Expression system, recombinant cell and its use

Abstract

Genes that are consistently upregulated in high-producing clones are subjected to transcriptional analysis to assess their ability to increase the production of the protein of interest. The products of these genes (metabolic impact products (MIPs)), such as actin, Erp27, Erp57, Foxa1, PPAR, Ca3, and Tagap, can be subdivided into different functional categories, such as signaling, protein folding, cytoskeletal organization, and cell survival.

Description

[0001] Background and technical field

[0002] Significant improvements in recombinant transgene expression have steadily increased the yield of cells expressing recombinant proteins, particularly recombinant therapeutic proteins (Farrell, McLoughlin, Milne, Marison, & Bones, 2014; Kim, Kim, & Lee, 2012; Wurm, 2004).

[0003] Chinese hamster ovary (CHO) cells are a widely used host cell factory for producing recombinant therapeutic proteins. They offer several advantages, including their ability to produce human-like post-translational modifications and the ability to grow in high-density suspension in chemically defined media. In addition, CHO cells are considered to be a safe host for producing recombinant therapeutic proteins (Hansen, Pristovsek, Kildegaard, & Lee, 2017).

[0004] So far, cell engineering has focused on increasing the time integral of viable cell concentration by improving the maximum viable cell density and prolonging the culture time, as well as increasing the specific productivity of CHO cells, since both parameters are determinants of the volumetric productivity of recombinant therapeutic proteins (Farrell et al., 2014; Kim et al., 2012). This is mainly achieved by regulating the expression of genes involved in various cellular functions (such as apoptosis, metabolism, cell cycle, and secretion) (Fischer, Handrick, & Otte, 2015).

[0005] However, the fact that some cellular processes are not optimal in CHO cells or still limit the production of therapeutic proteins and can therefore be improved by overexpression, downregulation or knockout of specific genes has not been the subject of such intensive studies (Baek, Kim, Park, & Lee, 2015; Hansen et al., 2017).

[0006] Protein folding in the endoplasmic reticulum (ER) is a critical step in the production of therapeutic proteins and has therefore been extensively studied (Hansen et al., 2017). Protein disulfide isomerase (PDI) is an enzyme that catalyzes the formation of native disulfide bonds to promote protein folding. PDI is also involved in the rearrangement of incorrectly formed disulfide bonds (Wang, Wang, & Wang, 2015). While some studies have reported increased unit yields of several therapeutic proteins upon PDI overexpression, other studies have observed no effect or even a decrease in unit yield or protein titer (Borth, Mattanovich, Kunert, & Katinger, 2005; Davis, Schooley, Rasmussen, Thomas, & Reddy, 2000; Hayes, Smales, & Klappa, 2010; Johari, Estes, Alves, Sinacore, & James, 2015; Mohan, Park, Chung, & Lee, 2007; Pybus et al., 2014). Another member of the PDI family, Erp57, has also been studied for its potential in improving the production of therapeutic proteins. Erp57 triggers disulfide bond formation of glycosylated proteins by interacting with two ER lectin chaperones, calreticulin (CRT) and calnexin (CNX) (Tannous, Pisoni, Hebert, & Molinari, 2015). It was found that upregulation of CHO cell-derived Erp57 or simultaneous upregulation of CNX and CRT can increase the specific productivity of thrombopoietin in CHO cells (Chung, Lim, Hong, Hwang, & Lee, 2004; Hwang, Chung, & Lee, 2003). However, expression of the mouse version of Erp57 reduces α 1 -Specific yields of trypsin-antitrypsin and C1 esterase inhibitor (Hansen et al., 2015). These conflicting effects may be due to different enzyme expression levels, sources, and expressed therapeutic proteins (Hansen et al., 2017).

[0007] Given the plethora of gene expression that can be modulated to improve therapeutic protein production, more global engineering strategies have focused on the expression of transcription factors that can serve as master regulators of gene expression (Gutierrez-Gonzalez et al., 2019). Notably, overexpression of the ER stress-related transcription factors sXBP1, sATF6, ATF4, and CHOP successfully increased the unit yield and / or potency of various therapeutic proteins (Becker, Florin, Pfizenmaier, & Kaufmann, 2008; Cain et al., 2013; Gulis, Simi, de Toledo, Maranhao, & Brigido, 2014; Haredy et al., 2013; Ku, Ng, Yap, & Chao, 2008; Nishimiya, Mano, Miyadai, Yoshida, & Takahashi, 2013; Ohya et al., 2008; Pybus et al., 2014; Tigges & Fussenegger, 2006), although overexpression of sXBPI yielded conflicting results (Ku et al., 2008; Rahimpour et al., 2013). Furthermore, overexpression of YY1, a zinc finger transcription factor with pleiotropic effects on many cellular processes, led to increased antibody titers in CHO cells (Tastanova et al., 2016).

[0008] Despite these advances, it has been difficult to determine whether upregulating or downregulating CHO cell activity consistently produces beneficial effects, regardless of the therapeutic protein. In addition, few Chinese hamster genes have been studied for their potential to improve the production of therapeutic proteins. At the same time, an increasing number of chimeric or engineered therapeutic proteins remain difficult to express at sufficient titers for clinical and therapeutic use (Hansen et al., 2017).

[0009] It has been previously described how the combination of vitamin B5 deficiency in CHO (Chinese Hamster Ovary) cell culture media and transfection with an expression vector for the vitamin B5 transporter allowed the identification of cell variants capable of expressing recombinant proteins at very high levels, including “easy to express” (ETE) trastuzumab, as well as “difficult to express” (DTE) proteins that otherwise would not be expressed at levels sufficient to produce therapeutic proteins, such as Infliximab (International Patent Publication No. WO2016 / 156574, U.S. Patent Publication No. 20180066268).

[0010] However, these high-yield and high-efficiency cells still only account for a small proportion of all stably transfected and selected cells, and therefore remain difficult to identify and isolate.Publications cited herein and / or in the accompanying references, including patents and patent publications, are incorporated herein by reference in their entirety.

[0011] There is a need in the art to identify specific changes in these high-producing cells that confer such desired production properties to construct cell lines, particularly CHO cell lines, that are consistently more efficient in producing molecules of interest. There is also a need in the art to utilize the knowledge of specific changes found in high-producing cells to generate expression systems and cells with such properties. The invention described herein addresses this need and other needs. Summary of the invention

[0012] Disclosed herein is the use of expression vectors / systems expressing MIPs (i.e., products that affect metabolism), in particular the use of expressing MIPs or combinations of MIPs, preferably for improving the metabolism of mammalian cells (such as CHO cells), more particularly for improving the metabolism of mammalian cells that can lead to, for example, increased production of a target protein (preferably a therapeutic protein). Also disclosed herein are engineered cells for expressing one or more MIPs. The MIP candidates are listed in Table 1, and are preferably Figure 1D Related to the cellular functions listed in.

[0013] MIP preferably includes mPPARα and / or Foxa1 transcription factors, m(mouse)PPARα and / or Foxa1 activated CHO cell genes or homologs (such as human homologs), structural proteins (such as actin), proteins involved in cellular basal metabolism (such as mRNA translation, signal transduction and transport activities) (such as Tagap, Rassf9, Erp27, Erp57, Clstn3), cell survival proteins (CDK15 and Ca3), apoptosis (such as CFLAR or SOD1), glutathione catabolism (such as GCLM or GGCT), or specific combinations thereof. The cells of the present invention overexpress the MIP or MIP human homologs, and / or are treated with chemicals that can increase the activity of the MIP (such as bezafibrate PPAR agonists and other chemical agonists or biological agonists).

[0014] In one embodiment, the present invention relates to a eukaryotic expression system, comprising: at least one metabolic impact product (MIP) expression vector, which comprises at least one nucleic acid encoding at least one MIP under the control of at least one regulatory sequence, wherein the MIP is preferably one of Table 1, in particular:

[0015] at least one transcription factor, preferably a pioneer transcription factor, such as Foxa1 (Forkhead box protein A1) or at least one transcription factor involved in fatty acid metabolism, such as at least one PPAR (Peroxisome Proliferator-activated Receptor),

[0016] - at least one factor that regulates RNA translation, such as Casc3, and / or

[0017] at least one structural protein, such as actin and / or a protein folding protein, such as Erp27 (endoplasmic reticulum protein 27), or a protein interacting with a corresponding protein folding protein, such as Erp57 (endoplasmic reticulum protein 57),

[0018] - at least one protein involved in signal transduction, vesicle trafficking and / or cell adhesion activities, such as Tagap (T cell activating GTPase activating protein), Rassf9 (RAS-associated domain family member 9), and / or Clstn3 (calcine syntenin 3),

[0019] - at least one protein involved in cell survival and / or proliferation, such as CDK15 (cyclin-dependent kinase 15) or Ca3 (carbonic anhydrase 3),

[0020] - at least one protein involved in apoptosis, such as CFLAR (CASP8 and FADD-like apoptosis regulator) or SOD1 (superoxide dismutase 1), and / or

[0021] - At least one protein involved in glutathione catabolism, such as GCLM (glutamate cysteine ​​ligase modifying subunit) or GGCT (gamma-glutamyl cyclotransferase).

[0022] The at least one MIP comprises at least one PPAR, in particular PPARα, PPARβ / δ or PPARγ.

[0023] Foxa1, actin, Erp27 can optionally be combined with Erp57. The at least one regulatory sequence can be a promoter selected from CMV, EF1α, CMV / EF1α, SV40, RSV and PGK, a promoter having the expression level of CMV, EF1α, CMV / EF1α, SV40, RSV and PGK, and a combination thereof.

[0024] The at least one MIP may include at least one (including, for example, two or three) primary MIPs and at least one, or two or three additional MIPs that are neither primary MIPs nor secondary MIPs. At least 2, 3, 4, 5 or more MIPs may be present in a eukaryotic expression system. The MIP expression vector may also include a first ITR (inverted terminal repeat) upstream of the nucleic acid encoding the MIP and a second ITR downstream. The at least one regulatory sequence may include a MAR element or a MAR construct, such as MAR 1-68 and / or MAR X-29, optionally including a single MAR element or MAR construct between the first ITR and the second ITR. The MIP expression vector may be a transposon donor vector. The expression system may also include a transposase expression auxiliary vector or mRNA. The transposase expression auxiliary vector may include a PB (piggybac) transposase coding sequence, optionally with untranslated terminal regions (UTRs) on the upstream and downstream sides.

[0025] The eukaryotic expression system may also include a carrier plasmid comprising at least one restriction enzyme cleavage site suitable for inserting a nucleic acid encoding a target protein. The carrier plasmid may also include an antibiotic resistance gene and / or a vitamin transporter, such as the sodium-multivitamin transporter SLC5A6. The elements of the carrier plasmid may also be part of another vector of the expression system.

[0026] In another embodiment, the invention relates to a method comprising:

[0027] (a) transfecting cells with any of the expression vectors of the expression system disclosed herein and / or

[0028] adding to the eukaryotic cell at least one activator of the protein product of the gene expressing the MIP, and

[0029] (b) Optionally, transfecting the cells with a vector plasmid comprising a protein of interest.

[0030] The at least one activator added to the eukaryotic cells can be an activator of at least one, two or all PPARs, in particular PPARα, PPARβ / δ or PPARγ, such as bezafibrate. The MA / EL of the target protein can be greater than 1.5 times the ML, greater than 2 times the ML, or even greater than 2.5 times or 3 times the ML.

[0031] In certain embodiments, the invention relates to a kit comprising in one container the eukaryotic expression system of any one of the preceding claims and in a second container instructions for use of the system. The kit may also comprise at least one activator of at least one MIP, wherein the MIP is preferably at least one PPAR, in particular PPARα, PPARβ / δ or PPARγ, and the activator is an activator of at least one, two or all PPARs, such as bezafibrate.

[0032] In certain embodiments, the present invention also relates to a recombinant eukaryotic cell, such as a Chinese hamster ovary (CHO) cell, comprising any eukaryotic expression system disclosed herein. The cell can be stably transfected with the MIP expression vector or a portion thereof comprising at least 1, at least 2, 3 or 4 MIPs.

[0033] The present invention also relates to a eukaryotic cell, comprising at least one endogenous MIP or an exogenous MIP, wherein the MIP is under the control of at least one exogenous promoter, an exogenous or recombinant endogenous promoter, and a combination thereof, wherein the exogenous promoter may be part of a promoter ladder selected from CMV, EF1α, CMV / EF1α, SV40, RSV, and PGK, and wherein the exogenous or recombinant endogenous promoter has the expression level of CMV, EF1α, CMV / EF1α, SV40, RSV, and PGK. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1: Identification of MIPs by transcriptome analysis.

[0035] (A) Transcriptome analysis by RNASeq comparing unselected, B5-selected, and antibiotic-selected cells producing easy-to-express (ETE) or difficult-to-express (DTE) proteins of interest. (B) Graph showing the two main expression patterns of selected B5 target genes, here in ETE cells. Gene expression corresponds to gene read counts in RNASeq analysis. (C) Transcripts upregulated in trastuzumab high-producing clones were identified in comparison with CHO-M wild-type (WT) cells and with polyclonal cells used for trastuzumab production. A total of 51 mRNAs encoded by 32 genes were identified. (D) Functional categories of candidate genes identified by transcriptome analysis and literature screening (see Table 1).

[0036] Figure 2: Effects of candidate MIPs on easily expressed (ETE) protein of interest: production of trastuzumab.

[0037] (A) Clones were isolated from the trastuzumab polyclonal population for transcriptome analysis (see Figure 1C). Intermediately generated clones Tras6 and Tras14 that maintained rapid cell division rates in fed-batch culture were used in subsequent experiments. (B) Production of readily expressed trastuzumab antibodies on days 6 (white bars), 9 (grey bars), and 11 (black bars) of fed-batch culture after stable overexpression of candidate MIPs in the Tras14 clone. SRP14 overexpression was used as a positive control (LeFourn et al., 2013), and cells transfected with GFP or empty vector were used as negative controls. (C) Production of trastuzumab on day 11 of fed-batch culture. Stable cells expressing increasing amounts of a specific MIP were obtained by transfecting increasing amounts of MIP plasmids in the trastuzumab clone. (D) Production of trastuzumab antibodies on day 13 of fed-batch culture after stable overexpression of Foxa1 in the trastuzumab clone. (E) Relative expression of Foxa1, Ca3, and Rassf9 in cells stably transfected with Foxa1 (white bars), GFP (grey bars), and untransfected cells (black bars) to illustrate the increased expression of Ca3 and Rassf9 secondary MIPs when the Foxa1 primary MIP is overexpressed. RNA was extracted on day 8 of fed-batch culture.

[0038] FIG. 3 : Effects of candidate MIPs on the expression of a difficult-to-express (DTE) target protein: infliximab.

[0039] MIPS are stably overexpressed in recombinant clones expressing the difficult-to-express (DTE) infliximab antibody. (A) Infliximab antibody produced on day 9 (grey bars) and day 11 (black bars) of fed-batch culture after candidate gene overexpression. Cells transfected with empty vector served as negative control. (B) Viable cell density of cells on day 0 (white bars), day 6 (light grey bars), day 9 (black bars), and day 11 (dark grey bars) of fed-batch culture.

[0040] Figure 4 . A schematic diagram highlighting the B5 target genes found to be regulated by PPARs is provided.

[0041] Figure 5: PPAR activation studies in easy-to-express (ETE) cells: endogenous PPAR agonists in B5 selected cells.

[0042] PPAR transient activation analysis uses the PPAR reporter gene DsRed, whose promoter contains a PPAR response element (PPRE). (A) ETE cells selected by antibiotics (AB) and ETE (trastuzumab) selected by B5 were transiently transfected with the peroxisome proliferator response element (PPRE)-DsRed reporter gene or co-transfected with the PPRE reporter gene and mouse PPARα. DsRed activity was normalized to the BFP2 marker (see Materials and Methods). (B) The negative control for the PPAR transient analysis corresponds to DsRed activity without the PPRE reporter gene. The data from sub-figures A and B represent the mean fluorescence ± SE of the corrected DsRed activity from four independent experiments. Statistics: *P≤0.05 and **P≤0.02 (one-sided t-test; paired samples). (C) Schematic diagram for interpreting transient PPARα activation data.

[0043] Figure 6: PPAR activation studies in easy-to-express (ETE) clones: Effects of exogenous pan-PPAR agonists.

[0044] (A) ETE clones (trastuzumab) were untreated (control) or treated with 10 mM bezafibrate PPARα ligand (+ bezafibrate) after 3 days of fed-batch culture. Expression of candidate genes was quantified by RT-qPCR on day 6. (B) ETE cells treated with 10 mM bezafibrate after 1 day of fed-batch culture and IgG titers measured after 10 days. Data are means ± SE of four independent experiments. *P ≤ 0.05 and **P ≤ 0.02 (t test; two-sided; unpaired samples, unequal variance).

[0045] Figure 7: PPARα overexpression in difficult-to-express (DTE) cells.

[0046] Antibiotic-selected DTE (infliximab) cells were stably transfected with mouse PPARα or empty vector. DTE clones, empty vector cells, and PPARα overexpressing cells (PPARα_OE) were compared for analysis of gene expression, IgG titer, and cell viability. (A) Gene expression (qRT-PCR) of PPARα target, PPARα, and IgG genes in untreated cells or cells treated with bezafibrate (BEZA). On day 1 of fed-batch culture, 10 mM bezafibrate was added. RNA was extracted on day 6 of fed-batch culture. Infliximab IgG unit productivity (B) and cell viability (C) are shown in non-selective medium or B5 starvation medium. Cells were cultured at 2 × 10 5Starting amounts of cells / ml were cultured in 12-well plates for 5 days and then transferred to non-selective medium. IgG unit productivity (PCD) was determined after 3 days of culture in non-selective medium. Each measurement is the result of three independent cultures. Statistics: *P ≤ 0.05 and **P ≤ 0.02 (t-test; one-sided; unpaired samples, unequal variance).

[0047] Figure 8: Metabolic analysis of CHO cells overexpressing or not expressing PPARα MIP after antibiotic or B5 selection.

[0048] As shown in the figure, vitamin B5 ( Fig. 8A ), lactic acid ( Figure 8B ), acetyl-CoA ( Figure 8C ) and ketone (3-hydroxybutyrate) ( Fig.8D ) were quantified. Data represent ± SE from four independent biological experiments. Statistics: *P ≤ 0.05 and **P ≤ 0.02 (two-sided t test; paired samples). The levels of these metabolites were also quantified in antibiotic-selected DTE (infliximab) cells, DTE cell pools stably transfected with mouse PPARα expression vector (PPARa-OE) or empty vector ( Figure 8E-Figure 8H ). Data represent ± SE from three technically independent experiments. Statistics: *P≤0.05 and **P≤0.02 (two-sided t-test; equal variance).

[0049] Figure 9: ACTC1 overexpression in ETE and DTE CHO cells.

[0050] ETE (trastuzumab, "TRAS") and DTE (Fc fusion protein) cells were stably transfected with Chinese hamster ACTC1 cDNA encoding actin or empty vector. Gene expression and IgG titer analysis were compared between ETE clones (control), empty vector cells and ACTC1 overexpressing cells (ACTC1_OE). (A) ACTC1, IgG light chain (Lc) and heavy chain (Hc) gene expression (qRT-PCR). Each measurement is the result of two independent cultures. (B) After 3 days of culture in non-selective medium, the IgG unit productivity (PCD) was determined, i.e., picograms of IgG secreted per cell and per day. (C) Production of DTE Fc fusion protein (Ctrl = control, empty vector).

[0051] Figure 10: Effects of single or combined expression of CFLAR, GCLM and ACTC1 on the secretion of IgG1-bevacizumab (bevacizumag) expressing CHO-M clones, Fc fusion expressing CHO-M clones and Fab enzyme fusion expressing clones.

[0052] Bevacizumab expression clones ( Fig. 10A )、fc fusion expression clone ( Fig. 10B ) and fab enzyme fusion expression clone (DTE) ( Fig. 10C ). Then, the unit productivity of the resulting cell pool was evaluated by batch subculture every 3 or 4 days. The results are expressed as a percentage (%) of the PCD value (pg / cell / day) of their respective bevacizumab control cells or FC fusion control cells.

[0053] Figure 11. Effects of Erp27 and / or Erp57 overexpression on therapeutic protein production.

[0054] Clones expressing easy or difficult therapeutic proteins were generated by stable transfection with Erp27 or Erp57 expression vectors or co-transfection with Erp27 and Erp57 expression vectors. Gene expression, cell growth, cell viability, and protein production were evaluated in fed-batch cultures of stable polyclonal populations (panels a-e) or clones (panels f-h). (a) Quantification of mRNA levels of Erp27 and Erp57 in Tras-producing clones evaluated by qRT-PCR, expressed as fold change relative to the mRNA levels of Erp27 and Erp57 in untransfected parental CHO cells at day 0 and day 8 of fed-batch culture. Error bars are shown as SD, n=3, and p values ​​were determined using unpaired one-tailed t-test. (b) Tras-producing clones (parental Tras clones) were stably transfected with Erp27 and / or Erp57 expression vectors, and the titer of secreted trastuzumab was determined from the cell culture supernatant at the end of fed-batch culture. Cells transfected with a GFP expression vector were used as a control. Error bars are shown as SD, n=3, unpaired one-tailed t-test. (c) Parental Tras clones were stably transfected with decreasing amounts of Erp27 expression vectors and empty vector to keep the total amount of plasmid constant. Cells transfected with an empty vector plasmid were used as a control. Trastuzumab titers were determined at the end of fed-batch culture. Error bars are shown as SD, n=3, unpaired one-tailed t-test. (d) Infliximab-producing clones were characterized based on the titer of secreted monoclonal antibodies obtained during fed-batch culture using parental clones or derived cell populations obtained after transfection with Erp27 and / or Erp57, or with a GFP expression vector, as indicated. Titers are represented by Tukey box-whisker plots with median (middle bar) and 25%-50% and 50%-75% quartiles (boxes). The whiskers extend to the lowest and highest values ​​that are still within 1.5 times the interquartile range. (e) Viable cell density of fed-batch culture analyzed in panel d. Error bars are shown as SD, unpaired one-tailed t-test (panels d and e, n≥4). (f) Clones stably transfected with Erp27 and Erp57 expression vectors, or with empty vector (as control) to produce etanercept. Use The device was used to separate cell clones, and the clone with the highest etanercept secretion halo was isolated and characterized for etanercept titer at the end of fed-batch culture. The fold change in titer relative to control cells is shown in panel d using Tukey box-whisker plots. (g, h) Viable cell density and cell viability of fed-batch cultures were analyzed in panel f. Error bars represent SEM, panels f to h (n≥8).

[0055] FIG. 12 . Effects of Foxa1 overexpression on Tras.

[0056] Clones producing Tras were stably transfected with Foxa1 or GFP expression vectors. Trastuzumab titer (a), viable cell density (b), and cell viability (c) were assessed during 10 days of fed-batch culture. n = 5, unpaired one-tailed t-test. Titers are shown as Tukey box-whisker plots as in Figure 2, while error bars are shown as SD (sub-figure b, sub-figure c). (d) RT-qPCR analysis of the mRNA levels of Foxa1 target genes and other related genes identified in Figure 1c on Foxa1 overexpressing cells, GFP expressing cells, or parental Tras clones on day 8 of fed-batch culture. Error bars are shown as SD, n = 3, paired one-tailed t-test. (e) RT-qPCR quantification of the mRNA levels of Foxa1, Ca3, Rassf9, and Tagap in Foxa1 overexpressing cells, GFP expressing cells, or parental TRAS clones on day 0 of fed-batch culture. Error bars are shown as SD, n = 3, paired one-tailed t-test. (f) Expression of carboxy-H in Foxa1-overexpressing cells and parental Tras clones on days 0, 3, 6, 8, and 9 of fed-batch culture. 2 Intracellular ROS levels were assessed by DCFDA. Error bars show SD, n = 3, unpaired one-tailed t-test.

[0057] Figure 13. Effects of Ca3, Rassf9 and Tagap overexpression on Tras.

[0058] Tras6 clones producing Tras were stably transfected with Ca3, Rassf9, Tagap or GFP expression vectors. Trastuzumab titer (a), viable cell density (b) and cell viability (c) were determined during 10 days of fed-batch culture. Error bars are shown as SD, n≥3, unpaired two-tailed t-test. (d) Candidate gene mRNA levels in stable populations expressing Ca3, Rassf9 or Tagap were quantified by RT-qPCR analysis. Data relative to mRNA levels in control GFP-expressing cells are provided. Error bars are shown as SD, n=3, paired two-tailed t-test. (e) Tras clones were stably transfected with different amounts of Ca3 expression vector together with empty vector (to keep the total amount of plasmid constant). At the end of fed-batch culture, the trastuzumab titer obtained from these cells was evaluated. Error bars are shown as SD, n=3, unpaired one-tailed t-test.

[0059] FIG. 14 . Effect of Foxa1 overexpression on infliximab production.

[0060] Infliximab-producing clones stably transfected with Foxa1 or GFP expression vectors were evaluated for infliximab titer (a), viable cell density (b), and cell viability (c) during 9 days of fed-batch culture. n = 5, unpaired one-tailed t-test. Titers are shown in Figure 2 (panel a), while error bars are shown as SD (panel b, panel c). (d) Carboxy-H was used in Foxa1-overexpressing cells and infliximab-producing parental clones on days 3, 6, 7, and 8 of fed-batch culture. 2 DCFDA assessed intracellular ROS levels. Error bars are shown as SD, n = 3, unpaired one-tailed t-test. (e) RT-qPCR was used to quantify the mRNA levels of Foxa1, Ca3, Rassf9, and Tagap in Foxa1-overexpressing cells, GFP-expressing cells, or parental infliximab clones on day 6 of fed-batch culture. Error bars are shown as SD, n = 3, paired one-tailed t-test.

[0061] Fig.15 .The effect of Tagap overexpression on infliximab production.

[0062] Infliximab-producing clones were stably transfected with Tagap or GFP expression vectors, and infliximab titer (a), viable cell density (b), and cell viability (c) were evaluated during 9 days of fed-batch culture. n = 4, unpaired one-tailed t-test. Titers are shown in Figure 2. Error bars are shown as SD (sub-figure b, sub-figure c). (d) On day 6 of fed-batch culture, the mRNA levels of Foxa1, Ca3, Rassf9, and Tagap in Tagap-overexpressing cells, GFP-expressing cells, or parental clones were quantified by RT-qPCR. Error bars are shown as SD, n = 3, paired two-tailed t-test.

[0063] Fig.16 .Candidate gene mRNA levels obtained from RNASeq analysis or using qPCR analysis.

[0064] mRNA levels of Erp27 (a), Foxa1 (b), Ca3 (c) and Tagap (d) in parental CHO cells, Tras polyclonal cells and Tras high-producing (HP) clones, analyzed by RNASeq and shown as transcripts per kilobase million (TBM), or analyzed using RT-qPCR. Data relative to parental CHO cells are provided. Error bars are shown as SD. Three biological replicates were used for Tras high-producing clones, while three technical replicates were used for parental CHO cells and polyclonal cell populations producing Tras.

[0065] Fig.17Fed-batch culture analysis and mRNA levels of cells producing easy-to-express or difficult-to-express therapeutic proteins and cells overexpressing Erp27, Erp57, or both.

[0066] Viable cell density (a) and cell viability (b) of trastuzumab-producing clones stably transfected with Erp27 and / or Erp57 expression vectors during fed-batch culture. Error bars are shown as SD, n=3, unpaired one-tailed t-test. The mRNA levels of Erp27 (c) and Erp57 (d) in different cell populations were quantified by qRT-PCR. Data relative to mRNA levels in control GFP-expressing cells are provided. Error bars are shown as SD, n=3. (e) qRT-PCR quantification of Erp27 mRNA levels in Tras clones, which were stably transfected with reduced amounts of Erp27 expression vectors and empty vectors to keep the total amount of plasmid unchanged. Data relative to the mRNA levels of Erp27 in control cells are provided. Error bars are shown as SD, n=2. (f and g) qRT-PCR quantification of Erp27 and Erp57 mRNA levels in infliximab-producing clones stably transfected with Erp27 and Erp57 expression vectors. Data are presented relative to mRNA levels in control cells. Error bars are shown as SD, n = 2. (h) Analysis of cell viability of different cell populations during fed-batch process. Error bars are shown as SD, unpaired one-tailed t-test, n ≥ 4.

[0067] Fig.18 mRNA levels of candidate genes and trastuzumab HC and LC transgenes during fed-batch culture.

[0068] (a) RT-qPCR quantification of mRNA levels of Foxa1, Rassf9, Ca3, and Tagap in clones producing trastuzumab (Tras) on day 0 and day 8 of fed-batch culture. Data relative to mRNA levels in CHO cells are provided. Error bars are represented as SD, n=3. (b) RT-qPCR quantification of Tras heavy chain (HC) and light chain (LC) mRNA levels in Foxa1 overexpressing cells, GFP expressing cells, or parental Tras clones on day 8 of fed-batch culture. Data relative to mRNA levels in control GFP expressing cells are provided. Error bars are shown as SD, n=3, paired one-tailed t-test.

[0069] Fig.19 Analysis of trastuzumab and Ca3 mRNA levels.

[0070] (a) RT-qPCR quantification of Tras immunoglobulin heavy and light chain mRNA levels in cells overexpressing Cas3, Rassf9, and Tagap. Data are provided relative to Tras heavy and light chain mRNA levels in control GFP-expressing cells. Error bars are shown as SD, n=3, paired one-tailed t-test. (b) qRT-PCR quantification of Ca3 mRNA levels in Tras clones that were stably transfected with different amounts of Ca3 expression vector and empty vector to keep the total amount of plasmid constant. Data are provided relative to Ca3 mRNA levels in control GFP-expressing cells.

[0071] Fig. 20 .Expression of ACTC1 and TAGAP genes after vitamin B5 selection.

[0072] In (a) and (b), the figure shows transcriptome RNA sequencing (RNA-Seq) analysis of mRNA levels of ACTC1 and TAGAP, comparing untransfected, unselected parental control cells (c) with transfected cells subjected to antibiotic selection or B5 selection and expressing trastuzumab (ETE, panel a) and interferon-β (DTE, panel b). After selection of transfected cells, cultures were grown in non-selective complete medium and total mRNA was extracted for high-throughput sequencing to identify genes upregulated in the cell population subjected to the B5 selection process. Relative mRNA levels correspond to normalized read counts from RNA-Seq analysis. (c) Effects of SLC5A6 overexpression and B5-deficient selection on ACTC1 and TAGAP gene expression. Cells were co-transfected with ACTC1 or TAGAP expression vectors and a puromycin resistance gene (with or without the SLC5A6 expression vector), and the cultures were then selected in B5-deficient medium (B5-deficient) and in the presence of puromycin (antibiotic selection), respectively. The selected cells were transferred to non-selective medium, and the mRNA of ACTC1 and TAGAP was quantified by RT-qPCR. The mRNA levels of cells lacking B5 selection were normalized to the mRNA levels of cells selected by antibiotics. (d) After 6 days of batch culture, the vitamin B5 content of cells transfected and selected as described in subfigure C was determined by LC-MS. (e) Comparison of the mRNA levels of ACTC1 and TAGAP in cells transfected with antibiotic resistance genes (including or excluding SLC5A6 expression vectors) and subjected to antibiotic selection. Relative mRNA levels were determined by RT-qPCR and normalized to the mRNA levels of antibiotic-resistant cells. Data are mean ± SEM of 3 to 5 biological replicates. *P≤0.05; **P≤0.02 (relative to antibiotic selection) (t test; single tail).

[0073] Fig.21ACTC1 levels in ETE-producing cells overexpressing TAGAP

[0074] Puromycin-selected clones expressing trastuzumab antibodies were stably retransfected with CHO TAGAP expression vector or empty vector and blasticidin resistance gene, and clones with resistance to blasticidin were selected. TAGAP relative mRNA levels (a) and ACTC1 protein levels (b) were evaluated by RT-qPCR using the resulting stable polyclonal cell pool. Immunoblots of total protein extracts were probed with ACTC1 or GAPDH mouse antibodies. The ratio of ACTC1 signals was normalized to the ratio of GAPDH, as quantified by ImageJ. Data represent the mean fluorescence ± SEM of 3 replicates. **P≤0.02 (relative to cells transfected with empty vector) (t test; two-tailed).

[0075] Fig. 22 ACTC1 overexpression in recombinant protein producing cells

[0076] (a) Puromycin-selected clones expressing infliximab antibodies were stably retransfected with CHO ACTC1 expression vector or empty vector and blasticidin resistance gene, and blasticidin-resistant clones were selected. The relative mRNA levels of ACTC1 were quantified by RT-qPCR using the resulting stable cell pool. (b) Immunoblots of total protein extracts in sub-B cell pools were probed with ACTC1 or GAPDH mouse antibodies. The ratio of ACTC1 signal to GAPDH signal was quantified using ImageJ. (c) Red Ponceau staining of total protein on immunoblot membrane in sub-C. Data represent mean ± SEM of 3 replicates.

[0077] Fig.23 Production of DTE recombinant protein in ACTC1 overexpressing cells

[0078] In (a), (b) and (c), the figures show antibiotic selected immunoglobulin gamma (IgG) expressing clones stably re-transfected with ACTC1 expression vector or empty expression vector, and the IgG unit productivity of the resulting stable cell pools was determined after selection for resistance to another antibiotic. @(Panel A), bevacizumab IgG1 (Panel B), and infliximab IgG1 (Panel C) unit productivity is expressed as pg of IgG secreted per cell per day and is the mean ± SEM of three replicates. (d) Infliximab IgG levels of cells analyzed in Panel C were assessed under 3-day fed-batch culture conditions in non-selective medium, where the IgG titers released in the cell culture medium represent the mean ± SEM of three biological replicates. (e) Lactate content of infliximab-expressing cell pools transfected with ACTC1 expression vector or empty vector was determined using LC-MS analysis after 3 days of batch culture from two independent cell pools. Lactate concentrations represent the mean ± SEM of three technical replicates. *P≤0.05 and **P≤0.02 (relative to empty vector) (t-test; two-tailed).

[0079] Fig.24 Characterization of ACTC1 overexpressing cells

[0080] Trastuzumab-expressing CHO cell clones stably retransfected with an antibiotic resistance plasmid and either a CHO ACTC1 expression vector or an empty expression vector. Stably transfected antibiotic-resistant cells were then selected from which clones were isolated for further analysis. (a) Quantification of relative mRNA levels of ACTC1 determined by RT-qPCR. (b) Fig.25 Ponceau red staining of total protein in the immunoblot membrane of a. (c) Fig.25 b Viable cell density of clones grown in fed-batch culture for 10 days.

[0081] Fig.25 Characterization of the yield of ACTC1 overexpressing cells

[0082] Trastuzumab expressing clones were stably re-transfected with CHO ACTC1 expression vector or empty expression vector, and cell clones were isolated for further analysis. (a) Immunoblot of total protein extracts labeled with ACTC1 or GAPDH mouse antibodies. The histogram shows the ratio of ACTC1 signal relative to GAPDH signal, as assessed using ImageJ. Fig.24 a shows a membrane stained with Ponceau red. (b) The secreted antibody titer in the culture supernatant after 13 days of fed-batch culture was assessed by double antibody sandwich ELISA.

[0083] Fig.26 Actin polymerization levels in ETE clones

[0084] (a) Representative Sir-actin fluorescence staining of F-actin on cells from a representative ACTC1 overexpressing trastuzumab clone (ACTC1_Clone 2) or from a control clone transfected with an empty expression vector (Empty_Clone 2). Unstained cells were used as negative controls. (b) Average fluorescence signal of Sir-actin staining obtained from flow cytometry analysis. A total of 2 × 10 cells were analyzed for each condition. 4 The data shown in the graph represent the mean ± SEM of 4 independent clones analyzed. *P < 0.05 (t-test; two-tailed; unequal variance).

[0085] Fig. 27 Actin polymerization levels in ETE clones

[0086] Sir-actin fluorescence histogram of F-actin on cells of all tested ACTC1 overexpressing trastuzumab clones (ACTC1_clones) or control clones transfected with empty expression vector (empty_clones) obtained from flow cytometry. Unstained cells were used as negative control.

[0087] Fig.28 . Sorting therapeutic protein-producing cell pools based on their F-actin polymerization levels

[0088] (a) Representative histograms of flow cytometric analysis of polyclonal populations expressing trastuzumab treated with Sir-actin staining. Unstained controls and other analyses are described in Figure S4. A total of 5 × 10 5 cells, of which 0.4×10 5 to 1.4×10 5 (a) Cells were sorted by cytofluorimetry according to their low, medium or high actin polymerization (pol) levels as indicated. (b) Selected cells were transferred to antibiotic-containing medium and then analyzed by cytofluorimetry for IgG cell surface display by immunofluorescence staining. (c) IgG secretion assay of sorted cells from panel B. Histograms represent mean ± SEM of 6 cell pools. **P ≤ 0.02 (t-test; two-tailed; paired) relative to the low actin polymerization class.

[0089] Fig.29 . Sorting of trastuzumab-expressing cell pools according to their actin polymerization levels

[0090] Representative histograms of flow cytometric analysis of polyclonal populations of trastuzumab treated with Sir-actin staining are shown in the legend to Figure 5. The top histogram corresponds to unstained control cells, while the bottom histogram represents flow cytometric analysis of an independent pool of Sir-actin stained cells. DETAILED DESCRIPTION

[0091] Specific changes in high-producing cells (cells producing the protein of interest) were identified, e.g., higher levels in cells deficient in vitamins than in corresponding cells grown in standard medium. In particular, metabolic factors that support the production of the desired level of the protein of interest. It was found that in a rare subpopulation of CHO cells, changes in metabolic outcomes were caused by, or were associated with, the overexpression of specific CHO cell genes. Thus, changes in the expression of CHO cell genes associated with increased CHO protein synthesis, related to the high production capacity of the protein of interest, were identified: these products, in particular proteins whose synthesis is associated with high production of recombinant proteins, are called metabolic impact products (MIPs), in particular RNA-encoded proteins, but also non-coding RNAs. Therefore, mRNA levels of high-producing CHO cells selected with vitamin B5 or selected using conventional methods were compared to determine whether changes in mRNA levels are specific markers of high-producing cells.

[0092] FIG1 shows the cell selection method and the comparison between various types of selected high-producing cells and control cells.

[0093] A list of candidate MIP encoding genes identified by various methods is provided in Table 1. It should be noted that metabolism-related MIPs can be regulatory proteins, such as transcription factors (e.g., PPAR or Foxa1), whose increased mRNA and protein levels can in turn activate the expression of their target genes, as well as metabolic genes themselves, such as catabolic genes for lipids and sugars, or anabolic genes encoding, for example, components of the mRNA translation machinery, cellular structural proteins (e.g., actin), or cell survival factors (e.g., Ca3 or CDK15).

[0094] In order to determine the genes and proteins that actually lead to improved cellular metabolic properties, candidate MIPs were expressed in CHO cells expressing, for example, therapeutic proteins to determine whether their increased expression leads to improved production of the target protein (Figures 2 to 3). The effects of overexpression of regulatory MIPs (e.g., primary MIPs) (such as Foxa1 or PPAR) on the expression of other MIPs (e.g., secondary MIPs) were evaluated, and whether they can jointly improve cellular metabolism, such as the metabolism of lipids, lipid precursors (such as acetyl-CoA) and byproducts (such as lactate), thereby potentially improving the metabolic fitness of the cells, which in turn can further increase the production of the target protein (such as therapeutic IgG). Alternatively, it was also tested whether overexpression of structural MIPs (such as actin) would lead to increased synthesis of the target protein, and thus to increased production of the target protein. These figures show that some (but not all) candidate MIPs can increase the production of easy-to-express (ETE) trastuzumab antibodies and / or difficult-to-express (DTE) infliximab antibodies. Certain MIPs have been shown to increase the production of, for example, a therapeutic protein, but not another therapeutic protein.

[0095] Eukaryotic cells according to the present invention, including mammalian cells, such as recombinant mammalian cells, can be maintained under cell culture conditions. Non-limiting examples of this type of cell are HEK 293 (human embryonic kidney), Chinese hamster ovary (CHO) cells, and mouse myeloma cells, including NS0 and Sp2 / 0 cells. Modified versions of CHO cells include CHO-K1 and CHO pro-3. In a preferred embodiment, SURE CHO-M cells can be used. TM line (SELEXIS SA, Switzerland). Cellular proteins of these eukaryotic cells can support the expression of transgenics encoding proteins of interest in transfected eukaryotic cells. These cellular proteins are particularly involved in lipid metabolism, signal transduction, protein transport, transcription and translation, cellular transport, protein repair, protein folding and cell adhesion, all of which are necessary for the expression of these transgenics encoding proteins of interest, and are referred to herein as their counterparts in other species (such as humans) as metabolic impact products (MIPs), in particular proteins, but also as non-coding RNAs as shown in Table 1. One or more transgenes expressing these MIPs (MIP transgenes) can be added to cells by the MIP eukaryotic expression vectors described herein. Alternatively or additionally, the expression of an endogenous MIP (i.e., the expression of a nucleic acid in the genome of a cell encoding one or more MIPs) can be stimulated by adding one or more substances that directly or indirectly affect the expression of the MIP, including an endogenous gene expressing the MIP, such as the PPAR agonist bezafibrate or by promoter swapping, wherein such an endogenous MIP is controlled by a different exogenous promoter or an endogenous promoter, wherein each promoter is associated with a specific expression level of such MIP and can therefore be used to alter the expression of such an endogenous MIP. Preferably, the expression of the MIP selected according to the invention results in a cell also carrying a transgene encoding a protein of interest (usually, but not necessarily on a separate vector, referred to herein as a vector plasmid), such that the expression level of the transgene exceeds the expression level of the transgene when the cell is not transfected with a vector comprising one or more selected MIPs. The nucleic acid encoding the MIP typically comprises or consists of a coding sequence (CDS) of a cell or human counterpart. Table 1 shows some MIPs.

[0096] Primary MIPs can increase the expression of their target genes and secondary MIPs and include regulatory proteins such as:

[0097] Foxa1 (forkhead box protein A1) is a transcription factor that is involved in embryonic development, establishment of tissue-specific gene expression, and regulation of gene expression in differentiated tissues. Foxa1 is thought to act as a "pioneer" factor, thus opening compact chromatin for other proteins by interacting with nucleosomal core histones and thereby displacing linker histones at target enhancer and / or promoter sites.

