agrobacterium), or eukaryotic cells or yeast, etc. No matter which host cell is selected, as long as it contains the nucleic acid molecules of the present invention or the above-mentioned recombinant vectors, it falls within the protection scope of the present invention.

[0012] In a fourth aspect, the present invention provides use of the nucleic acid molecule, the recombinant vector, or the recombinant cell as described above in cultivating Cordyceps militaris fruiting bodies.

[0013] In a fifth aspect, the present invention provides a method for increasing the spore production or cordycepin content of Cordyceps militaris, comprising: transferring the above-mentioned nucleic acid molecule or the above-mentioned recombinant vector into the target Cordyceps militaris to overexpress the nucleic acid molecule in the target Cordyceps militaris.

[0014] For those skilled in the art, it is conceivable that the above nucleic acid molecules are introduced into Cordyceps militaris to make them overexpressed by using conventional techniques in the art to increase the spore yield and cordycepin content of the mycelium, as well as the cordycepin content in the fermentation broth of the Cordyceps militaris.

[0015] Optionally, in some embodiments of the present invention, the target Cordyceps militaris fungus is the Cordyceps militaris strain Cm01.

[0016] In a sixth aspect, the present invention provides a method for cultivating Cordyceps militaris fruiting bodies, comprising: inoculating Cordyceps militaris fungi that overexpress the nucleic acid molecule as described above into living pupae.

[0017] The cultivation method of the invention can increase the cordycepin content of the fruiting body of Cordyceps militaris and effectively improve the quality of the fruiting body of Cordyceps militaris.

[0018] Optionally, in some embodiments of the present invention, the Cordyceps militaris is inoculated into living pupae by injection.

[0019] Optionally, in some embodiments of the present invention, the method further comprises: culturing the inoculated live pupae at 24-26°C.

[0020] Optionally, in some embodiments of the present invention, the Cordyceps militaris is the Cordyceps militaris strain Cm01.

[0021] In a seventh aspect, the present invention provides a method for detecting the nucleic acid molecule as described above, comprising: using the primer pair shown in SEQ ID NO. 2-3 to amplify the nucleic acid template extracted from the Cordyceps militaris to be detected.

[0022] It should be noted that, based on the nucleotide sequence shown in SEQ ID NO.1 disclosed in the present invention, those skilled in the art can easily conceive of using other primer pair sequences to perform qualitative or quantitative detection on the nucleic acid molecule. No matter which primer pair is selected to detect the nucleic acid molecule shown in the above-mentioned SEQ ID NO.1, it falls within the protection scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0024] Figure 1 : Plasmid map of plasmid vector pKD2.

[0025] Figure 2 :Gene expression detection results of different strains: A-detection of gene expression with LN9 as the starting strain, B-detection of gene expression with Cm01 as the starting strain.

[0026] Figure 3 :Comparison of growth rate and spore production of different strains.

[0027] Figure 4 : Determination of cordycepin and adenosine contents in the fermentation broth of transformants with Cm01 as the starting strain.

[0028] Figure 5 : Determination of cordycepin and adenosine contents in the fermentation broth of transformants with LN9 as the starting strain.

[0029] Figure 6 Figure 2: Photos of the growth status of silkworm pupae at different times after inoculation with CmLaeACm01 transformants. DETAILED DESCRIPTION

[0030] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0031] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0032] The materials used in the examples below are as follows:

[0033] 1 Strains and plasmids

[0034] The wild-type strain Cm01 of Cordyceps militaris was provided by the laboratory of Wang Chengshu, Shanghai Institute of Plant Physiology and Ecology, Chinese Academy of Sciences; the wild-type strain LN9 of Cordyceps militaris was provided by the Edible Fungi Research Institute, Shanghai Academy of Agricultural Sciences. Both Cm01 and LN9 can be purchased from the market. Escherichia coli DH5a and BL21, and Agrobacterium tumefaciens AGL1 competent cells were purchased from Shanghai Weidi Biotechnology Co., Ltd.

