RNAi reagents for inhibiting HIF-2α (EPAS1) expression, their compositions and methods of use
By developing an RNAi reagent composition that connects a targeting ligand and a pharmacokinetic enhancer, the targeting and stability issues of oligonucleotide drugs in vivo delivery have been resolved, achieving selective inhibition of the HIF-2α gene and therapeutic effects on related diseases.
Patent Information
- Application Number
- CN202080008795.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2019-04-26
- Filing Date
- 2020-01-08
- Publication Date
- 2025-11-14
- Estimated Expiration
- 2040-01-08
AI Technical Summary
Existing technologies struggle to effectively and selectively inhibit HIF-2α gene expression, especially when delivering oligonucleotide drugs in vivo, which suffer from rapid degradation and poor targeting.
Compositions containing RNAi reagents, which are linked to a targeting ligand and a pharmacokinetic enhancer, have been developed to selectively inhibit HIF-2α gene expression. These compositions include sense and antisense strands, and the modified nucleotide sequences are conjugated to the targeting ligand to enhance in vivo delivery.
This study achieved selective and effective inhibition of HIF-2α gene expression in vivo, reducing the development of related diseases such as clear cell renal cell carcinoma, and improving the targeting and stability of oligonucleotide drugs.
Smart Images

Figure 6743 
Figure 18882 
Figure 23842
Abstract
Description
[0001] sequence list
[0002] This application contains a sequence list, which has been submitted in ASCII format and is hereby incorporated in its entirety by reference. The ASCII copy is named 30663_SEQ_LISTING.txt and has a size of 227kb.
[0003] Cross-reference to related applications
[0004] This application claims priority to U.S. Provisional Application Serial No. 62 / 790,360, filed January 9, 2019; U.S. Provisional Application Serial No. 62 / 827,564, filed April 1, 2019; and U.S. Provisional Application Serial No. 62 / 839,381, filed April 26, 2019, all of which are incorporated herein by reference in their entirety. Technical Field
[0005] This disclosure relates to RNA interference (RNAi) agents for inhibiting HIF-2α (EPAS1) gene expression, such as double-stranded RNAi agents, including compositions of HIF-2α RNAi agents and methods of using them. Background Technology
[0006] Hypoxia-inducible factor-2α (also known as HIF-2α, HIF2-α, Hif2α, or Hif2α), or protein 1 containing the endothelial PAS domain (EPAS1), is a hypoxia-inducible transcription factor that responds to a reduction in available oxygen (hypoxia). HIF-2α is encoded by the EPAS1 gene (which may alternatively be referred to as the "HIF-2α gene" in this document), and its expression is known to be upregulated under hypoxic conditions.
[0007] In some high-altitude populations (such as Tibetans), a significant portion of these groups has evolved to carry certain allelic variants of the HIF-2α gene, which help improve oxygen transport in hypoxic environments. However, in more typical high-altitude environments, overexpression of wild-type EPAS1 has been associated with increased hypertension and stroke, and symptoms similar to altitude sickness due to excessive red blood cell production. Mutations in this gene have also been linked to familial polycythemia type 4 and pulmonary hypertension.
[0008] It is noteworthy that, although HIF-2α is widely expressed in a variety of human tissues, the HIF-2α protein has been identified as essential for or enhancing the expression of various genes involved in disease classifications, including tumor progression. For example, HIF-2α is thought to play a role in the progression of uveal melanoma by promoting the autocrine loop VEGF-pVEGFR2 / KDR and by enhancing LDHA expression, thereby conferring a growth advantage.
[0009] EPAS1 has also been shown to be associated with or upregulate the expression of other factors, including: cMyc (which contributes to cell proliferation, transformation, tumor formation, and tumorigenesis, and is highly expressed in most cancers); interleukin-8 (a pro-inflammatory mediator, e.g., in gingivitis and psoriasis); SP-1 (a transcription factor involved in IL-8 regulation and a co-activator of cMyc); LDH5 (associated with tumor necrosis and increased tumor size); and LANA (a latency-associated nuclear antigen associated with Kaposi's sarcoma-associated herpesvirus). Furthermore, HIF (hypoxia-inducible factor) activity can typically play a role in angiogenesis required for cancer tumor growth. For example, HIF-2α is thought to be involved in several other diseases, including renal cell carcinoma, clear cell renal cell carcinoma (and metastases of this and other cancers), melanoma, inflammation, chronic inflammation, neovascularization, rheumatoid arthritis, uveal melanoma, chondrosarcoma, and multiple myeloma. Mutations in the EPAS1 gene have also been associated with the early onset of neuroendocrine tumors such as paragangliomas, somatostatinomas, and / or pheochromocytomas. These mutations are typically somatic missense mutations located at the primary hydroxylation site of HIF-2α. These mutations are thought to disrupt protein hydroxylation / degradation mechanisms and lead to protein stabilization and pseudohypoxia signaling. Furthermore, neuroendocrine tumors release erythropoietin (EPO) into the circulating bloodstream, resulting in polycythemia.
[0010] More specifically, HIF-2α has been associated with tumor progression and metastasis in clear cell renal cell carcinoma (ccRCC). It is believed that most ccRCC tumors express a mutant form of the Von Hippel-Landau protein that cannot degrade HIF-2α, leading to the accumulation of HIF-2α and activation of genes regulated by HIF-2α (which promote tumor growth and metastasis).
[0011] Feasible therapeutic treatments remain needed to treat a variety of diseases, including cancers such as ccRCC. Similarly, therapeutic drug products capable of inhibiting HIF-2α expression and / or reducing its production remain needed. As just one example, a significant reduction in HIF-2α expression in ccRCC cells could potentially suppress the unwanted growth of these cancer cells or otherwise slow their progression.
[0012] One known method of inhibiting gene expression is RNA interference (RNAi) through the administration of oligonucleotide-based pharmaceutical products (e.g., RNAi agents) capable of inhibiting or silencing gene expression. However, significant challenges remain in identifying effective and stable oligonucleotide sequences capable of silencing gene expression in vivo and in determining therapeutically feasible methods for the safe and selective delivery of therapeutic agents to desired cells or tissues. Oligonucleotide-based pharmaceutical products tend to degrade or filter readily and rapidly in vivo when administered, especially due to their relatively small size and inherent organic properties, which often prevent them from reaching the intended target cells and / or tissues. Various attempts have been proposed to overcome this limitation, including, for example, encapsulation in liposomes, iontophoresis, and incorporation with other mediators such as hydrogels, cyclodextrins, biodegradable nanocapsules, bioadhesive microspheres, protein carriers, or dynamic polyconjugates. TM (DPC) (See, for example, WO 2000 / 053722, WO 2008 / 0022309, WO 2011 / 104169 and WO 2012 / 083185, each of which is incorporated herein by reference). Alternatively, conjugation of oligonucleotides to targeting ligands (such as compounds with affinity for cell surface molecules, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments, or antibody mimics with affinity for cell surface molecules) has achieved some recent success in delivering oligonucleotide-based therapeutics to hepatocytes in the liver. However, to date, efforts to target extrahepatic cells with oligonucleotide-based drug products have largely failed due to a lack of potency, toxicity, or a combination of both.