[0098] PPAR (peroxisome proliferator-activated receptor) is a ligand-activated transcription factor. PPAR exists mainly in three subtypes: α, β / δ and γ, each of which mediates the physiological effects of various fatty acids (FA) and FA-derived molecules and participates in FA metabolism. Activation of PPAR-β / δ can enhance fatty acid metabolism. Therefore, the PPAR family plays an important regulatory role in the energy homeostasis and metabolic function of cells. All PPARs heterodimerize with retinoid X receptor (RXR) and bind to specific regions on the DNA of target genes. These DNA sequences are called PPRE (peroxisome proliferator hormone response elements). The common sequence of PPRE consists of two AGGTCA-like sequences oriented with a mononucleotide spacer. Usually, this sequence occurs in the promoter region of a gene, and when PPAR binds to its ligand, the transcription of the target gene is increased or decreased depending on the gene. The promoter region with PPRE, TATA box and transcription start site can be located in a repressive chromatin structure. Binding of ligand to the PPAR / RXR / corepressor complex results in the release of the corepressor from the ligand-activated PPAR / RXR complex. Binding of the activated PPAR / RXR complex to the PPRE can lead to changes in chromatin structure and release of histone H1. PPAR / RXR bound to the PPRE targets the coactivator-acetyltransferase complex to the promoter. The coactivator-acetyltransferase complex acetylates the histone tail (Ac), thereby generating a transcriptionally active structure. Additional transcription factors (TFs) and the RNA Pol II initiation complex can be recruited to accessible promoters and initiate transcription. Figure 4 B5 target genes found to be regulated by PPARs are highlighted, most of which ultimately go into lipid metabolism.

[0099] Endogenous ligands (endogenous agonists) that can activate PPARs include free fatty acids and eicosanoids. PPARs are also molecular targets for many drugs (exogenous agonists). For example, fibrates (e.g., clofibrate, gemfibrozil, ciprofibrate, bezafibrate, and fenofibrate) activate PPARα. They are useful in cholesterol disorders and disorders characterized by high triglycerides. Bezafibrate can also activate other types of PPARs, namely PPARβ / δ and PPARγ, and is therefore considered a pan-PPAR activator. Antidiabetic thiazolidinediones (TZDs) activate PPARγ and are used to treat diseases characterized by insulin resistance, such as diabetes. GW501516 (also known as GW-501,516, GW1516, GSK-516) is a PPARδ receptor agonist. The synthetic chemical perfluorooctanoic acid activates PPARα, and the synthetic perfluorononanoic acid activates both PPARα and PPARγ.

[0100] Secondary MIPs are MIPs expressed as a result of overexpression of primary MIPs such as PPARs and / or Foxa1. As described elsewhere herein, cells expressing a protein of interest above a threshold level not only express PPARs and unrelated MIPs at levels not observed in cells that do not express the protein of interest above a threshold level, but also express MIPs known or likely to be affected by PPARs such as Hmgcs2, Acot1, and Cyp4a14. Ca3 and Rassf9 are transcriptional targets of Foxa1 and therefore may be secondary MIPs. The MIPs discussed below may or may not be secondary MIPs.

[0101] Structural MIP

[0102] The cytoskeleton consists of a network of actin filaments, microtubules, and intermediate filaments that are required for a variety of cellular processes, such as cell shape and resistance to mechanical deformation (Mays, Beck, & Nelson, 1994), protein synthesis (Hudder, Nathanson, & Deutscher, 2003), protein transport and secretion (Paavilainen, Bertling, Falck, & Lappalainen, 2004; Stamnes, 2002), association of cellular components (Knull & Walsh, 1992), and metabolic pathways (Aon & Cortassa, 2002). In addition, increased production of monoclonal antibodies was associated with a significant increase in cytoskeletal proteins such as actin, tubulin, or actin-bound cofilin (Dinnis et al., 2006). Recent studies have shown that suspension CHO cells evolve from adherent cells through the destruction of the extracellular attachment matrix, accompanied by major changes in the cytoskeleton, such as increased expression of actin filaments, which are required for proper interaction with integrins, resistance to shear stress, and proliferation of suspension cells (Walther, Whitfield, & James, 2016). Therefore, the regulation of cytoskeletal organization and actin filament levels may affect suspension cell fitness and recombinant protein expression, from mRNA translation to protein secretion.

[0103] Structural MIPs directly contribute to the structure of the cell, including, for example, actin. Actin monomers can polymerize to form filaments organized into dynamic networks that play fundamental roles in a variety of different cellular processes. Turnover of the actin network can drive a variety of cellular processes, including cell motility, cell adhesion, cell morphology changes, vesicle trafficking, and cytokinesis. ACTC1 is a major protein of the cardiac sarcomere thin filaments and is responsible for the muscle contractile function of the heart. ACTC1 deficiency has been primarily associated with heart disease (Debold et al., 2010; Wang et al., 2016).

[0104] MIPs involved in signal transduction, vesicle trafficking activity and cell adhesion include, for example, Tagap (T cell-activating GTPase-activating protein), Rassf9 (RAS-associated domain family member 9).

[0105] The protein encoded by the Rassf9 gene is localized in paranuclear endosomes. The protein can associate with peptidylglycine α-amidating monooxygenase and may participate in the trafficking of the enzyme through secretory or endosomal pathways. Clstn3 (calcium homeotropic protein 3) can regulate calcium-mediated postsynaptic signaling.

[0106] TAGAP is not only a signaling protein, but also participates in the organization of the cytoskeleton (see ACTC1 above). Therefore, TAGAP is involved in the loss of thymocyte adhesion and the reorganization of the cytoskeleton of thymocytes and T cells (Connelly et al., 2014; Duke-Cohan et al., 2018). Alterations in the TAGAP gene are associated with a variety of autoimmune diseases (Eyre et al., 2010).

[0107] MIPs involved in basic cellular metabolism, such as mRNA translation, include, for example, asparaginyl-t-RNA synthetase (see Table 1 for more examples).

[0108] Proteins involved in protein folding (also called protein folding proteins) include Erp27 (endoplasmic reticulum protein 27.7 kDa), which is considered to have chaperone activity, ERp57, which is an endoplasmic reticulum (ER) luminal protein and a member of the protein disulfide isomerase (PDI) family. ERp44 is also a protein disulfide isomerase that participates in protein quality control at the ER-Golgi interface.

[0109] Cell survival and / or proliferation proteins include CDK15 (cyclin-dependent kinase 15), which belongs to a large family of serine / threonine protein kinases that regulate cell proliferation, apoptosis, cell differentiation, and embryonic development. Ca3 (carbonic anhydrase 3) participates in the reversible hydration of carbon dioxide.

[0110] Proteins involved in apoptosis include CFLAR (CASP8 and FADD-like regulator of apoptosis) or SOD1 (superoxide dismutase 1).

[0111] Proteins involved in glutathione catabolism include GCLM (glutamate-cysteine ​​ligase modifying subunit) or GGCT (γ-glutamyl cyclotransferase).

[0112] Eukaryotic cells (also referred to herein as eukaryotic host cells or simply host cells), such as Chinese hamster ovary (CHO) cells, are widely used in industrial processes for producing recombinant therapeutic proteins. For example, the cell viability of CHO cells, NSO, BHK and human embryonic kidney-293 (HEK-293) depends on the uptake of vitamins. Mammalian cells cannot synthesize vitamins, so mammals must obtain vitamins from their diets. The main function of vitamins is to act as cofactors or coenzymes in a variety of enzymatic reactions such as the biosynthesis of acetyl-CoA. It has been shown that under fed-batch bioreactor production conditions, vitamin deficiency can increase the viability of cell clones and their yield in terms of the titer of secreted recombinant therapeutic proteins. These effects are achieved by reducing the levels of vitamin B5 or vitamin H. Vitamin metabolic proteins can increase the utilization of vitamins in cells, and in particular vitamin transporters can serve as selection markers. Therefore, in the simplest form of vitamin deficiency, in a culture medium lacking a vitamin, recombinant eukaryotic cells expressing the corresponding vitamin transporter as a selection marker can grow better than cells that do not express the corresponding vitamin transporter. The sodium-multivitamin transporter SLC5A6 has been characterized as a transporter for vitamin B5 or vitamin H. Other examples of vitamin-metabolizing proteins include pantothenate kinase 1, pantothenate kinase 2, or pantothenate kinase 3. Pantothenate kinase is a key regulatory enzyme for the biosynthesis of coenzyme A (CoA).

[0113] A transgene as used in the context of the present invention is an isolated deoxyribonucleotide (DNA) sequence encoding a given protein. In the case of a MIP, the transgenic DNA sequence may also encode a non-coding RNA. The term "transgenic" is used herein to refer to a DNA sequence that is introduced into a cell (e.g., a eukaryotic host cell) by transfection. Thus, a transgene is always exogenous, but may be heterologous or homologous.

[0114] Exogenous nucleic acid used herein refers to the introduction of the nucleic acid involved into the host cell. The source of the exogenous nucleic acid can be an expressed homologous nucleic acid or a heterologous nucleic acid. Accordingly, the term "endogenous" refers to a nucleic acid molecule present in the host cell before transfection. The term "heterologous nucleic acid" refers to a nucleic acid molecule derived from a source other than the host cell species, while the term "homologous nucleic acid" refers to a nucleic acid molecule from the same species as the host cell. Therefore, the exogenous nucleic acid according to the present invention can utilize one or both of heterologous nucleic acid or homologous nucleic acid. For example, the cDNA of the human interferon gene is a heterologous exogenous nucleic acid in CHO cells, but a homologous exogenous nucleic acid in HeLa cells. Similarly, when introduced into CHO cells by a vector, the gene encoding MIP shown in Table 1 is an exogenous nucleic acid, and this exogenous nucleic acid is heterologous (e.g., human, mouse, Escherichia coli (E.coli)) or homologous (e.g., black hamster (Cricetulus griseus)).

[0115] In addition to MIP transgenes, some transgenes according to the present invention are transgenes encoding proteins of interest, such as therapeutic proteins, ergo proteins with therapeutic activity, including immunoglobulins (Ig) and Fc fusion proteins. Certain immunoglobulins, such as infliximab (Remicade) or coagulation factor VIII, are particularly difficult to express because most are uncharacterized cellular bottlenecks. With the help of the MIP expression vectors, recombinant eukaryotic cells and methods of the present invention, these bottlenecks can be determined and / or opened.

[0116] The specific productivity (e.g., IgG productivity) of clones expressing a transgene (e.g., protein of interest) is determined as the slope of the calculated IgG concentration relative to the integral viable cell density (IVCD) during the production phase, usually from day 3 to day 7, and expressed in pg per cell and day (pcd).

[0117] Easily expressible (ETE) transgenes, particularly transgenes encoding a protein of interest, such as a therapeutic protein, are expressed at levels greater than 10 pcd in standard CHO culture medium. An example of an ETE transgene is the trastuzumab antibody.

[0118] Difficult-to-express (DTE) transgenes are transgenes encoding proteins, particularly proteins of interest, such as therapeutic proteins, that are expressed at levels below 10 pcd in standard CHO culture medium. Examples of DTE transgenes include those encoding infliximab IgG1 (remicade), etanercept Fc fusion or bevacizumab, or transgenes for other secreted proteins such as factor VIII and interferon beta proteins.

[0119] As used herein, the term "transgene" shall not include non-transcribed flanking regions, such as RNA transcription initiation signals, polyadenylation addition sites, promoters or enhancers.

[0120] A vector according to the invention is a nucleic acid molecule capable of transporting another nucleic acid (such as a nucleic acid encoding a MIP) into a cell. For example, a plasmid is one type of vector, and a retrovirus or a lentivirus is another type of vector. In certain embodiments, the vector is linearized prior to transfection.

[0121] The MIP expression vector includes regulatory sequences, such as promoters, enhancers, locus control regions (LCRs), matrix attachment regions (MARSs), scaffold attachment regions (SARSs), insulator elements and / or nuclear matrix-associated DNA, which can lead to efficient transcription of the MIP integrated into the expression vector. These regulatory sequences are always foreign and usually heterologous (see below).

[0122] Promoter refers to a DNA sequence that can control the expression of a coding sequence. In some embodiments, the promoter sequence includes proximal and more distal upstream elements, the latter elements are generally referred to as enhancers. Therefore, an "enhancer" is a DNA sequence that can stimulate promoter activity, and can be homologous or heterologous.

[0123] The MIP expression vector, as well as any other vector or recombinant cell disclosed herein, may include one or more promoters selected from the group consisting of CMV, EF1α, CMV / EF1α fusion promoter, SV40, RSV, PGK, and combinations thereof, which may be used, for example, to express any one or combination of MIPs at expression levels specific to the respective promoters. For example, the promoter CMV / EF1α (commonly referred to as a very strong promoter) may be used to express the corresponding gene at a first expression level specific to the CMV / EF1α promoter (=CMV / EF1α promoter expression level + / - 5% or 10%), while the promoter CMV (commonly referred to as a strong promoter when full-length (hereinafter referred to as "CMV promoter")) and the weak promoter (when provided as a modified full-length CMV promoter for reduced expression (sometimes referred to as a "minimal CMV promoter")) may be used to express the corresponding gene at a second expression level (=CMV promoter expression level + / - 5% or 10%), wherein the first expression level exceeds the second expression level specific to the CMV promoter. Depending on the type of target protein to be expressed, one promoter or the other may be used. In certain embodiments, the promoter is inducible. The different promoters may be part of a promoter ladder comprising at least two promoters.

[0124] Promoter exchange includes introducing one or more promoters into a host cell and / or generating variants of one or more promoters (referred to herein as "recombinant promoters") that exhibit more than one expression level (e.g., a promoter ladder), or different regulatory properties (e.g., tighter regulatory control of a selected gene), and can also be used to alter the expression level of endogenous MIPs in, for example, eukaryotic cells (host cells) such as CHO cells.

[0125] A promoter ladder may include multiple promoters having different levels of promoter activity. A promoter ladder may include 2, 3, 4, 5 or more promoters, each associated with an activity that provides a level of gene expression under the control of the promoter, for example, a second expression level that exceeds a first expression level. A promoter ladder may be associated with endogenous MIP genes or with exogenous counterparts. The ladder will allow switching promoters based on the MIP level required to express a transgene expressing a product of interest at a certain level. Such a ladder may also be used to optimize the expression level used in different types of such transgenic situations.

[0126] The vector plasmid according to the present invention is an expression vector suitable for transporting a transgene expressing a target protein into a cell. It also includes regulatory sequences and generally has at least one restriction enzyme cleavage site suitable for inserting a nucleic acid encoding a target protein and optionally an antibiotic resistance gene and / or a vitamin transporter (such as the sodium-multivitamin transporter SLC5A6). The expression vector may also include an origin of replication. As will be readily appreciated by those skilled in the art, a transgene expressing a target protein may also be incorporated into a MIP vector.

[0127] A transposon is a mobile genetic element that efficiently transposes between a vector and a chromosome by a "cut and paste" or "copy and paste" mechanism. During the transposition process, the transposase of the transposon system (e.g., the PB transposase in the PiggyBac transposon system) recognizes the transposon-specific terminal inverted repeats (ITRs) located at both ends of the transposon (any transposon system has 5'ITRs and 3'ITRs), and moves the contents out of the original site and integrates them into a chromosomal site, such as the TTAA chromosomal site. In this process, the transposon system of the transposon system (e.g., the PB transposase in the PiggyBac transposon system) recognizes the transposon-specific terminal inverted repeats (ITRs) located at both ends of the transposon, and moves them out of the original site and integrates them into a chromosomal site, such as the TTAA chromosomal site. For example, the powerful activity of the PiggyBac transposon system enables the target gene between the two ITRs to be easily mobilized into the target genome.

[0128] For example, the PiggyBac transposon system is described in U.S. Patent Publication 2010 / 0154070, the entire contents of which are incorporated herein by reference (see also U.S. Patent Publication 2015 / 0361451). In non-viral vectors, transposons are attractive because they can integrate single copies of DNA sequences at high frequencies at multiple sites within the host genome. Unlike viral vectors, some transposons are reported to not preferentially integrate near cellular genes, so they are unlikely to introduce harmful mutations. In addition, transposons are easy to produce and handle, typically including a transposon donor vector / plasmid (or a transposon vector containing only cargo DNA with inverted repeat sequences on both sides) and a transposase expression auxiliary vector / plasmid (also referred to herein as a "transposase expression vector") or mRNA. In order to mobilize DNA in a variety of cell lines without interfering with endogenous transposon copies, several transposon systems have been developed. For example, the PiggyBac (PB) transposon originally isolated from cabbage looper moth can effectively transpose cargo DNA into a variety of mammalian cells. In transposon donor plasmids, epigenetic regulatory elements can be used to protect cargo DNA from unwanted epigenetic effects when close to the transgene on the plasmid vector. For example, MAR can increase the integration and transcription of cargo DNA genome, while preventing heterochromatin silencing, taking powerful human MAR1-68 and MARX-29 elements as examples. They can also act as insulators, and thus prevent the activation of neighboring cell genes. Therefore, MAR elements have been used to mediate high and continuous expression in the case of plasmid vectors or viral vectors (see U.S. Patent Publication No. 2015 / 0361451, the entire contents of which are expressly incorporated herein by reference).

[0129] MAR elements (also called MAR sequences or MARs) belong to a broader group of epigenetic regulatory elements that also include boundary elements or insulating elements such as cHS4, locus control regions (LCRs), stable antirepressor (STAR) elements, ubiquitous chromatin opening (UCOE) elements or histone modifiers such as histone deacetylases (HDACs).

[0130] MAR elements can be defined according to the identified MARs on which they are primarily based: thus, a MAR construct is a MAR element whose majority of nucleotides (50% plus, preferably 60%, 70% or 80%) are based on MAR S4. Some simple sequence motifs are often found in MAPs, such as high A and T content. Other common motifs are A-box, T-box, DNA melting motif, SATB1 binding sites (H-box, A / T / C25), and consensus topoisomerase II sites for vertebrates or Drosophila.

[0131] MAR is usually characterized as a sequence attached to the nuclear matrix in eukaryotic chromosomal DNA. The properties of MAR are only partially determined by its primary structure. For example, it is known that the typical primary structure found in MAR elements (such as AT-rich regions) can lead to tertiary structure, i.e., certain curvatures that define the function of MAR. Therefore, MAR is usually defined not only by its primary structure, but also by its secondary and tertiary structures, such as its curvature and / or physical properties (such as melting temperature).

[0132] The curved DNA region rich in AT / TA-dinucleotides (hereinafter referred to as "AT-rich region") common in MAR elements is a curved DNA region including a large number of A and T, especially in the form of dinucleotides AT and TA. In a preferred embodiment, the DNA region contains at least 10% dinucleotides TA and / or at least 12% dinucleotides AT over a period of 100 consecutive base pairs, preferably at least 33% dinucleotides TA over a period of 100 consecutive base pairs (or when the length of the AT-rich region is shorter, on a corresponding shorter section), and / or at least 33% dinucleotides AT, and has a curved secondary structure. However, the "AT-rich region" can be as short as about 30 nucleotides or less, but is preferably about 50 nucleotides, about 75 nucleotides, about 100 nucleotides, about 150 nucleotides, about 200 nucleotides, about 250 nucleotides, about 300 nucleotides, about 350 nucleotides or about 400 nucleotides long or longer.

[0133] Some binding sites also typically have relatively high A and T content, such as the SATB1 binding site (H-box, A / T / C25) and the consensus topoisomerase II site of vertebrates (RNYNNCNNGYNGKTNYNY) (SEQ ID NO: 154) or Drosophila (GTNWAYATTNATNNR) (SEQ ID NO: 155). However, by comparing the regional bending patterns, binding site regions (modules), especially TFBS regions including a cluster of binding sites, can be easily distinguished from regions rich in AT and TA dinucleotides ("AT-rich regions") from MAR elements with high A and T content. For example, for human MAR 1_68, the latter may have an average curvature degree of more than about 3.8 or about 4.0, while the TFBS region may have an average curvature degree of less than about 3.5 or about 3.3. The identified MAR regions, as described elsewhere herein, can be determined by alternative means, such as but not limited to relative melting temperatures. However, these values ​​are species-specific and thus may vary from species to species and, for example, may be lower. Thus, each AT- and TA-rich dinucleotide region may have a lower curvature degree, for example, from about 3.2 to about 3.4, or from about 3.4 to about 3.6, or from about 3.6 to about 3.8, and the TFBS region may have a proportionally lower curvature degree, for example, less than about 2.7, less than about 2.9, less than about 3.1, less than about 3.3. In SMAR Scan II, the respective lower window values ​​will be selected by those skilled in the art.

[0134] Some preferred MAR elements identified include but are not limited to MAR 1_68, MARX_29, MAR 1_6, MAR S4, MARS46, including all of their arrangements disclosed in WO2005040377 and U.S. Patent Publication 20070178469, which are expressly incorporated into the present application by reference to disclose the sequences of these MAR elements and other MAR elements. Chicken lysozyme MAR is also a preferred example (see U.S. Patent No. 7,129,062, which is also expressly incorporated into this article to disclose MAR elements).

[0135] If a vector is said to contain a single MAR, this means that there is one MAR in this vector and there are no other MARs of the same or different type or structure in this vector. In certain embodiments, this single MAR is located downstream of the transgene integration site encoding, for example, a protein of interest, for example, between the transgene integration site and the 3'ITR. In certain embodiments, this transgene is a CDS encoding a MIP located between the 5'ITR and the 3'ITR. The MAR follows the polyadenylation signal at the 3' end of the CDS encoding the MIP and is located between the polyadenylation site and the 3'ITR. A promoter such as a CMV promoter and / or a CMV / EF1α fusion promoter is located at the 5'ITR and CDS encoding the MIP.

[0136] Transfection as used herein refers to the introduction of nucleic acids (including naked or purified nucleic acids or vectors carrying specific nucleic acids) into cells, particularly eukaryotic cells, including mammalian cells. In the context of the present invention, any known transfection method can be used. Some of these methods include enhancing the permeability of biological membranes to bring nucleic acids into cells. Outstanding examples are electroporation or microporation. These methods can be used alone, or can be supported by sound waves, electromagnetic and thermal energy, chemical penetration enhancers, pressure, etc., to selectively increase the flux rate of nucleic acids into host cells. Other transfection methods are also within the scope of the present invention, such as vector-based transfection, including liposome transfection or virus (also referred to as transduction) and chemical-based transfection. However, any method for bringing nucleic acids into cells can be used. Transiently transfected cells will carry / express transfected RNA / DNA in a short time without passing it on. Stably transfected cells will continue to express transfected DNA and pass it on: exogenous nucleic acids have been integrated into the genome of the cell. Stably transfected cells according to the present invention include, for example, cells in which the MIP transgene has become part of the cell genome after transfection with a transposon vector.

[0137] Cells grown in complete medium can utilize all vitamins at standard concentrations. The standard concentration is referred to herein as 1×. The standard concentrations of B1, B5, and H (1×) were set at 7.5 μM, 2.5 μM, and 0.5 μM, respectively. It was determined that B5 has an approximately 10 -4 × to 10 -3 × (0.25 nM to 2.5 nM) growth limiting concentration range, while 10 -2 × and higher concentrations allowed normal culture growth. The limiting concentration of B1 for CHO cells was determined to be 10 -5 ×(15pM) to 10 -4 × (150pM), while the limiting concentration of H for CHO cells is less than 10 -5 ×(5pM).

[0138] In a medium with a limiting concentration of said vitamin (limited medium or defective medium), said concentration is less than 1×, e.g., 10 -1 ×, 10 -2 ×, 10 -3 ×, 10 -4 × and 10 -5 The concentration of a vitamin is considered saturating if it exceeds that of a standard reference medium (also referred to herein as a "saturated medium") (e.g., 2×, 3×, 4×, 5×, or 10× the amount in complete medium).

[0139] The present invention makes use of, inter alia, the fact that in a restrictive medium, the growth and / or division of cells may be arrested, and the cells produce MIPs that result in the production of a protein of interest at a maximum arrest / expression level ("MA / EL", [g / 1]). When a protein of interest is co-transfected into cells with one or more genes encoding a MIP produced during cell arrest, the protein of interest may be produced at a MA / EL that exceeds the maximum level ("ML", [g / 1]) of the protein expressed by cells of the same type when the one or more MIPs are not present / when cell growth and / or division is not arrested. The MA / EL may be greater than 1.5×ML, greater than 2×ML, even greater than 2.5×ML or 3×ML. For example, when the ML of a protein of interest (e.g., an antibody) expressed by a recombinant cell (e.g., a recombinant CHO cell that has not been co-transfected with a MIP) may be about 1 g / l of antibody, the MA / EL of a protein of interest (e.g., an antibody expressed by a recombinant cell that also expresses one or more MIPs) may be about 1.5 g / l or 2 g / l of antibody or more.

[0140] Expression system / vector usually comprises a selection marker gene, which helps to select eukaryotic cells (host cells, also referred to as recombinant eukaryotic cells in this article) transformed with a vector comprising a polynucleotide encoding a target protein. The selection marker (or "selection marker protein") expressed by this gene is usually based on antibiotic resistance. For example, by adding puromycin, the puromycin resistance selection expression cassette can be used to identify cells successfully transformed with the cassette. However, it is also possible to select without any resistance to antibiotics. In the case of the present invention, vitamin metabolism proteins, particularly vitamin transporters, can be used as selection markers alone or in combination with other selection markers. Therefore, in its simplest form, in a culture medium lacking a vitamin such as B5 (pantothenic acid), vitamin B1 (thiamine) and / or H (B8 or biotin), the recombinant eukaryotic cells expressing the corresponding vitamin transporter as a selection marker can grow better than cells that do not express the corresponding vitamin transporter. However, as described herein, even in standard culture medium, the vitamin transporter also provides a growth advantage, and therefore can be used as a selection marker. In addition to selection marker genes based on, for example, antibiotic resistance, the expression system of the invention may comprise as selection marker one or more vitamin metabolism proteins, in particular one or more vitamin transporters, such as the sodium-multivitamin transporter SLC5A6.

[0141] Nucleic acids and proteins having greater than 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the polynucleotide and protein sequences disclosed herein are also part of the present invention, either alone or as part of any system (e.g., vector and cell), cell, method and kit disclosed herein. The nucleic acids of the present invention may differ from any wild-type sequence by at least one, two, three, four, five, six, seven, eight, nine or more nucleotides. In many cases, nucleic acids consisting of the CDS of the corresponding gene / cDNA are preferred.

[0142] The term sequence identity refers to a measure of the identity of a nucleotide sequence or an amino acid sequence. Typically, sequences are aligned to obtain the highest order match. "Consistency" itself has a recognized meaning in the art and can be calculated using published techniques. (See, for example: Computational Molecular Biology, Lesk, AM, ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, DW, ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, AM, and Griffin, HG, eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991). Although there are a variety of methods to determine the identity between two nucleotide sequences, the term "identity" is well known to those skilled in the art (Carillo, H. & Lipton, D., SIAM J Applied Math 48: 1073 (1988)).

[0143] Whether any particular nucleic acid molecule is at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to, for example, a particular nucleic acid sequence encoding a MIP, or a portion thereof, can be routinely determined using known computer programs, such as DNAsis software (Hitachi Software, San Bruno, Calif) for initial sequence alignment followed by ESEE version 3.0 DNA / protein sequence software for multiple sequence alignment.

[0144] Whether an amino acid sequence is at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to, for example, a protein form of a MIP or a portion thereof, can be routinely determined using known computer programs, such as the BESTFIT program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, Wis. 53711). BESTFIT uses the local homology algorithm of "Smith and Waterman, Advances in Applied Mathematics 2:482-489 (1981)" to find the best homology segment between two sequences. Many MIPs have been studied intensively and have one, but usually more than one, conserved region. As will be appreciated by those skilled in the art, variations in nucleic acid / protein sequences are preferably, if not exclusively, outside of such one or more conserved regions of the corresponding MIP.

[0145] When using DNAsis, ESEE, BESTFIT or any other sequence alignment program to determine whether a particular sequence is, for example, 95% identical to a reference sequence according to the present invention, the parameters are set to calculate the percent identity over the entire length of the reference nucleic acid sequence or amino acid sequence, and a homology difference of up to 5% with the total number of nucleotides in the reference sequence is allowed.

[0146] Effects of selected MIPs on transgene expression

[0147] As mentioned above, Foxa1 generally increases cell viability, viable cell density, and production of both easy-to-express and difficult-to-express therapeutic proteins when overexpressed. This effect may be related to Foxa1-mediated upregulation of Tagap. In fact, when Foxa1 is overexpressed, Tagap can transiently increase viable cell density, and increased titers of both easy-to-express and difficult-to-express therapeutic proteins are observed.

[0148] Tagap is a member of the Rho GTPase activating protein (GAP) family of signaling proteins. In thymocytes, Tagap was shown to regulate the abundance of active RhoA, thereby promoting cytoskeletal reorganization and release of β1 integrin-mediated adhesion, allowing thymocytes to migrate from the cortex to the medulla (Duke-Cohan et al., 2018). In addition, Tagap and cardiac actin alpha (ACTC1) were found to be upregulated at very high levels in vitamin B5-selected cells producing therapeutic proteins, and overexpression of Tagap was shown to increase the expression of ACTC1, which in turn increased the production of multiple therapeutic proteins. Therefore, in CHO suspension cells, TAGAP can act as a mediator of intracellular cytoskeletal signals to cell surface integrins, thereby improving cell proliferation, viability, and adaptation to suspension.

[0149] Interestingly, globular integrin aggregation, as well as increased actin content and the formation of globular actin sheaths were observed in CHO cells adapted to suspension (Walther, Whitfield, & James, 2016). Therefore, increased Tagap expression helps to improve actin-mediated cell adaptation to the suspension environment. Since the actin cytoskeleton is involved in the regulation of the secretory pathway, Tagap upregulation also helps to increase the secretion of therapeutic proteins (Stamnes, 2002). It is worth noting that another candidate gene upregulated in Tras high-yield clones, Arhgap42 (Rho GTPase Activating Protein 42) is a Rho GTPase activating protein that has been shown to be located in actin stress fibers and focal adhesions and promote cell motility (Hu et al., 2018; Luo et al., 2017). In addition, Arhgap42 is also a Foxa1 target gene. Therefore, the expression of Arhgap42 is also within the scope of the present invention, preferably to increase titer and viable cell density.

[0150] As mentioned above, the ACTC1 (Actin alpha cardiac muscle 1) gene is known to be involved in the synthesis of cardiac alpha actin. It has also been shown to improve the expression and secretion of therapeutic proteins in ETE and DTE by recombinant eukaryotic cells such as CHO cells. It was observed that the increase in ACTC1 levels was accompanied by a decrease in total actin polymerization, implying that the organization of the cytoskeleton controls or influences the expression or secretion of therapeutic proteins. In support of this observation, it was shown that the CHO cell pool with spontaneously reduced actin polymerization levels secreted significantly higher levels of recombinant protein. Since the increase in therapeutic protein release from actin-overexpressing cells was not accompanied by an increase in IgG light and heavy chain mRNA (data not shown), it was concluded that this actin effect was post-transcriptional.

[0151] The data support that ACTC1 overexpression accumulates excess actin monomers, which may disturb the intracellular G / F-actin balance, leading to the observed reduction in F-actin polymerized forms. The interaction of actin dynamics and gene expression has been proposed in mammalian cells. For example, it was found that treatment of primary mouse cells with chemical agents that induce F-actin disruption leads to global inhibition of translation and protein synthesis and activation of cellular stress responses (Silva, Sattlegger, & Castilho, 2016). This may indicate that the reduction in actin polymerization, whether spontaneous or caused by ACTC1 overexpression, mediates the increase in recombinant protein expression in CHO cells, and this does not impair cell division or cell viability. It can be inferred that F-actin depolymerization may cause the turnover of actin assembly, thereby enhancing the transport of vesicles and proteins. For example, colifin is an actin depolymerizing protein that induces actin reorganization, thereby promoting the exocytosis and vesicle transport of small molecules (Birkenfeld, Kartmann, Betz, & Roth, 2001). Similarly, CHO suspension cells selected for lower levels of polymerized actin can show higher cytoskeletal reorganization, which in turn can improve recombinant protein secretion. However, another beneficial effect of ACTC1 overexpression is the reduced accumulation of cytotoxic lactate byproducts that lead to early glycolysis. Reports have shown that the interaction between the cytoskeleton and lactate accumulation has shown that interference with the cytoskeleton can inhibit lactate transporters and entry into oocytes (Tosco, Faelli, Gastaldi, Paulmichl, & Orsenigo, 2008), suggesting that CHO cell actin depolymerization can prevent the accumulation of toxic intracellular lactate concentrations.

[0152] Overall, several mechanisms could explain the positive effects of actin overexpression on protein production in eukaryotic cells such as CHO cells, which could be related to the basal metabolism of these cells and the potential activation of energy production from glycolysis and protein secretion. In conclusion, it could be shown that both ACTC1 overexpression and / or the detection of spontaneous changes in F-actin polymerization using SiR-actin staining and cell sorting could be used to facilitate the isolation of high-expressing CHO cells from a stable cell pool.

[0153] This may suggest that modulation of cytoskeletal proteins and cytoskeletal organization may be used to improve protein production for biotechnological purposes.

[0154] As mentioned above, Erp27 is a protein that selectively binds to unfolded proteins and interacts with the disulfide isomerase Erp57 in the ER (Alanen et al., 2006; Kober et al., 2013). As mentioned above, Foxa1 is a pioneer transcription factor involved in the development of multiple organs (Zaret & Carroll, 2011). Studies have shown that the expression of specific combinations of these MIPs improves cell density and cell viability in fed-batch cultures, increases the production of both easy-to-express and difficult-to-express therapeutic proteins, and reduces reactive oxygen species, providing a new approach for the production of highly efficient therapeutic proteins. Table 2 shows the genes upregulated in Tras high-producing clones (HPCs) compared to parental CHO cells and Tras polyclonal cells (PCs) (Figure 11- Fig.15 ).

[0155] The ER-localized protein Erp27 has been shown to be involved in the high-level production of both easy-to-express and difficult-to-express therapeutic proteins. Although Erp27 is a redox-inactive member of the PDI family, it may be involved in protein folding because it selectively binds to unfolded proteins and interacts with the disulfide isomerase Erp57 (Alanen et al., 2006; Kober et al., 2013). Notably, difficult-to-express proteins are prone to misfolding, and the unfolded protein response (UPR) has been shown to be activated upon expression of difficult-to-express proteins (for review, see Hansen et al., 2017). Therefore, overexpression of Erp27 and Erp57 may directly contribute to reducing the accumulation of misfolded difficult-to-express proteins, thereby preventing or delaying UPR-induced apoptosis. This could well explain the increase in cell viability and viable cell density when Erp27 and Erp57 were co-overexpressed in cells expressing difficult-to-express proteins. Although Erp27 and Erp57 have been shown to be upregulated upon ER stress (Bargsted, Hetz, & Matus, 2016; Kober et al., 2013), this upregulation may not be sufficient to handle large amounts of misfolded recombinant proteins. In addition to increasing the production of therapeutic proteins, overexpression of Erp27 and Erp57 may also prevent quality issues in the product, as antibody quality was found to decline as cell viability decreased (Kaneko, Sato, & Aoyagi, 2010). In contrast, high production of trastuzumab antibodies did not elicit a full UPR response (Le Fourn et al., 2014), consistent with the finding that overexpression of Erp27, whether or not combined with Erp57, failed to improve cell viability under these conditions and had little or no effect on viable cell density. However, as suggested by the fact that modest overexpression of Erp27 increased trastuzumab titer, the folding capacity of CHO cells under these conditions may still be a bottleneck.

[0156] Although protein folding in the ER was shown to be a limiting step in the production of several therapeutic proteins, conflicting results have been published regarding the effects of PDI and Erp57 overexpression on therapeutic protein production (see review in Hansen et al., 2017).

[0157] Upregulation of Ca3 was also observed in high-producing clones of easy-to-express and difficult-to-express proteins and in cells overexpressing Foxa1, and to a lesser extent in cells overexpressing Tagap. 2 O 2 Induced cell apoptosis and decreased H 2 O 2Ca3 has been shown to protect cells from hypoxic stress (see Di Fiore et al., 2018 for review). Importantly, ROS accumulation was observed during fed-batch culture, and oxidative stress has been shown to affect antibody production and galactosylation (Ha, Hansen, Kol, Kildegaard, & Lee, 2018). Furthermore, the addition of antioxidants baicalein or S-sulfocysteine ​​to fed-batch culture can improve cell viability and antibody production in fed-batch culture (Ha et al., 2018; Hecklau et al., 2016). The inventors consistently found that ROS accumulation was reduced and cell viability was improved in Foxa1-overexpressing cells during the last days of fed-batch culture. In contrast, although overexpression of Ca3 led to an increase in Tras titer, the inventors did not observe any positive effect on cell viability. One possible explanation is that Ca3 is not overexpressed at the correct level. It is also possible that the Foxa1-mediated increase in cell viability requires the activation of other genes. A possible candidate gene is CDK15, which is also upregulated in Tras high-producing clones and has been shown to protect cells from apoptosis (Park, Kim, Kim, & Chung, 2014), however, whether CDK15 is a target gene of Foxa1 remains to be tested.

[0158] Finally, upregulation of Rassf9 was also observed in both easy-to-express and difficult-to-express high-producing clones as well as in Foxa1-overexpressing cells. Rassf9 has been shown to be associated with recycling endosomes and is thought to regulate vesicle trafficking through interactions with integral membrane proteins (Chen, Johnson, & Milgram, 1998). Although overexpression of Rassf9 only resulted in an increase in therapeutic protein titer for Tras14, but not Tras6, it may be involved in the secretion of therapeutic proteins.

[0159] Overall, it was observed that upregulation of several CHO cell genes contributes to increased production of a variety of easy-to-express and difficult-to-express therapeutic proteins. Interestingly, several of these CHO genes appear to be upregulated by the Foxa1 transcriptional activator. Therefore, the inventors concluded that increased expression of Foxa1 may induce a transcriptional program that favors high-level production of therapeutic proteins and that this provides a convenient way to increase production of recombinant target proteins.

[0160] The invention will be explained below by means of non-limiting examples.

[0161] Example

[0162] Candidate MIP selection

[0163] RNASeq Overview

[0164] To decipher the genetic and metabolic changes that occur within cells during B5 selection, we performed transcriptome analysis by RNASeq, comparing B5 to unselected cells and antibiotic-treated to unselected cells ( Figure 1A Genes whose expression was significantly upregulated (at least 1.5-fold increase, P>0.5) between AB selection and B5 selection were identified and detected in both ETE and DTE recombinant cell lines. Thirty-one (31) candidate genes were found to be targets of B5 selection (Table 1).

[0165] The expression patterns of these genes can be divided into two categories: Figure 1B ). The first category includes most of the candidate genes, and after antibiotic (AB) selection, gene expression decreased after recombinant protein transfection (above). However, gene expression was enhanced in B5-selected recombinant cells. The hypothesis for this expression pattern is that gene transcription is challenged due to competing cellular machinery to produce recombinant protein in large quantities. In contrast, B5 selection can improve overall cell fitness and metabolism, thereby enhancing the expression of the target gene.

[0166] For the second expression mode ( Figure 1B (Figure 2), the target gene was induced in both AB and B5 selected cells compared to untransfected cells, with higher expression in B5 selected cells. In this case, the target gene can be induced in response to the recombinant protein and participate in different steps of recombinant protein production and secretion from cells, or as part of the detoxification process caused by the inflammatory response.

[0167] B5 selection induced changes mainly in metabolic genes such as enzymes and transporters (9 / 31 target genes). Since B5 selection was based on changes in primary metabolism caused by B5 deficiency, it is expected that a large number of target genes will be part of various cellular metabolisms.

[0168] Unexpectedly, five of these genes were related to lipid metabolism. Through in-depth research in the literature, the inventors found that three of these genes, Hmgcs2, Acot1 and Cyp4a14, were targets of a common transcription factor PPAR (Rakhshandehroo et al., 2010).

[0169] Hydroxymethylglutaryl-CoA synthase 2 (Hmgcs2) encodes a mitochondrial protein that catalyzes the first reaction of ketone body generation by condensing acetyl-CoA with acetyl-CoA to form HMG-CoA. It determines the metabolic fate of fatty acids in the liver of starved animals (Vila-Brau et al, 2011).

[0170] Acot1 encodes an acyl-CoA thioesterase that catalyzes the hydrolysis of acyl-CoA into free fatty acids and coenzyme A (CoASH). It is involved in long fatty acid metabolism.

[0171] Cyp4a14 is a cytochrome P450 that has been shown to be involved in liver injury, inflammation, and fibrosis in mice (Zhang, 2017).

[0172] Peroxisome proliferator-activated receptors (PPARs) are ligand-activated transcription factors belonging to the nuclear hormone receptor superfamily and play an important role in nutrient homeostasis in the body (Kersten et al., 2000). Three different PPAR isoforms are known: PPARα, PPARβ / δ, and PPARγ. All PPARs can form heterodimers with the nuclear receptor RXR and then bind to PPAR response element (PPRE) sequences located on the promoters of their target genes. Activation of transcription by PPARs depends on many different steps, including ligand binding to PPARs, PPAR binding to target genes, removal of corepressors and recruitment of coactivators, remodeling of chromatin structure, and ultimately promotion of gene transcription (Michalik et al., 2006). PPARs can regulate the expression of genes that play a role in lipid and carbohydrate metabolism, vascular biology, tissue repair, cell proliferation and differentiation, and sexual dimorphism (Wahli et al., 2012). Therefore, this study focused on PPARs and PPAR targets to examine whether there is a link between B5 selection and PPAR activation leading to PPAR target activation.

[0173] Another target gene noted is the ACTC1 gene involved in actin synthesis. The organization of the cytoskeleton is important for many cellular components, such as the synthesis and secretion of proteins (Hudder et al, 2003) or the stability of metabolic networks (Aon and Cortassa, 2002). Therefore, the increase in recombinant protein production may be related to the increase in the cytoskeleton, the secretory pathway (ER chaperones) and the metabolic machinery (Dinnis et al, 2006). Recent studies have shown that suspension CHO cells evolved from adherent cells by reorganizing their cytoskeleton to strengthen their subcortical actin sheath (Walther, 2016). Therefore, the regulation of actin may affect suspension cell fitness and recombinant protein production.

[0174] Identification of genes associated with high production of therapeutic proteins

[0175] Genes showing expression changes associated with CHO cells producing therapeutic proteins at high levels were identified and tested as new cell engineering candidates for improving therapeutic protein production. For this purpose, transcriptome analysis was performed to compare three different types of cells: CHO cell clones produced easily expressed trastuzumab (Tras) antibodies at high levels while maintaining high cell density, showing an average unit yield of 19.3pg (pg / cell / day) Tras secreted per cell per day, and the average maximum viable cell density (VCD) was analyzed to be 43.3 million cells per milliliter. These cell lines were compared with the Tras polyclonal cell population obtained after antibiotic selection of cells stably expressing transgenics (unit yield of 7.4pg / cell / day, maximum VCD of 36.3 million cells / ml) and parental non-transfected CHO cells (Fig. 1c).