[0035] 2 Culture medium

[0036] PDA medium: 200 g potatoes, 20 g glucose, 20 g agar, distilled water to 1000 mL.

[0037] Rice culture medium: 30 g rice, 45 mL distilled water (containing 0.3% KH2PO4, 0.15% MgSO4, 2% glucose), high temperature sterilization at 121°C for 1 h.

[0038] IM medium, containing: 10mmol·L -1 K2HPO4, 10mmol·L -1 KH2PO4, 2.5mmol·L -1 NaCl, 2mmol·L -1 MgSO4·7H2O, 0.7mmol·L -1 CaCl2, 9 μmol·L -1 FeSO4·7H2O,4mmol·L -1 (NH4)2SO4, 10mmol·L -1 Glucose, 5 g L -1 Glycerol, 0.4mmol·L -1 Acetosyringone (AS), and 40mmol·L -1 2-(N-Morpholino)ethanesulfonic acid (MES).

[0039] M-100 medium: 16 g KH2PO4, 4 g Na2SO4, 8 g KCl, 2 g MgSO4·7H2O, 1 g CaCl2, 8 mL M-100 trace element solution (60 mg H3BO3, 140 mg MnCl2·4H2O, 400 mg ZnCl2, 40 mg Na2MO4·2H2O, 100 mgFeCl3·6H2O, 400 mg CuSO4·5H2O), and 15 g agar; make up to 1000 mL with distilled water.

[0040] LB medium (Tiangen Biochemical Technology Co., Ltd.); SDB medium (BD Biosciences, USA).

[0041] 3 Main reagents

[0042] PCR kit, endonuclease, T4 DNA ligase and high-fidelity DNA polymerase (Dalian Bao Biotechnology Co., Ltd.); plasmid extraction kit, protein quantification kit, PCR product recovery kit and extraction kit (Tiangen Biochemical Technology Co., Ltd.); PBS phosphate buffer, ampicillin, kanamycin sulfate (Shanghai Sangon Biotechnology Co., Ltd.); glufosinate-ammonium (Sigma, USA).

[0043] Redzol kit (Beijing Cellbio Gene Technology Co., Ltd.); PrimeScript TM Ⅱ1st Strand cDNA Synthesis Kit, SYBR Premix Ex TaqⅡ Kit (TaKaRa, Japan).

[0044] Example 1

[0045] Construction and transformation of overexpression vector

[0046] The relevant sequences were searched through the NCBI (https: / / pubmed.ncbi.nlm.nih.gov / ) website. The LaeA gene sequence of Aspergillus nidulans (shown as SEQ ID NO.4) was commissioned to be synthesized by a company and named AsLaeA. The nucleotide sequence is as follows:

[0047]

[0048] Primers (F: ATGGCGGGTAGAATCTCGTCAGTTR: TTACATGACACAGTACGCGTGGTAA) were designed based on the gene sequence of Cordyceps militaris, and the genomic DNA of Cordyceps militaris strain Cm01 (as shown in SEQ ID NO.1) was used as a template for amplification to obtain the Cordyceps militaris LaeA gene, named CmLaeA, with the nucleotide sequence as follows:

[0049]

[0050] The above two genes were constructed into the vector pDK2-SOD (see Figure 1 ) to form plasmid vectors pDK2-SOD-CmlaeA and pDK2-SOD-AsLaeA. Agrobacterium-mediated transformation of the starting strain (wild-type strain) was used.

[0051] Genetic transformation of filamentous fungi mediated by Agrobacterium tumefaciens:

[0052] 1) A single colony of freshly cultured Agrobacterium AGL-1 containing the target vector was selected from an LB plate (containing 50 μg / mL kanamycin), inoculated into 5 mL LB liquid medium (containing 50 μg / mL kanamycin), and cultured overnight at 220 rpm and 28°C.

[0053] 2) The next day, the cells were collected by centrifugation and resuspended in an equal volume of liquid induction medium IM. An appropriate amount of the resuspended liquid was transferred to 5 mL of liquid induction medium IM to make the OD 660 =0.14-0.2.