[0013] Despite some progress in this field, improved delivery mechanisms are still needed to facilitate the in vivo delivery of therapeutic agents, including oligonucleotides and oligonucleotide-based pharmaceutical products. Furthermore, effective and selective inhibitors of HIF-2α remain in demand. Summary of the Invention
[0014] This document discloses RNA interference (RNAi) agents (also referred to herein as RNAi agents, RNAi triggers, or triggers) capable of selectively and effectively inhibiting the expression of the HIF-2α (EPAS1) gene, such as double-stranded RNAi agents. This document further discloses compositions comprising RNAi agents for inhibiting HIF-2α expression, wherein the HIF-2α RNAi agent is linked to at least one targeting ligand having affinity for a cellular receptor present on target cells, and, optionally, at least one pharmacokinetic (PK) enhancer. The HIF-2α RNAi agents disclosed herein can selectively and effectively reduce or inhibit the expression of the HIF-2α (EPAS1) gene in subjects (e.g., human or animal subjects).
[0015] Generally, this disclosure is characterized by HIF-2α gene-specific RNAi reagents, compositions including HIF-2α RNAi reagents, and methods for inhibiting the expression of the HIF-2α (EPAS1) gene in vivo and / or in vitro using the HIF-2α RNAi reagents and compositions including HIF-2α RNAi reagents described herein.
[0016] The described HIF-2α RNAi agents can be used in methods of therapeutic treatment (including preventative and prophylactic treatment) of conditions and diseases that can be at least partially mediated by a reduction in HIF-2α expression, including, for example, cancers such as clear cell renal cell carcinoma (ccRCC). The HIF-2α RNAi agents disclosed herein can selectively reduce HIF-2α gene expression in the cells of a subject. The methods disclosed herein involve administering one or more HIF-2α RNAi agents to a subject (e.g., a human or animal subject) using any suitable method known in the art (such as intravenous infusion, intravenous injection, or subcutaneous injection).
[0017] In one aspect, this disclosure is characterized by an RNAi reagent for inhibiting the expression of the human HIF-2α (EPAS1) gene, wherein the RNAi reagent comprises a sense strand and an antisense strand. The HIF-2α RNAi reagent may be further linked to or conjugated to one or more targeting ligands and / or one or more PK enhancers.
[0018] This article also describes pharmaceutical compositions comprising an RNAi agent capable of inhibiting HIF-2α (EPAS1) gene expression, wherein said composition further comprises at least one pharmaceutically acceptable excipient. The pharmaceutical compositions described herein comprising one or more disclosed HIF-2α RNAi agents are capable of selectively and effectively reducing or inhibiting HIF-2α gene expression in vivo. Compositions comprising one or more HIF-2α RNAi agents may be administered to subjects, such as human or animal subjects, for the treatment (including prophylactic treatment or inhibition) of conditions and diseases mediated by a reduction in HIF-2α expression, including, for example, cancers such as ccRCC.
[0019] One aspect described in this article is an RNAi agent for inhibiting the expression of the HIF-2α (EPAS1) gene, which comprises:
[0020] (i) An antisense strand containing at least 17 adjacent nucleotides that differs from any of the sequences provided in Table 3 by 0 or 1 nucleotide;
[0021] (ii) a sense strand comprising a nucleotide sequence at least partially complementary to the antisense strand; and
[0022] (iii) One or more targeted ligands.
[0023] In another aspect, an RNAi agent capable of inhibiting the expression of the HIF-2α (EPAS1) gene is described, comprising:
[0024] (i) An antisense strand of length between 18 and 49 nucleotides that is at least partially complementary to the HIF-2α (EPAS1) gene (SEQ ID NO: 1);
[0025] (ii) A sense chain that is at least partially complementary to the antisense chain;
[0026] (iii) A targeting ligand connected to the sense chain; and
[0027] (iv) A PK enhancer attached to the sense chain.
[0028] In some embodiments, the HIF-2αRNAi reagent disclosed herein includes an antisense strand, said antisense strand consisting of, substantially consisting of, or containing said nucleotide sequence that differs from the nucleotide sequence (5′→3′)UUUCAUGAAAUCGUUACGUUG (SEQ ID NO:827) by 0 or 1 nucleotide. In some embodiments, the HIF-2αRNAi reagent disclosed herein includes an antisense strand, said antisense strand consisting of, substantially consisting of, or containing said nucleotide sequence that differs from the nucleotide sequence (5′→3′)UUUCAUGAAAUCGUUACGUUG (SEQ ID NO:827) by no more than 1 nucleotide, wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, the HIF-2αRNAi reagent disclosed herein includes an antisense strand consisting of, substantially consisting of, or containing a nucleobase sequence that differs from the nucleotide sequence (5′→3′) UUUCAUGAAAUCGUUACGUUG (SEQ ID NO:827) by 0 or 1 nucleobase, wherein SEQ ID NO:827 is located at positions 1-21 (5′→3′) of the antisense strand.