[0176] Candidate genes were selected based on two criteria: First, 113 mRNAs that were significantly upregulated in Tras high-producing clones compared to parental CHO cells were selected (Figure 1c). 1774 mRNAs that were upregulated in high-producing clones compared to the polyclonal Tras-expressing cell pool were also selected. It was found that 51 mRNAs met these two criteria, corresponding to 32 genes, whose upregulated expression may be related to the high yield of Tras (Figure 1c, Table 2). The changes in the mRNA levels of candidate genes were further confirmed by RT-qPCR on different samples ( Fig.16 , data not shown). Unexpectedly, ontology analysis revealed that candidate protein-coding genes were mostly related to signaling and cell adhesion (Table 2, Figure 1d). Genes involved in protein folding (Erp27), cell survival (Ca3, Cdk15, Vegfd), cell growth (Clstn3), vesicle trafficking (Rassf9, Clstn3), and cytoskeletal organization (Mybpc2, Tagap, Arhgap42) were also identified, all of which are cellular functions previously proposed to affect the production of therapeutic proteins (Table 2, Figure 1d, Baek et al., 2015; Fischer et al., 2015; Hansen et al., 2017). Interestingly, compared with their expression in parental CHO cells, most of these candidate genes were also upregulated in CHO cell clones that produced high levels of another easy-to-express antibody (bevacizumab) and the difficult-to-express interferon β protein (data not shown). This suggests that upregulation of candidate genes is not exclusively associated with cells showing high trastuzumab productivity, indicating that these candidate genes may be involved in high-level production of a variety of easy-to-express and difficult-to-express therapeutic proteins.

[0177] Figure 4Figures 10 to 10 illustrate the summary of the positive effects of PPAR, ACTC1 and other MIP candidates from various sources on ETE and DTE CHO cell lines.

[0178] Figure 1 and Table 2 show:

[0179] Genes associated with high trastuzumab production included those involved in protein folding, cell survival, vesicle trafficking, and cytoskeletal remodeling.

[0180] Foxa1 is a pioneer transcription factor that is upregulated in trastuzumab-producing clones and may activate transcriptional responses that favor the production of therapeutic proteins.

[0181] B5 selection induced changes in lipid metabolism genes.

[0182] PPAR transcription factors appear to be regulators of some B5-targeted lipid genes.

[0183] • Regulation of the cytoskeleton and morphology through actin production may play a role in cell adaptability and recombinant protein production.

[0184] Annotate Figure 1 and Table 1:

[0185] In order to identify genes associated with high trastuzumab production, transcriptome analysis was performed. In this analysis, genes upregulated in trastuzumab high-producing clones compared to CHO-M WT cells were selected and compared to trastuzumab-producing cell polyclones ( Figure 1C ). 32 genes associated with high yield were identified (candidate genes, Table 1). Importantly, the expression of these genes may be the cause or result of the high yield of trastuzumab. Further focus will be placed on potential candidate genes that can improve the yield of therapeutic proteins based on their functions ( Figure 1D ).

[0186] Figures 2 and 3 provide a summary of the effects of these different MIPs (Erp27, Erp57, Ca3, CDK15, Rassf9, Clstn3, Tagap, and Foxa1) on trastuzumab (ETE) and infliximab (DTE).

[0187] MIP candidate genes found in high-producing clones of therapeutic proteins

[0188] Overexpression of candidate genes can increase trastuzumab production (Figure 2):

[0189] FIG. 2A to FIG. 2EThe effect of candidate MIPs on the production of trastuzumab, an antibody that is easy to express (ETE), is shown. For this purpose, two trastuzumab intermediate producing clones that maintain rapid cell division were isolated from a trastuzumab polyclonal population for transcriptome analysis. These clones were stably transfected with plasmids to express MIPs (Tagap, Rassf9, Erp27, Erp57, Erp27+Erp57, Clstn3, CDK15, Ca3, and Foxa1). Trastuzumab production in these stable populations was evaluated at different times in fed-batch culture. Overexpression of SRP14 was used as a positive control, and cells expressing GFP or cells transfected with an empty vector were used as negative controls. Although overexpression of Rassf9, Foxa1, and Ca3 increased trastuzumab production, overexpression of Erp57, Clstn3, and CDK15 and co-overexpression of Erp27 and Erp57 did not affect trastuzumab production. Tagap overexpression had a variable effect on trastuzumab production, but sometimes a positive effect. Erp27 reduced trastuzumab production when strongly overexpressed and increased trastuzumab production when slightly overexpressed. According to the database, Ca3 and Rassf9 are transcriptional targets of Foxa1. There was indeed overexpression of Ca3 and Rassf9 in Foxa1 overexpressing cells. These results strongly suggest that Foxa1 overexpression can induce transcription of genes that increase trastuzumab production.

[0190] In summary, the inventors found that:

[0191] Overexpression of Rassf9, Ca3, and Foxa1 can enhance trastuzumab production.

[0192] When strongly overexpressed, Erp27 can reduce trastuzumab production, whereas when slightly overexpressed, Erp27 can increase trastuzumab production.

[0193] Overexpression of Erp57, Clstn3, and CDK15, as well as co-overexpression of Erp27 and Erp57, had no effect on trastuzumab production.

[0194] Foxa1 transcriptional response may create a favorable environment for trastuzumab production.

[0195] Overexpression of specific candidate MIPs can increase the production of infliximab, a poorly expressed (DTE) antibody (Figure 3):

[0196] Figure 3A and Figure 3BThe effect of candidate MIPs on the production of infliximab, a difficult-to-express (DTE) antibody, is shown. Infliximab producing clones were stably transfected with plasmids expressing the MIPs. Infliximab production in these stable populations was evaluated at different times in fed-batch culture. Cells transfected with empty vector served as negative controls. Although expression of Erp27 or Erp57 did not increase infliximab production, co-expression of Erp27 and Erp57 or expression of Tagap increased infliximab production. On days 9 and 11 of fed-batch culture, viable cell density was higher in cells overexpressing Tagap and Erp27+Erp57.

[0197] In conclusion, it was found that overexpression of Tagap and co-overexpression of Erp27 and Erp57 increased the viable cell density at day 6 and day 9 of fed-batch culture and improved infliximab production.

[0198] Erp27 is a protein present in the endoplasmic reticulum that binds to unfolded proteins (Kober et al., 2013). Although Erp27 was originally annotated as a protein disulfide isomerase (PDI), it does not have any redox activity. Specifically, Erp27 contains the non-catalytic b and b′ domains of PDI, but lacks the CXXC active site required for catalyzing dithiol-disulfide exchange (Alanen et al., 2006). However, Erp27 is known to interact with the PDI Erp57, thereby triggering the formation of disulfide bonds (Alanen et al., 2006). Increased expression of Erp57 significantly increased the yield of thrombopoietin in CHO cells (Hwang et al., 2003).

[0199] Overexpression of Erp27 alone or together with Erp57 increases production of therapeutic proteins

[0200] Since Erp27 has been shown to bind to the disulfide isomerase Erp57 both in vitro and in vivo (Alanen et al., 2006), it was hypothesized that the Erp27-Erp57 complex is involved in the folding of therapeutic proteins, providing production advantages.

[0201] This hypothesis was evaluated by assessing the effect of Erp27 and Erp57 overexpression on trastuzumab secretion levels. For this purpose, clones were isolated from a trastuzumab polyclonal population previously used for transcriptome analysis, and clones that showed high productivity in fed-batch culture (1.8-fold of the polyclonal population) while maintaining a rapid cell division rate were selected. Notably, Erp27 mRNA levels in this clone were upregulated 3- to 6-fold ( 1.8-fold) compared to parental CHO cells on day 0 or day 8 of fed-batch culture. Fig.11a). In contrast, Erp57 mRNA levels were similar in CHO parental cells and Tras-producing clones at day 0, whereas a slight upregulation of Erp57 mRNA levels of 1.2-fold was observed in clones at day 8. The levels of secreted Tras were assessed during fed-batch cultivation of polyclonal populations stably transfected with Erp27 and / or Erp57 expression vectors or with a GFP expression vector as a control.

[0202] When Erp57 was overexpressed or co-expressed with Erp27, the viable cell density increased on day 6 of fed-batch culture, whereas cell viability decreased on day 10 ( Fig.17 a, Fig.17 b). Overall, the Tras titer levels in Erp57 overexpressing cells were similar to those in control cells ( Fig.11b In contrast, growth and cell viability during fed-batch culture were not affected by Erp27 overexpression ( Fig.17 a, Fig.17 b). However, Erp27 overexpression resulted in a decrease in Tras levels, which was also noted when Erp57 was co-expressed ( Fig.11b The inventors noted that Erp27 overexpression resulted in a significant increase in Erp27 mRNA levels compared to clones producing Tras ( Fig.17 c to Fig.17 d), suggesting that this overexpression level could lead to a metabolic imbalance in the activity of these proteins, thereby indeed reducing Tras expression. Therefore, the amount of Erp27 expression vector in stably transfected cells was adjusted down. In fact, in the case of reduced Erp27 overexpression, a 14% increase in Tras levels was observed ( Fig.11c and Fig.17 e). Overall, the results suggest that moderate overexpression of Erp27 increases Tras production.

[0203] As indicated by transcriptome analysis, Erp27 mRNA expression was also increased in clones expressing the difficult-to-express interferon beta at high levels (data not shown), so the effect of Erp27 and Erp57 overexpression on the production of difficult-to-express therapeutic proteins was further assessed. Infliximab chimeric immunoglobulin (Infli) and etanercept Fc fusion protein were used as two additional examples of difficult-to-express therapeutic proteins. In contrast to the results obtained for Tras, in clones expressing infliximab, Infli titers were not affected by Erp27 overexpression, but were reduced when Erp57 was overexpressed ( Fig.11d and Fig.17 F, Fig.17g). However, on days 9 and 11 of fed-batch culture, co-overexpression of Erp27 and Erp57 resulted in an increase in infliximab titer by 61% and 72%, respectively, relative to GFP-expressing control cells (Fig. 2d). In addition, on day 9 of fed-batch culture, co-overexpression of Erp27 and Erp57 resulted in an increase in viable cell density and cell viability (Fig. Fig.11e and Fig.17 h).

[0204] The effect of co-overexpression of Erp27 and Erp57 in generating etanercept clones was also assessed. Individual subclones co-expressing Erp27 and Erp57 were isolated and used The cell clone imaging device evaluates the production of Erp27 and Erp57. Cell clones showing the broadest etanercept secretion halo were isolated from Erp27 and Erp57 overexpressing cell populations or control cell populations, and the derived cell clones were evaluated for etanercept production in fed-batch culture. After Erp27 and Erp57 overexpression, the viable cell density and cell viability were increased, and the plateau phase of viable cells was prolonged, with a 37% increase in titer ( Figure 11f to Figure 11h ). Taken together, these results support that moderate overexpression of Erp27 can increase the production of easily expressed therapeutic proteins, and that combined overexpression of Erp27 and Erp57 can improve viable cell density, cell viability, and titer of cells producing different difficult-to-express therapeutic proteins.

[0205] Foxa1 overexpression increases trastuzumab production and reduces oxidative stress

[0206] Unexpectedly, the inventors found that among the 32 genes associated with high trastuzumab production, there is a pioneer transcription factor called Foxa1. Foxa1 can activate transcriptional responses that are beneficial to the production of therapeutic proteins. Foxa1 can bind to repressive heterochromatin structures, which can release gene expression independently of other transcription factors (see review, Zaret & Carroll, 2011). Foxa1 is involved in the development of different organs, such as liver, pancreas, lung and prostate (Friedman & Kaestner, 2006). Therefore, the inventors hypothesized that Foxa1 can activate a transcriptional program that is beneficial to the production of therapeutic proteins (such as Tras).

[0207] Consistently, on days 0 and 8 of fed-batch culture, Foxa1 mRNA expression was increased in Tras clones compared with parental CHO cells, up-regulated by 1.5-fold and 2.1-fold, respectively ( Fig.18a). In transcriptome analysis, a 3-fold upregulation relative to the parental CHO cell control was observed in Tras high-producing clones, thus indicating that Foxa1 expression could be further increased (see Table 2). Therefore, Tras-producing clones were stably transfected with a Foxa1 expression vector. Stable expression of Foxa1 under the control of the strong CMV / EF1α promoter resulted in increased cell death during antibiotic-mediated selection (data not shown). However, replacement of this strong promoter with a minimal CMV promoter abolished this undesirable effect and final Tras titers were increased by 57% when Foxa1 was overexpressed ( Fig.12a ), while Foxa1 mRNA was upregulated 40-fold and 14-fold on day 0 and day 8 of fed-batch culture, respectively ( Fig.12d , Fig.12e ). When comparing Foxa1-overexpressing and control cells until day 6, cell growth in fed-batch culture was similar, with Foxa1-overexpressing cells continuing to divide until day 9, reaching an average viable cell density of 31 million cells / ml, whereas control cells peaked at 19 million cells / ml on day 8 ( Figure 12b In addition, the viability of Foxa1-overexpressing cells remained above 90% until day 9, while the viability of control cells began to decline from day 7 and was below 75% on day 9 ( Fig.12c ).

[0208] Ca3, Rassf9, and Tagap are upregulated upon overexpression of Foxa1 in Tras-generating clones

[0209] Several studies have demonstrated that productivity can be increased by prolonging cell survival in fed-batch cultures (for review, see Kim et al., 2012). Of the 32 genes identified, Ca3 and CDK15 (see Figure 2b) promote cell survival. Ca3 protects cells from oxidative stress (Di Fiore et al., 2018), while CDK15 protects cells from apoptosis (Park et al., 2014). Therefore, overexpression of these proteins may extend the lifespan of cells in fed-batch cultures and thus improve productivity.

[0210] Another focus is on two proteins (Rassf9 and Clstn3) found in transport vesicles (Chen et al., 1998; Rindler et al., 2007) that may be involved in the secretion of therapeutic proteins.

[0211] Tagap is a signaling protein involved in the loss of thymocyte adhesion and cytoskeletal reorganization in thymocytes and T cells (Connelly et al., 2014; Duke-Cohan et al., 2018). Similarly, for actin, Tagap overexpression improves cell adaptation to suspension and can trigger cytoskeletal reorganization, thereby improving secretion. Notably, Tagap is also overexpressed in B5-selected cells.

[0212] The fact that Foxa1 is a pioneer transcription factor suggests that it could directly increase transcription of the trastuzumab heavy chain (HC) and light chain (LC) transgenes. However, no significant changes in trastuzumab HC and LC mRNA levels were observed upon overexpression of Foxa1 ( Fig.18 b) To confirm that Foxa1-mediated enhancement of trastuzumab potency is caused by transcriptional activation of CHO cell genes that are also upregulated in Tras high-producing clones (Table 2). portal to identify potential Foxa1 target genes (Rouillard et al., 2016). Thus, of the 25 protein-coding genes identified as upregulated in Tras high-producing clones, 11 were predicted to be Foxa1 target genes, including the Foxa1 gene itself (Table 2). Therefore, the inventors tested whether these genes were upregulated in trastuzumab-producing clones upon Foxa1 overexpression and found that Ca3 and Rassf9 were highly upregulated upon Foxa1 overexpression on day 8 of fed-batch culture, while the expression of other Foxa1 potential target genes did not change significantly (Figure 12). In addition, while Erp27 was not upregulated in Foxa1 overexpressing cells, upregulation of the Tagap candidate gene was observed and was also found to be upregulated in vitamin B5-selected cells that produce very high levels of therapeutic protein. Notably, Rassf9, Ca3, and Tagap mRNAs were also upregulated in Foxa1-overexpressing cells at day 0 of fed-batch culture, indicating that their upregulation was not due to the high cell growth observed at day 8 in Foxa1-overexpressing cells ( Fig.12e Since Ca3 has been shown to protect cells from oxidative stress (for review, Di Fiore, Monti, Scaloni, DeSimone, & Monti, 2018), the active fluorescent dye carboxy-H 2 DCFDA was used to assess the level of intracellular reactive oxygen species (ROS). Interestingly, although the ROS level in Foxa1-overexpressing cells increased slightly on day 3, it decreased on days 6, 8, and 9 ( Fig.12f ).

[0213] Overexpression of Ca3 and Tagap increases trastuzumab production

[0214] To verify whether the increased Tras titer caused by Foxa1 overexpression was a result of upregulation of Ca3, Rassf9, and / or Tagap, these three candidate genes were stably overexpressed in Tras-producing clones and the Tras titers obtained from fed-batch cultures were assessed. Consistently, higher Tras titers were obtained from Tras-producing clones when Tagap was overexpressed, whereas no effect was detected with Ca3 or Rassf9 overexpression ( Fig.13a When Tagap was overexpressed, an increase in viable cell density was observed on the 6th and 8th days of culture, with a maximum viable cell density of 31 million cells / ml on the 8th day ( Fig.13b However, cell viability began to decline sharply from day 9 ( Fig.13c The increase in Tras production upon Tagap overexpression was similar to that upon Foxa1 overexpression, with a titer of 1331 μg / ml, although lower cell viability was observed in long-term fed-batch cultures from Tagap overexpression ( Figure 12a-12c and Figure 13a-Figure 13c When Tagap was overexpressed, a slight increase in the expression of Tras in HC and LC was also observed (1.6 and 1.3, respectively) ( Fig.19 a).

[0215] Interestingly, when Tagap was overexpressed, the expression of Ca3 was also increased 10-fold ( Fig.13d To assess whether the lack of effect of Ca3 overexpression alone was due to unfavorable expression levels ( Figure 13a-Figure 13c ), the amount of expression vector used to establish stable cell lines was titrated. At higher Ca3 overexpression levels, trastuzumab titer increased slightly, while viable cell density and viability were not affected ( Fig.13e and Fig.19 b, and data not shown). In summary, although Tagap overexpression could recapitulate the Foxa1-mediated increase in trastuzumab titer and transiently increase viable cell density, Tagap overexpression reduced cell viability at the end of fed-batch culture. Overall, the positive effects of Foxa1 on cell viability and cell growth as well as protein titer may arise from its effects on the expression of several target genes.

[0216] Foxa1 can also improve the production of difficult-to-express therapeutic proteins

[0217] The effect of Foxa1 overexpression on the secretion of infliximab, which is difficult to express, was further evaluated. Impressively, after Foxa1 overexpression, infliximab production increased by nearly one-fold, with an average titer of 378 μg / ml, and Foxa1 mRNA levels increased by 8.2-fold ( Fig.14a , Fig.14e ). Notably, Foxa1-overexpressing cells showed a significant increase in viable cell density from day 6 to day 9, reaching a maximum viable cell density of 12.2 million cells / ml on day 7, while control cells only reached a viable cell density of 8.6 million cells / ml ( Fig.14b Consistently, the inventors observed that the cell viability of Foxa1-expressing cells remained significantly higher, preventing the cell viability collapse of control cells observed from day 7 onwards ( Fig.14c This was accompanied by a decrease in ROS accumulation in Foxa1-overexpressing cells at days 7 and 8 ( Fig.14d Similar to what was observed after Foxa1 overexpression in Tras-producing clones, the mRNA levels of Ca3, Rassf9, and Tagap were also upregulated after Foxa1 overexpression ( Fig.14e Consistently, the inventors obtained a 45% increase in infliximab production after Tagap overexpression, with an average titer of 283 μg / ml ( Fig.15 a). Thus, while Tagap overexpression could reproduce the Foxa1-mediated increase in Tras titer, it could only partially mimic the Foxa1-induced increase in infliximab titer. In the Tras-producing clones, Tagap overexpression led to a rapid increase in the viable cell density of the infliximab clones, with a maximum viable cell density of 12 million cells / ml on day 6 ( Fig.15 b). However, compared with Foxa1 overexpressing cells, cell viability remained largely unchanged after Tagap overexpression ( Fig.15 c). Notably, overexpression of Tagap in infliximab-producing clones also resulted in upregulation of Ca3 mRNA levels ( Fig.15 d). Taken together, these results suggest that Foxa1 overexpression can be used to increase the production levels of both difficult-to-express and easy-to-express therapeutic proteins in CHO cells, and that this effect may be partly due to Foxa1-mediated enhancement of Tagap expression levels.

[0218] Candidate MIPs (PPARs) discovered in B5 selection

[0219] Figure 5A and Figure 5BIt is shown that a significant increase in DsRed (Discosoma sp. Red) activity was observed in AB and B5 selected cells, regardless of the presence of a PPRE reporter sequence, indicating that DsRed expression is induced independently of PPAR activation. This induction can be explained by the overall improved fitness of B5 selected cells compared to AB selected cells.

[0220] However, when mPPARα was exogenously added, DsRed activity was significantly higher in B5-selected cells only under the control of the PPRE reporter gene. The results suggest that B5 selection produces stable cells that constitutively produce an unknown PPAR agonist, which may be sensed by the cells as starvation stress. Therefore, exogenous PPARα is more activated in B5-selected cells compared to AB-selected cells.

[0221] Summarize:

[0222] Unidentified PPAR agonists accumulate during B5 starvation selection.

[0223] • Better fitness in B5-selected cells resulted in overall better gene expression compared to antibiotic-selected cells.

[0224] In B5-selected cells, exogenous PPARα activation was higher, resulting in higher expression of PPAR target genes compared to antibiotic-selected cells.

[0225] Fig. 6A and Figure 6B The activity of bezafibrate (2-[4-[2-(4-chlorobenzoyl)ethyl]phenoxy]-2-methylpropanoic acid) was shown. Bezafibrate was reported to be a general PPAR pan-agonist (Wilson et al., 2000; Inoue et al., 2002).

[0226] Bezafibrate has been used clinically as an anti-hyperlipidemic drug. After 3 days of fed-batch, the addition of bezafibrate to ETE induced the PPAR target genes HmgCs2 and Acot1 found in RNA-Seq screening, as well as the known PPAR target genes DBl1, Ascl1 (Rakhshandehroo et al., 2010) and RXR nuclear receptor ( Fig. 6A). Cyp4a14 was not induced upon addition of bezafibrate, which may mean that other control mechanisms by other agonists or PPARs may be used to control the expression of this gene. Interestingly, the B5 target gene Slc22a14 was activated by bezafibrate. The Slc22a14 gene has been implicated in male fertility in mice (Maruyama, 2016), but no function has been described in relation to PPAR responses.

[0227] The addition of bezafibrate on day 3 of fed-batch significantly increased cell survival when subjected to starvation stress during fed-batch culture (data not shown), but no increase in IgG production was observed under normal fed-batch culture conditions (see M&M for fed-batch culture). Day 3 of fed-batch culture corresponds to the exponential phase of cell division. The early addition of bezafibrate during fed-batch culture (day 1) was shown to favor recombinant protein production at the end of fed-batch culture ( Figure 6B ).

[0228] Bezafibrate was also tested in DTE cells. However, although the same target genes were induced, cell production and cell fitness were not improved. Therefore, PPAR activation and target gene induction by bezafibrate do not seem to be sufficient to overcome the bottleneck of cellular synthesis of difficult-to-express proteins.

[0229] Since bezafibrate can alter cell division and cell metabolism at high concentrations due to its strong broad effects on the activation of all PPARs, addition of bezafibrate to ETE and DTE cells did not show any beneficial effects on cell division, cell viability, and recombinant protein production (data not shown).

[0230] In summary, it has been found (see Figure 6):

[0231] PPAR targets identified by B5 selection can be chemically induced in CHO cells.

[0232] The Slc22a14 transporter, highlighted as a B5 target, was shown to be a novel PPAR target.

[0233] This induction may lead to better IgG production in ETE cells.

[0234] Recombinant cells expressing DTE protein were not affected by bezafibrate induction.

[0235] When cultured in stress-free complete medium, PPARα-overexpressing cells (e.g., PPARα_OE) did not show any differences in PPAR target gene expression and IgG production compared to wild-type cells and empty vector cells. However, when bezafibrate was added, exogenous PPARα present in PPARα_OE was activated and subsequently induced the transcription of PPAR target genes and RXR nuclear factor as well as IgG light and heavy chains ( Fig. 7A This increase resulted in higher IgG production in PPARα_OE cells ( Figure 7B ).

[0236] In summary, it has been found that ( Fig. 7A and Figure 7B ):

[0237] Activation of exogenous PPARs can generate DTE cells with improved cell fitness, thereby improving DTE therapeutic protein production.

[0238] In summary, it has been found that ( Figure 8A-8D ):

[0239] Lactate was reduced in B5 selected cells.

[0240] Overexpression of PPAR can lead to decreased lactate content in CHO cells.

[0241] Candidate MIPs (actin) found in B5 selection

[0242] Figure 9 has shown that overexpression of the actin gene generates ETE cells with improved production of therapeutic proteins. The Fc fusion expression clone was retransfected with the transposition ACTC1 expression vector. The specific productivity of the resulting cell pool was then assessed by subculturing it under batch conditions every 3 or 4 days. The results are presented as the fold change of PCD relative to the PCD value of the FC fusion control cells. The results show that overexpression of actin in suspension CHO cells can improve the production and secretion of therapeutic proteins by regulating the organization and polymerization of the cytoskeleton.

[0243] In further experiments, the authors will use antibodies encoding the “easily expressed” (ETE) trastuzumab or the “difficult to express” (DTE) infliximab or etanercept. CHO cells co-transfected with expression vectors for therapeutic proteins and vitamin B5 transporter SLC5A6 or antibiotic resistance genes were used as controls. Cells were then selected based on their ability to survive in B5-deficient medium or antibiotic resistance, and differentially expressed cellular genes were determined by RNA sequencing. After antibiotic selection, the expression of both ACTC1 and TAGAP was lower than that of untransfected cells, whereas after B5 selection, the expression of ACTC1 and TAGAP increased ( Fig. 20 a and Fig. 20b) Increased expression of TAGAP following SLC5A6 expression and vitamin B5 starvation was confirmed by four independent trastuzumab-expressing CHO cell lines isolated using antibiotic or B5 selection ( Fig. 20 c).

[0244] Gene induction after B5 selection may be caused by B5 starvation during selection as previously found in a study (Pourcel et al., 2019), or by overexpression of SLC5A6 itself, which mediates higher cellular uptake of vitamin B5 ( Fig. 20 d), or a combination of both effects. B5 is an important cofactor for acetyl-CoA, a key component of central and energy metabolism that may be involved in cytoskeletal regulation. To distinguish between these possibilities, cell lines overexpressing the SLC5A6 transporter were generated without any B5 deficiency, which showed that increased expression of SLC5A6 was sufficient to significantly upregulate the ACTC1 gene, while TAGAP expression was not significantly increased ( Fig. 20 e). Thus, the B5 selection process can activate ACTC1 gene expression through increased B5 intracellular import mediated by SLC5A6 overexpression, while a significant increase in TAGAP expression requires a combination of SLC5A6 overexpression and B5 starvation. It was also observed that TAGAP overexpression increased ACTC1 mRNA and protein accumulation ( Fig.21 ), suggesting that the increased expression of ACTC1 during B5 selection may be partly responsible for the upregulation of TAGAP.

[0245] In the expression of several DTE proteins (such as etanercept The effect of ACTC1 overexpression on recombinant protein expression was assessed in antibiotic-selected cell clones expressing ETE trastuzumab immunoglobulin (ETE trastuzumab IgG1 or bevacizumab Fc fusion protein or bevacizumab or infliximab IgG1). These cell clones were re-transfected with the ACTC1 coding sequence together with another antibiotic selection gene, and antibiotic-resistant cells overexpressing ACTC1 were selected ( Fig. 22 a- Fig. 22 c). After 3-4 days, the specific productivity of the resulting cell pool was evaluated under batch culture conditions, indicating that high-level expression of ACTC1 had a positive effect on the production of DTE protein by CHO cells ( Fig.23 a- Fig.23 c). Further analysis of the infliximab-producing ACTC1-overexpressing cell pool showed a significant increase in IgG titers after 10 days of fed-batch culture ( Fig.23 d).

[0246] Individual ACTC1 overexpressing clones were subsequently analyzed. To this end, trastuzumab-producing clones were retransfected with ACTC1 or an empty expression vector and expressed using The device picked individual clones. Eight clones transfected with empty vector and 24 ACTC1 expressing clones were used to verify the transcriptional expression of ACTC1, among which four control clones and four ACTC1 high expressing clones were randomly selected for further analysis ( Fig.24 a). ACTC1 protein overexpression was verified by immunoblotting ( Fig.25 a and Fig.24 b). Among the four ACTC1 overexpression clones, three ACTC1 overexpression clones showed the highest IgG titers after 13 days of fed-batch culture compared with the empty vector clone ( Fig.25 b and Fig.24 c).

[0247] To determine whether the increased secretion of therapeutic proteins caused by overexpression of ACTC1 may be caused by changes in cellular metabolism, the inventors measured major metabolic markers by mass spectrometry analysis of ACTC1 overexpressing cell pools. It is worth noting that the inventors assessed the accumulation of lactic acid, a toxic byproduct of early glycolysis that has been documented as a bottleneck for the production of therapeutic proteins (Lao & Toth, 1997). This showed that compared with control cells, ACTC1 overexpressing cells had significantly reduced lactic acid accumulation after 3 days of batch culture (Figure 2e). Overall, the inventors therefore concluded that overexpression of the ACTC1 gene significantly improved the secretion of a variety of therapeutic proteins, and this effect may be related to reducing the accumulation of toxic lactic acid metabolic byproducts.

[0248] Significance of actin polymerization levels in recombinant protein secretion

[0249] The inventors then assessed whether overexpression of ACTC1 would affect the polymerization state of actin. To this end, the inventors relied on SiR-actin staining, which specifically binds to F-actin ( et al., 2014), producing fluorescence levels in stained cells that are proportional to actin polymerization. Comparison of SiR-actin staining of ACTC1 and trastuzumab-expressing clones relative to control clones showed that control clones had higher fluorescence than ACTC1 overexpressing clones, indicating that ACTC1 overexpression significantly reduced actin polymerization levels ( Fig.26 a. Fig.26 b and Fig. 27 ).

[0250] To further evaluate whether actin polymerization affects recombinant protein expression, two independent polyclonal populations of CHO cells expressing trastuzumab protein but not transfected with ACTC1 vector were stained with SiR-actin. Fig.28 a and Fig.29 ) The stained cells were divided into three independent cell batches to obtain 6 cell pools for each fluorescence level. The IgG secretion level and IgG unit productivity of cells showing low, medium and high levels of polymerized actin were then evaluated ( Fig.28 b, Fig.28 c). High SiR-actin staining cells showed significantly lower IgG expression levels than low SiR-actin staining cells, supporting the conclusion that cells with lower levels of actin polymerization can mediate higher recombinant protein secretion even in the absence of ACTC1 overexpression.

[0251] Effects of single or combined expression of MIPs on secretion of different therapeutic protein-expressing CHO clones

[0252] Annotated Figure 10:

[0253] Bevacizumab expression clones were then transfected with multiple single or combined transposition CFLAR--expression vectors, GCLM--expression vectors, and ACTC1-expression vectors ( Fig. 10A )、Fc fusion expression clone ( Fig. 10B ) and Fab enzyme fusion expression clone ( Fig. 10C Then, the unit productivity of the resulting cell pool was evaluated by batch subculture every 3 or 4 days. The results are expressed as the PCD value (pg -1 .cell -1 .sky -1 ) percentage (%).

[0254] Summary Figure 10:

[0255] After transfection with expression vector MIP (such as CFLAR-expression vector, GCLM-expression vector, ACTC1-expression vector), the secretion of therapeutic proteins by CHO cells increased.

[0256] Table 1: Candidate genes identified by transcriptome analysis (fourth and fifth columns) and literature screening (sixth column). The third column describes the functional classification of the candidate genes.

[0257]

[0258]

[0259]

[0260]

[0261]

[0262]

[0263] Table 2. Upregulated genes in Tras high producing clones (HPCs) compared to parental CHO cells and Tras polyclonal cells (PCs).

[0264]

[0265]

[0266] 1 Genes upregulated in Tras high-producing cell clones compared to parental CHO cells and Tras polyclonal cells were selected according to the following criteria: log2 fold change > 0.5 and p value < 0.05.

[0267] 2 Genes listed as Foxa1 target genes according to ChIP-seq databases (ENCODE Transcription Factor Target Gene Database) and low- or high-throughput transcription factor functional studies obtained using the Harmonizome portal (TRANSFAC-organized Transcription Factor Target Gene Database) (Rouillard et al., 2016).

[0268] Table 3: Sequences encoding selected tested and possible MIPs

[0269]

[0270]

[0271]

[0272]

[0273] Table 4. For Figure 16-19 List of primers for RT-qPCR analysis

[0274] Gene Forward primer (FP) SEQ ID NO(FP) Reverse Primer (RP) SEQ ID NO(RP) Erp27 TGCAGCTGGCTTATTTAACACC 120 CCTGGAAGAGCTTAGCTGCC 137 Erp57 TGGAACTCACGGACGAAAACT 121 AGGGGCGAAGAACTCGACTA 138 SDHA TGGCGTGGATGTCACTAAGG 122 CAGCACCTGCCCTTTGTAGT 139 Foxa1 AAAGGGGACCCCCACTACTC 123 TGCCTTGAAGTCCAGCTTGT 140 Ca3 GGAATCGCTGTTGTTGGCAT 124 GAGCCTCCTTGCCCTTAGTC 141 Rassf9 TGGCACAGCTAGAAGAACGG 125 TCTTCACTTCCGTCGATGCC 142 Epcam TGTTTGGTGATGAAGGCGGA 126 TCGTTGTTCTGTATGGCCCC 143 Pcdhb3 CTGGGTCTAGGCGCTATTCTG 127 CTACCCTGAGCCCCAAATCC 144 Slc25a23 TCCGAGATTCAGCAGAGCTTC 128 CGCCATTCCTGCCAATCAATG 145 Pde1a TGGGTGTTTCTTGGGGTAGG 129 ACCCACCAAGAGTCACGTTG 146 Edn1 AGAAGGTTGGAGGCCATCAC 130 TGCTCGGTTGTGTGTCAACT 147 Sentence1 CACACCCACCTGGAAAGTCA 131 GTTAGGCCATCTTCCCGAGC 148 Frk GCCCAGTCCCCTCTTGATTT 132 GCAGAGCTGAGAGAGTTCCC 149 Arhgap42 CAGTTCAACTTGCAGAATACAAGG 133 TGGCTGGGTGGTCTGTAATC 150 Response GCCCACCATCCTACGAAGAG 134 GAGCCGTGTTCCATTTGAGC 151 TrasHC GACTCCGATGGGTCGTTCTT 735 CATGACGGAGCAGGAGAACA 152 After Lc GCGGACTACGAGAAGCACAA 136 CGGTTGAACGACTTGGTCAC 153

[0275] Materials and Methods

[0276] Selection and discovery of MIP candidates

[0277] Candidate gene sequences and DNA vector constructs

[0278] The NCBI BLAST software was used to align the homologous genes in mice and determine the genomic and cDNA sequences of the RNAseq MIP candidate genes. The SELEXIS CHO-M gene expression database was used to determine the transcript sequences and accumulation of the corresponding genes.

[0279] CHO-M (Sure CHO-M Cell Line TM (SELEXIS Inc., San Francisco, USA)), and the GoScript reverse transcription system (Promega) was used to extract the DNA from 106 CHO-M cells (NucleoPoSpin TM 1 μg of total RNA was extracted using RNA kit (Macherey-Nagel), and the cDNA library was amplified by reverse transcription.

[0280] The MIP coding sequence (CDS) was cloned into the pBSK_ITR_BT+_EGFP_X29_ITR vector (SELEXIS Inc., San Francisco, USA) by excising the green fluorescent protein (GFP) gene and replacing it with the MIP CDS.

[0281] The construction of the vector is as follows: CDS was amplified from the CHO-M cDNA library by PCR (Phusion high-fidelity DNA polymerase; Finnzymes, THERMO FISHERSCIENTIFIC), using primers with restriction sites from ATG to terminator. Then, the cDNA product and pBSK_ITR_BT+_EGFP_X29_ITR vector were double digested by the corresponding restriction endonucleases. Finally, the cDNA was ligated to the pBSK_ITR_BT vector, and the GFP sequence was excised after digestion with the same restriction endonucleases.

[0282] The pBSK_ITR_BT+_EGFP_X29_ITR vector includes an expression cassette consisting of a CMV / EF1α promoter and a BGH polyadenylation signal followed by hMAR X29. The expression cassette is flanked by inverted terminal sequences of the piggyBac transposon.

[0283] The GFP protein was expressed using a eukaryotic expression cassette consisting of the human cytomegalovirus (CMV) enhancer and human glyceraldehyde 3-phosphate dehydrogenase (GAPDH) promoter upstream of the coding sequence, followed by the simian virus 40 (SV40) polyadenylation signal, the human gastrin terminator and the SV40 enhancer (Le Fourn et al., 2013). The pSG5_PPARα vector was from Issemann and Green, 1990.

[0284] The BLASTICIDIN vector (pBlast) contains the blasticidin resistance gene controlled by the SV40 promoter from the pRc / RSV plasmid (INVITROGEN / LIFE TECHNOLOGIES).

[0285] RNASeq analysis

[0286] The cells used for RNASeq analysis were as follows:

[0287] -CHO-M WT cells

[0288] - Polyclonal cell populations expressing ENBREL Fc fusion protein (difficult to express) selected with puromycin and B5 or puromycin alone.

[0289] - Polyclonal cell populations expressing trastuzumab IgG (prone to expression) selected with puromycin and B5 or with puromycin alone.

[0290] - Clones expressing trastuzumab IgG (prone to expression) were selected with puromycin.

[0291] - Clones expressing bevacizumab IgG (prone to expression) were selected with puromycin.

[0292] - Interferon beta expressing (poorly expressed) clones selected with puromycin.

[0293] The cells were cultured in spin tubes for 4 days without antibiotic selection. Total RNA was isolated from the cells using the NucleoSpin RNA kit (Macherey-Nagel). RNA quality was assessed using a fragment analyzer (Advanced Analytical). The RNA-seq library was prepared by converting 0.5 μg to 1 μg of total RNA into cDNA using the Stranded mRNA-seq reagent (Illumina). The paired ends of the RNA-seq library were 100 nt in Illumina HiSeq The reads were mapped to the CHO-K1 transcriptome (RefSeq, 2014).

[0294] Cell culture, stable transformation, and stable polyclonal line analysis

[0295] Chinese hamster ovary cells (CHO-M) were suspended in SFM4CHO Hyclone serum-free medium (SFM, THERMOSCIENTIFIC) supplemented with L-glutamine (PAA, Austria) and HT supplement (GIBCO, INVITROGEN LIFE SCIENCES) at 37°C and 5% CO. 2 The suspension cultures were maintained in a humidified atmosphere of 40 °C. Other cell culture media used for these experiments were deficient BalanCD Cho-M Growth A (B-CDmin; Irvine Scientific), supplemented with vitamin B1 (thiamine hydrochloride; SIGMA ALDRICH), vitamin B5 (DL-calcium pantothenate; TCI), and vitamin H (biotin, SIGMA ALDRICH).

[0296] CHO-M cells were transfected with pBSK-MIP, pBlast and pCS2-U5-PBU3IgG1-Hc or IgG1-Lc expression vectors by electroporation according to the manufacturer's recommendations (NEONDEVICES, INVITROGEN). Stable cell line production was achieved by culturing in SFM4 CHO medium supplemented with 7.5 μg / ml blasticidin for 3 weeks.

[0297] GFP and IgG1 producing cell polyclonal lines expressing GFP or IgG were selected for further experiments as follows: For blasticidin selection, cells were seeded in SFM medium supplemented with 10 mg / ml blasticidin for 2 weeks, then transferred to wells in SFM medium for 5 days and subsequently added to 50 ml spin tubes with SFM medium.

[0298] To double select cells with puromycin followed by B5, polyclonal stable cell lines were first selected with puromycin, then seeded at 20,000 cells / ml in B5 selection medium for 7 days (B-CD complete medium was used as a negative control), then transferred to SFM complete medium wells for 7 days, and then seeded into pin tubes with SFM medium.

[0299] Flow cytometry analysis was performed using a CyAn ADP flow cytometer (Beckman Coulter) to determine the percentage of fluorescent cells and the fluorescence intensity of GFP-positive cells. The immunoglobulin concentration in the cell culture supernatant was measured by sandwich ELISA. The accumulation of GFP, IgG1Lc, IgG1Hc, and MIP transcripts was confirmed by RT-quantitative PCR and then analyzed.

[0300] Flow cytometry (Beckman Coulter TMSurface IgG display was assessed by FACS analysis. Stable clones expressing IgG were obtained by cell sorting on a FACS Aria III (BD), expanded and analyzed for IgG production levels (sandwich ELISA).

[0301] Measuring Peroxisome Proliferator-Activated Receptor Response Element (PPRE) and PPAR Activation Using Transient Assays

[0302] Transient transfection assays were performed as follows: CHO cells were transfected with PPRE-TK-DsRed (provided by Michalik lab., University of Lausanne) or TK-DsRed (PPRE sequence cut from the original vector) in the absence or presence of pSG5_PPARα vector. pE-BFP2-Nuc (2xNLS) was used as an internal transfection control. It contains the eBFP2 (enhanced blue fluorescent protein 2) coding sequence and the nuclear localization sequence NLS under the control of a minimal CMV promoter. Beckman Coulter Gallios cells were used 48 hours after transfection. Cells were visualized by flow cytometry and analyzed by Kaluza Signals were analyzed by ELISA software. DsRed activity (detection wavelength: 638 nm) was normalized to BFP2 labeling (detection wavelength: 488 nm).

[0303] Fed-Batch Performance Evaluation

[0304] Growth and IgG secretion performance of fed-batch cultures were performed according to Le Fourn et al. (2013) with the following modifications: IgG production clones stably transfected for expression of MIP were inoculated at 300,000 cells / ml in 5 mL of medium in a 50 mL falcon. Viable cell density and IgG titer (g / L) were measured after 3, 6, 8, 9, 10, and 13 days.

[0305] Quantitative PCR analysis

[0306] Total RNA was extracted from 106 cells and reverse transcribed into cDNA using the GoScript Reverse Transcription System (Promega) for quantitative PCR (qPCR) analysis. Transcript accumulation was quantified by qPCR using 480SYBR Green I Master and LightCycler 480II instrument (Roche). Transcript levels were normalized to the level of the SDHA housekeeping gene.

[0307] Metabolite analysis (metabolite extraction, sample size normalization)

[0308] Metabolite extraction

[0309] For metabolite quantification, 1000 μL of pre-cooled MeOH:H 2 The cell pellets were extracted with a 4:1, vol / vol solvent mixture as the best compromise for efficient protein precipitation, inhibition of metabolism, and extraction of a wide range of polar metabolites. The samples were then probe-ultrasonicated (4 pulses × 5 seconds) to completely lyse the cells and improve metabolite extraction. To promote protein precipitation, the samples were incubated at -20 °C for 1 hour and then centrifuged at 13,000 rpm for 15 minutes at 4 °C. The resulting supernatant was collected and evaporated to dryness in a vacuum concentrator (LABCONCO, Missouri, US). The sample extract was then concentrated in 100 μL MeOH:H 2 The samples were reconstituted in 2% O (4:1) and injected into the LC-MS system.

[0310] Protein quantification

[0311] The protein pellet was evaporated and the mixture was stirred in 20 mM Tris-HCl (pH 7.5), 4 M guanidine hydrochloride, 150 mM NaCl, 1 mM Na 2 EDTA, 1mM EGTA, 1% Triton, 2.5mM sodium pyrophosphate, 1mM β-glycerophosphate, 1mM Na 3 CO 4 The total protein concentration (A562 nm) was measured using a BCA protein assay kit (THERMO SCIENTIFIC, Massachusetts, US) (HIDEX, Turku, Finland).