[0054] 3) Incubate at 28°C, 220 rpm for 4-6 hours until the bacterial solution concentration reaches OD 660 = between 0.5 and 0.8.

[0055] 4) Cultivation and collection of Cordyceps militaris spores: In a clean room, fresh mycelium activated on PDA medium (25°C, 20 days) was transferred to a homogenizer, 50 mL of SDB liquid medium was added, and homogenization was performed for 30 seconds (10 seconds at low speed, 10 seconds at high speed, and 10 seconds at low speed). Then, 10 mL was transferred to 100 mL of SDB liquid medium and cultured on a shaking table at 25°C, 150 rpm for 7 days until the spore count reached 10 8 -10 9 Filter the blastospores through non-woven fabric and store them at 4°C until use. They can be used within one month.

[0056] 5) Take the above Agrobacterium solution and dilute it to 1×10 6 100 μL of each spore suspension of 100 μL / mL was mixed thoroughly and spread on IM plates and cultured at 28°C for 2 days.

[0057] 6) Add 1 mL of 0.05% Tween20 solution to the above plate, and use a spreader to thoroughly wash (scrape) and mix the co-culture. Spread 200 μL of the washed culture evenly on M-100 medium containing 300 μg / mL cephalosporin and 300 μg / mL glufosinate ammonium, and culture at 25°C for 3-5 days until transformants appear, thereby obtaining gene-transformed strains.

[0058] 7) Transformants were picked up and placed on M-100 medium containing 300 μg / mL cephalosporin. When they grew to a diameter of 1-2 cm, a small amount of genome was extracted for PCR verification. At the same time, RNA of the wild starting strain and the overexpression strain was extracted and reverse transcribed into cDNA for expression verification.

[0059] Transformed strains overexpressing LaeA genes from different sources were obtained as follows:

[0060] Starting strain Transformation vector Transformant name LN9 pDK2-SOD CKLN9 Cm01 pDK2-SOD CKCM01 LN9 pDK2-SOD-CmLaeA CmLaeALN9 Cm01 pDK2-SOD-CmLaeA CmLaeACm01 LN9 pDK2-SOD-AsLaeA AsLaeALN9 Cm01 pDK2-SOD-AsLaeA AsLaeACm01

[0061] Experimental Example 1

[0062] Validation of overexpression strains

[0063] Methods: The total RNA of Cordyceps militaris strain samples was extracted using the Redzol kit operating instructions of Beijing Saibaisheng Gene Technology Co., Ltd. Specific operations: Use Redzol reagent to lyse an appropriate amount of mycelium ground by liquid nitrogen, and then purify the lysate with chloroform, isopropanol and 75% ethanol. The integrity and concentration of total RNA were detected by 1% agarose gel electrophoresis and Nanodrop1000 spectrophotometer. Reverse transcription of cDNA was carried out according to the operating instructions of the PrimeScriptTMⅡ1stStrand cDNA Synthesis Kit [TaKaRa (Japan) Company], and the reaction conditions were: 42℃2min, 37℃15min, 85℃5s, and stored at 4℃. RT-PCR primers were designed based on the AsLaeA and CmLaeA gene sequences, and the Tublin gene name was used as an internal reference. Reverse transcription PCR was used to verify the target transformant. The wild-type strain and the strain transformed with an empty vector were used as controls, respectively. The test results are shown in. Figure 2 .

[0064]

[0065] from Figure 2 It can be seen that when the transformants of LN9 as the starting strain were amplified using the primers of CmLaeA, all transformants expressed, but it was obvious that the expression levels of CmLaeALN9 and ASLaeALN9 were higher than those of LN9 and CKLN9 transformed with an empty vector. When verified using the AsLaeA gene primers, only the strain ASLaeALN9 transformed with the AsLaeA gene had obvious expression; similarly, when two pairs of detection primers were used to verify different transformants of Cm01 as the starting strain, the results showed that the transformant transformed with the CmLaeA fragment had the highest expression level, and the strain ASLaeACm01 transformed with the AsLaeA gene had obvious expression.