[0029] In some embodiments, the HIF-2αRNAi reagent disclosed herein includes an antisense strand consisting of, substantially consisting of, or containing a modified nucleotide sequence that differs from the nucleotide sequence (5′→3′)usUfsusCfaUfgAfaAfuCfgUfuAfcGfuUfsg (SEQ ID NO:30) by no more than one nucleotide, wherein a, c, g, and u represent 2′-O-methyladenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2′-fluoroadenosine, cytidine, guanosine, and uridine, respectively; and s represents a phosphate thioester bond, wherein the sense strand is at least substantially complementary to the antisense strand. As will be readily understood by those skilled in the art, the inclusion of phosphate thioester bonds as shown in the modified nucleotide sequences disclosed herein substitutes for phosphodiester bonds typically found in oligonucleotides (see, for example, showing all nucleoside linkages). Figures 7A to 7GIn some embodiments, the HIF-2αRNAi reagent disclosed herein includes an antisense strand consisting of the nucleotide sequence (5′→3′)usUfsusCfaUfgAfaAfuCfgUfuAfcGfuUfsg (SEQ ID NO:30), substantially consisting of the nucleotide sequence (5′→3′)usUfsusCfaUfgAfaAfuCfgUfuAfcGfuUfsg (SEQ ID NO:30), or containing the nucleotide sequence (5′→3′)usUfsusCfaUfgAfaAfuCfgUfuAfcGfuUfsg (SEQ ID NO:30). NO:30), where a, c, g and u represent 2′-O-methyladenosine, cytidine, guanosine and uridine respectively; Af, Cf, Gf and Uf represent 2′-fluoroadenosine, cytidine, guanosine and uridine respectively; and s represents a thiophosphate bond, wherein the sense chain and the antisense chain are at least substantially complementary.
[0030] In some embodiments, the HIF-2αRNAi reagent disclosed herein includes an antisense strand consisting of, substantially consisting of, or containing a modified nucleotide sequence, wherein the modified nucleotide sequence differs from the nucleotide sequence (5′→3′)asCfsasUfaGfuAfcAfuAfgAfgAfaUfgUfsg (SEQ ID NO: 90) by no more than one nucleotide, wherein a, c, g, and u represent 2′-O-methyladenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2′-fluoroadenosine, cytidine, guanosine, and uridine, respectively; and s represents a phosphate thioester bond, wherein the sense strand is at least substantially complementary to the antisense strand. In some embodiments, the HIF-2αRNAi reagent disclosed herein includes an antisense strand consisting of the nucleotide sequence (5′→3′)asCfsasUfaGfuAfcAfuAfgAfgAfaUfgUfsg (SEQ ID NO:90), substantially consisting of the nucleotide sequence (5′→3′)asCfsasUfaGfuAfcAfuAfgAfgAfaUfgUfsg (SEQ ID NO:90), or containing the nucleotide sequence (5′→3′)asCfsasUfaGfuAfcAfuAfgAfgAfaUfgUfsg (SEQ ID NO:90). NO:90), where a, c, g and u represent 2′-O-methyladenosine, cytidine, guanosine and uridine respectively; Af, Cf, Gf and Uf represent 2′-fluoroadenosine, cytidine, guanosine and uridine respectively; and s represents a thiophosphate bond, wherein the sense chain and the antisense chain are at least substantially complementary.
[0031] In some embodiments, the HIF-2αRNAi reagent disclosed herein includes an antisense strand consisting of, substantially consisting of, or containing a modified nucleotide sequence that differs from the nucleotide sequence (5′→3′)usGfsusUfaGfuAfuGfgAfcAfgUfuGfuGfsu (SEQ ID NO: 113) by no more than one nucleotide, wherein a, c, g, and u represent 2′-O-methyladenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2′-fluoroadenosine, cytidine, guanosine, and uridine, respectively; and s represents a phosphate thioester bond, wherein the sense strand is at least substantially complementary to the antisense strand. In some embodiments, the HIF-2αRNAi reagent disclosed herein includes an antisense strand composed of the nucleotide sequence (5′→3′)usGfsusUfaGfuAfuGfgAfcAfgUfuGfuGfsu (SEQ ID NO:113), substantially composed of the nucleotide sequence (5′→3′)usGfsusUfaGfuAfuGfgAfcAfgUfuGfuGfsu (SEQ ID NO:113), or containing the nucleotide sequence (5′→3′)usGfsusUfaGfuAfuGfgAfcAfgUfuGfuGfsu (SEQ ID NO:113). NO:113), wherein a, c, g and u represent 2′-O-methyladenosine, cytidine, guanosine and uridine respectively; Af, Cf, Gf and Uf represent 2′-fluoroadenosine, cytidine, guanosine and uridine respectively; and s represents a thiophosphate bond, wherein the sense chain and the antisense chain are at least substantially complementary.
[0032] In some embodiments, the HIF-2αRNAi reagent disclosed herein includes an antisense strand consisting of, substantially consisting of, or containing a nucleobase sequence that differs from the nucleotide sequence (5′→3′)ACAUAGUACAUAGAGAAUGUG (SEQ ID NO:883) by 0 or 1 nucleobase. In some embodiments, the HIF-2αRNAi reagent disclosed herein includes an antisense strand consisting of, substantially consisting of, or containing a nucleotide sequence that differs from the nucleotide sequence (5′→3′)ACAUAGUACAUAGAGAAUGUG (SEQ ID NO:883) by no more than 1 nucleotide, wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, the HIF-2αRNAi reagent disclosed herein includes an antisense strand consisting of, substantially consisting of, or containing a nucleobase sequence that differs from the nucleotide sequence (5′→3′)ACAUAGUACAUAGAGAAUGUG (SEQ ID NO:883) by 0 or 1 nucleobase, wherein SEQ ID NO:883 is located at positions 1-21 (5′→3′) of the antisense strand.
[0033] In some embodiments, the HIF-2αRNAi reagent disclosed herein includes an antisense strand consisting of, substantially consisting of, or containing a nucleobase sequence that differs from the nucleotide sequence (5′→3′)UGUUAGUAUGGACAGUUGUGU (SEQ ID NO:902) by 0 or 1 nucleobase. In some embodiments, the HIF-2αRNAi reagent disclosed herein includes an antisense strand consisting of, substantially consisting of, or containing a nucleotide sequence that differs from the nucleotide sequence (5′→3′)UGUUAGUAUGGACAGUUGUGU (SEQ ID NO:902) by no more than 1 nucleotide, wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, the HIF-2αRNAi reagent disclosed herein includes an antisense strand consisting of, substantially consisting of, or containing a nucleobase sequence that differs from the nucleotide sequence (5′→3′)UGUUAGUAUGGACAGUUGUGU (SEQ ID NO:902) by 0 or 1 nucleobase, wherein SEQ ID NO:902 is located at positions 1-21 (5′→3′) of the antisense strand.