[0312] Data acquisition - LC-HRMS

[0313] The extracted samples were analyzed by hydrophilic interaction liquid chromatography coupled to high resolution mass spectrometry (HILIC-HRMS) in negative ionization mode using Q- Instrument (quadrupole The mass spectrometer (THERMO FISHERSCIENTIFIC) was operated at a mass resolution of 70,000 full width at half maximum (FWHM). Metabolites were chromatographed using a ZIC pHILIC column (100 mm, 2.1 mm ID and 5 μm particle size). The mobile phase consisted of A = 20 mM ammonium acetate and 20 mM NH 4OH is dissolved in water, pH 9.3 and B = 100% CAN composition. A linear gradient elution was performed from 90% B (0 min-1.5 min) to 50% B (1.5 min-8 min), followed by an isocratic step (8 min-11 min) and a linear gradient down to 45% B (11 min-12 min). These conditions were maintained for 3 minutes. Finally, the initial chromatographic conditions were established as a 9-minute post-run for column reequilibrium. The flow rate was 300 μL / min, the column temperature was 30°C, and the injection volume was 2.5 μl. The ESI source conditions were set as follows: probe heater temperature 200°C, sheath gas 60 a.u., auxiliary gas 15 a.u., capillary temperature 280°C and ESI spray voltage -3600V. Full scan mode was used as the acquisition mode to quantify lactate, pyruvate, 3-hydroxybutyrate and pantothenic acid, while parallel reaction monitoring acquisition mode was used to quantify acetyl-CoA, using 30 eV as the collision energy.

[0314] Data processing

[0315] Thermo Fisher Scientific software (Xcalibur 4.0 The raw LC-HRMS data were processed by THERMOFISHER SCIENTIFIC. External calibration curves were used for metabolite quantification.

[0316] Statistical analysis

[0317] Results are presented as mean ± standard error of the mean (SEM) or mean ± standard deviation (SD). Statistical analysis was performed using one-tailed or two-tailed Student's t-test. Asterisks in subfigures refer to statistical probability. Statistical probability values ​​less than 0.05 were considered significant.

[0318] Materials and methods:

[0319] Evaluation of the effects of MIP expression alone or in combination on secretion from different therapeutic protein-expressing CHO clones

[0320] CFLAR, GCLM, ACTC1:

[0321] DNA vector construction

[0322] The PB transposase expression vector pCS2+U5V5PBU3 contains the PB transposase coding sequence surrounded by the 5' and 3' untranslated terminal regions (UTRs) of the African clawed frog β-globin gene. The plasmid was constructed as follows: the 3'UTR 317 bp fragment from pBSSK / SB10 (kindly provided by Dr S. Ivies) was inserted into pCS2+U5 (INVITROGEN / LIFE Technologies, Paisley, UK) to obtain pCS2+U5U3. The PB transposase coding sequence (2067 bp, GenBank accession number: EF587698) was synthesized by ATG:biosynthetic (Merzhausen, Germany) and cloned into the pCS2+U5U3 backbone between the two UTRs. The PB control vector corresponds to the unmodified pCS2+U5 plasmid (Figure 10, left subfigure). Different transposon vectors were generated by introducing PB 235bp 3' and 310bp 5' terminal inverted repeats (ITRs) synthesized by ATG:biosynthetic (Merzhausen, Germany) into pBluescript SK-plasmid (pBSK ITR3'-ITR5', Figure 1, right subfigure). Then, the puromycin resistance gene (PuroR) was inserted between the two ITRs under the control of the SV40 promoter from the pRc / RSV plasmid (INVITROGEN / LIFE Technologies). The MAR1-68 and MARX-29 elements, the puromycin resistance gene and the GFP gene used in this study were as described previously.

[0323] Cell culture, stable transfection and subcloning of CHO cell lines

[0324] Suspension Chinese hamster ovary cells (CHO-K1) were maintained in SFM4CHO Hyclone serum-free medium (THERMOSCIENTIFIC) supplemented with L-glutamine (PAA, Austria) and HT supplement (GIBCO, INVITROGEN life sciences) at 37°C and 5% CO 2in humid air. According to the manufacturer's recommendations (Neon devices, Invitrogen), CHO-K1 cells were electroporated with a recombinant target protein expression vector carrying a puromycin resistance gene. 2 Two days later, the cells were transferred to a T75 plate containing 10 μg / ml puromycin, and the cells were cultured for 2 weeks under selection conditions. Stable single-cell clones expressing bevacizumab IgG, Fc fusion or circulating hormones were generated by limiting dilution, amplified and analyzed for growth performance and production levels. Bevacizumab IgG-, Fc fusion-producing cell clones expressing the highest protein levels were selected for further biochemical experiments. Circulating hormone expression CHOM clones were analyzed by SDS-PAGE and immunoblotting.

[0325] Some of these clones were then co-transfected with a variety of metabolic improved protein (MIP) expression vectors and a plasmid carrying a blasticidin resistance gene by electroporation as described below. The cells were then cultured for two weeks in a medium containing 10 μg / ml blasticidin as described above. Stable clones were isolated by limiting dilution and clones were isolated using a Clonepix instrument and then analyzed for growth and production.

[0326] Cell culture and transfection assays

[0327] CHO-M cells were cultured in SFM4CHO Hyclone serum-free medium (THERMO SCIENTIFIC) supplemented with L-glutamine (PAA, Austria) and HT supplement (GIBCO, INVITROGEN life sciences) at 37°C and 5% CO. 2 The suspension cultures were maintained in a humidified atmosphere of 4% CO. Transposon donor plasmids were transferred into these cells by electroporation according to the manufacturer's recommendations (Neon devices, INVITROGEN). Quantification of recombinant protein secretion levels from batch cultures was performed as previously described (see Le Fourn et al., 2013). Briefly, cell populations expressing immunoglobulins in batch cultures were incubated in 50 ml microbioreactor tubes (TPP, Switzerland) at 37°C and 5% CO. 2 The cells were cultured in a humidified incubator for 7 days for evaluation. The immunoglobulin concentration in the cell culture supernatant was measured by sandwich ELISA.

[0328] Alternatively, use The device isolated two clones from the unsorted and unselected population that expressed each of the three IgGs. Briefly, individual cells were fixed with semisolid medium and clones secreting high amounts of IgG were selected 10 days after embedding. These cell lines were grown in a rotating tube bioreactor at 3 × 105 Cells were passaged every 3 to 4 days at a density of 10 cells / ml in growth medium containing peptone (Hyclone SFM4CHO supplemented with 8 mM glutamine) maintained at 37°C and 5% CO. 2 Incubate the cells in a humidified incubator with orbital shaking at 180 rpm.

[0329] When assessing polyclonal cell populations, start with 1 × 10 5 IgG titers were determined in cells inoculated at a cell density of 10 cells / ml and cultured in 5 ml complete medium in a 50 ml rotating tube bioreactor for 6 days. Alternatively, shake flask cultures of clonal populations were plated at 3 × 10 5 The cells were inoculated into SFM4CHO medium at a density of 10 cells / ml to start the fed-batch production process. The culture medium was maintained at 37°C and 5% CO. 2 Fed-batch production assays were performed in a humidified incubator (25 ml shake flasks and rotary tubes) with shaking at 0 rpm, using 25 ml culture volume in 125 ml shake flasks or 5 ml culture volume in 50 ml TPP culture tubes. On days 0, 3, and 6 to 8, 16% of the initial culture volume was fed with a chemically defined concentrate feed (HYCLONE, Cell Boost5, 52 g / l), respectively, and the production was continued for 10 days. No glutamine and glucose were added during the culture. Daily use The viability and viable cell density (VCD) of the cultures were measured using a MILLIPORE machine. The concentration of MAbs secreted into the culture medium was determined using a double sandwich ELISA assay.

[0330] Batch and fed-batch cultures

[0331] Growth and production performance of individual clones expressing bevacizumab IgG, Fc fusion, and circulating hormone were measured in 50 ml microbioreactor tubes (TPP, Switzerland) at 37°C, 5% CO. 2 The cells were cultured in batches for 7 days in a humidified incubator. Cell density and cell viability were determined by flow cytometry system (MILLPOLE). IgG titer in cell culture supernatant was measured by sandwich ELISA. Cell density (Cv.ml 1) and IgG titer value (pg.ml) were plotted on the sampling day of the designated treatment time.

[0332] The specific IgG productivity of the recombinant protein expressing clones was determined by the slope of the MIP concentration versus the viable cell count (IVCD) calculated from day 3 to day 7 (production phase), expressed as pg / cell / day (pcd). In fed-batch production cultures, cells were inoculated at 0.3×106 cells / ml into 25 ml SFM4CHO Hyclone serum-free medium in 125 ml shake flasks. The cultures were maintained at 37°C and 5% CO. 2 The cultures were stirred at 4 °C. The cultures were fed daily with commercial Hyclone feed (THERMO SCIENTIFIC). Cell density and IgG production were assessed daily.

[0333] Erp27 and Erp57:

[0334] DNA vector construction

[0335] To obtain the candidate gene coding sequence (CDS), NucleoSpin TM RNA kit (MACHEREY-NAGEL) from CHO-M cells (SURE CHO-M Cell Line TM , Selexis SA, Switzerland) was used to isolate total RNA. Reverse transcription was performed using the GoScript reverse transcription system (Promega). The candidate gene CDS was inserted into the pBSK_ITR_BT+_X29_ITR (pBSK_ITR) or pBSK_ITR_Blast vector. The pBSK_ITR vector includes an expression cassette consisting of a CMV / EF1α promoter and a BGH polyadenylation signal followed by hMAR X-29 (Le Fourn, Girod, Buceta, Regamey, & Mermod, 2014). The expression cassette is flanked by the terminal reverse sequences of the piggyBac transposon. In the pBSK_ITR_Blast vector, a blasticidin resistance gene controlled by the SV40 promoter was inserted after hMAR X-29. In experiments with overexpression of Erp27 and Erp57 in cells expressing difficult-to-express proteins or when titrating Erp27 or Ca3 overexpression, the pBSK_ITR plasmid was used and cells were co-transfected with a plasmid carrying the blasticidin resistance gene under the control of the SV40 promoter. In other experiments, the pBSK_ITR_Blast vector was used. In experiments with overexpression of Foxa1, the CMV / EF1α promoter was replaced by a minimal CMV promoter for expression of both Foxa1 and GFP. The piggyBac transposase expression vector (pCS2+U5V5PBU3) has been previously described (Ley et al., 2013).

[0336] Analysis of Reactive Oxygen Species

[0337] 6-carboxy-2′,7′-dichlorodihydrofluorescein diacetate (carboxy-H 2 DCFDA, THERMOFISHERSCIENTIFIC) was used to detect the level of intracellular reactive oxygen species (ROS). Two million cells were cultured in a medium containing 50 μM carboxy-H 2 The cells were incubated in PBS with DCFDA for 30 min. The cells were then centrifuged, resuspended in 1 ml PBS, and stained with DAPI to exclude dead cells. The DAPI-negative cell population was analyzed by flow cytometry for carboxy-H 2 DCFDA fluorescence ( BECKMAN COULTER).

[0338] Cell culture, stable transformation, and stable polyclonal line analysis

[0339] The cells were cultured in SFM4CHO Hyclone serum-free medium (GE Healthcare) supplemented with 5% HyClone Cell Boost 5 supplement (GE HEALTHCARE), 8 mM L-glutamine (PAA, Austria) and 1× HT supplement (GIBCO) at 37°C and 5% CO. 2 The suspension cultures were maintained in a humidified incubator at 4 °C. Polyclonal CHO-M cells producing trastuzumab or infliximab antibodies were generated and characterized as described previously (Le Fourn et al., 2014). Stable clones expressing IgG were obtained by cell sorting on a FACS Aria II (BD), expanded, and analyzed for IgG production levels by sandwich ELISA. The manufacturer's protocol ( Transfection system 100uL kit, INVITROGEN), clones producing trastuzumab or infliximab were re-transfected by electroporation with pBSK_ITR_CDS, pBlast and pCS2+U5V5PBU3 or with pBSK_ITR_Blast_CDS and pCS2+U5V5PBU3 to obtain stable cell lines overexpressing the candidate gene. Cells with stable insertion were selected with 3μg / ml or 7.5μg / ml of blasticidin (INVIVOGEN). For clones producing etanercept, individual subclones co-expressing Erp27 and Erp57 were isolated and evaluated for Erp27 and Erp57 production using the ClonePix cell clone imaging device. Cell clones showing the widest etanercept secretion halo were isolated from Erp27 and Erp57 overexpressing or control cell populations.

[0340] ACTC1 and TAGAP:

[0341] DNA vector construction

[0342] The genomic and cDNA sequences of ACTC1 and TAGAP genes were determined by comparing with homologous genes in mice using NCBI BLAST software. Transcript sequence RNAseq analysis was performed on Selexis SA CHO K1 cells (CHO-M). The cDNA library was used The reverse transcription system (PROMEGA) was used from 10 6 CHO-M cells (NucleoSpin TM RNA kit; MACHEREY-NAGEL) was used to reverse transcribe 1 μg of total RNA isolated. ACTC1 and TAGAP coding sequences (CDS) were cloned into pBSK_ITR_BT+_EGFP_X29_ITR transposition expression vector (Le Fourn, Girod, Buceta, Regamey, & Mermod, 2014) to obtain pBSK-ACTC1 and pBSK-TAGAP expression vectors. The pBSK_ITR_BT+_EGFP_X29_ITR vector includes an expression cassette consisting of a CMV / EF1α promoter and a BGH polyadenylation signal followed by hMAR X-29 (Le Fourn, Girod, Buceta, Regamey, & Mermod, 2014). The expression cassette is flanked by the terminal inverted sequences of the piggyBac transposon. The blasticidin vector (pBlast) contains the blasticidin resistance gene controlled by the SV40 promoter from the pRc / RSV plasmid (Invitrogen / Life Technologies).

[0343] Cell culture and stable transfection

[0344] CHO K1 cells were cultured in SFM4CHO medium supplemented with L-glutamine (PAA, Austria) and HT supplement (GIBCO, INVITROGEN LIFE SCIENCES). Serum-free medium (SFM, ThermoScientific TM ) at 37°C and 5% CO 2 The other cell culture medium used for these experiments was BalanCD Cho-M Growth A (B- IRVINE SCIENTIFIC), supplemented with vitamin B1 (thiamine hydrochloride; SIGMA ALDRICH), vitamin B5 (DL-calcium pantothenate; TCI) and vitamin H (biotin, SIGMA ALDRICH). CHO-M cells were transfected with pBSK-ACTC1 or TAGAP, pBlast and pCS2-U5-PBU3IgG1-Hc or IgG1-Lc expression vectors by electroporation according to the manufacturer's recommendations (NEONDEVICES, INVITROGEN). Stable cell lines were generated by culturing for 3 weeks in SFM4CHO medium supplemented with 7.5 μg / ml blasticidin. Polyclonal cell populations expressing IgG were selected for further experiments as follows: For blasticidin selection, cells were inoculated in SFM4CHO medium supplemented with 10 mg / ml blasticidin for 2 weeks, then transferred to wells containing unsupplemented medium for 5 days and subsequently transferred to 50 ml spin tubes.

[0345] Analysis of stable polyclonal and monoclonal cell lines

[0346] Fed-batch performance evaluation, IgG cell surface staining, IgG cell secretion assay, and vitamin B5 metabolite quantification were performed as previously described (Pourcel et al., 2019). Briefly, IgG secretion performance in fed-batch cultures was the same as previously reported (Le Fourn et al., 2014). Cell surface IgG was measured as previously reported (Brezinsky et al., 2003) and was measured using Molecular The cell pool expressing recombinant IgG was subcloned using the ClonePixTMFL Imager. To quantify vitamin B5 metabolites, 1 mL of cold MeOH:H 2 The cell pellets were extracted with a 4:1, vol / vol solvent mixture and then probe sonicated. The supernatant was obtained after incubation at -20 °C for 1 h, then centrifuged at 4 °C, 13,000 rpm for 15 min, collected and evaporated to dryness, and then washed with 100 μL MeOH:H 2 O (4:1) and injected into the LC-MS system. The protein pellet was evaporated and the precipitate was stirred in 20 mM Tris-HCl (pH 7.5), 4 M guanidine hydrochloride, 150 mM NaCl, 1 mM Na 2 EDTA, 1mM EGTA, 1% Triton, 2.5mM sodium pyrophosphate, 1mM sodium β-glycerophosphate, 1mM Na 3 VO 4and 1 μg / ml leupeptin. The extracted samples were analyzed by HILIC-HRMS in negative ionization mode using Q- Instrument (Thermo Fisher ) were run at a mass resolution of 70,000 full width at half maximum. Software (Xcalibur 4.0 The raw LC-HRMS data were processed by THERMOFISHER SCIENTIFIC. External calibration curves were used for metabolite quantification.

[0347] RNA RT-PCR and sequencing RNA-seq analysis

[0348] For RNA reverse transcription and real-time quantitative PCR (RT-qPCR) analysis, 6 Total RNA was extracted from each cell and reverse transcribed into cDNA using polyT primers. Transcript accumulation was quantified by qPCR using the SYBR Green-Taq polymerase kit from EUROGENTEC Inc. and an ABI Prism 7700 PCR instrument (APPLIED BIOSYSTEMS). Transcript levels were normalized to those of the GAPDH housekeeping gene. RNASeq analysis of B5 and puromycin-selected CHO cells was as described previously (Pourcel et al., 2019).

[0349] Briefly, total RNA was extracted from: i) parental CHO cells, ii) CHO cell clones expressing interferon-β and the B5 transporter SLC5A6 expression vector after B5 deficiency / puromycin selection or puromycin selection alone, iii) CHO cell pools expressing trastuzumab and SLC5A6 expression vectors after B5 deficiency / puromycin selection or puromycin selection alone as described previously. cDNA was obtained from 0.5 μg to 1 μg of total RNA using the Stranded mRNA-seq reagent (ILLUMINA). RNA-seq libraries with 100 nt paired ends were prepared on an Illumina HiSeq The reads were mapped to the CHO-K1 transcriptome (RefSeq, 2014).

[0350] Protein sample preparation and immunoblotting

[0351] The total actin content was assessed as follows. 7Cells were used for protein extraction, and then the cell pellets were resuspended in RIPA lysis buffer (150Mm NaCl, 50mM Tris-HCl pH 8.0, 1% NP-40, 0.1% sodium deoxycholate, 0.1% SDS) and stirred for 30 minutes. Cell debris was precipitated by centrifugation (5 minutes, 15.000g) and the supernatant was collected. Equal volumes of protein samples were subjected to denaturing gel electrophoresis and immunoblotting with 6%-14% SDS / PAGE gel, Mini-Protean Tetra gel (Bio-Rad) and Mini TransBlot Cell (Bio-Rad), and protein was blotted onto nitrocellulose membranes. The membranes were blocked at room temperature for 1 hour in TBST (20mM trishydroxymethylaminomethane, 135mM NaCl, 0.1% Tween-20, pH 7.6) with 5% skim milk powder. The membrane was then incubated with α-cardiac actin polyclonal antibody (PA5-21396, Invitrogen, dilution 1:500) or GAPDH antibody (sc-32233, SANTA CRUZ BIOTECHNOLOGY, dilution 1:500) overnight, followed by incubation with anti-mouse HRP-conjugated secondary antibody (G21040, Invitrogen, dilution 1:1000) for 1 hour. (34580, THERMO SCIENTIFIC) and The protein bands were visualized using an imaging system (BIO-RAD). The resulting protein band intensities were quantified using the Fiji distribution (NIH, Bethesda, MD).

[0352] Analysis of actin polymerization by fluorescence-activated cell sorting

[0353] By dividing 2×10 5 Cells / ml were seeded in SFM and cultured at 37°C, 5% CO 2 After 3 days of culture, the levels of polymerized actin (F-actin) were assessed in the cell cultures. 10 6 The cells were resuspended in 3 aliquots supplemented with 200 nM SiR-Actin (CY- SPIROCHROME) in fresh medium and incubate at 37°C, 5% CO 2The cells were then sorted by flow cytometry (BD FACS Aria II, BD BIOSCIENCES, San Jose, CA) based on their fluorescence levels (Abs 652 nm, Em 674 nm, low, medium, and high fluorescence). These cell populations were expanded and maintained at 37°C, 5% CO 2 until further analysis.

[0354] It should be understood that the systems (vectors / cells, etc.), methods and kits of the present invention can be incorporated in the form of a variety of embodiments, only a few of which are disclosed herein. It is obvious to those skilled in the art that there are other embodiments that do not deviate from the spirit of the present invention. Therefore, the embodiments described herein are illustrative and should not be construed as limiting.

[0355] References

[0356] Alanen, HI, Williamson, RA, Howard, MJ, Hatahet, FS, Salo, KE, Kauppila, A., ... Ruddock, LW (2006). ERp27, a new non-catalytic endoplasmicreticulum-located human protein disulfide isomerase family member, interacts with ERp57.J BiolChem, 281(44), 33727-33738.doi: 10.1074 / jbc.M604314200

[0357] Aon MA, Cortassa S. Coherent and robust modulation of a metabolic network by cytoskeletal organization and dynamics. Biophys Chem. 2002 Jun 19; 97(2-3): 213-31.

[0358] Baek,E.,Kim,C.L.,Park,J.H.,&Lee,G.M.(2015).Cell Engineering forTherapeutic Protein Production.ln M.Al-Rubeai(Ed.),Cell Engineering,vol9.Animal Cell Culture(pp.565-590).doi:10.1007 / 978-3-319-10320-4_18

[0359] Bargsted,L.,Hetz,C.,&Matus,S.(2016).ERp57in neurodegeneration andregeneration.Neural Regen Res,11(2),232-233.doi:10.4103 / 1673-5374.177722

[0360] Becker,E.,Florin,L.,Pfizenmaier,K.,&Kaufmann,H.(2008).An XBP-1dependent bottle-neck in production of lgG subtype antibodies in chemicallydefined serum-free Chinese hamster ovary(CHO)fed-batch processes.JBiotechnol,135(2),217-223.doi:10.1016 / j.jbiotec.2008.03.008

[0361] Birkenfeld,J.,Kartmann,B.,Betz,H.,&Roth,D.(2001).Cofilin activationduring Ca(2+)-triggered seGretion from adrenal chromaffincells.Biochemicaland biophysical research communications,286(3),493-498.doi:10.1006 / bbrc.2001.5435

[0362] Borth,N.,Mattanovich,D.,Kunert,R.,&Katinger,H.(2005).Effect ofincreased expression of protein disulfide isomerase and heavy chain bindingprotein on antibody secretion in a recombinant CHO cell line.BiotechnolProg,21(1),106-111.doi:10.1021 / bp0498241

[0363] Brezinsky,S.C.G.,Chiang,G.G.,Szilvasi,A.,Mohan,S.,Shapiro,R.1.,MacLean,A.,Thill,G.(2003).A simple method for enriching populations oftransfected CHO cells for cells of higher specific productivity.Journal ofImmunological Methods,277(1-2),141-155.doi:10.1016 / s0022-1759(03)00108-x

[0364] Cain,K.,Peters,S.,Hailu,H.,Sweeney,B.,Stephens,P.,Heads,J.,...Dickson,A.(2013).A CHO cell line engineered to express XBP1 and ERO1-Lalpha has increased levels of transient protein expression.Biotechnol Prog,29(3),697-706.doi:10.1002 / btpr.1693

[0365] Chen,L.,Johnson,R.C.,&Milgram,S.L.(1998).P-CIP1,a novel protein thatinteracts with the cytosolic domain of peptidylglycine alpha-amidatingmonooxygenase,is associated with endosomes.J BiolChem,273(50),33524-33532.doi:10.1074 / jbc.273.50.33524

[0366] Chung,J.Y.,Lim,S.W.,Hong,Y.J.,Hwang,S.O.,&Lee,G.M.(2004).Effect ofdoxycycline-regulated calnexin and calreticulin expression on specificthrombopoietin productivity of recombinant Chinese hamster ovarycells.Biotechnol Bioeng,85(5),539-546.doi:10.1002 / bit.10919

[0367] Connelly TM,Berg AS,Harris LR 3rd,Hegarty JP,Ruggiero FM,Deiling SM,Brinton DL,Kol-tun WA.T-cell activation Rho GTPase-activating proteinexpression vsries with inflamma-tion location and severity in Crohn′sdisesse.J Surg Res.2014Aug;190(2):457-64.

[0368] Davis,R.,Schooley,K.,Rasmussen,B.,Thomas,J.,&Reddy,P.(2000).Effect ofPDl overexpression on recombinantprotein secretion in CHOcells.BiotechnolProg,16(5),736-743.doi:10.1021 / bp000107q

[0369] Debold,E.P.,Saber,W.,Cheema,Y.,Bookwalter,C.S.,Trybus,K.M.,Warshaw,D.M.,&Vanburen,P.(2010).Human actin mutations associated with hypertrophicand dilated cardiomyopathies demonstrate distinct thin filament regulatoryproperties in vitro.Journalof molecular and cellularcardiology,48(2),286-292.doi:10.1016 / j.yjmcc.2009.09.014

[0370] Di Fiore,A.,Monti,D.M.,Scaloni,A.,De Simone,G.,&Monti,S.M.(2018).Protective Role of Carbonic Anhvdrases III and Vll in Cellular DefenseMechanisms upon Redox Unbalance.Oxid Med Cell Longev,2018,2018306.doi:10.1155 / 2018 / 2018306

[0371] Dinnis DM,Stansfield SH,Schlatter S,Smales CM,Alete D,Birch JR,RacherAJ,Marshall CT,Nielsen LK,James DC.Functional proteomic analysis of GS-NS0murine myeloma cell lines with varying recombinant monoclonal antibodyproduction rate.Biotechnol Bioeng.2006Aug 5;94(5):830-41.

[0372] Duke-Cohan,J.S.,lshikawa,Y.,Yoshizawa,A.,Choi,Y.I.,Lee,C.N.,Acuto,O.,...Reinherz,E.L.(2018).Regulation of thymocyte trafficking by Tagap,a GAPdomain proteinlinked to human autoimmunity.Sci Signal,11(534).doi:10.1126 / scisignal.aan8799

[0373] Eyre,S.,Hinks,A.,Bowes,J.,Flynn,E.,Martin,P.,Wilson,A.G.,Barton,A.(2010).Overlapping genetic susceptibility variants between three autoimmunedisorders:rheumatoid arthritis,type 1diabetes and coeliac disease.Arthritisresearch&therapy,12(5),R175.doi:10.1186 / ar3139

[0374] Farrell,A.,McLoughlin,N.,Milne,J.J.,Marison,I.W.,&Bones,J.(2014).Application of multi-omics techniques for bioprocess design and optimizationin Chinese hamster ovary cells.J ProteomeRes,13(7),3144-3159.doi:10.1021 / pr500219b

[0375] Fischer,S.,Handrick,R.,&Otte,K.(2015).The art of CHO cellengineering:A comprehensive retrospect and future perspectiyes.Biotechnol Adv,33(8),1878-1896.doi:10.1016 / i.biotechadv.2015.10.015

[0376] Friedman,J.R.,&Kaestner,K.H.(2006).The Foxa family of transcriptionfactors in development and metabolism.Cell Mol Life Sci,63(19-20),2317-2328.doi:10.1007 / s00018-006-6095-6

[0377] Gulis,G.,Simi,K.C.,de Toledo,R.R.,Maranhao,A.Q.,&Brigido,M.M.(2014).Optimization of heterologous protein production in Chinese hamster ovarycells under overexpression of spliced form of human X-box binding protein.BMCBiotechnol,14,26.doi:10.1186 / 1472-6750-14-26

[0378] Gutierrez-Gonzalez,M.,Latorre,Y.,Zuniga,R.,Aguillon,JC,Molina,MC,&Altamirano,C.(2019).Transcription Factor Engineering in CHO Cells for Recombinant Protein Production.Crit Rev. Sci Biotechnol,39(5),665–679.doi:10.1080 / 07388551.2019.1605496

[0379] Ha,TK,Hansen,AH,Kol,S.,Kildegaard,HF,&Lee,GM(2018).BaicaleinReduces Oxidative Stress in CHO Cell Cultures and Proves RecombinantAntibody Productivity.Biotechnol J,13(3),e1700425.doi:10.1002 / biot.201700425

[0380] Hansen,HG,Nilsson,CN,Lund,AM,Kol,S.,Grav,LM,Lundqvist,M.,...Kildegaard,HF(2015).Versatile microscale screening platform for improving recombinant protein productivity in Chinese hamster ovary cells.SciRep,5,18016.doi:10.1038 / srep18016

[0381] Hansen,H.G.,Pristovsek,N.,Kildegaard,H.F.,&Lee,G.M.(2017).1mprovingthe secretory capacity of Chinese hamster ovary cells by ectopic expressionof effector genes:Lessons learned and future directions.Biotechnol Adv,35(1),64-76.doi:10.1016 / j.biotechadv.2016.11.008

[0382] Haredy,A.M.,Nishizawa,A.,Honda,K.,Ohya,T.,Ohtake,H.,&Omasa,T.(2013).lmproved antibody production in Chinese hamster ovary cells by ATF4overexpression.Cytotechnology,65(6),993-1002.doi:10.1007 / s10616-013-9631-x

[0383] Hayes,N.V.,Smales,C.M.,&Klappa,P.(2010).Protein disulfide isomerasedoes not control recombinant lgG4productivity in mammalian celllines.BiotechnolBioeng,105(4),770-779.doi:10.1002 / bit.22587

[0384] Hecklau,C.,Pering,S.,Seibel,R.,Schnellbaecher,A.,Wehsling,M.,Eichhorn,T.,...Zimmer,A.(2016).S-Sulfocysteine simplifies fed-batch processesand increases the CHO specific productivity via anti-oxidant activity.JBiotechnol,218,53-63.doi:10.1016 / j.jbiotec.2015.11.022

[0385] Hu,Q.,Lin,X.,Ding,L.,Zeng,Y.,Pang,D.,Ouyang,N.,...Yao,H.(2018).ARHGAP42promotes cell migration and invasion involving PI3K / Akt signalingpathway in nasopharyngeal carcinoma.Cancer Med,7(8),3862-3874.doi:10.1002 / cam4.1552

[0386] Hudder A,Nathanson L,Deutscher MP.Organization of mammaliancytoplasm.Mol Cell Biol.2003Dec;23(24):9318-26.

[0387] Hwang,S.O.,Chung,J.Y.,&Lee,G.M.(2003).Effect of doxycycline-regulatedERp57expression on specific thrombopoietin productivity of recombinant CHOcells.Biotechnol Prog,19(1),179-184.doi:10.1021 / bp025578m

[0388] Inoue l,ltoh F,Aoyagi S,Tazawa S,Kusama H,Akahane M,Mastunaga T,Hayashi K,Awata T,Komoda T,Katayama S.Fibrate and statin synergisticallyincrease the transcriptional activities of PPARalpha / RXRalpha and decreasethe transactivation of NFkappaB.Biochem Biophys Res Commun.2002Jan 11;290(1):131-9.

[0389] lssemann l,Green S.Activation of a member of the steroid hormonereceptor superfamily by peroxisome proliferators.Nature.1990Oct 18;347(6294):645-50.

[0390] Johari,Y.B.,Estes,S.D.,Alves,C.S.,Sinacore,M.S.,&James,D.C.(2015).Integrated cell and process engineering for improved transient production ofa″difficult-to-express″fusion protein by CHO cells.Biotechnol Bioeng,112(12),2527-2542.doi:10.1002 / bit.25687

[0391] Kaneko,Y.,Sato,R.,&Aoyagi,H.(2010).Changes in the quality ofantibodies produced by Chinese hamster ovary cells during the death phase ofcell culture.J Biosci Bioeng,109(3),281-287.doi:10.1016 / j.jbiosc.2009.09.043

[0392] Kersten S,Desvergne B,Wahli W.Roles of PPARs in health anddisease.Nature.2000May 25;405(6785):421-4.

[0393] Kim,J.Y.,Kim,Y.G.,&Lee,G.M.(2012).CHO cells in biotechnology forproduction of recombinant proteins:current state and furtherpotential.ApplMicrobiol Biotechnol,93(3),917-930.doi:10.1007 / s00253-011-3758-5

[0394] Kober,F.X.,Koelmel,W.,Kuper,J.,Drechsler,J.,Mais,C.,Hermanns,H.M.,&Schindelin,H.(2013).The crystal structure of the protein-disulfide isomerasefamily member ERp27provides insights into its substrate bindingcapabilities.J Biol Chem,288(3),2029-2039.doi:10.1074 / jbc.M112.410522

[0395] Ku,S.C.,Ng,D.T.,Yap,M.G.,&Chao,S.H.(2008).Effects of overexpressionof X-box binding protein 1on recombinant protein production in Chinesehamster ovary and NS0 myeloma cells.BiotechnolBioeng,99(1),155-164.doi:10.1002 / bit.21562

[0396] Knull,H.R.,&Walsh,J.L.(1992).Association of glycolytic enzymes withthe cytoskeleton.Current topics in cellular regulation,33,15-30.

[0397] Lao,M.S.,&Toth,D.(1997).Effects of ammonium and lactate on growth andmetabolism of a recombinant Chinese hamster ovary cell culture.Biotechnologyprogress,13(5),688-691.doi:10.1021 / bp9602360

[0398] Le Fourn,V.,Girod,P.A.,Buceta,M.,Regamey,A.,&Mermod,N.(2014).CHO cellengineering toprevent polypeptide aggregation and improve therapeutic proteinsecretion.Metab Eng,21,91-102.doi:10.1016 / j.ymben.2012.12.003

[0399] Ley,D.,Harraghy,N.,Le Fourn,V.,Bire,S.,Girod,P.A.,Regamey,A.,...Mermod,N.(2013).MAR elements and transposons for improved transgeneintegration and expression.PLoS One,8(4),e62784.doi:10.1371 / journal.pone.0062784

[0400] G.,Reymond,L.,D′Este,E.,Masharina,A., F.,Ta,H.,Johnsson,K.(2014).Fluorogenic probes for live-cell imaging of thecytoskeleton.Nature Methods,11,731.doi:10.1038 / nmeth.2972

[0401] Luo,W.,Janostiak,R.,Tolde,O.,Ryzhova,L.M.,Koudelkova,L.,Dibus,M.,...Rosel,D.(2017).ARHGAP42is activated by Src-mediated tyrosinephosphorylation to promote cell motility.J Cell Sci,130(14),2382-2393.doi:10.1242 / jCs.197434

[0402] Maruyama SY,lto M,lkami Y,Okitsu Y,lto C,Toshimori K,Fujii W,Yogo K.Acritical role of solute carrier 22a14in sperm motility and male fertility inmice.Sci Rep.2016Nov 4;6∶36468.

[0403] Mays,R.W.,Beck,K.A.,&Nelson,W.J.(1994).Organization and function ofthe cytoskeleton in polarized epithelial cells:a component of the proteinsorting machinery.Current Opinion in Cell Biology,6(1),16-24.

[0404] Michalik L,Auwerx J,Berger JP,Chatterjee VK,Glass CK,Gonzalez FJ,Grimaldi PA,Ka-dowaki T,Lazar MA,O′Rahilly S,Palmer CN,Plutzky J,Reddy JK,Spiegelman BM,Staels B,Wahli W.lnternational Union ofPharmacology.LXI.Peroxisome proliferator-activated receptors.PharmacolRev.2006Dec;58(4):726-41.

[0405] Mohan,C.,Park,S.H.,Chung,J.Y.,&Lee,G.M.(2007).Effect of doxycycline-regulated protein disulfide isomerase expression on the specific productivityof recombinant CHO cells:thrombopoietin and antibody.Biotechnol Bioeng,98(3),611-615.doi:10.1002 / bit.21453

[0406] Nishimiya,D.,Mano,T.,Miyadai,K.,Yoshida,H.,&Takahashi,T.(2013).Overexpression of CHOP alone and in combination with chaperones is effectivein improving antibody production in mammalian cells.Appl MicrobiolBiotechnol,97(6),2531-2539.doi:10.1007 / s00253-012-4365-9

[0407] Ohya,T.,Hayashi,T.,Kiyama,E.,Nishii,H.,Miki,H.,Kobayashi,K.,...Ohtake,H.(2008).Improved production of recombinant human antithrombin IIIin Chinese hamster ovary cells by ATF4overexpression.Biotechnol Bioeng,100(2),317-324.doi:10.1002 / bit.21758

[0408] Paavilainen,V.O.,Bertling,E.,Falck,S.,&Lappalainen,P.(2004).Regulation of cytoskeletal dynamics by actin-monomer-binding proteins.Trendsin Cell Biology,14(7),386-394.doi:10.1016 / j.tcb.2004.05.002

[0409] Park,M.H.,Kim,S.Y.,Kim,Y.J.,&Chung,Y.H.(2014).ALS2CR7(CDK15)attenuates TRAIL induced apoptosis by inducing phosphorylation of survivinThr34.Biochem Biophys Res Commun,450(1),129-134.doi:10.1016 / j.bbrc.2014.05.070

[0410] Pourcel,L.,Buron,F.,Garcia,F.,Delaloix,M.S.,Le Fourn,V.,Girod,P.A.,&Mermod,N.(2019).Transient vitamin B5starving improves mammalian cellhomeostasis and protein production.Metabolic Engineering,under review.

[0411] Pybus,L.P.,Dean,G.,West,N.R.,Smith,A.,Daramola,O.,Field,R.,...James,D.C.(2014).Model-directed engineering of″difficult-to-express″monoclonalantibody production by Chinese hamster ovary cells.Biotechnol Bioeng,111(2),372-385.doi:10.1002 / bit.25116

[0412] Rahimpour,A.,Vaziri,B.,Moazzami,R.,Nematollahi,L.,Barkhordari,F.,Kokabee,L.,...Mahboudi,F.(2013).Engineering the cellular protein secretorypathway for enhancement of recombinant tissue plasminogen activatorexpression in Chinese hamster ovary cells:effects of CERT and XBP1s genes.JMicrobiol Biotechnol,23(8),1116-1122.doi:10.4014 / jmb.1302.02035

[0413] Raisanen,S.R.,Lehenkari,P.,Tasanen,M.,Rahkila,P.,Harkonen,P.L.,&Vaananen,H.K.(1999).Carbonic anhydrase III protects cells from hydrogenperoxide-induced apoptosiS.FASEB J,13(3),513-522.doi:10.1096 / fasebj.13.3.513

[0414] Rakhshandehroo M,Knoch B,Müller M,Kersten S.Peroxisome proliferator-activated receptor alpha target genes.PPAR Res.2010;2010:612089.

[0415] Rindler MJ,Xu CF,Gumper I,Cen C,Sonderegger P,Neubert TA.Calsynteninsare secretory granule proteins in anterior pituitary gland and pancreaticislet alpha cells.J Histochem Cytochem.2008Apr;56(4):381-8.

[0416] Rouillard,A.D.,Gundersen,G.W.,Fernandez,N.F.,Wang,Z.,Monteiro,C.D.,McDermott,M.G.,&Ma′ayan,A.(2016).The harmonizome:a collection of processeddatasets gathered toserve and mine knowledge about genes andproteins.Database (Oxford),2016.doi:10.1093 / database / baw100

[0417] Shi,C.,Uda,Y.,Dedic,C.,Azab,E.,Sun,N.,Hussein,A.I.,...Pajevic,P.D.(2018).Carbonic anhydrase III protects osteocytes from oxidativestress.FASEBJ,32(1),440-452.doi:10.1096 / fj.201700485RR

[0418] Silva,R.C.,Sattlegger,E.,&Castilho,B.A.(2016).Perturbations in actindynamics reconfigure protein complexes that modulate GCN2activity and promotean elF2response.Journal of cell science,129(24),4521-4533.doi:10.1242 / jcs.194738

[0419] Stamnes,M.(2002).Regulating the actin cytoskeleton during vesiculartransport.Curr Opin Cell Biol,14(4),428-433.doi:10.1016 / S0955-0674(02)00349-6

[0420] Tannous,A.,Pisoni,G.B.,Hebert,D.N.,&Molinari,M.(2015).N-linked sugar-regulated protein folding and quality control in the ER.Semin Cell Dev Biol,41,79-89.doi:10.1016 / j.semcdb.2014.12.001

[0421] Tastanova,A.,Schulz,A.,Folcher,M.,Tolstrup,A.,Puklowski,A.,Kaufmann,H.,&Fussenegger,M.(2016).Overexpression of YY1 increases the proteinproduction in mammalian cells.J Biotechnol,219,72-85.doi:10.1016 / j.jbiotec.2015.12.005

[0422] Tigges,M.,&Fussenegger,M.(2006).Xbp1-based engineering of secretorycapacity enhances the productivity of Chinese hamster ovary cells.Metab Eng,8(3),264-272.doi:10.1016 / j.ymben.2006.01.006

[0423] Tosco,M.,Faelli,A.,Gastaldi,G.,Paulmichl,M.,&Orsenigo,M.N.(2008).Endogenous lactate transport in Xenopus laevis oocyte:dependence oncytoskeleton and regulation by protein Kinases.Journa / of comparativephysiology.B,Biochemical,systemic,and environmental physiology,178(4),457-463.doi:10.1007 / s00360-007-0238-4

[0424] Vilà-Brau A,De Sousa-Coelho AL,Mayordomo C,Haro D,Marrero PF.HumanHMGCS2reg-ulates mitochondrial fatty acid oxidation and FGF21expression inHepG2 cell line.J Biol Chem.2011Jun 10;286(23):20423-30.

[0425] Wahli W,Michalik L.PPARs at the crossroads of lipid signaling andinflammation.Trends En-docrinol Metab.2012Jul;23(7):351-63.