[0066] Comprehensive analysis of the results showed that the LaeA genes from two different sources were expressed in different transformed strains; due to the low sequence homology between AsLaeA and CmLaeA, the aslaea detection primers could only detect expression in strains transformed with the aslaea gene; there were obvious differences in the expression levels of the CmLaeALN9 and CmLaeACm01 strains transformed with the CmLaeA gene, with CmLaeACm01 having a higher expression level, which indicated that there might be interspecies differences between the different starting strains Cm01 and LN9.

[0067] Experimental Example 2

[0068] Growth rate and spore production detection

[0069] Method: Mycelial blocks (0.5 cm in diameter) of different strains in Example 1 were inoculated on PDA plates (9 cm in diameter) respectively, and the colony diameter was measured after 3 weeks. The conidia were washed with 3 mL of 0.05% Tween, and the mycelia were filtered out with 3 layers of lens paper. The number of spores was counted using a hemocytometer, and the difference in spore production was calculated using SPSS software. Each strain was inoculated with 5 plates each time, and the experiment was repeated 3 times. 100 μL of conidia (0.5×10 3 ) were inoculated into 3 mL of SDB medium, placed on a sparse horizontal plate (6 cm in diameter) and cultured statically (25°C, 18 h), and the number of germinating conidia was counted under an optical microscope.

[0070] Results: The obtained transformants were morphologically observed. There were no visible differences between the different strains cultured on PDA. The colony diameters of the different strains after 21 days of growth were recorded. Regardless of whether the transformants were based on LN9 or Cm01 as the starting strain, there was no significant difference in their growth rate. The spore production of the different strains was counted under a microscope. Compared with the starting strain, the transformants based on LN9 did not change. However, there were significant differences between the transformants based on Cm01 as the starting strain. The transformant CmLaeACm01 had the highest spore production. This result is speculated to be caused by the high expression of the laeA gene in this strain (see Figure 3 ).

[0071] Experimental Example 3

[0072] Determination of cordycepin and adenosine content

[0073] HPLC was used to analyze the changes in cordycepin and adenosine content in different transformed strains; the method is as follows:

[0074] Chromatographic conditions:

[0075] The column is Sunfire RC18 (4.6 mm × 250 mm, 5 μm), the mobile phase was methanol-water (volume ratio: 20:80), the flow rate was 1 mL / min, the detection wavelength was 260 nm, the column temperature was 25 ± 5 °C, and the injection volume was 10 μL.

[0076] Establishment of standard curve:

[0077] Weigh 10 mg of cordycepin and adenosine standard respectively, dissolve in 50% methanol solution, dilute to 10 mL, and obtain 1 mg / mL cordycepin and adenosine solutions respectively. Then take 0, 0.2, 0.4, 0.8, 1.2, and 1.6 mL in 6 10 mL volumetric flasks, dilute to scale, filter through 0.22 μm microporous membrane, and measure according to chromatographic conditions. Draw a standard curve with mass concentration (mg / mL) as the X-axis and peak area as the Y-axis.

[0078] Preparation of test solution

[0079] The fermentation broth cultured in SDB shake flasks for 5 days was filtered to obtain the fermentation broth. 1 mL of the fermentation broth was taken and 50% methanol (V / V) solution was added to make the volume 10 mL, and 3 sets of parallel samples were made. Ultrasonic extraction was performed for 60 min, the loss solution was supplemented, centrifuged, the supernatant was taken, and filtered through a 0.22 μm microporous filter membrane as the test solution.

[0080] Results Figure 3 and Figure 4 Among the transformants with Cm01 as the starting strain, only the CmLaeACm01 transformant had a significantly higher cordycepin content in the fermentation broth, while the transformant AsLaeACm01 had no significant change. This result is consistent with the analysis of the expression level. This also further illustrates that there are differences in the effects of LaeA from different sources, and the overexpression of the LaeA gene (SEQ ID NO.1) from the Cm01 strain has a greater effect on increasing the cordycepin content than the LaeA gene (SEQ ID NO.2) from Aspergillus nidulans.