[0034] In some embodiments, the HIF-2αRNAi reagent disclosed herein comprises an antisense strand and a sense strand, wherein the antisense strand consists of a modified nucleotide sequence (5′→3′)usUfsusCfaUfgAfaAfuCfgUfuAfcGfuUfsg (SEQ ID NO:30), is substantially composed of a modified nucleotide sequence (5′→3′)usUfsusCfaUfgAfaAfuCfgUfuAfcGfuUfsg (SEQ ID NO:30), or contains a modified nucleotide sequence (5′→3′)usUfsusCfaUfgAfaAfuCfgUfuAfcGfuUfsg (SEQ ID NO:30), and the sense strand consists of a modified nucleotide sequence (5′→3′)Y-(NH-C6)scsaacguaaCfGfAfuuu Z ca Z ug Z aa Z sa(invAb)(6-S)-X (SEQ ID NO:761) is composed of a modified nucleotide sequence (5′→3′)Y-(NH-C6)scsaacguaaCfGfAfuuu Z ca Z ug Z aa Z sa(invAb)(6-S)-X (SEQ ID NO:761) consists of, or contains, a modified nucleotide sequence (5′→3′)Y-(NH-C6)scsaacguaaCfGfAfuuu Z ca Z ug Z aa Z sa(invAb)(6-S)-X (SEQ ID NO:761), where a, c, g, and u represent 2′-O-methyladenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2′-fluoroadenosine, cytidine, guanosine, and uridine, respectively; and each X, Y, and Z is independently a pharmacological motif (e.g., a targeting ligand, a targeting group, and / or a PK enhancer); u Z a Z g Z and c ZThese represent uridine, adenosine, guanosine, and cytidine, respectively, wherein the pharmacological portion (e.g., a targeting ligand, a targeting group, and / or a PK enhancer) is linked to the 2' position of the nucleotide (which, for the HIF-2αRNAi reagent disclosed in the embodiments herein, terminates by coupling to a 2'-O-propynyl group), (NH2-C6) as defined in Table 7, and s represents a phosphate thioester bond. In some embodiments, the HIF-2αRNAi reagent disclosed herein comprises an antisense strand and a sense strand, wherein the antisense strand consists of a modified nucleotide sequence (5′→3′)usUfsusCfaUfgAfaAfuCfgUfuAfcGfuUfsg (SEQ ID NO:30), is substantially composed of a modified nucleotide sequence (5′→3′)usUfsusCfaUfgAfaAfuCfgUfuAfcGfuUfsg (SEQ ID NO:30), or contains a modified nucleotide sequence (5′→3′)usUfsusCfaUfgAfaAfuCfgUfuAfcGfuUfsg (SEQ ID NO:30), and the sense strand consists of a modified nucleotide sequence (5′→3′)Y-(NH-C6)scsaacguaaCfGfAfuuu Z ca Z ug Z aa Z sa(invAb)(6-S)-X (SEQ ID NO:761) is composed of a modified nucleotide sequence (5′→3′)Y-(NH-C6)scsaacguaaCfGfAfuuu Z ca Z ug Z aa Z sa(invAb)(6-S)-X (SEQ ID NO:761) consists of, or contains, a modified nucleotide sequence (5′→3′)Y-(NH-C6)scsaacguaaCfGfAfuuu Z ca Z ug Z aa Z sa(invAb)(6-S)-X (SEQ ID NO:761), wherein the sense strand further comprises inverted debase residues at the 3' end and the 5' end of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently linked to the 5' end, wherein the targeting ligand comprises a compound having affinity for an integrin receptor.
[0035] In some embodiments, the HIF-2αRNAi reagent disclosed herein comprises an antisense strand and a sense strand, wherein the antisense strand consists of a modified nucleotide sequence (5′→3′)asCfsasUfaGfuAfcAfuAfgAfgAfaUfgUfsg (SEQ ID NO:90), is substantially composed of a modified nucleotide sequence (5′→3′)asCfsasUfaGfuAfcAfuAfgAfgAfaUfgUfsg (SEQ ID NO:90), or contains a modified nucleotide sequence (5′→3′)asCfsasUfaGfuAfcAfuAfgAfgAfaUfgUfsg (SEQ ID NO:90), and the sense strand consists of a modified nucleotide sequence (5′→3′)(Z)3-(TriAlk14)s(invAb)scacauucuCfUfAfugu Z ac Z ua Z ug Z us(invAb)(C6-S)-X (SEQ ID NO:806) is composed of a modified nucleotide sequence (5′→3′)(Z)3-(TriAlk14)s(invAb)scacauucuCfUfAfugu Z ac Z ua Z ug Z us(invAb)(C6-S)-X (SEQ ID NO:806) consists of, or contains, a modified nucleotide sequence (5′→3′)(Z)3-(TriAlk14)s(invAb)scacauucuCfUfAfugu Z ac Z ua Z ug Z us(invAb)(C6-S)-X (SEQ ID NO:806), where a, c, g, and u represent 2′-O-methyladenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2′-fluoroadenosine, cytidine, guanosine, and uridine, respectively; and each X, Y, and Z is independently a pharmacological motif (e.g., a targeting ligand, a targeting group, and / or a PK enhancer); u Z a Z g Z and c ZThese represent uridine, adenosine, guanosine, and cytidine, respectively, wherein the pharmacological portion (e.g., a targeting ligand, a targeting group, and / or a PK enhancer) is linked to the 2' position of the nucleotide (which terminates, for the HIF-2αRNAi reagent disclosed in the embodiments herein, by coupling to a 2'-O-propynyl group), (TriAlk14), (C6-S), and (invAb) as defined in Table 7, and s represents a phosphate thioester bond. In some embodiments, the HIF-2αRNAi reagent disclosed herein comprises an antisense strand and a sense strand, wherein the antisense strand consists of a modified nucleotide sequence (5′→3′)asCfsasUfaGfuAfcAfuAfgAfgAfaUfgUfsg (SEQ ID NO:90), is substantially composed of a modified nucleotide sequence (5′→3′)asCfsasUfaGfuAfcAfuAfgAfgAfaUfgUfsg (SEQ ID NO:90), or contains a modified nucleotide sequence (5′→3′)asCfsasUfaGfuAfcAfuAfgAfgAfaUfgUfsg (SEQ ID NO:90), and the sense strand consists of a modified nucleotide sequence (5′→3′)(Z)3-(TriAlk14)s(invAb)scacauucuCfUfAfugu Z ac Z ua Z ug Z us(invAb)(C6-S)-X (SEQ ID NO:806) is composed of a modified nucleotide sequence (5′→3′)(Z)3-(TriAlk14)s(invAb)scacauucuCfUfAfugu Z ac Z ua Z ug Z us(invAb)(C6-S)-X (SEQ ID NO:806) consists of, or contains, a modified nucleotide sequence (5′→3′)(Z)3-(TriAlk14)s(invAb)scacauucuCfUfAfugu Z ac Z ua Z ug Z us(invAb)(C6-S)-X(SEQ ID NO:806), wherein the sense strand further comprises inverted debase residues at the 3' end and the 5' end of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently linked to the 5' end, wherein the targeting ligand comprises a compound having affinity for an integrin receptor.