[0426] Walther,C.G.,Whitfield,R.,&James,D.C.(2016).Importance of Interactionbetween lntegrin and Actin Cytoskeleton in Suspension Adaptation of CHOcells.ApplBiochem Biotechnol,178(7),1286-1302.doi:10.1007 / s12010-015-1945-z

[0427] Wang,L.,Wang,X.,&Wang,C.C.(2015).Protein disulfide-isomerase,afolding catalyst and a redox-regulated chaperone.Free Radic BiolMed,83,305-313.doi:10.1016 / j.freeradbiomed.2015.02.007

[0428] Wurm,F.M.(2004).Production of recombinant protein therapeutics incultivated mammalian cells.Nat Biotechnol,22(11),1393-1398.doi:10.1038 / nbt1026

[0429] Zaret, KS, & Carroll, JS (2011). Pioneer transcription factors: establishing competence for gene expression. Genes Dev, 25(21), 2227-2241. doi: 10.1101 / gad.176826.111

[0430] Zhang X, Li S, Zhou Y, Su W, Ruan X, Wang B, Zheng F, Warner M, Gustafsson Guan Y.Ablation of cytochrome P450omega-hydroxylase 4A14gene attenuateshepatic steatosis and fibrosis.Proc Natl Acad Sci USA.2017Mar 21;114(12):3181-3185. Sequence Listing <110> SLANX LIMITED <120> Expression system, recombinant cell and its use <130> P100530WO <140> <141> <150> 62 / 749,789 <151> 2018-10-24 <160> 155 <170> PatentIn version 3.5 <210> 1 <211> 1515 <212> DNA <213> Black-lined hamster (Cricetulus griseus) <400> 1 atgttaatat gcctcaccag aaacttgggt ggtgtctctg ggttcttcca agtggtcttc 60 gtggtcagtc tatttctggt gcttttcaag gcagtccgat tctacttaag aaggcagtgg 120 ctgctcaaga ccctgcagaa gtttccatcc acgccttccc attggctttg ggggcaccaa 180 ctgaaggaca aggaactcga gcagattctt atctgggtag aggaattccc aagtgcctgc 240 ttacactggc tctcagggag caaggcacga gtcgtgctct atgacgctga ctatgtgaag 300 atgattctgg ggagatcaga tccaaaggct tctggaattt atggactctt tgctccctgg 360 attggttacg gttgcttct gttgaatggg aagaagtggt tccagcaccg gcggatgttg 420 accccagctt tccattatga catcctcaaa ccctatgtca gaatcatggc ggactctgtc 480 aatacaatgc tagacagatg ggagaagctt gatggtgaga actgccctct ggagatcttt 540 cactatatct cttcaatgac actggacact gttatgaagt gtgctttcag tcaccagggc 600 agtgtccaac tggatgaaaa ttccaggtcc tacactaagg ctgttgagga tctgaacagc 660 cttgctttct ttcgaatgag gagtgccttc tatgagaata acaccatcta taaaatgtcc 720 tctgatggcc gttggttcta ccgtgcctgc cagcttgctc atgagcacac agatggagtg 780 atcaagatga ggaaggctca gctgcagaat gaggaagagc tggagagggt caagaagaag 840 aggcgcttgg atttcctgga catcctcttg tttgccaaaa tggaggatgg gagcagcttg 900 tctgatgagg acctgcgtgc agaggtggat acattcatgt ttgaaggtca cgataccaca 960 gccagtggaa tatcctggat tttctatgct ctggccacac accctgaata ccagcagaga 1020 tgcagggaag aggtgcagag catcctggga gatggaacct ctgtcacctg ggatcacctg 1080 gaccagatgc cctacactac catgtgcatc aaggaggccc tgaggctcta cccaccagta 1140 ccaattgtta gtcgagagct caacacacct atcaccttcc cagatggacg ctccttacct 1200 aaaggtatca cagttgcaat ctccatttat ggtcttcacc ataatccaag tttatggcca 1260 aatcctaagg agttgaccc atctagattt gcaccagatt cttctcggca cagctatgct 1320 ttcctgccct tctcaggagg agcaaggaat tgcattggga aacagtttgc tatgaatgag 1380 ctgaaggtgg ccgtggccct gactctgctc cgctttgagc tgttgcctga tcccaccagg 1440 gtcccagtac tcatacaaag acttgttttg aagtccaagg atgggattta tcttcgtctc 1500 aagaagctaa gataa 1515 <210> 2 <211> 1368 <212> DNA <213> Striped hamster (Cricetulus griseus) <400> 2 atggtggcct cgcctctcgc tgtcctgcga acaagcaggt tgtgccaatg gggctggaag 60 agccgggcgc ggttgtcagg gtctctgccc ttcggtcggg gaggatggac cacttgggcc 120 cctgcgcgga caaatgcgac gctgagcctg gagcccgcgg gccgcagctg ttgggacgag 180 ccgctgggta tctccgtgca cggcctggcc cccgagcagc ccgtcacgct gcgcgcggcc 240 ctgcgagacg agaaaggcgc gctcttccgc gcccacgcgc gctaccgcgc cgacgaccac 300 ggcggcctgg acctggcgcg cgcgcccgcg ctgggcggca gcttcgccgg gatcgagccc 360 atggggctgc tctgggctct ggagcccgaa cggccattct ggcgcctgat caagcgcgac 420 gtgcagacgc ccttcgtggt ggagctggag gtgctggacg gccacgagcc cgacggcggg 480 cggctgctgg cgcgcgcggt gcacgagcgt cacttcatgg ctcccggggt gcggcgcgtg 540 cccgtgcgcg agggccgtgt gcgcgccacg ctcttcctgc ctccagaacc tgggccctat 600 cctgggatcc tggacctttt tggagttgga ggtggccttc tggagtaccg agctagtctg 660 ctggctggga agggctttgc tgtcatggct ctggcttatt ataactacga tgacctcccc 720 aagggcatgg acaccatgcg catggagtac tttgaagaag cagtgaacta cctgctcagc 780 caccctgagg tgaagggtcc aggaattgga ctgcttggga tttccaaagg gggtgaactt 840 ggccttgcta tggcctcctt cctgaagggc atcaaagctg ctgttgtgat caatggctct 900 gtggctgctg ttgggaacac catatactac aaggatgaga ctataccccc tgtttctctt 960 ctgagaaatc gagttaaaat gaccaaagat ggcctcttgg atgttgtgga aggtctgcaa 1020 agccctttgg tggaagagaa gagcttcatc cccgtggaaa ggtctgacac ggccttcctg 1080 ttgcttgtag gtcaggatga ccacaactgg aagagcgagt tctatgccaa tgagatctcc 1140 aaacgcttag aggcccatgg gaaggggaag ccccagatca tctgctaccc agaagcaggg 1200 cactatattg agccccctta cttcccactg tacaaggctg gcatgcacct cctggtgggt 1260 gctaatatca cctttggagg ggagcctaag cctcatgctg tggcccaggt ggatgcatgg 1320 cagcagctcc agactttctt acacaaacac ttgggtggta agagttag 1368 <210> 3 <211> 1527 <212> DNA <213> Cricetulus griseus <400> 3 atgcagcggc ttttggctcc agcaaggagg gtcttgcaag tgaaaagagt gatgcaggat 60 gcttggatca cacctgctca cccgctctca gcagcccagc agaggttttt tacaatccct 120 cctgctcccc tggccaaaac agacacttgg ccaaaagatg ttggcatcct tgccctggag 180 gtctactttc cagcccaata tgtggaccaa actgacctgg agaagttcaa caatgtggaa 240 gccgggaagt atacagtggg cttgggccag acccgtatgg gcttctgttc agtccaggag 300 gacatcaact cactgtgtct aacagtggtg cagaggctga tggagcgcac aaagctgcca 360 tgggacgctg tgggccgcct agaagtgggc accgagacca tcattgacaa atccaaggct 420 gtcaagacag tgctcatgga actctttcag gattcaggca acactgacat tgaaggcata 480 gataccacca acgcctgcta cggtggcacc gcctccctct tcaatgctgc caactggatg 540 gaatccagct actgggatgg tcgctatgcc ctggtggtct gtggtgatat tgcagtctac 600 ccagtaggca acgccaggcc cacaggtggc gccggggctg tggcaatgct gattggaccc 660 aaggctcctc tagtcctgga gcaagggctg aggggaaccc acatggagaa cgcatatgac 720 ttctacaaac caaacttgtc ctcggagtat ccactagtgg acgggaagct ctcaatccag 780 tgctacatgc gggccttgga tcggtgctat gcagcctacc gcaagaaaat ccagaatcag 840 tggaagcgag agggaaacaa caagcctttc accctcgatg atgtgcaata catgatcttc 900 cacacaccct tttgcaagat ggtccagaaa tccctggctc gactgatgtt caatgacttc 960 ctgtcgtcca gcagtgacgc acggaatgat ttatacaagg ggctggaggc cttcaggggt 1020 ctaaagctgg aagaaaccta caccaacaaa gatgtagaca aggctatttt gaaggcctcc 1080 ctggacatgt tcaacaagaa aaccaaggct tccctttacc tgtccacgaa caatgggaac 1140 atgtacacct catccctcta tgggtgcctg gcctcacttc tctcccacca ctctgcccaa 1200 gaattggctg gctccaggat tggtgctttc tcgtatggct caggcttagc agcgagtttc 1260 ttttcatttc gagtgtccaa ggatgcctct ccaggttccc ctctggagga gctggtgtct 1320 agtgtgtcag atctgcccaa gcgtctagac tcccggaggc gcatgacccc tgaggaattc 1380 acagaaataa tgaaccaaag agagcagttc taccataagg tgaacttctc accacctggt 1440 gacacaagaa acctcttccc aggtacttgg tatctggaac gagtggatga gatgcatcgc 1500 cgaaagtatg cccggcgtcc cgtctag 1527 <210> 4 <211> 1434 <212> DNA <213> Cricetulus griseus <400> 4 atgtttttct gccagggatt ttgggagagc caattggaac tcagggagag atacgggcct 60 ctgtgtgggt actatcttgg ccgtcggatg tatattgtca tttctgagcc agccatgatc 120 aagcaggtgt tggttgagaa cttcactaac ttttccaaca gaatggcctc aggtctggaa 180 cccaagcctg tagcagacag catcctgttt ttacgagaca aaaggtggga agaagtcaga 240 ggtgccttga tgtctgcatt cagtcctgaa aagttgaatg agatgacgcc tctcatcagc 300 caagcctgtg aacatctcct gagtcactta aagctctatg cagcatccag agacacattc 360 gacatccaga ggtgttactg ctgttacacc acaaatgtgg tggccagtgt ggcctttggc 420 acccaggtgg actcccagaa cactccggaa gatccctttg tgcaacactg ccgtcaattc 480 tttgccttgc gtatccccag gcctctcctg gctttaatct tatcatttcc atccataatg 540 gtcccattgg cccggattct gcccaataag aaccgagatg aactgaatgg cttttttaac 600 aaactcatta ggaacgtgat tgccttacgg gaccagcaag cagcagaaga gaggcggaga 660 gacttcttgc agatggtgct ggatgcccgg cactccacaa gctctgtggg tgtggaagac 720 tttgacatgg tcaaagaagc cctgtcctct agcgagtgtc cagtgaaccc tccccaaaga 780 ggccagcctg catccatgcc tgagccttta accacggatg aaattgtggg ccaggccttc 840 ctcttcctca tcgctggcca agagatcatc actaacacac tctccttcat cacgtacctg 900 ctggccaccc accctgactg ccaggagagg cttctggagg aggtggacct cttcgtggag 960 aaacacccag cccctgggta ctgcagcctg caggaaggcc tgccctatct ggacatggtg 1020 attgcagaga ccctgaggat gtacccacca gctttcagat tcacacggga ggcagcccaa 1080 gactgtgagg tgctgggaca gtacatcccc gcaggtgcag tgctggaggt agccgtgggt 1140 gccctacacc atgacccaga gcactggcca caccctgaga cctttgaccc tgaaaggttc 1200 acagcagagg cccggcttca gcgggggccc ttcacatacc tgcccttcgg agctggcccc 1260 aggagctgcc tcggggtgcg gctggggctg atggtggtca aactgacact actccaggtc 1320 ctacacaaat tccgctttga agccagctct gagactcagg ttccacttca gctagaatcc 1380 aaatctgccc taagtcccaa aaatggagtc tacatcaaga ttgtgtctcg ttga 1434 <210> 5 <211> 1125 <212> DNA <213> Cricetulus griseus <400> 5 atgggcactg ctggaaaagt tatcaagtgc aaagcagctg tactatgggg aatgaaccag 60 cccttctcca ttgaggaaat agaagtggcc ccaccaaaag ctaaggaagt tcgtgttaag 120 gttttggcca caggaatctg tcgcacagat gaccatgtga taaaaggagc aatggtgtct 180 aagtttccag tgattttggg acatgaagca gttggggttg tagagagtgt tggggaagga 240 gtcactacag taagaccagg tgacaaggtc atccccctct ttctaccaca gtgtagagaa 300 tgcaatgcct gctgtaaccc agagggcaat ctctgcatta ggagcgatct gacgggtcgt 360 ggagtactgg ccgatggcac taccagattc atgtgcaagg gcaaaccggt ccagcatttc 420 480 gatggcgcag ctgctcctga gaaagcctgc ctcattggct gtgggttttc cacaggctat 540 ggggctgctg ttaaaaccgc caaggtcacc cctggctcca cttgtgtagt gttcggcctg 600 ggaggtgttg gcctatcggt catcatgggc tgtaaggcag ctggagcctc caggatcatt 660 ggaattgaca tcaacaagga caaattccag aaggccctgg ctgtaggtgc cacagagtgtgt 720 atcaatccca aggacttcac caagcccatc agtgaggtgc tgtcagacat gacagggaac 780 accgtgcagt acacatttga agttattgg cgtcttgaaa ccatggtcga cgccctctcg 840 tcttgtcata tgaactatgg gaccagtgtg gtggttggcg ctcctccatc agccaagacg 900 ctcacttacg acccaatgct gctcttcact gggcggacgt ggaagggatg cgtctttgga 960 ggttggaa gcagagatga cgtaccaaaa ctggtgactg agctcctgga agaaattt 1020 gacctggacc agttgatcac ccacgtcttg ccttttgaaa gcatcaaaga agggtttgaa 1080 ttgctttatt cagggcaaag cattcggact gtcctgacat tttga 1125 <210> 6 <211> 1038 <212> DNA <213> Cricetulus griseus <400> 6 atgccccgca tagatgcgga tcttaaactc gacttcaagg atgttctgct gcgacctaag 60 cggagcagcc tcaaaagccg agccgaggtg gatctcgagc gaacctttac atttcgaaac 120 tcaaagcaga cctactcagg gattcccatc attgtagcca acatggacac tgtggggaca 180 tttgagatgg ctgcggtaat gtcacagcac gccatgttta cagccgttca caagcattac 240 tccttggatg actggaaacg ttttgcggaa aaccaccctg agtgcctgca gcatgtagcc 300 gtgagttcgg gcagtgggca gaatgatctg gagaagatga gccacatctt ggaagccgtg 360 ccacaggtga agttcatctg cctggatgtg gccaatgggt attcggaaca ttttgtggaa 420 ttcgtgaaac tggtccgatc caaatttcct gaacacacca tcatggcagg aaatgtggtg 480 acaggagaga tggtggaaga gctcatcctc tctggagcag atatcatcaa agtgggagtt 540 ggaccaggtt ctgtgtgtac cacccgaacc aagacaggag tgggctaccc gcagctgagt 600 gccgtaatag agtgtgctga ctctgcccat ggcctcaagg ggcacatcat ctctgatgga 660 ggctgtacat gtccaggaga tgtcgccaaa gcctttggag ccggtgcaga cttcgtcatg 720 ctgggaggca tgttctcagg ccacactgag tgtgcagggg aggtgatcga acggaacgga 780 cagaagctga aactcttcta tggcatgagc tcggacacag ccatgaagaa acactcggga 840 ggagtcgccg agtacagggc ctctgagggc aagactgtgg aagtgcctta caaaggggat 900 gtggagaaca caattctgga tatcctggga ggacttcggt ctacctgtac ctacgtaggg 960 gctgccaagc tcaaagagct cagcaggaga gcaacattca tccgggtgac ccaacagcac 1020 aacacagtgt ttggttag 1038 <210> 7 <211> 876 <212> DNA <213> Cricetulus griseus <400> 7 atggacactg tggggacatt tgagatggct gcggtaatgt cacagcacgc catgtttaca 60 gccgttcaca agcattactc cttggatgac tggaaacgtt ttgcggaaaa ccaccctgag 120 tgcctgcagc atgtagccgt gagttcgggc agtgggcaga atgatctgga gaagatgagc 180 cacatcttgg aagccgtgcc acaggtgaag ttcatctgcc tggatgtggc caatgggtat 240 300. tcggaacatt ttgtggaatt cgtgaaactg gtccgatcca aatttcctga acacaccatc atggcaggaa atgtggtgac aggagagatg gtggaagagc tcatcctctc tggagcagat 360 420. atcatcaaag tgggagttgg accaggttct gtgtgtacca cccgaaccaa gacaggagtg ggctacccgc agctgagtgc cgtaatagg tgtgctgact ctgcccatgg cctcaagggg 480 cacatcatct ctgatggagg ctgtacatgt ccaggagatg tcgccaaagc ctttggagcc 540 ggtgcagact tcgtcatgct gggaggcatg ttctcaggcc acactgagtg tgcaggggag 600 gtgatcgaac ggaacggaca gaagctgaa ctcttctatg gcatgagctc ggacacagcc atgaagaaac actcgggagg agtcgccgag tacagggcct ctgagggcaa gactgtggaa gtgccttaca aaggggatgt ggagaacaca attctggata tcctgggagg acttcggtct acctgtacct acgtaggggc tgccaagctc aaagagctca gcaggagagc aacattcatc 840 cgggtgaccc aacagcacaa cacagtgttt ggttag <210> 8 <211> 1587 <212> DNA <213> Cricetulus griseus <400> 8 atgtccatgt cagaacaagg caagaatgtt cagcccagtg gcggggaggt gaggctggaa 60 ctgaggccaa cagcccagtg gaaccagggc tgcagcaacg cagccttcca ggccttgggg 120 catcagaggg caatgcgagt cttcaatggg ggttggcggc acctggtgat gcggtctcca 180 tctggacgaa gttgggatga agaccttgaa gagcaggact caccaggaaa cagcacagtc 240 aggagcagag ttttacagag cggggaacaa ggaaatgcca aacagggtga caggcagatc 300 acgattgagg aggagtcgtc tccaggaaac aaagaagacg tggagggtga tgaccaggat 360 gaccatcaaa aagggtgttt ggaaagaaag tatgatatga tttgtgagtt ttgtagaaag 420 cacaggatca ttctccgacg catcatcgga ggcattttat tgactggttt cctggctctg 480 gtgattgcag cctgtgtact aaacttccac agagcccttc ctctatttgt gatcaccgtg 540 gttaccatct tctttgttat ctgggatcac ttgatggcca aatatgagca tcgaatcgat 600 gagttcctat ctccatgcag aaggcttctc aacaggcatt ggttctggct gaaatgggtg 660 atgtggagct cactggtcct ggtggttatt ttctggttga tccttgacac cgccaggctg 720 ggcaagcagc agctggtgtc ctttggagga ctcatactgt acatcgtact gttgtttctc 780 ttttccaaac atccaaccag agtttactgg aggcctgtct tttggggaat tggattacag 840 tttcttcttg ggctcttaat tctgaggact aatcctggat ttattgcttt tgattggctg 900 ggaagacaag ttcagacttt tctggagtac actgatactg gagctatgtt tgtcttcggt 960 gagaagtaca cagaccactt cttcgcattt aagatcctgc cgatcgtggt tttcttcagc 1020 actgtgatgt ccgtgctcta ctacgtggga ctgatgcaat gggtgatccg aaaggttgga 1080 tggttaatgc ttgtcactat ggggtcatct cccattgagt ctgtagttgc tgctggcaac 1140 atatttgttg ggcaaacaga gtctccacta ctggtccaac catatttacc acatgtcacc 1200 aggtcagaac tccatgccat tatgacagct ggctttgcca caattgctgg aagcgtattg 1260 ggtgcctata tctcctttgg ggtgtcatcc acacacttgc taactgcctc agtcatgtca 1320 gcaccggcat ccctggctgt ggccaaactc ttttggcctg aaacagaaaa acccaaaatc 1380 accctcaaga atgccatgaa gattgagagt ggtgattcaa gaaatctcct ggaggcagca 1440 acacagggtg catcctcgtc catccccctg gtagcaaaca ttgcggtgaa tctgatcgcc 1500 ttcctggcct tattgtcttt tgtgaactca gccctgtcct ggttcggaaa catgcttgac 1560 tacccacagt tgagttttga ggtatga 1587 <210> 9 <211> 684 <212> DNA <213> Cricetulus griseus <400> 9 atggcttctt ttcacattcg ccagttccag gagagagact atgagcaggt cgtggatgtg 60 ttctccaggg gcctggagga gcacatcccc aatgccttcc gccacttgct gctgctgccc 120 cggaccctcc tgctcttagt tgtggtgcct cttgccgtag tcctggtgtc tggatcctgg 180 ctcctggctg ttgtatgtaa cttcttcctg cttggattct tgcggttcct tgctagttat 240 ccctggaaga attatgtgtc tacatgtttg cacactgaca tggctgacat caccaagtcc 300 tacctgagtg tgtgtggctc aggtttctgg gtggcagagg ctggaggaca agtggtgggc 360 ctagtggggg gtctgccagt caagaatcct ccattaggga ggaagcagct acagctcttt 420 cgcctgtctg tgtcctcaca gcatcgagga caggggatag cgaaagcact ggtcagaact 480 gtcctccagt ttgcacggga ccagggctac agcgatgttg tccttgagac cagccttttg 540 cagcaaggtg ctgtaaccct ctattacagc atgggcttcc agaagacagg agaatccttc 600 atgaacagac tcacatggct tgtggatctc tctctaattc atttcatata ctcactcccc 660 tctgctcagg aacatgagct gtga 684 <210> 10 <211> 1284 <212> DNA <213> Cricetulus griseus <400> 10 atggcagaag ctgtcttggt tgatctcttt ggtttaaaat tgaactccca gaaaatctgc 60 catcagacat tacttaagac attgaatggc attcacggcc accatgcccc caaggccaag 120 ttcctttgca taatgtgttg cagtaatgaa agggatggtg aacatgatct ttgtgactgg 180 gaaacaggaa atggattttc acttttcatg agagactttg agactgttag caatcccagt 240 atggctgcca ctttgtatgc aattaaacaa aaaattgatg aaaaaaatct gagccacatt 300 aaggtgattg tccctgagca caggaaaacg tttgtgaagg cttttattga tcagctcttc 360 actggggtt atgatttga gtttgaagat ttgcaggtag cttggaggga gagcctgttg 420 aaaccagcca ctgaaataaa cgaacccaca actcatcaac tagaagaaat ccagaatgaa 480 atagaaacat acttgagaag cctacccgct ctgaaagggg ccttaactat tatcagatct 540 cctttgatcc cagatctctt catacatgga tttactacac gaacaggtgg catatcttac 600 ataccaactc ttagctcact caatcttttc agtagttcca aacggagaga tcccaaagta 660 gttgtccaag aaaatcttcg aaggttggca aacgctgcag gattcaatgc agagaaattt 720 taccgaataa agactgatca cgccaatgac gtgtgggtga tggggaagaa ggagcctgaa 780 tcttacgatg gaatagtcac aaaccagaga ggagtcacca tcacagctct cggtgctgac 840 tgtataccta tagtctttgc agatcccgtg aaaacagcat gtggggttgc ccactctggc 900 tggaaaggta ctttgttggg tgtagctatg gctactgtga atgctatgat agcagaatat 960 ggctgtaatt tggaagacat cattgttgtt ctgggacctt ccgtggggcc ttgctgtttt 1020 accttccca gagaatcggc aacctcattt cataatcttc atccttcatg tgtgcggcag 1080 ttggactcac tgaatcccta tgttgacatc cggaaagcca ctaggattct tctagaacga 1140 ggaggaattc ttccacagaa tattcaagac cagaagggag atcttgacct ctgcacatcc 1200 tgccatcctg ataagttttt ctcccatgtt cgagatggcc ttaacttcgg tacacagatt 1260 ggcttcatat ccattagaga atga 1284 <210> 11 <211> 1827 <212> DNA <213> Cricetulus griseus <400> 11 atggaagatc accattccag gccagcattc ggataccaga atgccaggac cgcaaaccgg 60 aatgaggtct ccttcccctc ccattcctgg tccttggaga tgttgctacg cagactgaag 120 gccatcgatg ccaagaggga agacaagctg gccagtgttc tgagcgccgt gggggagttt 180 ggcgccttcc agtggaggct ggtggtcctc acgttcatcc ccagcatgct gtcatcctac 240 ttcttgctct ctgatcactt catgctcaca gcccagaggc cttactgtaa caccagctgg 300 atcctggcag tgggccccaa tctctccttg gatgaacagc tgaacttgac tctgccccga 360 gcacccaatg gcagcttcct gacatgcctc atgtacatac ctgtgccgtg ggatctagat 420 tccatcatcc attttggtct caattataca gaaacttgca aatttgggtg gatctaccct 480 tatgctaaga cacgctctct gatcaacgag tttgacctgg tgtgtggcaa tgaaccaaac 540 atggagaaca tgcagaccgt gttcctcgcg ggcatcttga cggggtctct cctctttggg 600 ttcttaagcg acaagatggg ccgctatcca accatcctgg tgtcactgct ggggctcctc 660 gtctttggct ttggggctgc ctttgtgaaa agcttttacc agtacctgtt cttccgcttt 720 ggtatggccc aggtagccgt gggctatgcc atcagcagtc actgcttcat ttctgtgggc 780 atcatgctcc tgtcggggtg cgcctacaaa atcttccact ggcggctgct gttcctgatg 840 ggcggtgtgc ccatgttacc tctcatctcc aacatctggg tcctccgaga atccccacgg 900 tggctgatgg tgaaagggaa ggtgcaagag gccaggaagg tgctgtgcta tgcagcagag 960 gtgaacaaga agaccatacc tttcaatcta ctcaatgagc tgcagctgca gggaaagaag 1020 gttaataaag cctccatcct ggacttctac accaatcagc accttttcaa ggtggtctta 1080 tccatggcct gcgtgtggta taccgtcagt tacatctatt taacactgag cctcaagatg 1140 1200 gcccggctga gttgcgttgt tctcctggag tactttggaa ggaagtgtag tctctacctg 1260 agcctcaccc tagctaccgt cttctgtttg tttctccttt tcctccctca agagctgagg 1320 tcaaataa tcttgatgat tgtgctcgga gagtttagcc tggctgccac tgtgactgtg 1380 ttcttcatct acaccgctga gctccttcc accgtcctca ggtctacagg tctgggcatg 1440 gtgtctctcg cctgggcggc tggagccatc acagctctag cagtcttcaa ccaggtcaaa 1500 acacaactgc ccatcttctt ctgctgcctg tcttgcgttg tggccttgtg ctttgcctcc 1560 1620 caaaaagatt ctactgaatc caagaggaaa aaccaggaca ttgcttcaat ggtaatagat 1680 gaggatcaa tgtctgatgt tgtgaatgat gaagtgacaa aaaataccat tctcaatgcc 1740 ctgcctctaa aatcagaagc aggcaggttc ttcaacacag ccttggagaa actcaccaac 1800 1827 <210> 12 <211> 2283 <212> DNA <213> Striped hamster (Cricetulus griseus) <400> 12 ggtgtcgtga ggattagctt ggtactaata cgactcacaa gcttgccgcc accatgaggg 60 ctggatgagg gctggactgg agacagcaga cattgccata gtggccctgt attttatcct 120 ggtcatgtgc attggttttt ttgccatgtg gaaatctaat agaagcacag tgagtggata 180 cttcctggct gggcgctcta tgacctgggt ggcaattggt gcctctctgt ttgtgagcaa 240 tattgggagt gaacacttca ttgggctggc aggatctgga gcagcaagtg gatttgcagt 300 gggcgcatgg gaattcaatg ccttactgct cttgcaactt ctgggatggg ttttcatccc 360 tatttacatc cggtcagggg tatacactat gcctgaatac ttgtccaaga gattcggtgg 420 ccataggatt caggtctatt ttgcggcctt gtctctgctc ctctatatct tcaccaagct 480 ctcagtggat ctgtattcag gtgccctctt tatccaggag tccttgggtt ggaacctcta 540 tgtgtctgtc atcctgctca ttggcatgac cgccctgctg actgtcaccg gaggccttgt 600 tgcagtgatc tacacagaca cgctacaggc tctgctcatg attatcgggg cactcacact 660 tatggtcatt agcatgatgg aggttggagg gtttgaggaa gtaaaaga ggtacatgtt 720 ggcctcaccc aatgttgctt ccattttgtt gacacaac ctttccaaca caaattcatg 780 840 tccatggcct ggattcattc ttgggcagac cccagcctct gtatggtact ggtgtgctga 900 ccaagtcatc gtgcagaggg ttctagcagc caaaaacatt gctcatgcca aaggctctac 960 tctaatggct ggcttcttga agctcctacc gatgtttatc atagttgtac cagggatgat 1020 ttccaggata ctgtttgttg atgacatagc ttgtatcaac ccagagcact gcatgcaagt 1080 gtgtgggagc agagctgggt gctccaatat cgcctatcca cgcctggtga tgaagttggt 1140 ccctgtgggc ctccggggct tgatgatggc cgtgatgatt gcagctctga tgagtgacct 1200 ggactccatc tttaacagtg ccagtaccat attcaccctt gatgtgtaca aacttatccg 1260 caagagtgca agctcccggg aactaatgat agtgggcagg atatttgtgg ctttcatggt 1320 tgtcgtcagc atagcctggg tgccgattat tgtagagatg caaggaggcc agatgtacct 1380 gtatatccag gaggtggcag actatctgac ccctcccgtg gcagccctct tcctgctggc 1440 aatttctgg aaacgctgca atgagcaagg agctttctat ggtggaatgg caggctttgt 1500 tcttggagcc gtccgtttga tactggcttt tacctaccgt gctcctgagt gtgaccaacc 1560 tgataacagg ccaggcttca tcaaagacat ccattatatg tacgtggcca cagcactgtt 1620 ctggatcaca ggactcatca ctgtgatcgt tagtcttctc acaccgcctc ccacaaagga 1680 ccagattcgc accaccacat tttggtcgaa gaagactctg gtaacaaagg agagctgctc 1740 tcagaaagac gagccataca gaatgcaaga gaagagcatt ctgaggtgca gtgacaatag 1800 tgaggttgtc aaccatgtca ttcccaacgg gaaatcggaa gacagcatta agggactgca 1860 gcctgaagac gtcaatctgt tggtggcatg cagagaagag ggcaacccgg tcgcttccct 1920 gggccactca gaggcagaaa caccagtaga cgcctattcc aatgggcagg cagctctcat 1980 gggtgagaaa gagagagaga aggaaacaga aaacaggagc aggtattggg agttcgtgga 2040 ctggttctgt ggctttaaaa gtaaaagcct tagcaagagg agtctcagag acttgatgga 2100 cgaggaggcc gtttgttcac agatgttaga agagtctcca caagtaaaag tggtgttaaa 2160 cattggactt tttgctgtgt gttcacttgg aattttcatg tttgtttatt tctccttatg 2220 atctagagtc ggggcggccg gccgctcgct gatcagcctc gactgtncct tctagtgcca 2280 gcc 2283 <210> 13 <211> 1686 <212> DNA <213> Cricetulus griseus <400> 13 atgtcctcgg aggtgatcag ggcgaccgca gggatggtac tagcagagct gtatgtctct 60 gatcgagaag gaaatgatgc aacaggagat ggaactaagg agaaaccatt taaaacaggc 120 ctaaaggctt tgatgacagt tggaaaagag ccatttccca ccatttatgt ggattcacaa 180 aaggaaaatg agaggtggga tgtcatttct aagtcccaga tgaagaacat taaaaagatg 240 tggcacagag agcagatgaa gaatgattct cgggagaaga aagaggcaga agataactta 300 cggagagaaa agaacctgga ggaagcaaag aaaattatca ttaaaaacga cccaagcctc 360 ccagagccag catgtgtaaa gatttgtgca ttagaaggat atagaggtca aagagtgaag 420 gtgtttggct gggtccacag gttactcagg gagggaaaga atttgatgtt tctggtgttg 480 cgagatggta caggctatct tcagtgtgtc ttgtcagatg acttgtgtca gtgttacaat 540 ggagtagtct tgtccaccga gagcagtgtg gcagtatatg gaacactaaa cctaactcca 600 aaaggcaaac aggctccggg aggccatgag ctgagctgtg acttctggga gctggtgggg 660 ctggccccag ctgggggggc tgataacctg atcaatgagg agtctgacgt agacgtccag 720 ctcaacaacc ggcacatgat gatccgagga gagaacatgt ccaaaatctt gaaagcacgc 780 tccatgatca ccaggtgctt cagggatcac ttcttcgaca gaggctactg tgaagttact 840 actccaacac tggtgcagac gcaggtggaa ggtggggcca cactcttcaa gcttgactat 900 tttggagaag aagcgttttt aacccagtcc tcgcagctgt acctggagac ctgccttccg 960 gccctggggg atgttttctg tattgcccag tcatacaggg ctgaacagtc cagaacacga 1020 aggcacctgg ctgaattcac tcatgtggaa actgagtctg agtgtccctt cctgaccttt 1080 gaggacctcc tgaaccgttt agaggaccta gtgtgtgatg tggtggacag agtcttgaag 1140 tcaccagtgg caagcatagt gtatgacctc aacccgaact ttaaaccccc taaacggcct 1200 ttcaggcgga tgaactattc agatgctatc gagtggctga gggagcacga tgtaaagaaa 1260 gaagacggga cactctatga atttggagat gatattcccg aagctcctga aagactgatg 1320 acagacacca ttaatgaacc aatcctgctg tgtcggtttc ctgtggagat caagtccttc 1380 tatatgcagc gatgtcctga ggatcctcga cttactgaat ctgttgacgt gttgatgccc 1440 aatgttggtg agattgtggg tggctctatg cgctcttggg atagtgaaga aattctagaa 1500 ggctataaaa gggaaggaat tgaccctgct ccttattatt ggtatacaga tcagagaaaa 1560 tatggtacat gtcctcatgg aggctatggc ttgggcttgg aaagattcct aagttggatt 1620 ctgaacaggt atcatatccg agatgtgtgc ttgtaccctc gattcgtcca gcgctgcagg 1680 ccataa 1686 <210> 14 <211> 873 <212> DNA <213> Cricetulus griseus <400> 14 atgagcttcg tggcctacga ggagctgatc aaggaaggcg atacagccat cctgtcgctg 60 ggccatggct cgatgatggc agtgcgtgtg cagcgtgggg cacagaccca gacccggcat 120 ggcgtcctgc ggcactcggt ggacctcatt ggccgcccat ttggctccaa ggtgatctgc 180 agcagaggcg gctgggtgta cgtgcttcac cccactcctg agctctggac tgtgaacctg 240 ccccaccgca cacagatcct ctactccacc gacattgcct taatcaccat gatgctggag 300 ctgcgacccg gttctgtggt ctgtgagtca ggcacgggca gtggttctgt ctcccacgcc 360 atcatccgca gcatcgcccc cactggccac ctacacactg tggagttcca ccaacagcgg 420 gcagacaagg cccgggagga gttccaggag catcgtgtga gccagtgggt gacggtgcac 480 acccaggatg tttgccgcag tggcttcggt gtcacccacg tggctgatgc tgtcttcttg 540 gatattccat caccctggga aactgtgggc catgcctggg atgccctcaa ggttgaaggt 600 gggcgcttct gttccttctc tccatgcatt gagcaagtgc agcgcacatg ccaggcactg 660 gcagcccatg gtttcacaga gctcagtacc ctggaggtgc tgccacaggt ctacaatgta 720 cgcaccgtca gtctgccctt gcctgacctg ggggcaagtg acttagaggt cagcatgggc 780 tctgatgcca gccctttccg tagtggcaca cccatgaagg agactgtggg ccacactggc 840 tacctgactt ttgccacgaa gactccagga tag 873 <210> 15 <211> 1134 <212> DNA <213> Cricetulus griseus <400> 15 atgtgtgacg acgaggagac cactgctttg gtttgcgaca atggctctgg gctggtgaag 60 gccggcttcg cgggtgatga tgcccccaga gctgttttcc cttccatcgt gggtcgccca 120 cgccaccagg gtgtcatggt gggtatgggg cagaaggact cctatgtagg tgatgaagcc 180 cagagcaagc gaggtatcct gactctgaag taccccattg agcatggcat catcaccaac 240 tgggacgata tggagaagat ctggcaccat acattctaca atgagctccg tgtggcccct 300 gaggagcacc cgaccctgct cactgaagcc ccactgaacc ccaaggccaa ccgtgagaag 360 atgacccaga tcatgtttga gaccttcaat gtccctgcca tgtatgtggc catccaagca 420 gtgctgtctc tttatgcttc tggaagaacc acaggcattg ttctggactc tggtgatggt 480 gtaactcaca atgtccccat ctatgagggt tatgccttac cccatgccat catgcgtctg 540 gatctagctg gtcgggatct cactgactac ctcatgaaga tcctcactga gcgcgggtac 600 tcctttgtca ccactgctga acgtgaaatc gtgcgtgaca ttaaggaaaa actgtgttac 660 gttgccctgg actttgagaa tgagatggct acagctgcct cttcctcctc tctggagaag 720 agctatgaac tgcctgatgg ccaggtcatc accattggca acgagcgttt ccgctgtcca 780 gagacactct tccagccttc tttcattggt atggaatctg ctggcatcca tgaaactact 840 tacaatagca tcatgaagtg tgacatcgat atccgcaagg acctatatgc caacaatgtc 900 ctatctggag gcaccactat gtaccctggt attgctgatc gtatgcaaaa ggaaatcact 960 gcactggctc ccagcaccat gaagattaag attattgctc cccctgagcg taaatactct 1020 gtgtggattg ggggctctat tctggcctct ctgtccacct tccaacaaat gtggatcagc 1080 aagcaagagt atgacgaggc aggcccatcc attgtccatc gcaagtgctt ctaa 1134 <210> 16 <211> 930 <212> DNA <213> Chinese striped hamster (Cricetulus griseus) <400> 16 atggagacgc tgctgaagcg tgagctgggc tgcagctcgg tcaaagctac gggccactcg 60 ggaggcgggt gcattagcca gggccagagt tacgacacgg acaaaggacg agtgtttgtg 120 aaagtgaact ccaaggcaga ggcaagaaga atgtttgaag gtgagatggc aagtttaatg 180 gccattatga agacagacac agtgaaagta cccaagccca tcaaggttct ggatgcccca 240 ggaggtggga gcgtgctagt gatggagcat ttggacatgc ggtatctgag cagtcatgcc 300 gccaagcttg ggtcccagct tgcagatcta cacctcgaga acaagaagct tggagaaggg 360 ctactcaagg aggctggcac cgtggggaaa ggaagtggac aggcagagcg gctctttgtg 420 gaccagtttg gatttgatgt ggtgacatgt tgtggatacc ttccccaggt aaatgactgg 480 cagaatgatt gggtcacatt ctatgccagg cagcgcattc agccccagat ggatatggta 540 gagaagaggt ctggagaccg ggaagctctt gagctgtggt ctgctctgca gttgaagatt 600 cctgacctat tccatgatct ggaaattgtg ccctctttac ttcacggaga cctctgggga 660 gggaacgtag cagaagattc ctctgggccc atcatttttg atccagcttc cttctacggc 720 cactcagaat atgagctggc aatagccggc atgtttgggg gcttcagtag ctccttttac 780 tctgcctatc atagtaaaat ccctaaaacc ccaggatttg agaaacgctt gcagttgtat 840 cagctctttc actatctgaa ccactggaat cattttggat ctgggtacag agggtcctct 900 ctaaacataa tgcggaatct cagcaaatga 930 <210> 17 <211> 1941 <212> DNA <213> Cricetulus griseus <400> 17 atgaggaagc tctctccttc atctgacttc tctggatcat tagaaccaga gctcaaagtg 60 tcactgtttg atcaaccctt gtcaatcatc tgtggagaga atgacacact ccccaaaccc 120 atccaggaca tcctcgccat cctctgcctt aaaggcccct caactgaagg gatattcagg 180 aaagctgcca gtgagaaagc ccgcaaggag ctgaaggagg aacttaactg tgggagcccc 240 gtgaacctga accagctccc agtacacctc ctggctgtgg tcttcaagga cttcctccga 300 ggaatccccc tgaagctgct gtcctgtgac ctctttgagg agtggatgga cgccctggag 360 aagccaagtg aggaggacag aatcgaggcc ctaaagcagg ttgcagactg cctcccccgg 420 cccaaccttc tactgctcag gcacttggtc tatgtgctgc acctgatcag caagaatgcc 480 gaggtcaaca agatggactc tagcaaccta gccatctgca tcgggcccaa cgtgctcact 540 ctgaagaatg accagagcct gtcattccag gtccagaagg acctgaacag taaggttaag 600 acattggtgg aattcctcat tgacaactgc tttgaaatat ttggggagaa cattcccaca 660 cattcccgta tcacttctga cgactccctg gaacacactg acagttcaga tgtgtcaact 720 ctgcagaatg actcagctta tgacagcaat gacccggatg tggagcccac aagcgccatc 780 acttctccca gcaggcagct ggaggggccc actgccacag tgactggccc agataaccgg 840 gcttcacagg acacctgtga gtcaaattca gaacctgctg atagcatggt agccaggttg 900 aaaagctcca ttggccagcc agacagacgg ttctctgaac ccaacatgtc accctcgcaa 960 gagtgcctca tggaccaaat gacgaaacaa aagctaacca agagcgagga taacttcacc 1020 atgccccagg aagtctcttg ttttgagggt cctgaggctg aagatccatt tacagaggaa 1080 gtcttcccag cagttgaagg caagcccaag agaccagtgg atttaaagat aaagaacttg 1140 acccacggtt tagcatcacc acagggatgg gtacccaaaa ctttgtccag agtctcctca 1200 ggtaaatctt tggacagctc acccatacct tctccttcct ttcccaaaag aagcttcttc 1260 actaggcacc agagtttcac cacaaagaca gacaagatca aaccacaaag agaaattaga 1320 aagcactcca tgtcgttttc cttcacctct cacaaaaaag tgctgccccg gacctccagc 1380 actgggtctg agaaatccaa agacttttct agagaccaaa tcaagaaggg tttgaggaaa 1440 gacagccagc ttgctggcag aatcatccag gaaaatgagt cagaaatcca aaacttcagc 1500 ttgtctagaa cctgggccct ctcggttgac aatgtgttcc agctaattga tgtgaggaag 1560 ccaggaagcc caccatccta cgaagaggcc attcattacc aggcatctgg attcacagcc 1620 tacagtggcc agacggtcag cagtatgaga gcaagaatgc tcaaatggaa cacggctctg 1680 cctcctctgc cttctcgcct tggaggtgac cacagtgaag ggacacccgg tggacacaga 1740 ctgtctcccc tgactgagtg ctggaaacag agtcagactg tcagtgtctc tgtggaaact 1800 caggggagat ctgagcagca cggattgagg atggtgtctg aaacgatgca gaaggctaag 1860 ttagactgtc tcaggcgaca acacagccac atggtctttg aggtcgacca actacagggt 1920 gctaaagaat cctacattta g 1941 <210> 18 <211> 186 <212> DNA <213> Cricetulus griseus <400> 18 atggacccca actgctcctg ctccaccggc agcacctgca cctgctccag ttcctgtggc 60 tgcaaagact gcaagtgcac ctcctgcaag aagagctgct gctcctgctg cccagtgggc 120 tgctccaagt gtgcccaggg ctgcgtctgc aaaggggcat cggacaagtg cacgtgctgt 180 gcctaa 186 <210> 19 <211> 1407 <212> DNA <213> Mus musculus <400> 19 atggtggaca cagagagccc catctgtcct ctctccccac tggaggcaga tgacctggaa 60 agtcccttat ctgaagaatt cttacaagaa atgggaaaca ttcaagagat ttctcagtcc 120 atcggtgagg agagctctgg aagctttggt tttgcagact accagtactt aggaagctgt 180 ccgggctccg agggctctgt catcacagac accctctctc cagcttccag cccttcctca 240 gtcagctgcc ccgtgatccc cgccagcacg gacgagtccc ccggcagtgc cctgaacatc 300 gagtgtcgaa tatgtgggaa caaggcctca gggtaccact acggagttca cgcatgtgaa 360 ggctgtaagg gcttctttcg gcgaactatt cggctgaagc tggtgtacga caagtgtgat 420 cggagctgca agattcagaa gaagaccgg aacaaatgcc agtactgccg ttttcacaag 480 tgcctgtctg tcgggatgtc acacaatgca attcgctttg gaagaatgcc aagatctgaa 540 aaagcaaaac tgaaagcaga aattcttacc tgtgaacacg acctgaaaga ttcggaaact 600 gcagacctca aatctctggg caagagaatc cacgaagcct acctgaagaa cttcaacatg 660 aacaaggtca aggcccgggt catactcgcg ggaaagacca gcaacaaccc gcctttgtc 720 atacatgaca tggagacctt gtgtatggcc gagaagacgc ttgtggccaa gatggtggcc 780 aacggcgtcg aagaaaga ggcagaggtc cgattcttcc actgctgcca gtgcatgtcc 840 gtggagaccg tcacggagct cacagaattt gccaaggcta tcccaggctt tgcaaacttg 900 gacttgaacg accaagtcac cttgctaaag tacggtgtgt atgaagccat cttcacgatg 960 ctgtcctcct tgatgaacaa agacgggatg ctgatcgcgt acggcaatgg ctttatcaca 1020 cgcgagttcc ttaagaacct gaggaagccg ttctgtgaca tcatggaacc caagtttgac 1080 ttcgctatga agttcaatgc cttagaactg gatgacagtg acatttccct gtttgtggct 1140 gctataattt gctgtggaga tcggcctggc cttctaaaca taggctacat tgagaagttg 1200 caggagggga ttgtgcacgt gcttaagctc cacctgcaga gcaaccatcc agatgacacc 1260 ttcctcttcc caaagctcct tcaaaaaatg gtggaccttc ggcagctggt cacggagcat 1320 gcgcagctcg tacaggtcat caagaagacc gagtccgacg cagcgctgca cccactgttg 1380 caagagatct acagagacat gtactga 1407 <210> 20 <211> 1308 <212> DNA <213> Cricetulus griseus <400> 20 atggctccct ttggaagaaa tttgttgaag acgcgacata agaacagatc tccaactaaa 60 gacatggatt ctgaggagaa ggaaattgtg gtttgggttt gccaggagga aaagattgtc 120 tgtggattaa ctaaacgcac cacctccacc gatgtcatcc aggctttgct ggaggaacat 180 gaggctacat ttggagagaa gagattcta ctgggcaagg ccagtgacta ctgcatcgta 240 gagaagtgga ggggctcaga gcgggccct cctccactga cgaggatcct gaagctatgg 300 aaggcttggg gagatgagca agccaacatg cagtttgttt tggttaaaac agatgcctttt 360 ctcccagttc cactgtggag gacagcggaa accaaactag tgcaaatag tgaaaagcct 420 tgggagctca gtccggcgaa ctacatgaaa actttgccac cagataaaca aaaacgaatc 480 gtcaggaaaa ccttccgaaa actggctaaa attaagcagg acatgttttc tcatgatcgg 540 gacagtatgg agactttggt tcatctaatt atttctcagg accacactat tcaccagcaa 600 gtacaaagaa tgaaagagtt agatatggaa attgagaaat gtgaggctaa gatccacttg 660 gaccgggtag ggaatgatgg ggacaattac gttcaggagg catatttaat gcccagggtt 720 agtgaaaagg agcaaatgct agactttcaa cctgaggaca gccaggctct ggtggacgtg 780 cacgatggtg aggggatggc acagctagaa gaacggctgc agtactaccg agtgctcatc 840 gaaaagctct cggctgaaat tgagagagag ttgaagagct tgggcatcga cggaagtgaa 900 gattcagagg gggcagctgc ctgtgaactc gaaaactctg atttagaaaa tgtgaagtgc 960 gatttggaga agagtatgaa agctggtttg aaaatctact ctcacttgag tggcatccag 1020 aaagagatta aatacagtga ctcattgctt cagatgaaag caagagaata cgaactcctg 1080 gccaaggagt tcagttcgtt tcaccttagc aacaaagatg gatgccaatt aaaagaaaac 1140 aaaggaaagg aacacgaggc tgccagcggc agtgcggaga tccctccatt aactcaaagg 1200 gcattcaaca catacacaaa tgacacagat tcggacactg gcattagctc caaccacagc 1260 caggactctg agacaactct gggagatgtg ctgctgttgt caacgtaa 1308 <210> 21 <211> 825 <212> DNA <213> Cricetulus griseus <400> 21 atggaaatct ccaggtccgc atgcctagtc ctttcattta tcctcatgtg tgggctggtc 60 ccagaagtca tggcagatgc tgaagaaacc tcaggcggtc tcggcactac ccaggaaccc 120 atatggctcc cagacatccc agctacggag gaattcatca gtgctgctga agtggccatc 180 ataggtttct tccaggattt agaaataccg atagtgccca tattccgcag cacggctcaa 240 cagttccgag acataccatt cggaatcagc aacagttctg cggttctgag ccactacaac 300 gtcaccagaa acagcatctg cctcttccga ctggttgaca atgaacaact gcacttggat 360 gctgaagaca ttgaaaactt agatgcctcc aagttgagcc gtttcattca gatgcacagc 420 ctccgctggg tgacagagta cagccctctg attgcagctg gcttatttaa caccatggtt 480 cagactcacc ttctcctgat aatgaacaag acttccccgg agtatgaaaa gagcctgcag 540 caataccggg aggcagctaa gctcttccag ggacagatcc tctttgttct ggtggacagc 600 ggcaaggggg ggaaccgaaa ggtgatatcc tatttccaac taaaggagtc tcagctgccg 660 gctctggcca tttatgaaag tgtgaatgac aagtgggaca cactgcccat cacagaagtc 720 acagtggaga aagtccaagg cttctgtgat ggcttcctaa aggggacact gctgagagat 780 cacgatgtgg aaggagatgc agaggcgcgg aaggaggagc tctga 825 <210> 22 <211> 1518 <212> DNA <213> Cricetulus griseus <400> 22 atgcgcttca gctgcctagc gctgctcccg ggcgtggcgc tgctgctcgc ctcggcccgc 60 ctcgccgccg cctctgacgt gctgggaactc acggacgaaa acttcgagag tcgcgtctcc 120 gacacgggct ctgcgggcct catgctagtc gagttcttcg ccccttggtg tggacattgc 180 aagaggcttg cccctgagta tgaagctgca gcaactagat tgaaaggaat agtcccatta 240 gcaaaggttg attgcactgc caacacaaac acctgtaata agtatggagt cagtggctac 300 ccaaccctta aaatatttag agatggtgaa gaagcaggtg cttatgatgg gcctaggact 360 gccgatggaa ttgtcagcca cttgaagaaa caagcaggac cagcttcggt tcctctcagg 420 tctgaggaag aatttaagaa gttcattagt gataaagatg cttcggtggt gggctttttc 480 agggattat tcagtgacgg tcactctgaa ttcctaaaag cagccagcaa cttgagagat 540 aactacagat ttgcacacac caacgttgag tctctggtga aggagtatga tgataatgga 600 gaggggatca ctttatttcg tccttcacat cttgctaaca agtttgaaga caaaactgtg 660 gtatatactg aacagaaaat gaccagtggc aagataaaaa ggtttatcca ggaaagcatt 720 tttggtatct gtcctcatat gacagaagac aataaagatt tgatacagag caaggactta 780 cttacagcct actatgatgt tgactatgaa aagaatgcta aaggttccaa ctattggaga 840 aacagagtga tgatggtggc aaaaaaattc ctggatgctg gacacaaact caactttgct 900 gtagctagcc gtaaaacctt tagccatgag ctgtccgact ttggcttaga aagcactact 960 ggagaggttc ctgttgtagc aatcagaact gctaaaggag agaagtttgt catgcaggaa 1020 gagttctcga gggacgggaa ggctctggag cggttcctgc aggattactt tgatggcaac 1080 ctgaagagat acctcaagtc tgaacctatc ccagagacca acgatgggcc tgtcaaggtt 1140 gtggtagcag aaaattttga tgacatagtg aataatgaag ataaggatgt gctgattgaa 1200 ttttatgccc cttggtgtgg tcactgtaag aatctggagc ccaaaataataa agaactggga 1260 gagaaactca gcaaagaccc aaatattgtt atagccaaga tggatgccac agctaatgat 1320 gtgccttctc catatgaagt caaaggtttt cctaccatct acttttcacc agccaacaag 1380 aagctaaatc caaagaagta tgaaggtggc cgtgaattaa atgattttat taactatcta 1440 caacgagaag ctacaacccc ccctataatt caagaagaaa aacccaagaa gaagaagaag gcacaagagg acctctaa <210> 23 <211> 2874 <212> DNA <213> Cricetulus griseus (Cricetulus griseus) <400> 23 atgactctcc tgctgctgtc cctcttgctg gcctccctgc tccagctcag ctctggcaac aaagccaaca agcacaagcc ctggatcgag gcagagtacc agggcattgt catggagaat 180. gacaacactg tcctgttga tccaccactc tttgccttgg ataaagatgc cccgctgcgc tatgcaggtg agatctgtgg cttccggctg catgggtctg gggtaccctt tgaggctgtg atcctggaca aggcaacagg tgaagggctg atccggggcca aggagccggt ggactgtgag gcccagaagg aacacacctt taccatccag gcttatgact gtggcgaggg gcccgatggc 360 accaacacca agaagtctca caaggcaacc gtgcatgtcc gcgtcaacga tgtgaatgag tttgccccgg tctttgtgga gcgtctgtac cgtgctgcag tgacagaggg gaagctgtat 480 gaccgcatct tacgcgtgga agccatcgat ggcgactgct cccctcagta cagccagatc tgctactatg agattcttac acccaacatt cctttcctca tcgacaatga cggcaacatt 600 gagaaccag agaagctgca gtacagtggt gagaaactct acaagttcac ggtgacagcg 660 tacgactgtg ggaagaagcg gggctcggat gacgcggagg tggagataca ggtgaagccc 720 acctgcaagc ccagctggca aggctggaac aaaaggattg agtacgcccc aggcgccggg 780 agtttggctt tgttccctgg catccgcctg gagacctgtg atgaaccatt gtggaacatc 840 caggccacca tagagctgca gaccagccat gtggccaagg gctgtgaccg agaacactac 900 tccgaaaggg cactgcggaa gctctgtggc gctgctactg gggaggtaga cctgttgccc 960 atgcctggcc ccaatgccaa ctggacagcg ggactctcag tgcactacag ccaggacagc 1020 agcctcatct actggttcaa tggcacccaa gctgtgcaag ttcccctggg tggcccagca 1080 gggctggggct ctgggccgca ggatggcctt agtgaccact ttaccctgtc cttctggatg 1140 aaacatggcg tgactcccaa caaggggaag aaggaag agaccatcgt gtgtaacaca 1200 gtccagaatg aggacggctt ctctcactac tcactgactg tacatggctg cagaatctcc 1260 ttcctctact ggccactgct tgagagtgcc cgtccggtca agttcctctg gaagctggag 1320 caggtatgtg acgacgagtg gcaccactat gccctgaacc tcgagttccc cacggtcaca 1380 ctctacactg atggcatctc ctttgaccct gctctcatcc atgacaatgg tctcatccac 1440 ccacccagga gggagcctgc actcatgatt ggggcctgct ggactgaaga gaagaaga 1500 gaaaaggaaa aaggagaga caacagtaca gacacaaccc caggagaccc cttgctgatc 1560 caccactact tccacggcta cctggctggt ttcagcgtgc gctcaggtcg cctggagagc 1620 cgtgaggtca tcgagtgcct ctatgcatgc cgggaggggc tggactatag ggatttcgag 1680 agcctgggca aaggcatgaa ggtccacgtg aacccctcgc agtccctgct caccctggag 1740 ggggatgatg tggagacctt caaccatgcc ctgcagcatg tggcttacat gaacactctg 1800 cgctttgcca caccccggcgt caggccgctg cgcctcacca ccgctgtcaa gtgcttcagt 1860 gaagagtcct gcgtctccat ccctgaagtg gaaggctatg tggtggtcct tcagcctgat 1920 gccccccaga tccttctgag tggcacagct cattttgccc