[0081] Different transformants using LN9 strain as the starting strain showed increased cordycepin content in the fermentation broth of both transformants. This shows that overexpression of the LaeA gene (SEQ ID NO.1) derived from the Cm01 strain in different strains can increase the cordycepin content in the fermentation broth and has a wider applicability.

[0082] Experimental Example 4

[0083] The method for cultivating Cordyceps militaris fruiting bodies using the CmLaeACm01 transformant of Example 1 is as follows: 4 pieces of fresh mycelium (CmLaeACm01) activated on PDA medium (25°C, 7-14d), with a diameter of 1cm, are transferred to liquid SDB medium for cultivation for 4d. The Cordyceps militaris mycelium culture solution is filtered, and the filtrate contains a large number of blastospores. 200μL of the filtrate is injected into a single silkworm pupa with a sterile syringe (and the surface of the fresh silkworm pupa is wiped with 75% alcohol for disinfection), and the mixture is placed at 25°C for cultivation for 20d until the mycelium grows out of the insect body, and then transferred to a 22°C light incubator to induce primordium formation, and the cultivation is continued for 30 days until the fruiting bodies mature. Observe and record the time and growth of the fungus breaking through the insect body wall. Record the growth status at 10d, 20d, 30d, 40d, and 50d respectively. See the results in the table. Figure 6 It can be seen that after inoculation with CmLaeACm01, the time for the formation of Cordyceps militaris fruiting bodies is relatively short. It can break through the insect body wall in 20 days and form a relatively complete Cordyceps militaris fruiting body in 50 days. The growth rate is significantly earlier than that of other existing transformed strains by about 10 days.