[0036] In some embodiments, the HIF-2αRNAi reagent disclosed herein comprises an antisense strand and a sense strand, wherein the antisense strand consists of a modified nucleotide sequence (5′→3′)usGfsusUfaGfuAfuGfgAfcAfgUfuGfuGfsu (SEQ ID NO:113), is substantially composed of a modified nucleotide sequence (5′→3′)usGfsusUfaGfuAfuGfgAfcAfgUfuGfuGfsu (SEQ ID NO:113), or contains a modified nucleotide sequence (5′→3′)usGfsusUfaGfuAfuGfgAfcAfgUfuGfuGfsu (SEQ ID NO:113), and the sense strand consists of a modified nucleotide sequence (5′→3′)(Z)3-(TriAlk14)s(invAb)sacacaacuGfUfCfcau Z ac Z ua Z ac Z The sequence as(invAb)(C6-S)-X (SEQ ID NO:810) is essentially composed of the modified nucleotide sequence (5′→3′)(Z)3-(TriAlk14)s(invAb)sacacaacuGfUfCfcau Z ac Z ua Z ac Z The nucleotide sequence (5′→3′)(Z)3-(TriAlk14)s(invAb)sacacaacuGfUfCfcau, which is composed of or contains modified nucleotide sequences, is as(invAb)(C6-S)-X (SEQ ID NO:810). Z ac Z ua Z ac Z as(invAb)(C6-S)-X (SEQ ID NO:810), where a, c, g, and u represent 2′-O-methyladenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2′-fluoroadenosine, cytidine, guanosine, and uridine, respectively; and each X, Y, and Z is independently a pharmacological motif (e.g., a targeting ligand, a targeting group, and / or a PK enhancer); u Z a Z g Z and c ZThese represent uridine, adenosine, guanosine, and cytidine, respectively, wherein the pharmacological portion (e.g., a targeting ligand, a targeting group, and / or a PK enhancer) is linked to the 2' position of the nucleotide (which terminates, for the HIF-2αRNAi reagent disclosed in the embodiments herein, by coupling to a 2'-O-propyne group), (TriAlk14), (C6-S), and (invAb) are as defined in Table 7, and s represents a phosphate thioester bond. In some embodiments, the HIF-2αRNAi reagent disclosed herein comprises an antisense strand and a sense strand, wherein the antisense strand consists of a modified nucleotide sequence (5′→3′)usGfsusUfaGfuAfuGfgAfcAfgUfuGfuGfsu (SEQ ID NO:113), is substantially composed of a modified nucleotide sequence (5′→3′)usGfsusUfaGfuAfuGfgAfcAfgUfuGfuGfsu (SEQ ID NO:113), or contains a modified nucleotide sequence (5′→3′)usGfsusUfaGfuAfuGfgAfcAfgUfuGfuGfsu (SEQ ID NO:113), and the sense strand consists of a modified nucleotide sequence (5′→3′)(Z)3-(TriAlk14)s(invAb)sacacaacuGfUfCfcau Z ac Z ua Z ac Z The sequence as(invAb)(C6-S)-X (SEQ ID NO: 810) is essentially composed of the modified nucleotide sequence (5′→3′)(Z)3-(TriAlk14)s(invAb)sacacaacuGfUfCfcau Z ac Z ua Z ac Z The nucleotide sequence (5′→3′)(Z)3-(TriAlk14)s(invAb)sacacaacuGfUfCfcau, which is composed of or contains modified nucleotide sequences, is as(invAb)(C6-S)-X (SEQ ID NO:810). Z ac Z ua Z ac Z as(invAb)(C6-S)-X (SEQ ID NO:810), wherein the sense strand further comprises inverted debase residues at the 3' end and the 5' end of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently linked to the 5' end, wherein the targeting ligand comprises a compound having affinity for integrin receptors.
[0037] In some embodiments, the HIF-2αRNAi reagent disclosed herein comprises an antisense strand and a sense strand, wherein the antisense strand consists of, is substantially composed of, the modified nucleotide sequence (5′→3′)usUfsusCfaUfgAfaAfuCfgUfuAfcGfuUfsg (SEQ ID NO:30), or contains the modified nucleotide sequence (5′→3′)usUfsusCfaUfgAfaAfuCfgUfuAfcGfuUfsg (SEQ ID NO:30), and the sense strand consists of, is substantially composed of, the modified nucleotide sequence (5′→3′)usUfsusCfaUfgAfaAfuCfgUfuAfcGfuUfsg (SEQ ID NO:30), or contains the modified nucleotide sequence (5′→3′). Z cgua Z aCfGfAfuuuca Z ugaa Z sa(invAb)(6-S)-X(SEQ ID NO:740), Y-(NH-C6)scsaac Z guaa Z CfGfAfuuu Z caug Z aasa(invAb)(6-S)-X(SEQ ID NO:756), Y-(NH-C6)scsaacg Z uaa Z CfGfAfu Z uuc Z augaasa(invAb)(6-S)-X(SEQ ID NO:757) and Y-(NH-C6)scsaacguaaCfGfAfuuucau Z g Z a Z a Z sa(invAb)(6-S)-X (SEQ ID NO:762), where a, c, g, and u represent 2′-O-methyladenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2′-fluoroadenosine, cytidine, guanosine, and uridine, respectively; and each X, Y, and Z is independently a pharmacological motif (e.g., a targeting ligand, a targeting group, and / or a PK enhancer); u Z a Z g Z and c ZThese represent uridine, adenosine, guanosine, and cytidine, respectively, wherein the pharmacological portion (e.g., a targeting ligand, a targeting group, and / or a PK enhancer) is linked to the 2' position of the nucleotide (which terminates, for the HIF-2αRNAi reagent disclosed in the embodiments herein, by coupling to a 2'-O-propyne group), (NH2-C6), (invAb), and (6-S) as defined in Table 7, and s represents a phosphate thioester bond. In some embodiments, the HIF-2αRNAi reagent disclosed herein comprises an antisense strand and a sense strand, wherein the antisense strand consists of, is substantially composed of, the modified nucleotide sequence (5′→3′)usUfsusCfaUfgAfaAfuCfgUfuAfcGfuUfsg (SEQ ID NO:30), or contains the modified nucleotide sequence (5′→3′)usUfsusCfaUfgAfaAfuCfgUfuAfcGfuUfsg (SEQ ID NO:30), and the sense strand consists of, is substantially composed of, the modified nucleotide sequence (5′→3′)usUfsusCfaUfgAfaAfuCfgUfuAfcGfuUfsg (SEQ ID NO:30), or contains the modified nucleotide sequence (5′→3′). Z cgua Z aCfGfAfuuuca Z ugaa Z sa(invAb)(6-S)-X(SEQ ID NO:740), Y-(NH-C6)scsaac Z guaa Z CfGfAfuuu Z caug Z aasa(invAb)(6-S)-X(SEQ ID NO:756), Y-(NH-C6)scsaacg Z uaa Z CfGfAfu Z uuc Z augaasa(invAb)(6-S)-X(SEQ ID NO:757) and Y-(NH-C6)scsaacguaaCfGfAfuuucau Z g Z a Z a Zsa(invAb)(6-S)-X (SEQ ID NO:762), wherein the sense strand further comprises inverted debase residues at the 3' end and the 5' end of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently linked to the 5' end, wherein the targeting ligand comprises a compound having affinity for integrin receptors.