gcccagcggt ggactttgag 1980 ggacccgacg gggtcccttt gttccctgac cttcagatca cctgctccat ttctcaccag 2040 gtggaggcca aagcagatga gagctggcag ggcacagtga cagacacacg catgtcagat 2100 gagattgtac acaacctgga cggctgtgaa atttctctgg tgggagatga cctagaccct 2160 gagcgagaaa gcctgctctt ggacatggca tccttgcagc agcgaggcct ggaactcacc 2220 aacacatctg cctacctcac cattgctggg gtggaaacca tcactgtgta tgaagagatc 2280 ctgaggcacg ctcgttatca gctccggcat ggagctgccc tgtatgctag gaaattcagg 2340 ctttcctgtt cggagatgaa tggccgctac tccagcaacg aattcattgt ggaggtcaac 2400 gtccttcata gcatgaaccg ggtggcccac cccagccatg tgctcagctc acagcagttc 2460 ttgcaccgag gtcaccagcc tcctcctgag atggctggac acagcctggc cagctcccac 2520 cggaactcca tggtccccag tgctgcgact ctcatcattg tggtgtgtgt gggcttcctg 2580 gtgcttatgg tcatcctggg cctagtgcga atccactccc ttcaccgccg cgtctcagga 2640 actggcggac cctcaggggc ttccactgac ccgaaagacc ctgacctctt ctgggatgac 2700 tctgctctca ccattatcgt gaaccccatg gagtcctacc agaaccagca ggccagtgtg 2760 gcaggggttg ctggtggcca gcaagaggaa gaggacagca gtgactcaga ggcagccgac 2820 ttccccagca gcgacgagag acgcatcgtt gaaagccccc cacaccgcta ctga 2874 <210> 24 <211> 1308 <212> DNA <213> Cricetulus griseus <400> 24 atgggtcagg agctgtgtgc aaagagacag ccaggatgca gttgctacca ccgttcggag 60 agaggggagg cgcacagctg tcagagaagc cagcctggga gcaccgaggc tgctgcgttc 120 gagctaacag acataaaagg agcaacgtgt tccttgtctt catttcaccc caggggactc 180 cagggccctg gtgaccagaa gctggagagc aaaaggcccc ggagtaacag tgactctttt 240 caggaagaga atctgaggca agggttgcca tggaagaaga gcctcccttt tggggcagcc 300 tcatcttatt tgaacttgga gaagctgggt gaaggctctt atgccacagt ttacaagggg 360 attagcagga taaatggaca actagtagct ctaaaggtga tcagcatgaa cgccgaggag 420 ggtgtgcctt tcacagccat ccgggaagcc tccctcctga agggtctgaa gcatgccaac 480 attgtcctct tgcatgacat tgtgcacacc aaagagactc tgacattcgt atttgaatac atgcacacag atctggccca gtacatgtct cagcatcccg gaggccttca tcctcacaat gtcaggcttt tcatgtttca acttctgcga ggcctggcat acatccacca tcagcatgtt 660 cttcacaggg acctgaaacc tcagaacttg ctcatcagtc acctggggaga gctcaaattg gctgactttg gtcttgctcg agccaagtcc attcccagcc agcgtactc ttcagaagtg 780 gtgacactgt ggtaccggcc acctgacgcc ttgctgggag ccctgagta ctcctctgag 840 ctagacatat ggggcgcagg ctgcatcttt attgaaatgt tccagggtca acctttgttt cctggggttt ccaacatcct ggaacagctg gagaagatct gggaggtact gggagtccct acagaggaca cctggcctgg agtctccaag ctgcctaact acaatccaga atggttcccg ctgcctaagc ctcaaagcct gcagattgtc tggagcaggt tgggtggagt tcctgaagct 1080. gaagacctgg cctcccagat gctaaaaggt ttccctaggg accgagtatc agcacagga gcactcgttc atgattattt cagtgtcctt ccatcccagt tgtaccagct tcctgatgaa 1200 gagtctttgt ttgcagtttc aggagtgaag ctaaagccag aaatgtgtga cctttcagcc 1260 tcctacagga agggtcacta cctagccggg tttaacaaat gttggtga 1308 <210> 25 <211> 783 <212> DNA <213> Cricetulus griseus <400> 25 atggctaagg agtggggtta tgccagccac aatggtcctg aacactggca tgaactttat 60 ccaattgcca aaggggacaa tcagtcaccc attgagctgc atactaaaga catcaagcat 120 gacccctctt tgcaaccctg gtcagcatct tacgatcctg gctctgctaa gaccatcctg 180 aataatggga agacctgcag agttgtgttt gatgacacgt atgacaggtc tatgctgagg 240 ggtggtcctc tctctggacc ctatcgactt cgccagtttc atcttcactg gggctcctcg 300 gatgaccatg gctctgagca cacagtggat ggagtgaagt atgctgctga gcttcacctg 360 gttcactgga acccaaagta caacaccttc ggagaagctc taaagcaacc cgatggaatc 420 gctgttgttg gcatttttct gaagatagga cgggagaaag gagagttcca gattttcctt 480 gatgccctgg acaaaattaa gactaagggc aaggaggctc ctttcaccca cttcgaccca 540 tcctgcctgt ttcctgcttg ccgcgactac tggacctatc atggctcctt caccacgcca 600 ccctgcgagg agtgcatcgt gtggctgctg ttgaaggagc ccatgaccgt gagctcagac 660 cagatggcca agctgcgtag tctattcgcc agcacggaga atgagccccc ggtgcctctg 720 gtggggaatt ggcgcccccc gcagccggtc aagggtaggg tggtgagggc ctctttcaag 780 tga 783 <210> 26 <211> 1305 <212> DNA <213> Cricetulus griseus <400> 26 atgaactccg gcctgggttc catgaactcc atgaacagct acatgaccat gaacaccatg 60 accacgagcg gcaatatgac accggcttcc ttcaacatgt cctacgccaa cccgggccta 120 ggagccggcc tgagtccggg tgctgtggcc ggcatgcccg gaggctctgc cggcgccatg 180 aacagcatga ccgcggcagg cgtcacggcc atgggtgcag cgctgagccc gggaggcatg 240 ggctccatgg gcgcgcagcc cgcagcctct atgaacggcc tgggtcccta tgcggcagcc 300 atgaacccgt gcatgagccc catggcgtac gcgccgtcca acttgggccg cagccgcgct 360 ggggggcggcg gcgactccaa gacattcaag cgcagctacc cgcacgccaa gccgccctac 420 tcctacatct cgctcatcac catggccatc cagcaggcgc ccagcaagat gctcacactg 480 agcgagatct accagtggat catggacctc ttcccctatt accgtcaaaa ccagcagcgc 540 tggcagaact ccatccgcca ctcgctgtct ttcaacgact gtttcgtcaa ggtggcgcga 600 tccccggaca aaccgggcaa gggctcctac tggacgctgc acccggactc cggcaacatg 660 ttcgagaacg gctgctactt gcgccgtcaa aagcgcttca agtgtgagaa gcagccgggg 720 gccggaggcg ggagcggggg cgccggctcc aagggtggcc ccgaaagccg caaggacccc 780 tcaggcgcag gtaaccacgc cgagtcgccc cttcatcggg gtgtgcacgg aaaggctggc 840 cagctagagg gcgcgccggc ccccgggccc gccgccagcc cccagactct ggaccacagc 900 ggggccacag cgacagggg cgcttcggag ttgaagtctc cagcctcttc ctctgcgccc 960 cccataagct ccggggcctgg ggcgctggca tctgtacccc cctctcaccc ggcgcacggc 1020 ctggcacccc acgaatcgca gctgcacctg aaaggggacc cccactactc ctttaatcac ccgttctcta tcaacaacct catgtcctct tcggagcagc agcacaagct ggacttcaag gcatatgagc aggcactcca gtactctcct tatggtgcca ccttgcccgc cagtctgccc cttggcagcg cctcagtggc cacaaggagc cccatcgagc cctcagcact ggagccggcc tactaccaag gtgtgtattc cagacccgtg ctaaatactt cctag <210> 27 <211> 879 <212> DNA <213> Cricetulus griseus (Cricetulus griseus) <400> 27 atggaagact cgatggatat ggacatgagc cctcttaggc cacagaacta ccttttcggt tgtgaactaa aagctgacaa agattatcac tttaaggtgg aatgatga gaatgaacac cagttgtcac tagttagg gcaggggcaa aagatgaat acacatcgta gaggcagaag caatgaatta tgaaggcagt ccaattaag taacgctggc aacattgaaa atgtccgtac aaccaacagt ttcccttggt ggctttgaaa ttacaccacc tgtggtgtta 300 cggttgaggt gtggttcagg gcctgtgcac attagtggac agcatctagt agctgtagag 360 gaagatgcag agtcagagga tgaagatgag gaggatgtga aactcttaag tatgtctggc 420 aagcgatctg ctcctggagg tggtagcaaa gttccacaga aaaaagtaaa aatcgatgaa 480 gatgaggatg atgatgatga agatgatgaa gacgatgaag atgatgatga tgatgatttt 540 gatgatgaag aaactgaaga aaaagttcca gtgaagaaat ctgtacgaga taccccagcc 600 aaaaatgcac aaaaatcaaa ccaaaatgga aaagacttaa aaccatcaac accaagatca 660 aaaggtcaag agtccttcaa aaaacaggaa aaaactccta aaaccccaaa aggacctagt 720 tctgtagaag acattaaggc aaaaatgcaa gcaagtatag aaaaaggtgg ttctcttccc 780 aaagtggaag ccaagttcat taattatgtg aagaattgct tccggatgac tgaccaggag 840 gctattcaag atctctggca gtggaggaaa tctctttaa 879 <210> 28 <211> 2106 <212> DNA <213> Cricetulus griseus <400> 28 atggcggacc ggcgtcggca gcgcgcttcc caggacactg aggacgaga atctggtgct 60 tcgggttctg acagcggctc tccggcgcgg ggcggcggca gctgcagcgg gagcgccgga 120 ggcggcggca gtggctcgct gccgtctcag cgcggcggcc gcggcgggg ccttcatctg 180 cggcgggtgg agagcgggg cgccaagagc gccgaggat cggagtgtga gagtgaagat 240 ggcatggaag gcgatgctgt tctttccgat tatgaaagtg cagaagattc agaaggtgaa 300 360 gctgctgatt cctcagcaaa agagaaggga gaaaaagc ctgatactaa aggcactgtg 420 actggagaga ggcaaagtgg ggatggacag gagagcacag agcctgtaga gaataagtg 480 ggtaaaaaag gccctaagca tttggatgat gatgaagaatc ggaaaaatcc agcgtatata 540 ccaaggaaag ggctcttctt tgagcatgat cttcgagggc aaactcagga agaggaagtc 600 cgacccaagg gacgtcagcg aaagctatgg areatgagg gtcgctggga gcatgataag 660 ttccgtgaag atgaacaggc tccaaagtcc cgacaggaac tcattgccct ttatggctat 720 gatattcgat ctgctcacaa tcctgatgac atcaaacccc ggagaatccg gaagcctcga 780 tttggaagtc ccccacaaag agatccaaat tggattggtg atagatcaaa caagtcccat 840 cgccaccagg gtcctggggg taccctacca ccaaggacat ttattaatag gaatgcatca 900 ggtactggcc gcatgtctgc atccaggaat tattcacgat ctgggggctt caaggaaggt 960 cgtactagtt tcaggcctgt ggaggctggt gggcagcatg gtggccggtc tggtgagact 1020 cataaacatg aagctaatta ccggtcacga cgtctggagc aaacccctat gagggatcca 1080 tctccagaac cagatgctcc gttgcttggc agtcctgaga aagaagaggc ggcctcggag 1140 acaccagctg ccgctcctga cactgtacca ccagctcctg acaggcccat tgagaagaaa 1200 tcctattccc gggcaagaag gacccggacc aaagtggggg atgcaatgaa agctgctgag 1260 gaggctcctc ctccagctga agggctcact tcagcagcca caatcccaga aacagctcct 1320 cctccagctg ctaagactgg gaactgggag gctccagtag attctaccac aggtggactg 1380 gagcaagatg tggcacagct aaatatagca gaacaaaact ggagtccagg acagccttcg 1440 ttcctgcaac cacgggagct tcgaggtatg cccaaccaca tacatatggg agcaggacct ccacctcagt ttaaccggat ggaagaaatg ggtgtccagg gtagtcgagc taaacgttat tcatcccagc ggcagagacc tgtgccagag ccccctgctc ctcctgtcca tatcagtatc 1620 atggagggac attactatga tccattgcag ttccagggac caatctatac ccatggcgac agccctgccc cactgcctcc acagggcatg attgtacagc cagaaatgca ccttcctcat 1740. ccaggtttac atccccatca gtcaccagca cctctgccca atccgggtct ctacccacca ccagtgtcca tgtctccagg acaaccacca ccccagcagt tgctcgctcc tacttacttt tctgctccag gtgtcatgaa ttttggtaac cccagttacc cttatgctcc aggagcatta cctcctcctc cacctcctca tctgtatcct aacacacagg ctccatcaca ggtgtatggg ggagtgacct actataaccc tgcccagcag caggtgcagc caaaaccctc cccaccccgg aggctcccc aggctgtc catcaagccc cctccacctg aggttgtaag caggggttcc agttaa <210> 29 <211> 1101 <212> DNA <213> Cricetulus griseus <400> 29 atggctaagc cccaggtggt tgtggctcct gtgctaatgt ctaagctgtc tgcgaacgcc 60 cccgaatttt acccatcagg ttattctaat tataccgaat cctatgagga tgtttgtgag 120 gattatccca ctctaccaga atatgttcag gatttcctga atcatctcac agagcagcct 180 ggcagttttg aaacagaaat tgaacagttt gcagaaaccc tgaatggatg ggtcacaaca 240 gacgatgctt tgcaagagct tgtggaactc atctaccagc aggccacgtc tatcccaaat 300 ttctcttaca tgggagctcg cctgtgtaat tacctgtccc atcatctgac aattagccca 360 cagagtggca acttccgcca attgctactt caaaggtgcc ggacggaata tgaagctaaa 420 gacgaagctg caaaaggaga tgaagtgact cgaaaacgat tccatgcctt tgttctgttt 480 ctgggagaac tgtatcttaa cctggagatc aaaggaacaa atggacaggt tacaagagca 540 gatattcttc aggttggcct acgggaactg ctgaatgctc tgttctccaa tcctatggat 600 gacaacttaa tttgtgcagt aaagttgcta aagttgacag ggtcagtttt agaagatact 660 tggaaggaaa aggggaaaac tgatatggaa gaagtaattc agagaattga aaatgttgtc 720 ctagatgcaa actgcagcag agatgtaaaa cagatgctct tgaagcttgt agaacttcga 780 tcaagtaact ggggcagagt ccatgcaact tcaacataca gagaagctac ccctgaaaat 840 gaccctaact actttatgaa tgaaccaaca ttttatacat ctgatggtgt tcctttcact 900 gcagctgacc cagattacca agagaagtat caggagttac ttgaaagaga ggactttttt 960 ccagattatg aagaaaatgg aacagattta tccggggctg gtgacccata cttggatgat 1020 attgatgatg agatggaccc agagattgaa gaagcttatg aaaagttttg tttggaatca 1080 gagcgtaagc gaaaacagta a 1101 <210> 30 <211> 1440 <212> DNA <213> Striped hamster (Cricetulus griseus) <400> 30 atgtcggaca gtttcgatcg ggctccaggt gctggtcggg gccggagccg gggcctgggc 60 cgcggagggg gcgggcctga gggcggcggg ttcccgaacg gagcggggcc tgcggagcgg 120 tcgcggcacc agccgccgcc gcagcccaaa gccccgggct tcctgcagcc gccgccgctg 180 cgccagccca ggaccgcccc gccgccaggg gcccagagcg aggcccccgc cggctccgcg 240 cggcctcccc gacctggggc gctcccagaa caaacgcgtc cccagagagc tccacctagt 300 tcacaggata aaatcccaca gcagaactcg gagtcagcaa tggctaagcc ccaggtggtt 360 gtggctcctg tgctaatgtc taagctgtct gcgaacgcccc ccgaatttta cccatcaggt 420 tattctaatt ataccgaatc ctatgaggat gtttgtgagg attatcccac tctaccagaa 480 tatgttcagg atttcctgaa tcatctcaca gagcagcctg gcagttttga aacagaaatt 540 600 gtggaactca tctaccagca ggccacgtct atcccaaatt tctcttacat gggagctcgc 660 ctgtgtaatt acctgtccca tcatctgaca attagcccac agagtggcaa cttccgccaa 720 ttgctacttc aaaggtgccg gacggaatat gaagctaaag acgaagctgc aaaaggagat 780 gaagtgactc gaaaacgatt ccatgccttt gttctgtttc tgggagaact gtatcttaac 840 ctggagatca aaagcaaa tggacaggtt acaagagcag atattcttca ggttggccta 900 cgggaactgc tgaatgctct gttctccaat cctatggatg acaacttaat ttgtgcagta 960 aagttgctaa agttgacagg gtcagtttta gaagaatactt ggaaggaaaa ggggaaaact 1020 gatatggaag aagtaattca gagaattgaa aatgttgtcc tagatgcaaa ctgcagcaga 1080 gatgtaaaac agatgctctt gaagcttgta gaacttcgat caagtaactg gggcagagtc 1140 catgcaactt caacatacag agaagctacc cctgaaaatg accctaacta ctttatgaat 1200 gaaccaacat tttatacatc tgatggtgtt cctttcactg cagctgaccc agattaccaa 1260 gagaagtatc aggagttact tgaaagagag gacttttttc cagattatga agaaaatgga 1320 acagatttat ccggggctgg tgacccatac ttggatgata ttgatgatga gatggaccca 1380 gagattgaag aagcttatga aaagttttgt ttggaatcag agcgtaagcg aaaacagtaa 1440 <210> 31 <211> 1440 <212> DNA <213> Homo sapiens <400> 31 atgtctgctg aagtcatcca tcaggttgaa gaagcacttg atacagatga gaaggagatg 60 ctgctctttt tgtgccggga tgttgctata gatgtggttc cacctaatgt cagggacctt 120 ctggatattt tacgggaaag aggtaagctg tctgtcgggg acttggctga actgctctac 180 agagtgaggc gatttgacct gctcaaacgt atcttgaaga tggacagaaa agctgtggag 240 acccacctgc tcaggaaccc tcaccttgtt tcggactata gagtgctgat ggcagagatt 300 ggtgaggatt tggataaatc tgatgtgtcc tcattaattt tcctcatgaa ggattacatg 360 ggccgaggca agataagcaa ggagaagagt ttcttggacc ttgtggttga gttggagaaa 420 ctaaatctgg ttgccccaga tcaactggat ttattagaaa aatgcctaaa gaacatccac 480 agaatagacc tgaagacaaa aatccagaag tacaagcagt ctgttcaagg agcagggaca 540 agttacagga atgttctcca agcagcaatc caaaagagtc tcaaggatcc ttcaaataac 600 ttcaggctcc ataatgggag aagtaaagaa caaagactta aggaacagct tggcgctcaa 660 caagaaccag tgaagaaatc cattcaggaa tcagaagctt ttttgcctca gagcatacct 720 gaagagagat acaagatgaa gagcaagccc ctaggaatct gcctgataat cgattgcatt 780 ggcaatgaga cagagcttct tcgagacacc ttcacttccc tgggctatga agtccagaaa 840 ttcttgcatc tcagtatgca tggtatatcc cagattcttg gccaatttgc ctgtatgccc 900 gagcaccgag actacgacag ctttgtgtgt gtcctggtga gccgaggagg ctcccagagt 960 gtgtatggtg tggatcagac tcactcaggg ctccccctgc atcacatcag gaggatgttc 1020 atgggagatt catgccctta tctagcaggg aagccaaaga tgttttttat tcagaactat 1080 gtggtgtcag agggccagct ggaggacagc agcctcttgg aggtggatgg gccagcgatg 1140 aagaatgtgg aattcaaggc tcagaagcga gggctgtgca cagttcaccg agaagctgac 1200 ttcttctgga gcctgtgtac tgcggacatg tccctgctgg agcagtctca cagctcacca 1260 tccctgtacc tgcagtgcct ctcccagaaa ctgagacaag aaagaaaacg cccactcctg 1320 gatcttcaca ttgaactcaa tggctacatg tatgattgga acagcagagt ttctgccaag 1380 gagaaatatt atgtctggct gcagcacact ctgagaaaga aacttatcct ctcctacaca 1440 <210> 32 <211> 822 <212> DNA <213> Homo sapiens <400> 32 atgggcaccg acagccgcgc ggccaggcg ctcctggcgc gggcccgcac cctgcacctg 60 cagacgggga acctgctgaa ctggggccgc ctgcggaaga agtgcccgtc cacgcacagc 120 gaggagcttc atgattgtat ccaaaaaacc tgaatgaat ggagttccca aatcaaccca 180 gatttggtca gggagtttcc agatgtcttg gatgcactg tatctcatgc agtagaaaag 240 aaatcctg atgaagaga agaatgaaa gtttctgca aactgttcat tgtagaatca 300 aactcttcat catcaactag aagtgcagtt gataggcct gttcagtcct tggagttgca 360 cagctggatt ctgtgatcat tgctcacct cctattgag atggagttaa tctttccttg 420 gagcatttac agccttactg ggaggatta gaaaacttag ttcagagca aaagattgtt 480 gccataggta cctctgatct agacaaaca cagttggaac agctgtatca gtggggcacag 540 gtaaaaccaa atagtaacca agttaatctt gcctcctgct gtgtgatgcc accagatttg 600 actgcatttg ctaaaacatt tgacatacag ctgttgactc acatgatcc aaagaactg 660 ctttctgaag caagtttcca agaagctctt caggaaagca ttcctgacat tcaagcgcac 720 gagtgggtgc cgctgtggct actgcggtat tcggtcattg tgaaaagtag aggaattatc 780 aaatcaaaag gctacatttt acaagctaaa agaaggggtt ct 822 <210> 33 <211> 1131 <212> DNA <213> Homo sapiens <400> 33 atgtgtgacg acgaggagac caccgccctg gtgtgcgaca acggctctgg gctggtgaag 60 gccggctttg cgggcgatga cgcgccccgc gctgtcttcc cgtccatcgt gggccgcccg 120 cggcaccagg gagttatggt gggtatgggt cagaaggact cctacgtagg tgatgaagcc 180 cagagcaaga gaggcatcct gaccctgaag tatcccatcg agcatggtat catcaccaac 240 tgggacgaca tggagaagat ctggcaccac accttctaca atgagctccg tgtggctccc 300 gaggagcacc ccaccctgct cacagaggcc ccgctgaacc ccaaggccaa ccgggagaag 360 atgactcaga tcatgtttga gaccttcaat gtccctgcca tgtacgtggc catccaggca 420 gtgctatccc tgtatgcttc tggccgtacc acaggcattg ttctggactc tggggatggt 480 gtaactcaca atgtccccat ctatgagggc tacgctttgc cccatgccat catgcgtctg 540 gatctggctg gtcgggacct cactgactac ctcatgaaga tcctcactga gcgtggctac 600 tcctttgtca ccactgctga acgtgaaatt gtccgtgaca ttaaagagaa gctgtgctat 660 gtcgccctgg attttgagaa tgagatggcc acagctgcct cttcctcctc cctggagaag 720 agctatgaac tgcctgatgg ccaagtcatc actattggca atgagcgctt ccgctgtcct 780 gagacactct tccagccctc cttcattggt atggaatctg ctggcatcca tgaaacaact 840 tacaatagca tcatgaagtg tgacattgat atccgcaagg acctgtatgc caacaatgtc 900 ttatctggag gcaccactat gtaccctggt attgctgatc gtatgcagaa ggaaatcact 960 gctctggctc ctagcaccat gaagattaag attattgctc cccctgagcg taaatactct 1020 gtctggattg ggggctccat cctggcctct ctgtccacct tccagcaaat gtggattagc 1080 aagcaagagt acgatgaggc aggcccatcc attgtccacc gcaaatgctt c 1131 <210> 34 <211> 564 <212> DNA <213> Homo sapiens <400> 34 atggccaact cgggctgcaa ggacgtcacg ggtccagatg aggagagttt tctgtacttt 60 gcctacggca gcaacctgct gacagagagg atccacctcc gaaacccctc ggcggcgttc 120 ttctgtgtgg cccgcctgca ggattttaag cttgactttg gcaattccca aggcaaaaca 180 agtcaaactt ggcatggagg gatagccacc atttttcaga gtcctggcga tgaagtgtgg 240 ggagtagtat ggaaaatgaa caaaagcaat ttaaattctc tggatgagca agaaggggtt 300 aaaagtggaa tgtatgttgt aatagaagtt aaagttgcaa ctcaagaagg aaaagaaata 360 acctgtcgaa gttatctgat gacaaattac gaaagtgctc ccccatcccc acagtataaa 420 aagattattt gcatgggtgc aaaagaaaat ggtttgccgc tggagtatca agagaagtta 480 aaagcaatag aaccaaatga ctatacagga aaggtctcag aagaaattga agacatcatc 540 aaaaaggggg aaacacaaac tctt 564 <210> 35 <211> 462 <212> DNA <213> Homo sapiens <400> 35 atggcgacga aggccgtgtg cgtgctgaag ggcgacggcc cagtgcaggg catcatcaat 60 ttcgagcaga aggaaagtaa tggaccagtg aaggtgtggg gaagcattaa aggactgact 120 gaaggcctgc atggattcca tgttcatgag tttggagata atacagcagg ctgtaccagt 180 gcaggtcctc actttaatcc tctatccaga aaacacggtg ggccaaagga tgaagagagg 240 catgttggag acttgggcaa tgtgactgct gacaaagatg gtgtggccga tgtgtctatt 300 gaagattctg tgatctcact ctcaggagac cattgcatca ttggccgcac actggtggtc 360 catgaaaaag cagatgactt gggcaaaggt ggaaatgaag aaagtacaaa gacaggaaac 420 gctggaagtc gtttggcttg tggtgtaatt gggatcgccc aa 462 <210> 36 <211> 822 <212> DNA <213> Cricetulus griseus <400> 36 atggaaatct ccaggtccgc atgcctagtc ctttcattta tcctcatgtg tgggctggtc 60 ccagaagtca tggcagatgc tgaagaaacc tcaggcggtc tcggcactac ccaggaaccc 120 atatggctcc cagacatccc agctacggag gaattcatca gtgctgctga agtggccatc 180 ataggtttct tccaggattt agaaataccg atagtgccca tattccgcag cacggctcaa 240 cagttccgag acataccatt cggaatcagc aacagttctg cggttctgag ccactacaac 300 gtcaccagaa acagcatctg cctcttccga ctggttgaca atgaacaact gcacttggat 360 gctgaagaca ttgaaaactt agatgcctcc aagttgagcc gtttcattca gatgcacagc 420 ctccgctggg tgacagagta cagccctctg attgcagctg gcttatttaa caccatggtt 480 cagactcacc ttctcctgat aatgaacaag acttccccgg agtatgaaaa gagcctgcag 540 caataccggg aggcagctaa gctcttccag ggacagatcc tctttgttct ggtggacagc 600 ggcaaggggg ggaaccgaaa ggtgatatcc tatttccaac taaaggagtc tcagctgccg 660 gctctggcca tttatgaaag tgtgaatgac aagtgggaca cactgcccat cacagaagtc 720 acagtggaga aagtccaagg cttctgtgat ggcttcctaa aggggacact gctgagagat 780 cacgatgtgg aaggagatgc agaggcgcgg aaggaggagc tc 822 <210> 37 <211> 1515 <212> DNA <213> Cricetulus griseus <400> 37 atgcgcttca gctgcctagc gctgctcccg ggcgtggcgc tgctgctcgc ctcggcccgc 60 ctcgccgccg cctctgacgt gctgggaactc acggacgaaa acttcgagag tcgcgtctcc 120 gacacgggct ctgcgggcct catgctagtc gagttcttcg ccccttggtg tggacattgc 180 aagaggcttg cccctgagta tgaagctgca gcaactagat tgaaaggaat agtcccatta 240 gcaaaggttg attgcactgc caacacaaac acctgtaata agtatggagt cagtggctac 300 ccaaccctta aaatatttag agatggtgaa gaagcaggtg cttatgatgg gcctaggact 360 gccgatggaa ttgtcagcca cttgaagaaa caagcaggac cagcttcggt tcctctcagg 420 tctgaggaag aatttaagaa gttcattagt gataaagatg cttcggtggt gggctttttc 480 agggattat tcagtgacgg tcactctgaa ttcctaaaag cagccagcaa cttgagagat 540 aactacagat ttgcacacac caacgttgag tctctggtga aggagtatga tgataatgga 600 gaggggatca ctttatttcg tccttcacat cttgctaaca agtttgaaga caaaactgtg 660 gtatatactg aacagaaaat gaccagtggc aagataaaaa ggtttatcca ggaaagcatt 720 tttggtatct gtcctcatat gacagaagac aataaagatt tgatacagag caaggactta 780 cttacagcct actatgatgt tgactatgaa aagaatgcta aaggttccaa ctattggaga 840 aacagagtga tgatggtggc aaaaaaattc ctggatgctg gacacaaact caactttgct 900 gtagctagcc gtaaaacctt tagccatgag ctgtccgact ttggcttaga aagcactact 960 ggagaggttc ctgttgtagc aatcagaact gctaaaggag agaagtttgt catgcaggaa 1020 gagttctcga gggacgggaa ggctctggag cggttcctgc aggattactt tgatggcaac 1080 ctgaagagat acctcaagtc tgaacctatc ccagagacca acgatgggcc tgtcaaggtt 1140 gtggtagcag aaaattttga tgacatagtg aataatgaag ataaggatgt gctgattgaa 1200 ttttatgccc cttggtgtgg tcactgtaag aatctggagc ccaaaataataa agaactggga 1260 gagaaactca gcaaagaccc aaatattgtt atagccaaga tggatgccac agctaatgat 1320 gtgccttctc catatgaagt caaaggtttt cctaccatct acttttcacc agccaacaag 1380 aagctaaatc caaagaagta tgaaggtggc cgtgaattaa atgattttat taactatcta 1440 caacgagaag ctacaacccc ccctataatt caagaagaaa aacccaagaa gaagaagaag 1500 gcacaagagg acctc 1515 <210> 38 <211> 615 <212> DNA <213> Homo sapiens <400> 38 atgaccgagc gccgcgtccc cttctcgctc ctgcggggcc ccagctggga ccccttccgc 60 gactggtacc cgcatagccg cctcttcgac caggccttcg ggctgccccg gctgccggag 120 gagtggtcgc agtggttagg cggcagcagc tggccaggct acgtgcgccc cctgcccccc 180 gccgccatcg agagccccgc agtggccgcg cccgcctaca gccgcgcgct cagccggcaa 240 ctcagcagcg gggtctcgga gatccggcac actgcggacc gctggcgcgt gtccctggat 300 gtcaaccact tcgccccgga cgagctgacg gtcaagacca aggatggcgt ggtggagatc 360 accggcaagc acgaggagcg gcaggacgag catggctaca tctcccggtg cttcacgcgg 420 aaatacacgc tgccccccgg tgtggacccc acccaagttt cctcctccct gtcccctgag 480 ggcacactga ccgtggaggc ccccatgccc aagctagcca cgcagtccaa cgagatcacc 540 atcccagtca ccttcgagtc gcgggcccag cttgggggcc cagaagctgc aaaatccgat 600. gagactgccg 615 <210> 39 <211> 708 <212> DNA <213> Liquids( Escherichia coli) <400> 39 atgaagaaag gttttatgtt gtttactttg ttagcggcgt tttcaggctt tgctcaggct 120. gatgacgcgg caattcaaca aacgttagcc aaaatgggca tcaaaagcag cgatattcag cccgcgcctg tagctggcat gaagacagtt ctgactaaca gcggcgtgtt gtacatcacc 180 240. gatgatggta aacatatcat tcaggggcca atgtatgacg ttagtggcac ggctccggtc aatgtcacca ataagatgct gttaaagcag ttgaatgcgc ttgaaaaaga gatgatcgtt 360. tataagcgc cgcaggaaaa acacgtcatc accgtgttta ctgatattac ctgtggttac 420. tgccacaaac tgcatgagca aatggcagac tacaacgcgc tggggatcac cgtgcgttat cttgctttcc cgcgccaggg gctggacagc gatgcagaga aagaaatgaa agctatctgg 480 tgtgcgaaag ataaaacaa agcgtttgat gatgtgatgg caggtaaag cgtcgcacca gccagttgcg acgtggatat tgccgaccat tacgcacttg gcgtccagct tggcgttagc 600 ggtactccgg cagttgtgct gagcaatggc acacttgttc cgggttacca gccgccgaaa gagatgaag aattcctcga cgaacacca aaaatgacca gcggtaaa <210> 40 <211> 810 <212> DNA <213> Liquids( Escherichia coli) <400> 40 60. atgaaatcac tgtttaaagt aacgctgctg gcgaccacaa tggccgttgc cctgcatgca ccaatcactt ttgctgctga agctgcaaaa cctgctacag ctgctgacag caaagcagcg ttcaaaaatg acgatcagaa atcagcttat gcactgggtg cctcgctggg tcgttacatg 240. 240. 240. 240. 240. 240. 240. 240. 240. 240 gctggtgttc aggatgcatt tgctgataag agcaaactct ccgaccaaga gatcgaacag actctacaag cattcgaagc tcgcgtgaag tcttctgctc aggcgaagat ggaaaaagac gcggctgata acgaagcaaa aggtaaagag taccgcgaga aatttgccaa agagaaaggt gtgaaaacct cttcaactgg tctggtttat caggtagtag aagccggtaa aggcgaagca 480 ccgaaagaca gcgatactgt tgtagtgaac tacaaaggta cgctgatcga cggtaaagag 540 ttcgacaact cttacacccg tggtgaaccg ctttctttcc gtctggacgg tgttatcccg 600 ggttggacag aaggtctgaa gaacatcaag aaaggcggta agatcaaact ggttattcca 660 ccagaactgg cttacggcaa agcgggtgtt ccggggatcc caccgaattc taccctggtg 720 tttgacgtag agctgctgga tgtgaaacca gcgccgaagg ctgatgcaaa gccggaagct 780 gatgcgaaag ccgcagattc tgctaaaaaa 810 <210> 41 <211> 483 <212> DNA <213> Escherichia coli <400> 41 atgaaaaagt ggttattagc tgcaggtctc ggtttagcac tggcaacttc tgctcaggcg 60 gctgacaaaa ttgcaatcgt caacatgggc agcctgttcc agcaggtagc gcagaaaacc 120 ggtgtttcta acacgctgga aaatgagttc aaaggccgtg ccagcgaact gcagcgtatg 180 gaaaccgatc tgcaggctaa aatgaaaaag ctgcagtcca tgaaagcggg cagcgatcgc 240 actaagctgg aaaaagacgt gatggctcag cgccagactt ttgctcagaa agcgcaggct 300 tttgagcagg atcgcgcacg tcgttccaac gaagaacgcg gcaaactggt tactcgtatc 360 cagactgctg tgaaatccgt tgccaacagc caggatatcg atctggttgt tgatgcaaac 420 gccgttgctt acaacagcag cgatgtaaaa gacatcactg ccgacgtact gaaacaggtt 480 aaa 483 <210> 42 <211> 1350 <212> DNA <213> Homo sapiens <400> 42 atggaagggt ctaagacgtc caacaacagc accatgcagg tgagcttcgt gtgccagcgc 60 tgcagccagc ccctgaaact ggacacgagt ttcaagatcc tggaccgtgt caccatccag 120 gaactcacag ctccattact taccacagcc caggcgaaac caggagagac ccaggaggaa 180 gagactaact caggagagga gccatttatt gaaactcctc gccaggatgg tgtctctcgc 240 agattcatcc ccccagccag gatgatgtcc acagaaagtg ccaacagctt cactctgatt 300 ggggaggcat ctgatggcgg caccatggag aacctcagcc gaagactgaa ggtcactggg 360 gacctttttg acatcatgtc gggccagaca gatgtggatc acccactctg tgaggaatgc 420 acagatactc ttttagacca gctggacact cagctcaacg tcactgaaaa tgagtgtcag aactacaaac gctgtttgga gatcttagg caaatgaatg aggatgacag tgaacagtta cagatggagc taaggagct ggcactagag gaggagaggc tgatccagga gctggaagac gtggaaaaga accgcaagat agtggcagaa aatctcgaga aggtccaggc tgaggctgag agactggatc aggaggagc tcagtatcag agagaataca gtgaatttaa acgacagcag ctggagctgg atgatgagct gaagagtgtt gaaaaccaga tgcgttatgc ccagacgcag ctggataagc tgaagaaaac caacgtcttt aatgcaacct tccacatctg gcacagtgga cagtttggca caatcaata cttcaggctg ggtcgcctgc ccagtgttcc cgtggaatgg aatgagatta atgctgcttg gggccagact gtgttgctgc tccatgctct ggccataag atgggtctga aatttcagag ataccgactt gttccttacg gaaaccattc atatctggag tctctgacag acaaatctaa ggagctgccg ttatactgtt ctggggggtt gcggttttc tgggacaaca agtttgacca tgcaatggtg gctttcctgg actgtgtgca gcagttcaaa 1140 gaagaggttg agaaaggcga gacacgtttt tgtcttccct acaggatgga tgtggagaaa 1200 ggcaagattg aagacacagg aggcagtggc ggctcctatt ccatcaaaac ccagtttaac 1260 tctgaggagc agtggacaaa agctctcaag ttcatgctga cgaatcttaa gtggggtctt 1320 gcttgggtgt cctcacaatt ttataacaaa 1350 <210> 43 <211> 1815 <212> DNA <213> Homo sapiens <400> 43 atggcggggc tgtactcgct gggagtgagc gtcttctccg accagggcgg gaggaagtac 60 atggaggacg ttactcaaat cgttgtggag cccgaaccga cggctgaaga aaagccctcg 120 ccgcggcggt cgctgtctca gccgttgcct ccgcggccgt cgccggccgc ccttcccggc 180 ggcgaagtct cggggaaagg cccagcggtg gcagcccgag aggctcgcga ccctctcccg 240 gacgccgggg cctcgccggc acctagccgc tgctgccgcc gccgttcctc cgtggccttt 300 ttcgccgtgt gcgacgggca cggcgggcgg gaggcggcac agtttgcccg ggagcacttg 360 tggggtttca tcaagaagca gaagggtttc acctcgtccg agccggctaa ggtttgcgct 420 gccatccgca aaggctttct cgcttgtcac cttgccatgt ggaagaact ggcggaatgg 480 ccaaagacta tgacgggtct tcctagcaca tcagggacaa ctgccagtgt ggtcatcatt 540 cggggcatga agatgtatgt agctcacgta ggtgactcag gggtggttct tggaattcag 600 gatgacccga aggatgactt tgtcagagct gtggaggtga cacaggacca taagccagaa 660 cttcccaagg aaagagaacg aatcgaagga cttggtggga gtgtaatgaa caagtctggg 720 gtgaatcgtg tagtttggaa acgacctcga ctcactcaca atggacctgt tagaaggagc 780 acagttattg accagattcc ttttctggca gtagcaagag cacttggtga tttgtggagc 840 tatgatttct tcagtggtga atttgtggtg tcacctgaac cagacacaag tgtccacact 900 cttgaccctc agaagcacaa gtatattata ttggggagagtg atggactttg gaatatgatt 960 ccaccacaag atgccatctc aatgtgccag gaccaagagg agaaaaaata cctgatgggt 1020 gagcatggac aatcttgtgc caaaatgctt gtgaatcgag cattgggccg ctggaggcag 1080 cgtatgctcc gagcagataa cactagtgcc atagtaatct gcatctctcc agaagtggac 1140 aatcagggaa actttaccaa tgagatgag ttatacctga acctgactga cagcccttcc 1200 tataatagtc aagaaacctg tgtgatgact ccttcccat gttctacacc accagtcaag 1260 tcactggagg aggatccatg gccaagggtg aattctagg accatatacc tgccctggtt 1320 cgtagcaatg ccttctcaga gattttta gaggtttcag ctgagatagc tcgagagaat 1380 gtccaaggtg tagtcatacc ctcaaagat ccagaaccac ttgagaaaa ttgcgctaaa 1440 gccctgactt taggataca tgattctttg ataatagcc ttccattgg ccttgtgcct 1500 actaattcaacaactgt catggaccaaaaaatttga agatgtcaac tcctggccaa 1560 agaaagcccc aagaattga aagaacccct storm tgaaaggc attagaagg 1620 tccaattctg gccccctgat gagaagcat agacgaatg gcttaagtcg aagtagtggt 1680 gctcagcctg caagtctccc cacaacctca cagcgaaaga actctgttaa accaccatg 1740 cgacgcagac ttaggcca gagaaaatt ggaaatcctt tactcatca acacaggaaa 1800 actgtttgtg tttgc 1815 <210> 44 <211> 468 <212> DNA <213> Homo sapiens <400> 44 atgggcgcct ccaggctcta taccctggtg ctggtcctgc agcctcagcg agttctcctg 60 ggcatgaaaa agcgaggctt cggggccggc cggtggaatg gctttggggg caaagtgcaa 120 gaaggagaga ccatcgagga tggggctagg agggagctgc aggaggagag cggtctgaca 180 gtggacgccc tgcacaaggt gggccagatc gtgtttgagt tcgtgggcga gcctgagctc 240 atggacgtgc atgtcttctg cacagacagc atccagggga cccccgtgga gagcgacgaa 300 atgcgcccat gctggttcca gctggatcag atccccttca aggacatgtg gcccgacgac 360 agctactggt ttccactcct gcttcagaag aagaaattcc acgggtactt caagttccag 420 ggtcaggaca ccatcctgga ctacacactc cgcgaggtgg acacggtc 468 <210> 45 <211> 492 <212> DNA <213> Homo sapiens <400> 45 atgacggcca gcgcacagcc gcgcgggcgg cggccaggag tcggagtcgg agtcgtggtg 60 accagctgca agcatccgcg ttgcgtcctc ctggggaaga ggaaaggctc ggttggagct 120 ggcagtttcc aactccctgg aggtcatctg gagttcggtg aaacctggga agaatgtgct 180 caaagggaaa cctgggaaga agcagctctt cacctgaaaa atgttcactt tgcctcagtt 240 gtgaattctt tcattgagaa ggagaattac cattatgtta ctatattaat gaaaggagaa 300 gtggatgtga ctcatgattc agaaccaaag aatgtagagc ctgaaaaaaa tgaaagttgg 360 gagtgggttc cttgggaaga actacctccc ctggaccagc ttttctgggg actgcgttgt 420 ttaaaagaac aaggctatga tccatttaaa gaagatctga accatctggt gggatacaaa 480 ggaaatcatc tc 492 <210> 46 <211> 969 <212> DNA <213> Homo sapiens <400> 46 atggcctcgg agggcctggc gggggcgctg gcttccgtgc tggctggcca ggggtccagc 60 gtgcacagct gcgactcggc gccggccggg gagccgccgg cgcccgtgcg gctgcggaag 120 aacgtgtgct acgtggtgct ggccgtgttc ctcagcgagc aggatgaggt gctactgatc 180 caggaggcca agaggggagtg ccggggggtcg tggtacctgc ctgcggggag aatggagcca 240 ggggagacca tcgtggaggc gctgcagcgg gaggtgaagg aggaggcggg gctgcactgt 300 gagcccgaga cactgctgtc cgtggaggag cggggcccct cctgggtccg cttcgtgttc 360 ctcgctcgcc ccacaggtgg aattctcaag acttccaagg aggccgatgc ggagtccctg 420 caggctgcct ggtacccacg gacctccctg cccactccgc tgcgagccca tgacatcctg 480 cacctggttg aactagccgc ccagtatcgc cagcaagcca ggcaccctct cattctgccc 540 caagagctac cctgtgatct ggtctgccag cggctcgtgg ctacctttac cagcgcccag 600 acagtgtggg tgttagtggg cacagtgggg atgcctcact tgcctgtcac tgcctgtggc 660 ctcgacccta tggagcagag gggtggcatg aagatggccg tcctgcggct gctgcaggag 720 tgtctgaccc tgcaccactt ggtggtggag atcaaggggt tgcttggact gcagcacctg 780 ggccgagatc acagtgatgg catctgtttg aatgtgctgg tgaccgtggc ttttcggagc 840 ccagggatcc aggatgaacc cccaaaagtt cggggtgaga acttctcttg gtggaaggtg atggaggaag acctgcaaag ccagctcctc cagcggcttc agggatcctc tgttgtccca 960 gtgaacaga 969 <210> 47 <211> 1404 <212> DNA <213> Homo sapiens <400> 47 atggtggaca cggaaagccc actctgcccc ctctccccac tcgaggccgg cgatctagag 60 agcccgttat ctgaagagtt cctgcaagaa atgggaaaca tccaagagat ttcgcaatcc 120 atcggcgagg atagttctgg aagctttggc tttacggaat accagtattt aggaagctgt 180 cctggctcag atggctcggt catcacggac acgctttcac cagcttcgag cccctcctcg 240 gtgacttatc ctgtggtccc cggcagcgtg gacgagtctc ccagtggagc attgaacatc 300 gaatgtagaa tctgcgggga caaggcctca ggctatcatt acggagtcca cgcgtgtgaa 360 ggctgcaagg gcttctttcg gcgaacgatt cgactcaagc tggtgtatga caagtgcgac 420 cgcagctgca agatccagaa aaagaacaga aacaaatgcc agtattgtcg atttcacaag 480 tgcctttctg tcgggatgtc acacaacgcg attcgttttg gacgaatgcc aagatctgag 540 aaagcaaaac tgaaagcaga aattcttacc tgtgaacatg acatagaaga ttctgaaact 600 gcagatctca aatctctggc caagagaatc tacgaggcct acttgaagaa cttcaacatg 660 aacaaggtca aagcccgggt catcctctca ggaaaggcca gtaacaatcc accttttgtc 720 atacatgata tggagacact gtgtatggct gagaagacgc tggtggccaa gctggtggcc 780 aatggcatcc agaacaagga ggcggaggtc cgcatctttc actgctgcca gtgcacgtca 840 gtggagaccg tcacggagct cacggaattc gccaaggcca tcccaggctt cgcaaacttg 900 gacctgaacg atcaagtgac attgctaaaa tacggagttt atgaggccat attcgccatg 960 ctgcttctg tgatgaacaa agacgggatg ctggtagcgt atggaaatgg gtttataact 1020 cgtgaattcc taaaaagcct aaggaaaccg ttctgtgata tcatggaacc caagttttgat 1080 tttgccatga agttcaatgc actggaactg gatgacagtg atatctccct ttttgtggct 1140 gctatcattt gctgtggaga tcgtcctggc cttctaaacg taggacacat tgaaaaaatg 1200 caggagggta ttgtacatgt gctcagactc cacctgcaga gcaaccaccc ggacgatatc 1260 tttctcttcc caaaacttct tcaaaaaatg gcagacctcc ggcagctggt gacggagcat 1320 gcgcagctgg tgcagatcat caagaagacg gagtcggatg ctgcgctgca cccgctactg 1380 caggagatct acagggacat gtac 1404 <210> 48 <211> 1431 <212> DNA <213> Homo sapiens <400> 48 atgaccatgg ttgacacaga gatgccattc tggcccacca actttgggat cagctccgtg 60 gatctctccg taatggaaga ccactcccac tcctttgata tcaagccctt cactactgtt 120 gacttctcca gcatttctac tccacattac gaagacattc cattcacaag aacagatcca 180 gtggttgcag attacaagta tgacctgaaa cttcaagagt accaaagtgc aatcaaagtg 240 gagcctgcat ctccacctta ttattctgag aagactcagc tctacaataa gcctcatgaa 300 gagccttcca actccctcat ggcaattgaa tgtcgtgtct gtggagataa agcttctgga 360 tttcactatg gagttcatgc ttgtgaagga tgcaagggtt tcttccggag aacaatcaga 420 ttgaagctta tctatgacag atgtgatctt aactgtcgga tccacaaaaa aagtagaaat 480 aaatgtcagt actgtcggtt tcagaaatgc cttgcagtgg ggatgtctca taatgccatc 540 aggtttgggc ggatgccaca ggccgagaag gagaagctgt tggcggagat ctccagtgat 600 atcgaccagc tgaatccaga gtccgctgac ctcgggccc tgcaaaaca ttgtatgac 660 tcatacataa agtccttccc gctgaccaaa gcaaggcga gggcgatctt gaggaaag 720 acacagaca aatcaccatt cgttatctat gattgaatt cttaatgat gggagaagat 780 aaaatcaagt tcaacacat caccccctg caggagcaga gcaagggt ggccatccgc 840 atctttcagg gctgccagtt tcgctccgtg gaggctgtgc aggagatcac agagtatgcc 900 aaagcattc ctggttttgt aaatcttgac ttgaacgacc aagtaactct cctcaaatat 960 ggagtccacg agatcattta cacaatgctg gcctccttga tgaataaga tggttctc 1020 atatccgagg gccaaggctt catgacagg gagtttctaa agagcctgcg aaagcctttt 1080 ggtgacttta tggagccca gtttgagttt gctgtgaagt tcaatgcact ggaattagat 1140 gabagcgact tggcaatatt tattgctgtc attattctca gtggagaccg cccaggtttg 1200 ctgaatgtga agcccattga agacattcaa gacaacctgc tacaagccct ggagctccag 1260 ctgaagctga accaccctga gtcctcacag ctgtttgcca agctgctcca gaaaatgaca 1320 gacctcagac agattgtcac ggaacacgtg cagctactgc aggtgatcaa gaagacggag 1380 acagacatga gtcttcaccc gctcctgcag gagatctaca aggacttgta c 1431 <210> 49 <211> 1515 <212> DNA <213> Homo sapiens <400> 49 atgggtgaaa ctctgggaga ttctcctatt gacccagaaa gcgattcctt cactgataca 60 ctgtctgcaa acatatcaca agaaatgacc atggttgaca cagagatgcc attctggccc 120 accaactttg ggatcagctc cgtggatctc tccgtaatgg aagaccactc ccactccttt 180 gatatcaagc ccttcactac tgttgacttc tccagcattt ctactccaca ttacgaagac 240 attccattca caagaacaga tccagtggtt gcagattaca agtatgacct gaaacttcaa 300 gagtaccaaa gtgcaatcaa agtggagcct gcatctccac cttattattc tgagaagact 360 cagctctaca ataagcctca tgaagagcct tccaactccc tcatggcaat tgaatgtcgt gtctgtggag ataaagcttc tggatttcac tatggagttc atgcttgtga aggatgcaag 480 ggtttcttcc ggagaacaat cagattgaag cttatctatg acagatgtga tcttaactgt cggatccaca aaaaaagtag aaataatgt cagtactgtc ggtttcagaa atgccttgca gtggggatgt ctcataatgc catcaggttt gggcggatgc cacaggccga gaaggagaag ctgttggcgg agatctccag tgatatcgac cagctgaatc cagagtccgc tgacctccgg 720. gccctggcaa aacatttgta tgactcatac ataaagtcct tcccgctgac caaagcaaag gcgagggcga tcttgacagg aaagacaaca gacaaatcac cattcgttat ctatgacatg aattccttaa tgatggggaga agataaaatc aagttcaaac acatcacccc cctgcaggag cagagcaaag aggtggccat ccgcatcttt cagggctgcc agtttcgctc cgtggaggct 1020. gtgcaggaga tcacagagta tgccaaaagc attcctggtt ttgtaaatct tgacttgaac 1080. ctctcctca atatggagtc ttttacacaat gctggcctcc ttgatgaata aagatggggt tctcatatcc gagggccaag gcttcatgac aagggagttt 1140 ctaaagagcc tgcgaaagcc ttttggtgac tttatggagc ccaagtttga gtttgctgtg 1200 aagttcaatg cactggaatt agatgacagc gacttggcaa tatttattgc tgtcattatt 1260 ctcagtggag accgcccagg tttgctgaat gtgaagccca ttgaagacat tcaagacaac 1320 ctgctacaag ccctggagct ccagctgaag ctgaaccacc ctgagtcctc acagctgttt 1380 gccaagctgc tccagaaaat gacagacctc agacagattg tcacggaaca cgtgcagcta 1440 ctgcaggtga tcaagaagac ggagacagac atgagtcttc acccgctcct gcaggagatc 1500 tacaaggact tgtac 1515 <210> 50 <211> 2241 <212> DNA <213> Homo sapiens <400> 50 atggcggacg aggcggccct cgcccttcag cccggcggct ccccctcggc ggcgggggcc 60 gacagggagg ccgcgtcgtc ccccgccggg gagccgctcc gcaagaggcc gcggagagat 120 ggtcccggcc tcgagcggag cccgggcgag cccggtgggg cggccccaga gcgtgaggtg 180 ccggcggcgg cccgggctg gcggcggcgg cgctgtggcg ggaggcggag 240 gcagaggcgg cggcggcagg cggggagcaa gaggcccagg cgactgcggc ggctggggaa 300 ggagacaatg ggccgggcct gcaggggcca tctcgggagc caccgctggc cgacaacttg 360 tacgacgaag acgacgacga cgaggggcgag gaggaggag agggcggcggc ggcggcgatt 420 gggtaccgag ataccttct gttcggtgat gaaattatca ctaatggttt tcattcctgt 480 gaaagtgatg agggatag agcctcacat gcaagctcta gtgactggac tccaaggcca 540 cggataggtc catatacttt tgttcagcaa catcttatga ttggcacaga tcctcgaaca 600 attcttaaag atttattgcc ggaacaata cctccacctg agttggatga tatgacactg 660 tggcagattg ttattatat ccttcagaa ccaccaaaa ggaaaaaag aaagatatt 720 atacaattg aagatgctgt gaaattactg caagagtgca aaaaattt agttctact 780 ggagctgggg tgtctgtttc atgtggaata cctgacttca ggtcaaggga tggtatttat 840 gctcgccttg ctgtagactt cccagatctt ccagatcctc aagcgatgtt tgatattgaa 900 tattcagaa aagatccaag accattctc aagtttgcaa aggaatata tcctggacaa 960 ttccagccat ctctctgtca caatcata gccttgtcag ataaggaagg aaaactactt 1020 cgcaactata cccagaacat agacacgctg gaacaggttg cgggaatcca aaggataatt 1080 cagtgtcatg gttcctttgc aacagcatct tgcctgatt gtaaatacaa agttgactgt 1140 gaagctgtac gaggagatat ttttaatcag gtagttccctc gatgtcctag gtgcccagct 1200 gatgaaccgc ttgctatcat gaaaccagag attgtgtttt ttggtgaaaa tttaccagaa 1260 cagtttcata gagccatgaa gtatgacaaa gatgaagttg acctcctcat tgttattggg 1320 tcttccctca aagtaagacc agtagcacta attccaagtt ccatacccca tgaagtgcct 1380 cagatattaa ttaatagaga accttgcct catctgcatt ttgatgtaga gcttcttgga 1440 gactgtgatg tcatattaa tgaattgtgt cataggttag gtggtgaata tgccaaactt 1500 tgctgtaacc ctgtaaagct ttcagaatt actgaaaac ctccacgaac acaaaagaa 1560 ttggcttt tgtcagagtt gccaccaca cctctcatg ttcagaaga ctcaagttca 1620 ccagaaagaa cttcaccacc agattcttca gtgattgtca cacttttaga ccaagcagct 1680 aagagtaatg atgatttaga tgtgtctgaa tcaaaaggtt gtatggaaga aaaaccacag 1740 gaagtacaaa cttctaggaa tgttgaaagt attgctgaac agatggaaaa tccggatttg 1800 aagaatgttg gttctagtac tggggagaaa aatgaaagaa cttcagtggc tggaacagtg 1860 agaaaatgct ggcctaatag agtggcaaag gagcagatta gtaggcggct tgatggtaat 1920 cagtatctgt ttttgccacc aaatcgttac attttccatg gcgctgaggt atattcagac 1980 tctgaagatg acgtcttatc ctctagttct tgtggcagta acagtgatag tgggacatgc 2040 cagagtccaa gtttagaaga acccatggag gatgaaagtg aaattgaaga attctacaat 2100 ggcttagaag atgagcctga tgttccagag agagctggag gagctggatt tgggactgat 2160 ggagatgatc aagaggcaat taatgaagct atatctgtga aacaggaagt aacagacatg 2220 aactatccat caaacaaatc a 2241 <210> 51 <211> 4323 <212> DNA <213> Homo sapiens <400> 51 atggcgacgg cggcggcagc ggcggcggtg atggctcctc cgggctgcc gggttcgtgc 60 cccaacttcg ccgtagtctg ctccttcttg gagcgctacg ggccgctgct agacctgcct 120 gagttgccgt tccctgagct ggagcgggtg ctgcaggcgc cgccgccgga cgtcggcaac 180 ggagaagtac caaaagaatt ggtggagctc catttgaagc tgatgaggaa aattggcaaa 240 tctgttactg cagacagatg ggaaaaatat ttgatcaaga tatgccaaga gtttaacagt 300 acctgggcat gggagatgga gaagaagggc tatcttgaaa tgagtgttga atgcaaacta 360 gcactcttaa agtacctctg tgagtgtcag tttgatgaca atctcaaatt caagaatatt 420 attaatgagg agatgccga