[0084] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention. Sequence Listing <110> Shanghai Academy of Agricultural Sciences <120> Isolated nucleic acid molecule, recombinant vector and its application and method for cultivating Cordyceps militaris fruiting body <160> 4 <170> SIPOSequenceListing 1.0 <210> 1 <211> 1180 <212> DNA <213> Artificial sequence <400> 1 atggcgggta gaatctcgtc agtttcctac ccacgctatt ttatgctgct ggatggcgac 60 taactgataa cagagacgga cctgagtaca agcagggctg ctggaagcac ggacgattct 120 acggaaattg gagacctgat aaataccttt ttcccattga cagggtacga gattgtcacc 180 ctccctctc tcacaatatc ggtggccgca tgtatctgat cctcgacaac aggaagaac 240 ggatcgctgt gatacgttcc acaagttctt tcagttggct cgcaaaaatc aagtattctc 300 atatcctatt cttaggggca acgccccgtgt attggacctc ggtaccggca ctggtatctg 360 ggccatagac gtggcggaaa agtaagtatc gctgtgacaa gattctcagt catcgctgac 420 aatcaatcta gctatttgaa atgggcacat gtcatggctg tcgatctgaa caaaatccaa 480 ccagctctgt gtgcagaatt tccaaactac ccatgttgtt atgctgtcag ctaactcgat 540 cccagaatcc cccccaacgt ggaaatggta cagttcgata tcgaagaggc ttcctgggaa 600 ccactgttga aagactgcga tctggtgcat atgagactgc tgctggggctc catccacaac 660 acattgtggc cgaatatcta tcgcaacgcc tatgcgtatg ttccatctca ggatcgccaa 720 agccgggctc aaaatcaaaa tactgactcg tggcaggcac acaacccctg gcggctacat 780 tgagcaggtc gaaattcatt ggctaccctc gtgggaggga atcgaaccag cggtgtcaga 840 cttcaagaat tgggcggagt ttttcctgca gggcatggat aatttcgagc gaagcgcaag 900 agtggacacc aagggtgtga aaaaaatgat ggaggcagca ggctacgtca actttgagga 960 gcgcaccatg cgttgctatg tgaatccttg gcgcgctgac cctgacgaga acaaggtggc 1020 ctcatggttc aactattgtc ttattgaggg gttgcaagca atgagcctgg aacccttgat 1080 tgggaatttg cgcaagtcac atgaagaggt cgataagctt cttggtaatg tcaagcagga 1140 atgctgtctg ctacgttacc acgcgtactg tgtcatgtaa 1180 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <400> 2 ggtaccggca ctggtatctg 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <400> 3 tgcaccagat cgcagtcttt 20 <210> 4 <211> 1122 <212> DNA <213> Artificial Sequence <400> 4 atgttcgaaa tgggtccagt cggcacacgt cttcccgcta tgacatcgcc agctcacaac 60 cactactctt accactcgcc tacatcttct gaccgcggcc gatcgcgtca gaactcggac 120 gctatggaca tccagtctat cacagagcgt gagcctgcta cacgatacgc tgttgctggt 180 ggtcccgccc cctggaaccg taacggctct cctagcatgt ccccaatgta ctctaacaac 240 tcggaacgta accagttcca cgaagagaac ggtcgtacat accacggttt ccgacgtggt 300 atgtacttcc tgccatgcga cgaacaggag caggaccgtc ttgacatttt ccacaagctg 360 ttcacagtcg ctcgtgttag cgaatccctt atttacgccc ctcaccctac aaacggccgt 420 ttccttgacc tgggctgcgg cacgggtatt tgggctatcg aagttgctaa caagtaccca 480 gacgctttcg ttgccggtgt agacctggcc cctattcagc ctcctaacca cccaaagaac 540 tgcgagttct acgccccatt cgacttcgag gctccttggg ctatgggtga ggattcgtgg 600 gacctgatcc accttcagat gggttgcggt agcgttatgg gttggccaaa cctttaccgt 660 cgtatcttcg ctcacctccg tcccggtgct tggttcgagc aggttgagat tgacttcgag 720 cctcgatgcg acgaccgatc tctggacggc acagccctcc gacactggta cgactgcctt 780 aagcaggcta cagctgagac aatgcgtcca attgctcact ctagccgaga cacaattaag 840 gacttacagg acgccggttt cacagagatt gaccaccaga ttgtcggtct gccacttaac 900 ccttggcacc aggacgaaca cgagcgcaag gtcgcccgat ggtacaacct ggctgttagc 960 gaatctattg aaaacctgtc tcttgctcca ttctcgcgcg tttaccgttg gccactggag 1020 cgcattcagc agcttgccgc tgacgttaag tctgaggcgt tcaacaagga aattcacgct 1080 tacaacattc tgcacatcta ccaggcccgc aagcctctcc gc 1122

Claims

1. An isolated nucleic acid molecule, characterized in that Its nucleotide sequence is shown in SEQ ID NO.

1.

2. A recombinant vector, characterized in that: It contains the nucleic acid molecule according to claim 1.

3. A recombinant cell, characterized in that It contains the recombinant vector according to claim 2.

4. Use of the nucleic acid molecule according to claim 1, the recombinant vector according to claim 2, or the recombinant cell according to claim 3 in cultivating Cordyceps militaris fruiting bodies.

5. A method for increasing the spore production or cordycepin content of Cordyceps militaris, characterized in that: The nucleic acid molecule of claim 1 or the recombinant vector of claim 2 is transferred into the target Cordyceps militaris fungus so that the nucleic acid molecule is overexpressed in the target Cordyceps militaris fungus; the target Cordyceps militaris fungus is the Cordyceps militaris strain Cm01.

6. A method for cultivating Cordyceps militaris fruiting bodies, characterized in that: It includes: Inoculating Cordyceps militaris overexpressing the nucleic acid molecule of claim 1 into living pupae; The Cordyceps militaris strain is the Cordyceps militaris strain Cm01.

7. The method according to claim 6, characterized in that: The method further comprises: culturing the inoculated live pupae at 24-26°C.

Images