[0038] In some embodiments, the HIF-2αRNAi reagent disclosed herein includes an antisense strand that consists of, is substantially composed of, or contains a nucleotide sequence that differs from one of the following nucleotide sequences (5′→3′) by 0 or 1 nucleotide:
[0039] UUUCAUGAAAUCGUUACGUUG(SEQ ID NO:827);
[0040] ACAUAGUACAUAGAGAAUGUG (SEQ ID NO:883); or
[0041] UGUUAGUAUGGACAGUUGUGU (SEQ ID NO:902);
[0042] The HIF-2αRNAi reagent further comprises a sense strand that is at least partially complementary to the antisense strand; and wherein all or substantially all of the nucleotides on the antisense strand and the sense strand are modified nucleotides.
[0043] In some embodiments, the HIF-2αRNAi reagent disclosed herein includes an antisense strand that consists of, is substantially composed of, or contains a nucleotide sequence that differs from one of the following nucleotide sequences (5′→3′) by 0 or 1 nucleotide.
[0044] UUUCAUGAAAUCGUUACGUUG(SEQ ID NO:827);
[0045] ACAUAGUACAUAGAGAAUGUG (SEQ ID NO:883); or
[0046] UGUUAGUAUGGACAGUUGUGU (SEQ ID NO:902);
[0047] The HIF-2αRNAi reagent further comprises a sense strand that is at least partially complementary to the antisense strand; wherein all or substantially all nucleotides on the antisense strand and the sense strand are modified nucleotides; and wherein the sense strand further comprises inverted debased residues at the 3' end and the 5' end of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently linked to the 5' end, wherein the targeting ligand comprises a compound having affinity for integrin receptors.
[0048] In some embodiments, the HIF-2αRNAi reagent disclosed herein includes an antisense strand that consists of, is substantially composed of, or contains a nucleotide sequence that differs from one of the following nucleotide sequences (5′→3′) by 0 or 1 nucleotide.
[0049] UUUCAUGAAAUCGUUACGUUG(SEQ ID NO:827);
[0050] ACAUAGUACAUAGAGAAUGUG (SEQ ID NO:883); or
[0051] UGUUAGUAUGGACAGUUGUGU (SEQ ID NO:902);
[0052] The HIF-2αRNAi reagent further comprises a sense strand that is at least partially complementary to the antisense strand; wherein all or substantially all nucleotides on the antisense strand and the sense strand are modified nucleotides; and wherein the sense strand further comprises inverted debase residues at the 3' end and the 5' end of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently linked to the 5' end, wherein the targeting ligand comprises a compound having affinity for integrin receptors; and wherein each antisense strand sequence is located at positions 1-21 of the antisense strand.
[0053] In some embodiments, the HIF-2αRNAi reagent disclosed herein includes an antisense strand and a sense strand, wherein the antisense strand and the sense strand consist of, are substantially composed of, or contain nucleotide sequences that differ by 0 or 1 nucleotide from one of the following nucleotide sequence (5′→3′) pairs:
[0054] UUUCAUGAAAUCGUUACGUUG (SEQ ID NO:827) and
[0055] CAACGUAACGAUUUCAUGAAA (SEQ ID NO: 428);
[0056] ACAUAGUACAUAGAGAAUGUG (SEQ ID NO:883) and
[0057] CACAUUCUCUAUGUACUAUGU (SEQ ID NO:485); or
[0058] UGUUAGUAUGGACAGUUGUGU (SEQ ID NO:902) and
[0059] ACACAACUGUCCAUACUAACA(SEQ ID NO:507);
[0060] All or substantially all of the nucleotides on the antisense strand and the sense strand are modified nucleotides.
[0061] In some embodiments, the HIF-2αRNAi reagent disclosed herein includes an antisense strand and a sense strand, wherein the antisense strand and the sense strand consist of, are substantially composed of, or contain nucleotide sequences that differ by 0 or 1 nucleotide from one of the following nucleotide sequence (5′→3′) pairs:
[0062] UUUCAUGAAAUCGUUACGUUG (SEQ ID NO:827) and
[0063] CAACGUAACGAUUUCAUGAAA (SEQ ID NO: 428);
[0064] ACAUAGUACAUAGAGAAUGUG (SEQ ID NO:883) and
[0065] CACAUUCUCUAUGUACUAUGU (SEQ ID NO:485); or
[0066] UGUUAGUAUGGACAGUUGUGU (SEQ ID NO:902) and
[0067] ACACAACUGUCCAUACUAACA(SEQ ID NO:507);
[0068] All or substantially all nucleotides on the antisense strand and the sense strand are modified nucleotides; and the sense strand further includes inverted debased residues at the 3' end and the 5' end of the nucleotide sequence, and the sense strand also includes a targeting ligand covalently attached to the 5' end, wherein the targeting ligand includes a compound having affinity for integrin receptors.
[0069] In some embodiments, the HIF-2αRNAi reagent disclosed herein includes an antisense strand, which consists of, is substantially composed of, or contains a modified nucleotide sequence that differs from one of the following nucleotide sequences (5′→3′) by 0 or 1 nucleotide.