tactatgcgt ctccagccaa ttggtcgaga caaagatggc 480 ctcatgtact ggtaccaatt ggatcaagat cacaatgtca gaatgtacat agaagaacaa 540 gatgatcaag atggctcttc atggaaatgc attgtcagaa atcgaaacga gttggctgag 600 actcttgcac tcctgaaagc acaaattgat cctgtactat tgaaaaactc tagccaacaa 660 gacaacctt ctcgggaaag tcccagctta gaggatgagg agactaaaaa agaggaagaa 720 acacctaaac agaggaaca gaaagaagt gaaagatga aaagtgagga gcagcctatg 780 gatttagaaa accgttctac agccaatgtt ctagaagaga ctactgtgaa aaaagaaaaa 840 gaagatgaaa aggaacttgt gaaactgcca gtcatagtga agctagaaaa acctttgcca 900 gaaaatgaag aaaaaagat tatchaaaaaaaaagtgatt ccttcaagga aaatgtcaaa 960 cccattaaag ttgaggtgaa ggaatgtaga gcagatccta aagataccaa aagtagcatg 1020 gagaagccag tggcacagga gcctgaaagg atcgaatttg gtggcaat taaatctctct 1080 cacgaaatta ctgagaaatc tactgagaa actgagaaac ttaaaaatga ccagcaggcc 1140 aagataccac taaaaaaacg agaaattaaa ctgagtgatg attttgacag tccagtcag 1200 ggaccttgt gtaaatcagt tactccaaaagagtttt tgaagatga aaaaaaca 1260 gaggagaga cttgtaaag gatctctaca atcactgctt tggtcatga agggaacag 1320 ctggtaaatg gagaagttag tgatgaaagg gtagctccaa attttaagac agaaccaata 1380 gagacaagt tttgagac aaggaag agctatagcc cctctagga cagaaatc 1440 atcacggagg gaaatggaac agagtcctta aattctgtca taacaagtat gaaaacaggt 1500 gagcttgaga aagaaacagc ccctttgagg aaagatgcag atagttcaat atcagtctta 1560 gagatccata gtcaaaaagc acaaatagag gaacccgatc ctccagaaat ggaaacttct 1620 cttgattctt ctgagatggc aaaagatctc tcttcaaaaa ctgctttatc ttccaccgag 1680 tcgtgtacca tgaaaggtga agagaagtct cccaaaacta agaaggataa gcgcccacca 1740 atcctagaat gtcttgaaaa gttagagaag tccaaaaaga cttttcttga taaggacgca 1800 caaagattga gtccaatacc agaagaagtt ccaaagagta ctctagagtc agaaaagcct 1860 ggctctcctg aggcagctga aacttctcca ccatctaata tcattgacca ctgtgagaaa 1920 ctagcctcag aaaaagaagt ggtagaatgc cagagtacaa gtactgttgg tggccagtct 1980 gtgaaaaaag tagacctaga aaccctaaaa gaggattctg agttcacaaa ggtagaaatg 2040 gataatctgg acaatgccca gacctctggc atagaggagc cttctgagac aaagggttct 2100 atgcaaaaaa gcaaattcaa atataagttg gttcctgaag aagaaaccac tgcctcagaa 2160 atacagaga taacctctga aaggcagaa gaggcatca attackacaat caggatatca 2220 agtcggaaaa agaagcccga ttctcccccc aaagttctag aaccagaaaa caagcaagg 2280 aagacagaaa aggagagga gaaaacaat gtgggtcgta ctttaagaag atctccaaga 2340 atatctagac ccactgcaaa agtggctgag atcagagatc agaagctga taaaaaaaga 2400 gggaaggag aagatgaggt ggaaaagg tcacagctt tgshaaaaaac tgaaaaaag 2460 gaattttga aaaatcaga gaaagataca attctaag tagcaggt aaacccaaa 2520 ggcaaagttc gatggactgg ttctcggaca cgtggcagat ggaaatattc cagcaatgat 2580 gaagtgaag gtctggcag tgaaaaatca tctgcagctt cagaagagga ggaagaaag 2640 gaaagtgaag aagccatcct agcagatgat gatgaaccat gcaaaaatg tggccttcca 2700 aaccatcctg agctattct tctgtgtgac tcttgcgata gtggatacca tactgcctgc 2760 cttcgccctc ctctgatgat catcccagat ggagaatggt tctgcccacc ttgccacat 2820 aaactgctct gtgaaaaatt agaggaacag ttgcaggatt tggatgttgc cttaaagaag 2880 aaagagcgtg ccgaacgaag aaagaacgc ttggtgtatg ttggtatcag tattgaaac 2940 atcattccctc cacaagagcc agactttct gaagagatcaag aaagaaagaa aaagattca 3000 aaaaaatcca aaagcaactt gcttgaaagg aggtcaacaa gaacaaggaa atgtataagc 3060 tacagatttg tgagtttga tgagcaatt tatgagcta tgaatg catcaagaa 3120 gccgatggag gaggagttgg ccgaggaaa gatatctcca ccatcacagg tcatcgtggg 3180 aaagacatct ctactatttt ggatgaagaa agaaaagaaaaacgacc ccagagggca 3240 gctgctgctc gaggagaa acggccggcga ttaaatgatc tggacagtga tagcaacctg 3300 gatgagaag agagcgagga tgaattcaag atcagtgag gatctcaag tgagttttgtt 3360 gtgtctgatg aaacccaga tgaagtgaa gagatccgc catctaatga tgacagtgac 3420 actgactttt gtagccgtag actgaggcga cacccctc ggccaatgag gcagagcagg 3480 cgtttgcgaa gaagacccc aaaaaaaaa tattccgatg atgatgaga ggaggaatct 3540 gaggagaata gtagagactc tgaagtgac tcagtgatg attttagtga tgattttgta 3600 gaaactcggc gaaggcggtc aaggaaat caghaagac aattaacta gaagaagac 3660 tcagaaagtg acggttccca gaagagtttg cgacgtggta aagaataag gcgagtacac 3720 aagcgaagac ttccagctc agagagtgaa gagagctatt tgtccaagaa ctctgaagat 3780 gatgagctag ctaaagaatc aaagcggtca gttcgaagc ggggccgaag cacagacgag 3840 tattcagaag spagatgagga gaggagga gaggaggca aaccatcccg caacggcta 3900 caccggattg agacggatga ggaggagt tgtgacaatg ctcatggaga tgcaatcag 3960 cctgcccgtg acagccagcc tagggtcctg ccctcagaac aagagagcac achaagcccc 4020 taccggatag aaagtgatga ggaagaggac tttgaaatg taggcaagt ggggagccca 4080 ttggactata gcttagtgga cttaccttca accaatggac agagccctgg caagccatt 4140 gagaacttga ttggcaagcc tactgagaag tctcagaccc ccaaggacaa cagcacagcc 4200 agtgcaagcc tagcctccaa tgggacaagt ggtgggcagg aggcaggc accagaagc 4260 gaggaagatg agcttttgag agtgactgac cttgttgatt atgtctgtaa cagtgaacag 4320 tta 4323 <210> 52 <211> 1122 <212> DNA <213> Homo sapiens <400> 52 atgtcaaggg ttccaagtcc tccacctccg gcagaaatgt cgagtggccc cgtagctgag 60 agttggtgct acacacagat caaggtagtg aaattctcct acatgtggac catcaataac 120 tttagctttt gccgggagga aatgggtgaa gtcattaaaa gttctacatt ttcatcagga 180 gcaaatgata aactgaaatg gtgtttgcga gtaaacccca aagggttaga tgaagaaagc 240 aaagattacc tgtcacttta cctgttactg gtcagctgtc caaagagtga agttcgggca 300 aaattcaaat tctccatcct gaatgccaag ggagaagaaa ccaaagctat ggagagtcaa 360 cgggcatata ggtttgtgca aggcaaagac tggggattca agaaattcat ccgtagagat 420 tttcttttgg atgaggccaa cgggcttctc cctgatgaca agcttaccct cttctgcgag 480 gtgagtgttg tgcaagattc tgtcaacatt tctggccaga ataccatgaa catggtaaag 540 gttcctgagt gccggctggc agatgagtta ggaggactgt gggagaattc ccggttcaca 600 gactgctgct tgtgtgttgc cggccaggaa ttccaggctc acaaggctat cttagcagct 660 cgttctccgg tttttagtgc catgtttgaa catgaaatgg aggagagcaa aaagaatcga 720 gttgaaatca atgatgtgga gcctgaagtt tttaaggaaa tgatgtgctt catttacacg 780 gggaaggctc caaacctcga caaaatggct gatgatttgc tggcagctgc tgacaagtat 840 gccctggagc gcttaaaggt catgtgtgag gatgccctct gcagtaacct gtccgtggag 900 aacgctgcag aaattctcat cctggccgac ctccacagtg cagatcagtt gaaaactcag 960 gcagtggatt tcatcaacta tcatgcttcg gatgtcttgg agacctctgg gtggaagtca 1020 atggtggtgt cacatcccca cttggtggct gaggcatacc gctctctggc ttcagcacag 1080 tgcccttttc tgggaccccc acgcaaacgc ctgaagcaat cc 1122 <210> 53 <211> 738 <212> DNA <213> Homo sapiens <400> 53 atgggacccc agcatttgag acttgtgcag ctgttctgcc ttctaggggc catctccact 60 ctgcctcggg ctggagctct tttgtgctat gaagcaacag cctcaagatt cagagctgtt 120 gctttccata actggaagtg gcttctgatg aggaacatgg tgtgtaagct gcaagagggc 180 tgcgaggaga cgctagtgtt cattgagaca gggactgcaa ggggagtcgt gggctttaaa 240 ggctgcagct cgtcttcgtc ttaccctgcg caaatctcct accttgtttc cccacccgga 300 gtgtccattg cctcctacag tcgcgtctgc cggtcttatc tctgcaacaa cctcaccaat 360 ttggagcctt ttgtgaaact caaggccagc actcctaagt ctatcacatc tgcgtcctgt 420 agctgcccga cctgtgtggg cgagcacatg aaggattgcc tcccaaattt tgtcaccact 480 aattcttgcc ccttggctgc ttctacgtgt tacagttcca ccttaaaatt tcaggcaggg 540 tttctcaata ccaccttcct cctcatgggg tgtgctcgtg aacataacca gcttttagca 600 gattttcatc atattgggag catcaaagtg actgaggtcc tcaacatctt agagaagtct 660 cagattgttg gtgcagcatc ctccaggcaa gatcctgctt ggggtgtcgt cttaggcctc 720 ctgtttgcct tcagggac 738 <210> 54 <211> 1503 <212> DNA <213> Homo sapiens <400> 54 atggtcagaa agcctgttgt gtccaccatc tccaaaggag gttacctgca gggaaatgtt 60 aacgggaggc tgccttccct gggcaacaag gagccacctg ggcaggagaa agtgcagctg 120 aagaggaaag tcactttact gaggggagtc tccattatca ttggcaccat cattggagca 180 ggaatcttca tctctcctaa gggcgtgctc cagaacacgg gcagcgtggg catgtctctg 240 accatctgga cggtgtgtgg ggtcctgtca ctatttggag cttgtctta tgctgaattg 300 ggaacaacta taaagaaatc tggaggtcat tacacatata ttttggaagt ctttggtcca 360 ttaccagctt ttgtacgagt ctgggtggaa ctcctcataa tacgccctgc agctactgct 420 gtgatatccc tggcatttgg acgctacatt ctggaaccat ttttattca atgtgaaatc 480 cctgaacttg cgatcaagct cattacagct gtgggcataa ctgtagtgat ggtcctaaat 540 agcatgagtg tcagctggag cgcccggatc cagatttct taaccttttg caagctcaca 600 gcaattctga taattatagt ccctggagtt atgcagctaa ttaaaggtca aacgcagaac 660 tttaaagacg ccttttcagg aagagattca agtattacgc ggttgccact ggctttttat 720 tatggaatgt atgcatatgc tggctggttt tacctcaact ttgttactga agaagtagaa 780 aaccctgaaa aaaccattcc ccttgcaata tgtatatcca tggccattgt caccattggc 840 tatgtgctga caaatgtggc ctactttacg accattaatg ctgaggagct gctgctttca 900 aatgcagtgg cagtgacctt ttctgagcgg ctactgggaa atttctcatt agcagttccg 960 atctttgttg ccctctcctg cttggctcc atgaacggtg gtgtgtttgc tgtctccagg 1020 ttattctatg ttgcgtctcg agagggtcac cttccagaaa tcctctccat gattcatgtc 1080 cgcaagcaca ctcctctacc agctgttatt gttttgcacc ctttgacaat gataatgctc 1140 ttctctggag acctcgacag tcttttgaat ttcctcagtt ttgccaggtg gctttttatt 1200 gggctggcag ttgctgggct gatttatctt cgatacaaat gcccagatat gcatcgtcct 1260 ttcaaggtgc cactgttcat cccagctttg ttttccttca catgcctctt catggttgcc 1320 ctttccctct attcggacccc atttagtaca gggattggct tcgtcatcac tctgactgga 1380 gtccctgcgt attatctctt tattatatgg gacaagaaac ccaggtggtt tagaataatg 1440 tcagagaaaa taaccagaac attacaaata atactggaag ttgtaccaga agaagataag 1500 tta 1503 <210> 55 <211> 1218 <212> DNA <213> Homo sapiens <400> 55 atgcatcctg ccgtcttcct atccttaccc gacctcagat gctcccttct gctcctggta 60 acttgggttt ttactcctgt aacaactgaa ataacaagtc ttgatacaga gaatatagat 120 gaaattttaa acaatgctga tgttgcttta gtaaattttt atgctgactg gtgtcgtttc 180 agtcagatgt tgcatccaat ttttgaggaa gcttccgatg tcattaagga agaatttcca 240 aatgaaaatc aagtagtgtt tgccagagtt gattgtgatc agcactctga catagcccag 300 agatacagga taagcaaata cccaaccctc aaattgtttc gtaatgggat gatgatgaag 360 agagaataca ggggtcagcg atcagtgaaa gcattggcag attacatcag gcaacaaaaa 420 agtgacccca ttcaagaaat tcgggactta gcagaaatca ccactcttga tcgcagcaaa 480 agaaatatca ttggatattt tgagcaaaag gactcggaca actatagagt ttttgaacga 540 gtagcgaata ttttgcatga tgactgtgcc tttctttctg catttgggga tgtttcaaaa 600 ccggaaagat atagtggcga caacataatc tacaaaccac cagggcattc tgctccggat 660 atggtgtact tgggagctat gacaaattttt gatgtgactt acaattggat tcaagataaa 720 tgtgttcctc ttgtccgaga aataacattt gaaaatggag aggaattgac agaagaagga 780 ctgccttttc tcatactctt tcacatgaaa gaagatacag aaagtttaga aatattccag 840 aatgaagtag ctcggcaatt aataagtgaa aaaggtacaa taaacttttt acatgccgat 900 tgtgacaaat ttagacatcc tcttctgcac atacagaaaa ctccagcaga ttgtcctgta 960 atcgctattg acagctttag gcatatgtat gtgtttggag acttcaaaga tgtattaatt 1020 cctggaaaac tcaagcaatt cgtatttgac ttacattctg gaaaactgca cagagaattc 1080 catcatggac ctgacccaac tgatacagcc ccaggagagc aagcccaaga tgtagcaagc 1140 agtccacctg agagctcctt ccagaaacta gcacccagtg aatataggta tactctattg 1200 agggatcgag atgagctt 1218 <210> 56 <211> 1515 <212> DNA <213> Homo sapiens <400> 56 atgcgcctcc gccgcctagc gctgttcccg ggtgtggcgc tgcttcttgc cgcggcccgc 60 ctcgccgctg cctccgacgt gctagaactc acggacgaca acttcgagag tcgcatctcc 120 gacacgggct ctgcgggcct catgctcgtc gagttcttcg ccccctggtg tggacactgc 180 aagagacttg cacctgagta tgaagctgca gctaccagat taaaaggaat agtcccatta 240 gcaaaggttg attgcactgc caacactaac acctgtaata aatatggagt cagtggatat 300 ccaaccctga agatatttag agatggtgaa gaagcaggtg cttatgatgg acctaggact 360 gctgatggaa ttgtcagcca cttgaagaag caggcaggac cagcttcagt gcctctcagg 420 actgaggaag aatttaagaa attcattagt gataaagatg cctctatagt aggttttttc 480 gatgattcat tcagtgaggc tcactccgag ttcctaaaag cagccagcaa cttgagggat 540 aactaccgat ttgcacatac gaatgttgag tctctggtga acgagtatga tgataatgga 600 gagggtatca tcttatttcg tccttcacat ctcactaaca agtttgagga caagactgtg 660 gcatatacag agcaaaaaat gaccagtggc aaaattaaaa agtttatcca ggaaaacatt 720 tttggtatct gccctcacat gacagaagac aataaagatt tgatacaggg caaggactta 780 cttattgctt actatgatgt ggactatgaa aagaacgcta aaggttccaa ctactggaga 840 aacagggtaa tgatggtggc aaagaaattc ctggatgctg ggcacaaact caactttgct 900 gtagctagcc gcaaaacctt tagccatgaa ctttctgatt ttggcttgga gagcactgct 960 ggagagattc ctgttgttgc tatcagaact gctaaaggag agaagttttgt catgcaggag 1020 gagttctcgc gtgatgggaa ggctctggag aggttcctgc aggattactt tgatggcaat 1080 ctgaagagat acctgaagtc tgaacctatc ccagagagca atgatgggcc tgtgaaggta 1140 gtggtagcag agaatttga tgaaatagtg aataatgaaa ataaagatgt gctgattgaa 1200 tttatgccc cttggtgtgg tcactgtaag aacctggagc ccaagtataa agaacttggc 1260 gagaagctca gcaaagacccc aatatcgtc atagccaaga tggatgccac agccaatgat 1320 gtgccttctc catatgaagt cagaggtttt cctaccatat acttctctcc agccaacaag 1380 aagctaaatc caaagaaata tgaaggtggc cgtgaattaa gtgattttat tagctatcta 1440 caaagagaag ctacaaaccc ccctgtaatt caagaagaaa aacccaagaa gaagaagaag 1500 gcacaggagg atctc 1515 <210> 57 <211> 822 <212> DNA <213> Homo sapiens <400> 57 atggaagctg ccccgtccag gttcatgttc ctcttatttc tcctcacgtg tgagctggct 60 gcagaagttg ctgcagaagt tgagaaatcc tcagatggtc ctggtgctgc ccaggaaccc 120 acgtggctca cagatgtccc agctgccatg gaattcattg ctgccactga ggtggctgtc 180 ataggcttct tccaggattt agaaatacca gcagtgccca tactccatag catggtgcaa 240 aaattcccag gcgtgtcatt tgggatcagc actgattctg aggttctgac acactacaac 300 atcactggga acaccatctg cctctttcgc ctggtagaca atgaacaact gaatttagag 360 gacgaagaca ttgaaagcat tgatgccacc aaattgagcc gtttcattga gatcaacagc 420 ctccacatgg tgacagagta caaccctgtg actgtgattg ggttattcaa cagcgtaatt 480 cagattcatc tcctcctgat aatgaacaag gcctccccag agtatgaaga gaacatgcac 540 agataccaga aggcagccaa gctcttccag gggaagattc tctttattct ggtggacagt 600 ggtatgaaag aaaatgggaa ggtgatatca tttttcaaac taaaggagtc tcaactgcca 660 gctttggcaa tttaccagac tctagatgac gagtgggata cactgcccac agcagaagtt 720 tccgtagagc atgtgcaaaa cttttgtgat ggattcctaa gtggaaaatt gttgaaagaa 780 aatcgtgaat cagaaggaaa gactccaaag gtggaactct ga 822 <210> 58 <211> 1872 <212> DNA <213> Homo sapiens <400> 58 atgcagccag atcccaggcc tagcggggct ggggcctgct gccgattcct gcccctgcag 60 tcacagtgcc ctgagggggc aggggacgcg gtgatgtacg cctccactga gtgcaaggcg 120 gaggtgacgc cctcccagca tggcaaccgc accttcagct acaccctgga ggatcatacc 180 aagcaggcct ttggcatcat gaacgagctg cggctcagcc agcagctgtg tgacgtcaca 240 ctgcaggtca agtaccagga tgcaccggcc gcccagttca tggcccacaa ggtggtgctg 300 gcctcatcca gccctgtctt caaggccatg ttcaccaacg ggctgcggga gcagggcatg 360 gaggtggtgt ccattgaggg tatccacccc aaggtcatgg agcgcctcat tgaattcgcc 420 tacacggcct ccatctccat gggcgagaag tgtgtcctcc acgtcatgaa cggtgctgtc 480 atgtaccaga tcgacagcgt tgtccgtgcc tgcagtgact tcctggtgca gcagctggac 540 cccagcaatg ccatcggcat cgccaacttc gctgagcaga ttggctgtgt ggagttgcac 600 cagcgtgccc gggagtacat ctacatgcat tttggggagg tggccaagca agaggagttc 660 ttcaacctgt cccactgcca actggtgacc ctcatcagcc gggacgacct gaacgtgcgc 720 tgcgagtccg aggtcttcca cgcctgcatc aactgggtca agtacgactg cgaacagcga 780 cggttctacg tccaggcgct gctgcgggcc gtgcgctgcc actcgttgac gccgaacttc 840 ctgcagatgc agctgcagaa gtgcgagatc ctgcagtccg actcccgctg caaggactac 900 ctggtcaaga tcttcgagga gctcaccctg cacaagccca cgcaggtgat gccctgccgg 960 gcgcccaagg tgggccgcct gatctacacc gcgggcggct acttccgaca gtcgctcagc 1020 tacctggagg cttacaaccc cagtgacggc acctggctcc ggttggcgga cctgcaggtg 1080 ccgcggagcg gcctggccgg ctgcgtggtg ggcgggctgt tgtacgccgt gggcggcagg 1140 aacaactcgc ccgacggcaa caccgactcc agcgccctgg actgttacaa ccccatgacc 1200 aatcagtggt cgccctgcgc ccccatgagc gtgccccgta accgcatcgg ggtgggggtc 1260 atcgatggcc acatctatgc cgtcggcggc tcccacggct gcatccacca caacagtgtg 1320 gagaggtatg agccagagcg ggatgagtgg cacttggtgg ccccaatgct gacacgaagg 1380 atcggggtgg gcgtggctgt cctcaatcgt ctcctttatg ccgtgggggg ctttgacggg 1440 acaaaccgcc ttaattcagc tgagtgttac tacccagaga ggaacgagtg gcgaatgatc 1500 acagcaatga acaccatccg aagcggggca ggcgtctgcg tcctgcacaa ctgtatctat 1560 gctgctgggg gctatgatgg tcaggaccag ctgaacagcg tggagcgcta cgatgtggaa 1620 acagagacgt ggactttcgt agcccccatg aagcaccggc gaagtgccct ggggatcact 1680 gtccaccagg ggagaatcta cgtccttgga ggctatgatg gtcacacgtt cctggacagt 1740 gtggagtgtt acgacccaga tacagacacc tggagcgagg tgacccgaat gacatcgggc 1800 cggagtgggg tgggcgtggc tgtcaccatg gagccctgcc ggaagcagat tgaccagcag 1860 aactgtacct gt 1872 <210> 59 <211> 2274 <212> DNA <213> Homo sapiens <400> 59 atggcggtgt ctgccgggtc cgcgcggacc tcgcccagct cagataaagt acagaaagac 60 aaggctgaac tgatctcagg gcccaggcag gacagccgaa tagggaaact cttgggtttt 120 gagtggacag atttgtccag ttggcggagg ctggtgaccc tgctgaatcg accaacggac 180 cctgcaagct tagctgtctt tcgttttctt tttgggttct tgatggtgct agacattccc 240 caggagcggg ggctcagctc tctggaccgg aaataccttg atgggctgga tgtgtgccgc 300 ttccccttgc tggatgccct acgcccactg ccacttgact ggatgtatct tgtctacacc 360 atcatgtttc tgggggcact gggcatgatg ctgggcctgt gctaccggat aagctgtgtg 420 ttattcctgc tgccatactg gtatgtgttt ctcctggaca agacatcatg gaacaaccac 480 tcctatctgt atgggttgtt ggcctttcag ctaacattca tggatgcaaa ccactactgg 540 tctgtggacg gtctgctgaa tgcccatagg aggaatgccc acgtgcccct ttggaactat 600 gcagtgctcc gtggccagat cttcattgtg tacttcattg cgggtgtgaa aaagctggat 660 gcagactggg ttgaaggcta ttccatggaa tatttgtccc ggcactggct cttcagtccc 720 ttcaaactgc tgttgtctga ggagctgact agcctgctgg tcgtgcactg gggtgggctg 780 ctgcttgacc tctcagctgg tttcctgctc ttttttgatg tctcaagatc cattggcctg 840 ttctttgtgt cctacttcca ctgcatgaat tcccagcttt tcagcattgg tatgttctcc 900 tacgtcatgc tggccagcag ccctctcttc tgctcccctg agtggcctcg gaagctggtg 960 tcctactgcc cccgaaggtt gcaacaactg ttgcccctca aggcagcccc tcagcccagt 1020 gtttcctgtg tgtataagag gagccggggc aaaagtggcc agaagccagg gctgcgccat 1080 cagctgggag ctgccttcac cctgctctac ctcctggagc agctattcct gccctattct 1140 cattttctca cccagggcta taacaactgg acaaatgggc tgtatggcta ttcctgggac 1200 atgatggtgc actcccgctc ccaccagcac gtgaagatca cctaccgtga tggccgcact 1260 ggcgaactgg gctaccttaa ccctggggta tttacacaga gtcggcgatg gaaggatcat 1320 gcagacatgc tgaagcaata tgccacttgc ctgagccgcc tgcttcccaa gtataatgtc 1380 actgagcccc agatctactt tgatatttgg gtctccatca atgaccgctt ccagcagagg 1440 atttttgacc ctcgtgtgga catcgtgcag gccgcttggt caccctttca gcgcacatcc 1500 tgggtgcaac cactcttgat ggacctgtct ccctggaggg ccaagttaca ggaaatcaag 1560 agcagcctag acaaccacac tgaggtggtc ttcattgcag atttccctgg actgcacttg 1620 gagaattttg tgagtgaaga cctgggcaac actagcatcc agctgctgca gggggaagtg 1680 actgtggagc ttgtggcaga acagaagaac cagactcttc gagagggaga aaaaatgcag 1740 ttgcctgctg gtgagtacca taaggtgtat acgacatcac ctagcccttc ttgctacatg 1800 tacgtctatg tcaacactac agagcttgca ctggagcaag acctggcata tctgcaagaa 1860 ttaaaggaaa aggtggagaa tggaagtgaa acagggcctc tacccccaga gctgcagcct 1920 ctgttggaag gggaagtaaa agggggccct gagccaacac ctctggttca gacctttctt 1980 agacgccaac aaaggctcca ggagattgaa cgccggcgaa atactccttt ccatgagcga 2040 ttcttccgct tcttgttgcg aaagctctat gtctttcgcc gcagcttcct gatgacttgt 2100 atctcacttc gaaatctgat attaggccgt ccttccctgg agcagctggc ccaggaggtg 2160 acttatgcaa acttgagacc ctttgaggca gttggagaac tgaatccctc aaacacggat 2220 tcttcacatt ctaatcctcc tgagtcaaat cctgatcctg tccactcaga gttc 2274 <210> 60 <211> 2103 <212> DNA <213> Homo sapiens <400> 60 atggcggtgt ctgccgggtc cgcgcggacc tcgcccagct cagggttctt gatggtgcta 60 gacattcccc aggagcgggg gctcagctct ctggaccgga aataccttga tgggctggat 120 gtgtgccgct tccccttgct ggatgcccta cgcccactgc cacttgactg gatgtatctt 180 gtctacacca tcatgtttct gggggcactg ggcatgatgc tgggcctgtg ctaccggata 240 agctgtgtgt tattcctgct gccatactgg tatgtgtttc tcctggacaa gacatcatgg 300 aacaaccact cctatctgta tgggttgttg gcctttcagc taacattcat ggatgcaaac 360 cactactggt ctgtggacgg tctgctgaat gcccatagga ggaatgccca cgtgcccctt 420 tggaactatg cagtgctccg tggccagatc ttcattgtgt acttcattgc gggtgtgaaa 480 aagctggatg cagactgggt tgaaggctat tccatggaat atttgtcccg gcactggctc 540 ttcagtccct tcaaactgct gttgtctgag gagctgacta gcctgctggt cgtgcactgg 600 ggtgggctgc tgcttgacct ctcagctggt ttcctgctct tttttgatgt ctcaagatcc 660 attggcctgt tctttgtgtc ctacttccac tgcatgaatt cccagctttt cagcattggt 720 atgttctcct acgtcatgct ggccagcagc cctctcttct gctcccctga gtggcctcgg 780 aagctggtgt cctactgccc ccgaaggttg caacaactgt tgcccctcaa ggcagcccct 840 cagcccagtg tttcctgtgt gtataagagg agccggggca aaagtggcca gaagccaggg 900 ctgcgccatc agctgggagc tgccttcacc ctgctctacc tcctggagca gctattcctg 960 ccctattctc attttctcac ccagggctat aacaactgga caaatgggct gtatggctat 1020 tcctgggaca tgatggtgca ctcccgctcc caccagcacg tgaagatcac ctaccgtgat 1080 ggccgcactg gcgaactggg ctaccttaac cctggggtat ttacacagag tcggcgatgg 1140 aaggatcatg cagacatgct gaagcaatat gccacttgcc tgagccgcct gcttcccaag 1200 tataatgtca ctgagcccca gatctacttt gatatttggg tctccatcaa tgaccgcttc 1260 cagcagagga tttttgaccc tcgtgtggac atcgtgcagg ccgcttggtc accctttcag 1320 cgcacatcct gggtgcaacc actcttgatg gacctgtctc cctggagggc caagttacag 1380 gaaatcaaga gcagcctaga caaccacact gaggtggtct tcattgcaga tttccctgga 1440 ctgcacttgg agaattttgt gagtgaagac ctgggcaaca ctagcatcca gctgctgcag 1500 ggggaagtga ctgtggagct tgtggcagaa cagaagaacc agactcttcg agagggagaa 1560 aaaatgcagt tgcctgctgg tgagtaccat aaggtgtata cgacatcacc tagcccttct 1620 tgctacatgt acgtctatgt caacactaca gagcttgcac tggagcaaga cctggcatat 1680 ctgcaagaat taaaggaaaa ggtggagaat ggaagtgaaa cagggcctct acccccagag 1740 ctgcagcctc tgttggaagg ggaagtaaaa gggggccctg agccaacacc tctggttcag 1800 acctttctta gacgccaaca aaggctccag gagattgaac gccggcgaaa tactcctttc 1860 catgagcgat tcttccgctt cttgttgcga aagctctatg tctttcgccg cagcttcctg 1920 atgacttgta tctcacttcg aaatctgata ttaggccgtc cttccctgga gcagctggcc 1980 caggaggtga cttatgcaaa cttgagaccc tttgaggcag ttggagaact gaatccctca 2040 aacacggatt cttcacattc taatcctcct gagtcaaatc ctgatcctgt ccactcagag 2100 ttc 2103 <210> 61 <211> 528 <212> DNA <213> Homo sapiens <400> 61 atggcggctc ccgtcctgct aagagtgtcg gtgccgcggt gggagcgggt ggcccggtat 60 gcagtgtgcg ctgccggaat cctgctctcc atctacgcct accacgtgga gcgggagaag 120 gagcgggacc ccgagcaccg ggccctctgc gacctggggc cctgggtgaa gtgctccgcc 180 gcccttgcct ccagatgggg tcgaggattt ggtcttttgg gttccatttt tggaaaggat 240 ggtgtattaa accagccaaa cagtgtcttt ggacttatat tttatatact acagttatta 300 cttggcatga cagcaagcgc tgtggcggct ttgatcctca tgacgtcctc catcatgtcg 360 gtcgtggggt ccctgtacct ggcctacatt ctgtactttg tgctgaagga gttctgcatc 420 atctgcatcg tcacgtacgt gctgaacttc cttcttctca ttatcaacta caaacgacta 480 gtttacttga acgaggcctg gaagcggcag ctgcaaccca agcaggac 528 <210> 62 <211> 240 <212> DNA <213> Homo sapiens <400> 62 atgaaactgt caggcatgtt tctgctcctc tctctggctc ttttctgctt tttaacaggt 60 gtcttcagtc agggaggaca ggttgactgt ggtgagttcc aggaccccaa ggtctactgc 120 actcgggaat ctaacccaca ctgtggctct gatggccaga catatggcaa taaatgtgcc 180 ttctgtaagg ccatagtgaa aagtggtgga aagattagcc taaagcatcc tggaaaatgc 240 <210> 63 <211> 1296 <212> DNA <213> Escherichia coli <400> 63 atgcaagttt cagttgaaac cactcaagc cttggccgcc gtgtaacgat tactatcgct 60 gctgacagca tcgagaccgc tgttaaaagc gagctggtca acgttgcgaa aaaagtacgt 120 attgacggct tccgcaaagg caaagtgcca atgaatatcg ttgctcagcg ttggcgcg 180 tctgtacgcc aggacgttct gggtgacctg atgagccgta acttcattga cgccatcatt 240 aaagaaaaaa tcaatccggc tggcgcaccg acttatgttc cgggcgaata caagctgggt 300 gaagacttca cttactctgt agagtttgaa gtttatccgg aagttgaact gcagggtctg 360 gaagcgatcg aagttgaaaa accgatcgtt gaagtgaccg acgctgacgt tgacggcatg 420 ctggatactc tgcgtaaaca gcaggcgacc tggaaagaaa aagacggcgc tgttgaagca 480 gaagaccgg taaccatcga cttcaccggt tctgtagacg gcgaagagtt cgaaggcggt 540 aaagcgtctg atttcgtact ggcgatgggc cagggtcgta tgatcccggg ctttgaagac 600 ggtatcaaag gccacaaagc tggcgaagag ttcaccatcg acgtgacctt cccggaagaa 660 taccacgcag aaaacctgaa aggtaaagca gcgaaattcg ctatcaacct gaagaaagtt 720 gaagagcgtg aactgccgga actgactgca gaattcatca aacgtttcgg cgttgaagat 780 ggttccgtag aaggtctgcg cgctgaagtg cgtaaaaaca tggagcgcga gctgaagagc 840 gccatccgta accgcgttaa gtctcaggcg atcgaaggtc tggtaaaagc taacgacatc 900 gacgtaccgg ctgcgctgat cgacagcgaa atcgacgttc tgcgtcgcca ggctgcacag 960 cgtttcggtg gcaacgaaaa acaagctctg gaactgccgc gcgaactgtt cgaagaacag 1020 gctaaacgcc gcgtagttgt tggcctgctg ctgggcgaag ttatccgcac caacgagctg 1080 aaagctgacg aagagcgcgt gaaaggcctg atcgaagaga tggcttctgc gtacgaagat 1140 ccgaaagaag ttatcgagtt ctacagcaaa aacaaagaac tgatggacaa catgcgcaat 1200 gttgctctgg aagaacaggc tgttgaagct gtactggcga aagcgaaagt gactgaaaaa 1260 gaaaccactt tcaacgagct gatgaaccag caggcg 1296 <210> 64 <211> 453 <212> DNA <213> Homo sapiens <400> 64 atgatggcag aagagcacac agatctcgag gcccagatcg tcaaggatat ccactgcaag 60 gagattgacc tggtgaaccg agaccccaag aacattaacg aggacatagt caaggtggat 120 tttgaagacg tgatcgcaga gcctgtgggc acctacagct ttgacggcgt gtggaaggtg 180 agctacacca ccttcactgt ctccaagtac tggtgctacc gtctgttgtc cacgctgctg 240 ggcgtcccac tggccctgct ctggggcttc ctgttcgcct gcatctcctt ctgccacatc 300 tgggcggtgg tgccatgcat taagagctac ctgatcgaga tccagtgcat cagccacatc 360 tactcactct gcatccgcac cttctgcaac ccactcttcg cggccctggg ccaggtctgc 420 agcagcatca aggtggtgct gcggaaggag gtc 453 <210> 65 <211> 2238 <212> DNA <213> Homo sapiens <400> 65 atgctggtgc tcgggctgct ggtagccgga gcggcggacg gatgcgagct tgtgccccgg 60 cacctccgcg ggcggcgggc gactggctct gccgcaactg ccgcctcctc tcccgccgcg 120 gcggccggcg atagcccggc gctcatgaca gatccctgca tgtcactgag tccaccatgc 180 tttacagaag agacagatt tagtctgaa gctctcaa caatacata acaatggat 240 gatgacaag atggtggaat tgagtagag gaagtgag attcatcag agagaatg 300 aaataaag atgctacta taacacagc catctgcaca gagaata acataacg 360 attgaggatt tatggaacg atggaaaca tcagaagttc atattggac ccttgagac 420 actctcagt ggttgataga gtttgttgaa ctaccccaat atgagaagaa ttttagagac 480 aacaatgtca aaggaacgac acttcccagg atagcagtgc acgaaccttc atttatgatc 540 tcccagttga aaatcagtga ccggagtcac agacaaaac ttcagctcaa ggcattgat 600 gtggttttgt ttggacctct aacacgccca cctcatact ggatgaaaga ttttactc 660 acagtttcta tagtattgg tgttggaggc tgctgttg cttatacgca gaataagaca 720 tcaaagaac atgttgcaaa atgatgaaa gatttagaga gcttacaaac tgcagaccaa 780 agtctaatgg acttacaaga gaggcttga aaggcacagg aagaaacag aaatgttgct 840 gtagaaaagc aaatttaga gcgcaaatg atggatgaa tcaattatgc aaaggagg 900 gcttgtcggc tgagagct aagggagg gctgaatgtg aattgagtag acgtcagtat 960 gcagaacagg aattggaaca gttcgcatg gctctgaaaa aggccgaaaa agaatttgaa 1020 ctgagaagca gttggtctgt tccagatgca cttcagaat ggctcagtt aacacatgaa 1080 gtagaagtgc atactacaa tattaaaga caaacgctg aaatgcagct agctattgct 1140 aaagatgagg cagaaaaaat taaaaagaag agaagcacag tctttgggac tctgcacgtt 1200 gcacacagct cctccctaga tgaggtagac cacaaattc tggagcaa gaagctctc 1260 tctgagttga caactgttt acgagaacga cttttcgct ggcacaaat tgagaagaatc 1320 tgtggctttc agatagccca taactcagga ctcccagcc tgaccctc cctttattct 1380 gatcacagct gggtggtgat gcccagagctc tccattccac cctatccaat tgctggagga 1440 gttgatgact tagatgaaga cacaccccca atagtgtcac aatttcccgg gaccatggct 1500 aaacctcctg gatcattagc cagaagcagc agcctgtgcc gttcacgccg cagcattgtg 1560 ccgtcctcgc ctcagcctca gggagctcag cttgctccac acgcccccca cccgtcacac 1620 cctcggcacc ctcaccaccc gcaacacaca ccacactcct tgccttcccc tgatccagat 1680 atcctctcag tgtcaagttg ccctgcgctt tatcgaaatg aagaggagga agaggccatt 1740 tacttctctg ctgaaaagca atgggaagtg ccagacacag cttcagaatg tgactcctta 1800 aattcttcca ttggaaggaa acagtctcct cctttaagcc tcgagatata ccaaacatta 1860 tctccgcgaa agatatcaag agatgaggtg tccctagagg attcctcccg aggggattcg 1920 cctgtaactg tggatgtgtc ttggggttct cccgactgtg taggtctgac agaaactaag 1980 agtatgatct tcagtcctgc aagcaaagtg tacaatggca ttttggagaa atcctgtagc 2040 atgaaccagc tttccagtgg catcccggtg cctaaacctc gccacacatc atgttcctca 2100 gctggcaacg acagtaaacc agttcaggaa gccccaagtg ttgccagaat aagcagcatc 2160 ccacatgacc tttgtcataa tggagagaaa agcaaaaagc catcaaaaat caaaagcctt 2220 tttaagaaga aatctaag 2238 <210> 66 <211> 2262 <212> DNA <213> Homo sapiens <400> 66 atgctggtgc tcggctgct ggtagccgga gcggcggacg gatgcgagct tgtgccccgg 60 cacctccgcg ggcgggggc gactggctct gccgcaactg ccgccctc tcccgccgcg 120 gcggccggcg atagcccggc gctcatgaca gatccctgca tgtcactgag tccaccatgc 180 tttacagaag agacagatt tagtctgaa gctctcaa caatacata acaatggat 240 gatgacaag atggtggaat tgagtagag gaagtgag attcatcag agagaatg 300 aaataaag atgctacta taacacagc catctgcaca gagaata acataacg 360 attgaggatt tatggaacg atggaaaca tcagaagttc atattggac ccttgagac 420 actctcagt ggttgataga gtttgttgaa ctaccccaat atgagaagaa ttttagagac 480 aacaatgtca aaggaacgac acttcccagg atagcagtgc acgaaccttc atttatgatc 540 tcccagttga aaatcagtga ccggagtcac agacaaaac ttcagctcaa ggcattgat 600 gtggttttgt ttggacctct aacacgccca cctcatact ggatgaaaga ttttactc 660 acagtttcta tagtattgg tgttggaggc tgctgttg cttatacgca gaataagaca 720 tcaaaagaac atgttgcaaa aatgatgaaa gatttagaga gcttacaaac tgcagagcaa 780 agtctaatgg acttacaaga gaggcttgaa aaggcacagg aagaaaacag aaatgttgct 840 gtagaaaagc aaaatttaga gcgcaaaatg atggatgaaa tcaattatgc aaaggaggag 900 gcttgtcggc tgagagagct aagggaggga gctgaatgtg aattgagtag acgtcagtat 960 gcagaacagg aattggaaca ggttcgcatg gctctgaaaa aggccgaaaa agaatttgaa 1020 ctgagaagca gttggtctgt tccagatgca cttcagaaat ggcttcagtt aacacatgaa 1080 gtagaagtgc aatactacaa tattaaaaga caaaacgctg aatgcagct agctattgct 1140 aaagatgagg ttgctgcttc atatctgatt caggcagaaa aaattaaaaa gaagagaagc 1200 acagtctttg ggactctgca cgttgcacac agctcctccc tagatgaggt agaccacaaa 1260 attctggaag caaagaaagc tctctctgag ttgacaactt gtttacgaga acgactttt 1320 cgctggcaac aaattgagaa gatctgtggc tttcagatag cccataactc aggactcccc 1380 agcctgacct cttcccttta ttctgatcac agctgggtgg tgatgcccag agtctccatt 1440 ccaccctatc caattgctgg aggagttgat gacttagatg aagacacacc cccaatagtg 1500 tcacaatttc ccgggaccat ggctaaacct cctggatcat tagccagaag cagcagcctg 1560 tgccgttcac gccgcagcat tgccgtcc tcgcctcagc ctcagcgagc tcagcttgct 1620 ccacacgccc cccacccgtc acaccctcgg caccctcacc acccgcaaca cacaccacac 1680 tccttgcctt cccctgatcc agatatcctc tcagtgtcaa gttgccctgc gctttatcga 1740 aatgaagagg aggaagaggc catttacttc tctgctgaaa agcaatggga agtgccagac 1800 acagcttcag aatgtgactc cttaaattct tccattggaa ggaaacagtc tcctccttta 1860 agcctcgaga tataccaaac attatctccg cgaaagatat caagagatga ggtgtcccta 1920 gaggattcct cccgagggga ttcgcctgta actgtggatg tgtcttgggg ttctcccgac 1980 tgtgtaggtc tgacagaaac taagagtatg atcttcagtc ctgcaagcaa agtgtacaat 2040 ggcattttgg agaaatcctg tagcatgaac cagctttcca gtggcatccc ggtgcctaaa 2100 cctcgccaca catcatgttc ctcagctggc aacgacagta aaccagttca ggaagcccca 2160 agtgttgcca gaataagcag catcccacat gacctttgtc ataatggaga gaaaagcaaa 2220 aagccatcaa aaatcaaaag cctttttaag aagaaatcta ag 2262 <210> 67 <211> 2055 <212> DNA <213> Homo sapiens <400> 67 atggatgtat gcgtccgtct tgccctgtgg ctcctctggg gactcctcct gcaccagggc 60 cagagcctca gccatagtca cagtgagaag gcgacaggaa ccagctcggg ggccaactct 120 gaggagtcca ctgcagcaga gttttgccga attgacaagc ccctgtgtca cagtgaggat 180 gagaaactca gcttcgaggc agtccgtaac atccacaaac tgatggacga tgatgccaat 240 ggtgatgtgg atgtggaaga aagtgatgag ttcctgaggg aagacctcaa ttaccatgac 300 ccaacagtga aacacagcac cttccatggt gaggataagc tcatcagcgt ggaggacctg 360 tggaaggcat ggaagtcatc agaagtatac aattggaccg tggatgaggt ggtacagtgg 420 ctgatcacat atgtggagct gcctcagtat gaggagacct tccggaagct gcagctcagt 480 ggccatgcca tgccaaggct ggctgtcacc aacaccacca tgacagggac tgtgctgaag 540 atgacagacc ggagtcatcg gcagaagctg cagctgaagg ctctggatac agtgctcttt 600 gggcctctc tcttgactcg ccataatcac ctcaaggact tcatgctggt ggtgtctatc 660 gttattggtg tgggcggctg ctggtttgcc tatatccaga accgttactc caaggagcac 720 atagaagaa tgatgaagga cttggagggg ttacaccgag ctgagcagag tctgcatgac 780 cttcaggaaa ggctgcacaa ggcccaggag gagcaccgca cagtggaggt ggagaaggtc 840 catctggaaa agaagctgcg cgatgagatc aaccttgcta agcaggaagc ccagcggctg 900 aaggagctgc gggagggtac tgagaatgag cggagccgcc aaaaatatgc tgaggaggag 960 ttggagcagg ttcgggaggc cttgaggaaa gcagagaagg agctagaatc tcacagctca 1020 tggtatgctc cagaggccct tcagaagtgg ctgcagctga cacatgaggt ggaggtgcaa 1080 tattacaaca tcaagaagca aaatgctgag aagcagctgc tggtggccaa ggagggggct 1140 gagaaaaaaaaagaag aaacacactc tttggcacct tccacgtggc ccacagctct 1200 tccctggatg atgtagatca taaaattcta acagctaagc aagcactgag cgaggtgaca 1260 gcagcattgc gggagcgcct gcaccgctgg caacagatcg agatcctctg tggcttccag 1320 attgtcaaca accctggcat ccactcactg gtggctgccc tcaacataga ccccagctgg 1380 atgggcagta cacgccccaa ccctgctcac ttcatcatga ctgacgacgt ggatgacatg 1440 gatgaggaga ttgtgtctcc cttgtccatg cagtccccta gcctgcagag cagtgttcgg 1500 cagcgcctga cggagccaca gcatggcctg ggatctcaga gggatttgac ccattccgat 1560 tcggagtcct ccctccacat gagtgaccgc cagcgtgtgg cccccaaacc tcctcagatg 1620 agccgtgctg cagacgaggc tctcaatgcc atgacttcca atggcagcca ccggctgatc 1680 gagggggtcc acccagggtc tctggtggag aaactgcctg acagccctgc cctggccaag 1740 aaggcattac tggcgctgaa ccatgggctg gacaaggccc acagcctgat ggagctgagc 1800 ccctcagccc cacctggtgg ctctccacat ttggattctt cccgttctca cagccccagc 1860 tccccagacc cagacacacc atctccagtt ggggacagcc gagccctgca agccagccga 1920 aacacacgca ttccccacct ggctggcaag aaggctgtgg ctgaggagga taatggctct 1980 attggcgagg aaacagactc cagcccaggc cggaagaagt ttcccctcaa aatctttaag 2040 aagcctctta agaag 2055 <210> 68 <211> 903 <212> DNA <213> Homo sapiens <400> 68 atgcatccgg agcccgcccc gcccccgagc cgcagcagtc ccgagcttcc cccaagcggc 60 ggcagcacca ccagcggcag ccgccggagc cgccgccgca gcggggacgg ggagcccccg 120 ggggccccgc caccgccgcc gtccgccgtc acctacccgg actggatcgg ccagagttac 180 tccgaggtga tgagcctcaa cgagcactcc atgcaggcgc tgtcctggcg caagctctac 240 ttgagccgcg ccaagcttaa agcctccagc cggacctcgg ctctgctctc cggcttcgcc 300 atggtggcaa tggtggaggt gcagctggac gctgaccacg actacccacc ggggctgctc 360 atcgccttca gtgcctgcac cacagtgctg gtggctgtgc acctgtttgc gctcatgatc 420 agcacctgca tcctgcccaa catcgaggcg gtgagcaacg tgcacaatct caactcggtc 480 aaggagtccc cccatgagcg catgcaccgc cacatcgagc tggcctgggc cttctccacc 540 gtcatcggca cgctgctctt cctagctgag gtggtgctgc tctgctgggt caagttcttg 600 cccctcaaga agcagccagg ccagccaagg cccaccagca agccccccgc cagtggcgca 660 gcagccaacg tcagcaccag cggcatcacc ccgggccagg cagctgccat cgcctcgacc 720 accatcatgg tgcccttcgg cctgatcttt atcgtcttcg ccgtccactt ctaccgctca 780 ctggttagcc ataagactga ccgacagttc caggagctca acgagctggc ggagtttgcc 840 cgcttacagg accagctgga ccacagaggg gaccaccccc tgacgcccgg cagccactat 900 gcc 903 <210> 69 <211> 762 <212> DNA <213> Homo sapiens <400> 69 atgagtgctg agcttaacgt gcctatcgac ccctctgctc ctgcctgccc tgagcccggc 60 cataagggca tggattaccg ggactgggtc cgccgcagct acctggaact ggtcacctct 120 aaccaccact cggtacaggc cctgtcgtgg cggaagctct acctgagcag ggccaagctg 180 aaggcctcca gcaggacctc cgccctcctc tccggctttg ccatggtggc catggtggag 240 gtgcagctgg agacgcagta ccagtacccg cggccgctgc tgattgcctt cagcgcctgc 300 accacggtgc tggtggccgt gcacctgttc gccctcctca tcagcacctg catcctgccc 360 aatgtggagg ccgtgagcaa catccacaac ctgaactcca tcagcgagtc cccgcatgag 420 cgcatgcacc cctacatcga gctggcctgg ggcttctcca ccgtgcttgg catcctactc 480 ttcctggccg aggtggtgct gctctgctgg atcaagttcc tccccgtgga tgcccggcgc 540 cagcctggcc ccccacctgg ccctgggagt cacacgggct ggcaggccgc cctggtgtcc 600 accatcatca tggtgcccgt gggcctcatc ttcgtggtct tcaccatcca cttctaccgc 660 tccctggtgc gccacaaaac ggagcgccac aaccgcgaga tcgaggagct ccacaagctc 720 aaggtccagc tggacgggca tgagcgcagc ctgcaggtct tg 762 <210> 70 <211> 885 <212> DNA <213> Homo sapiens <400> 70 atgaagggcg gcgaggggga cgcgggcgag caggccccgc tgaaccctga gggcgagagc 60 cctgcaggct cggccacgta ccgggagttc gtgcaccgcg gctacctgga cctcatgggg 120 gccagtcagc actcgctgcg ggcgctcagc tggcgccgcc tctacctcag ccgggccaag 180 ctcaaagctt ccagccgcac gtctgccttg ctctcgggct tcgccatggt ggccatggtg 240 gaggtgcagc tggagagtga ccacgagtac ccaccaggcc tgctggtggc cttcagtgcc 300 tgcaccaccg tgctggtggc tgtgcacctc tttgcactca tggtctccac gtgtctgctg 360 ccccacattg aagctgtgag caacatccac aacctcaact ctgtccacca gtcgccacac 420 cagagactgc accgctacgt ggagctggcc tggggcttct ccactgccct gggcaccttt 480 ctcttccttg ctgaagttgt cctggttggt tgggtcaagt ttgtgcccat tggggctccc 540 ttggacacac cgacccccat ggtgcccaca tcccgggtgc ccgggactct ggcaccagtg 600 gctacctccc ttagtccagc ttccaatctc ccacggtcct ctgcgtctgc agcaccgtcc 660 caggctgagc cagcctgccc accccggcaa gcctgtggtg gtggtggggc ccatgggcca 720 ggctggcaag cagccatggc ctccacagcc atcatggtac ccgtggggct cgtgtttgtg 780 gcctttgccc tgcatttcta ccgctccttg gtggcacaca agacagaccg ctacaagcag 840 gaactagagg aactgaatcg cctgcagggg gagctgcagg ctgtg 885 <210> 71 <211> 1752 <212> DNA <213> Homo sapiens <400> 71 atgaagatga tgctggtgcg ccggttccgc gtgctcatcc tgatggtgtt cctggtggcc 60 tgcgcgctgc acatcgccct ggacctgctg cccaggctgg agcgacgcgg cgcgcggccc 120 tcgggggagc ccggctgttc gtgcgcgcag cccgccgccg aggtggccgc gcccggctgg 180 gcccaggttc ggggccgccc cggggagccc ccggccgcct cctccgccgc cggcgacgcg 240 ggctggccca acaagcacac gctccgcatc ctgcaggact tcagctccga cccctcctcc 300 aacctctcgt cccactcgct ggagaaactg ccgcccgcgg ccgagccggc cgagcgcgcc 360 ttgcgggggc gggatcccgg cgccctaaga ccccacgacc ccgcgcaccg gccgctgctg 420 cgagaccccg gcccgcgtcg gtccgagtcg ccccccggcc ccggcggaga cgcctccctc 480 ctggccaggc tgttcgagca cccgctttac cgggtggcgg ttccgccgct cacggaggag 540 gacgtcctgt tcaatgtgaa cagcgacacc aggctcagcc ccaaagcggc ggagaacccg 600 gactggccgc atgcgggtgc tgaaggtgca gaattcctct cccccgggga ggcggccgtg 660 gactcctatc ccaactggct caagttccac attggtatca accggtacga gctgtactcc 720 agacacaacc cggccatcga ggccctgctg cacgacctca gctcccagag gatcaccagc 780 gtggccatga agtcgggggg cacgcagctg aagctcatca tgaccttcca gaattacggg 840 caagcgctgt tcaaacccat gaaaacg agggagcagg agacacccc tgactttttt 900 tatttctctg actacgagag gcacaatgcg gagattgctg ccttccacct gcacaggatc 960 ctggacttcc gccgggtccc tcccgtggcc ggcaggatgg tcaacatgac caaggagatc 1020 cgggacgtca cacgggacaa gaagctctgg aggaccttct tcatctctcc agccaacaac 1080 atctgcttct acggcgagtg ttcctactac tgctccacgg agcacgccct gtgcgggaag 1140 ccagaccaga tcgagggctc gctggcggcc ttcctgcccg acctgtccct ggccaagagg 1200 aagacctggc ggaacccttg gcggcgttcc taccacaagc gcaagaagc cgagtgggag 1260 gtggaccctg actactgcga ggaggtgaag cagacaccgc cctacgacag cagccaccgc 1320 atcctggacg tcatggacat gacgatcttc gacttcctca tgggaaacat ggaccgtcac 1380 cactacgaga cttttgagaa gtttgggaat gaaacgttca tcatccactt agacaatgga 1440 agagggtttg ggaagtattc gcacgacgag ctctccatcc tggtgccgct acagcagtgc 1500 tgcaggatcc ggaagtccac ctacctgcgt ctgcagctcc tggccaagga ggagtacaag 1560 ctgagcctgc tgatggccga gtctctgcgg ggggaccagg tggcacccgt gctgtaccag 1620 ccgcacctgg aggccctgga ccggcggctc cgcgtcgtgc taaaggccgt ccgggactgc 1680 gtggagagga acgggctcca cagcgtggtg gatgacgacc tggacactga gcacagagcc 1740 gcctcggcga gg 1752 <210> 72 <211> 1095 <212> DNA <213> Homo sapiens <400> 72 atgcggcctc aggacagcac cggggtcgcg gagctccagg agcccgggct gccgctaacg 60 gacgatgcac ccccgggcgc cactgaggag ccggcggccg ccgaggcagc tggggcgcca 120 gaccgcggta ggtgctggct ctgcctttcc tcgccgtgtt gctcccgcac cgagccggaa 180 gccaagaaga aagcaccctg tcctggactt ggcttgtttt acacattatt gtctgccttc 240 cttttctcag tgggctcttt atttgttaaaa aaagtgcaag acgtccatgc tgtagagatt 300 agtgcgtttc gatgtgtgtt ccaaatgcta gttgttatcc cttgcttaat atacagaaaa 360 actgggttta taggcccaaa aggtcaacga attttcctca ttctcagagg agtccttggt 420 tctaccgcca tgatgcttat atactatgct taccagacaa tgtccctcgc tgatgccaca 480 gttatcacgt ttagcagtcc agtgtttacg tccatatttg cttggatatg tctcaaggaa 540 aaatatagcc cttgggatgc tcttttcacc gtgttcacaa tcactggagt gatccttatc 600 gtgagaccac catttttgtt tggttccgac acttcgggga tggaagaaag ctattcaggc 660 caccttaagg gaacattcgc agcaattgga agtgccgtat ttgctgcatc gactctagtt 720 atcctaagaa aaatgggaaa atctgtggac tactttctga gcatttggta ttatgtagta 780 cttggcctcg ttgaaagtgt catcatcctc tctgtattag gagagtggag tctgccttac 840 tgtgggttgg acaggctatt tctcatattc attgggctct ttggtttggg gggtcagata 900 tttatcacaa aagcacttca aatagaaaaa gcagggccag tagcaataat gaagacaatg 960 gatgtggtct ttgcttttat ctttcagatt attttcttta ataatgtgc...

Claims

1. Use of a eukaryotic expression system in producing a recombinant eukaryotic cell expressing a transgene encoding a therapeutic protein, the eukaryotic expression system comprising: A metabolic effect product (MIP) expression vector comprising a nucleic acid encoding the MIP under the control of at least one regulatory sequence, wherein the encoded MIP is Foxa1, Ca3, Rassf9, or Tagap, and the eukaryotic expression system is used to express trastuzumab; or The encoded MIP is Erp27 and Erp57, Tagap, or Foxa1; and the eukaryotic expression system is used to express infliximab.

2. The use of claim 1, wherein the at least one regulatory sequence is a promoter selected from the group consisting of CMV, EF1α, CMV / EF1α, SV40, RSV, PGK, and combinations thereof.

3. The use according to claim 1 or 2, wherein the MIP expression vector further comprises a first ITR (inverted terminal repeat) upstream of the nucleic acid encoding the MIP and a second ITR downstream.

4. The use of claim 1 or 2, wherein the at least one regulatory sequence comprises a MAR element or a MAR construct.

5. The use according to claim 4, wherein the MAR element or MAR construct is MAR 1-68 and / or MAR X-29.

6. The use of claim 1 or 2, wherein the at least one regulatory sequence comprises a single MAR element or a MAR construct.

7. The use of claim 6, wherein the single MAR element or MAR construct is between the first ITR and the second ITR.

8. The use according to claim 1 or 2, wherein the MIP expression vector is a transposon donor vector, and wherein the expression system further comprises a transposase expression helper vector or mRNA.

9. The use according to claim 1 or 2, comprising a vector plasmid comprising at least one restriction enzyme cleavage site suitable for inserting a nucleic acid encoding a target protein.

10. The use of claim 9, wherein the vector plasmid further comprises an antibiotic resistance gene and / or a vitamin transporter.

11. The use according to claim 10, wherein the antibiotic resistance gene and / or vitamin transporter is the sodium-multivitamin transporter SLC5A6.

12. The use of claim 8, wherein the transposase expression helper vector comprises a sequence encoding PB transposase.

13. The use according to claim 12, wherein The sequence encoding the PB transposase is flanked upstream and downstream by untranslated terminal regions (UTRs).

Images