[0070] usUfsusCfaUfgAfaAfuCfgUfuAfcGfuUfsg(SEQ ID NO:30);
[0071] asCfsasUfaGfuAfcAfuAfgAfgAfaUfgUfsg(SEQ ID NO:90); or
[0072] usGfsusUfaGfuAfuGfgAfcAfgUfuGfuGfsu(SEQ ID NO:113);
[0073] Wherein a, c, g, and u represent 2′-O-methyladenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2′-fluoroadenosine, cytidine, guanosine, and uridine, respectively; s represents a thiophosphate bond; and wherein the HIF-2αRNAi reagent further comprises a sense strand that is at least partially complementary to the antisense strand; and wherein all or substantially all nucleotides of the sense strand are modified nucleotides.
[0074] In some embodiments, the HIF-2αRNAi reagent disclosed herein includes an antisense strand, which consists of, is substantially composed of, or contains a modified nucleotide sequence that differs from one of the following nucleotide sequences (5′→3′) by 0 or 1 nucleotide.
[0075] usUfsusCfaUfgAfaAfuCfgUfuAfcGfuUfsg(SEQ ID NO:30);
[0076] asCfsasUfaGfuAfcAfuAfgAfgAfaUfgUfsg(SEQ ID NO:90); or
[0077] usGfsusUfaGfuAfuGfgAfcAfgUfuGfuGfsu(SEQ ID NO:113);
[0078] The HIF-2αRNAi reagent further comprises a sense strand that is at least partially complementary to the antisense strand; wherein all or substantially all nucleotides of the sense strand are modified nucleotides; wherein all or substantially all nucleotides on the antisense strand and the sense strand are modified nucleotides; and wherein the sense strand further comprises inverted debasement residues at the 3' end and the 5' end of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently linked to the 5' end, wherein the targeting ligand comprises a compound having affinity for integrin receptors.
[0079] In some embodiments, the HIF-2αRNAi reagent disclosed herein includes an antisense strand and a sense strand, said antisense strand and sense strand consisting of, substantially consisting of, or containing a modified nucleotide sequence, said modified nucleotide sequence differing from one of the following nucleotide sequence pairs (5′→3′) by 0 or 1 nucleotide:
[0080] usUfsusCfaUfgAfaAfuCfgUfuAfcGfuUfsg (SEQ ID NO:30) and
[0081] Y-(NH-C6)scsaacguaaCfGfAfuuu Z ca Z ug Z aa Z sa(invAb)(6-S)-X(SEQ ID NO:761);
[0082] asCfsasUfaGfuAfcAfuAfgAfgAfaUfgUfsg (SEQ ID NO:90) and
[0083] (Z)3-(TriAlk14)s(invAb)scacauucuCfUfAfugu Z ac Z ua Z ug Z us(invAb)(C6-S)-X(SEQ ID NO:806);
[0084] usGfsusUfaGfuAfuGfgAfcAfgUfuGfuGfsu (SEQ ID NO: 113) and
[0085] (Z)3-(TriAlk14)s(invAb)sacacaacuGfUfCfcau Z ac Z ua Z acZ as(invAb)(C6-S)-X(SEQ ID NO:328);
[0086] usUfsusCfaUfgAfaAfuCfgUfuAfcGfuUfsg(SEQ ID NO:810) and
[0087] Y-(NH-C6)scsaa Z cgua Z aCfGfAfuuuca Z ugaa Z sa(invAb)(6-S)-X(SEQ ID NO:740);
[0088] usUfsusCfaUfgAfaAfuCfgUfuAfcGfuUfsg(SEQ ID NO:30) and
[0089] Y-(NH-C6)scsaac Z guaa Z CfGfAfuuu Z caug Z aasa(invAb)(6-S)-X(SEQ ID NO:756);
[0090] usUfsusCfaUfgAfaAfuCfgUfuAfcGfuUfsg(SEQ ID NO:30) and
[0091] Y-(NH-C6)scsaacg Z uaa Z CfGfAfu Z uuc Z augaasa(invAb)(6-S)-X(SEQ ID NO:757);
[0092] usUfsusCfaUfgAfaAfuCfgUfuAfcGfuUfsg(SEQ ID NO:30) and
[0093] Y-(NH-C6)scsaacguaaCfGfAfuuucau Z g Z a Z a Z sa(invAb)(6-S)-X(SEQ ID NO:762);
[0094] Where a, c, g, and u represent 2′-O-methyladenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2′-fluoroadenosine, cytidine, guanosine, and uridine, respectively; and each X, Y, and Z is independently a pharmacological part (e.g., a targeting ligand, a targeting group, and / or a PK enhancer); u Z a Z g Z and c Z These represent uridine, adenosine, guanosine, and cytidine, respectively, wherein the pharmacological portion (e.g., a targeting ligand, a targeting group, and / or a PK enhancer) is linked to the 2' position of the nucleotide (which terminates, for the HIF-2αRNAi reagent disclosed in the embodiments herein, by coupling to a 2'-O-propyne group), (TriAlk14), (NH2-C6), (C6-S), (6-S), and (invAb) are as defined in Table 7, and s represents a phosphate thioester bond.
[0095] In some embodiments, the HIF-2αRNAi reagent disclosed herein comprises an antisense strand and a sense strand, said antisense strand and sense strand being composed of one of the following nucleotide sequence pairs (5′→3′), substantially composed of one of the following nucleotide sequence pairs (5′→3′), or containing one of the following nucleotide sequence pairs (5′→3′):
[0096] usUfsusCfaUfgAfaAfuCfgUfuAfcGfuUfsg (SEQ ID NO:30) and
[0097] Y-(NH-C6)scsaacguaaCfGfAfuuu Z ca Z ug Z aa Z sa(invAb)(6-S)-X(SEQ ID NO:761);
[0098] asCfsasUfaGfuAfcAfuAfgAfgAfaUfgUfsg (SEQ ID NO:90) and
[0099] (Z)3-(TriAlk14)s(invAb)scacauucuCfUfAfugu Z ac Z ua Z ug Z us(invAb)(C6-S)-X(SEQ ID NO:806);
[0100] usGfsusUfaGfuAfuGfgAfcAfgUfuGfuGfsu (SEQ ID NO: 113) and
[0101] (Z)3-(TriAlk14)s(invAb)sacacaacuGfUfCfcau Z ac Z ua Z ac Z as(invAb)(C6-S)-X(SEQ ID NO:810);
[0102] usUfsusCfaUfgAfaAfuCfgUfuAfcGfuUfsg(SEQ ID NO:30) and
[0103] Y-(NH-C6)scsaa Z cgua Z aCfGfAfuuuca Z ugaa Z sa(invAb)(6-S)-X(SEQ ID NO:740);
[0104] usUfsusCfaUfgAfaAfuCfgUfuAfcGfuUfsg(SEQ ID NO:30) and
[0105] Y-(NH-C6)scsaac Z guaa Z CfGfAfuuu Z caug Z aasa(invAb)(6-S)-X(SEQ ID NO:756);
[0106] usUfsusCfaUfgAfaAfuCfgUfuAfcGfuUfsg(SEQ ID NO:30) and
[0107] Y-(NH-C6)scsaacg Z uaa Z CfGfAfu Z uuc Z augaasa(invAb)(6-S)-X(SEQ ID NO:757);
[0108] usUfsusCfaUfgAfaAfuCfgUfuAfcGfuUfsg(SEQ ID NO:30) and
[0109] Y-(NH-C6)scsaacguaaCfGfAfuuucau Z g Z a Z aZ sa(invAb)(6-S)-X(SEQ ID NO:762);
[0110] Where a, c, g, and u represent 2′-O-methyladenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2′-fluoroadenosine, cytidine, guanosine, and uridine, respectively; and each X, Y, and Z is independently a pharmacological part (e.g., a targeting ligand, a targeting group, and / or a PK enhancer); u Z a Z g Z and c Z These represent uridine, adenosine, guanosine, and cytidine, respectively, wherein the pharmacological portion (e.g., a targeting ligand, a targeting group, and / or a PK enhancer) is linked to the 2' position of the nucleotide (which terminates, for the HIF-2αRNAi reagent disclosed in the embodiments herein, by coupling to a 2'-O-propyne group), (TriAlk14), (NH2-C6), (C6-S), (6-S), and (invAb) as defined in Table 7, and s represents a phosphate thioester bond; and the sense strand also includes a targeting ligand covalently linked to the 5' terminal end, wherein the targeting ligand comprises a compound having affinity for an integrin receptor.
[0111] In some embodiments, the HIF-2αRNAi reagent disclosed herein includes an antisense strand comprising a nucleotide sequence differing from a nucleotide sequence (5′→3′) by 0 or 1 nucleotide base:
[0112] UUUCAUGAAAUCGUUACGU(SEQ ID NO:5);
[0113] UGUUAGUAUGGACAGUUGU (SEQ ID NO: 10); and
[0114] ACAUAGUACAUAGAGAAUG (SEQ ID NO: 13).
[0115] In some embodiments, the HIF-2αRNAi reagent disclosed herein includes an antisense strand comprising a nucleotide sequence differing from a nucleotide sequence (5′→3′) by 0 or 1 nucleotide base:
[0116] UUUCAUGAAAUCGUUACGU(SEQ ID NO:5);
[0117] UGUUAGUAUGGACAGUUGU (SEQ ID NO: 10); and
[0118] ACAUAGUACAUAGAGAAUG (SEQ ID NO: 13).
[0119] All or almost all of these nucleotides are modified nucleotides.
[0120] In some embodiments, the HIF-2αRNAi reagent disclosed herein includes an antisense strand comprising a nucleotide sequence differing from a nucleotide sequence (5′→3′) by 0 or 1 nucleotide base:
[0121] UUUCAUGAAAUCGUUACGU(SEQ ID NO:5);
[0122] UGUUAGUAUGGACAGUUGU (SEQ ID NO: 10); and
[0123] ACAUAGUACAUAGAGAAUG(SEQ ID NO:13);
[0124] All or substantially all of the nucleotides are modified nucleotides, and SEQ ID NO:5, SEQ ID NO:10 and SEQ ID NO:13 are located at nucleotide positions 1-19 (5′→3′) of the antisense strand, respectively.
[0125] In some embodiments, the HIF-2αRNAi reagent disclosed herein includes an antisense strand and a sense strand, each comprising a nucleotide sequence differing from a nucleotide sequence pair (5′→3′) by 0 or 1 nucleotide base:
[0126] UUUCAUGAAAUCGUUACGU (SEQ ID NO:5) and ACGUAACGAUUUCAUGAAA (SEQ ID NO:17);
[0127] UGUUAGUAUGGACAGUUGU (SEQ ID NO:10); and ACAACUGUCCAUACUAACA (SEQ ID NO:22); or
[0128] ACAUAGUACAUAGAGAAUG (SEQ ID NO: 13) and CAUUCUCUAUGUACUAUGU (SEQ ID NO: 25).
[0129] In some embodiments, the HIF-2αRNAi reagent disclosed herein includes an antisense strand and a sense strand, each comprising a nucleotide sequence differing from a nucleotide sequence pair (5′→3′) by 0 or 1 nucleotide base:
[0130] UUUCAUGAAAUCGUUACGU (SEQ ID NO:5) and ACGUAACGAUUUCAUGAAA (SEQ ID NO:17);
[0131] UGUUAGUAUGGACAGUUGU (SEQ ID NO:10); and ACAACUGUCCAUACUAACA (SEQ ID NO:22); or
[0132] ACAUAGUACAUAGAGAAUG (SEQ ID NO:13) and CAUUCUCUAUGUACUAUGU (SEQ ID NO:25); and
[0133] All or almost all of these nucleotides are modified nucleotides.
[0134] In some embodiments, the compositions described herein comprising one or more HIF-2αRNAi reagents are packaged in kits, containers, pouches, dispensers, pre-filled syringes, or tubular vials. In some embodiments, the compositions described herein are administered parenterally, for example, by intravenous injection, intravenous infusion, or subcutaneous injection.
[0135] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While similar or equivalent methods and materials to those described herein may be used to practice or experiment with the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated herein by reference in their entirety. In case of conflict, this specification (including definitions) shall prevail. Furthermore, the materials, methods, and embodiments described are merely exemplary and are not intended to be limiting.
[0136] Other objects, features, aspects and advantages of the invention will become apparent from the following detailed description, the accompanying drawings and the claims. Attached Figure Description
[0137] Figure 1 A schematic diagram of the HIF-2αRNAi reagent (shown as a double helix) linked to a tripentate targeting group (which includes three structural 2-avb3 targeting ligands), a C18-diacid PK enhancer, and four internal structural 2-abv3 targeting ligands (shown as internal nucleotides linked to the HIF-2αRNAi reagent). The chemical structures of the targeting ligands, targeting group, and PK enhancer are shown.
[0138] Figure 2The diagram shows a HIF-2αRNAi reagent (shown as a double helix) with one end connected to a PK enhancer and the other end connected to a tridentate scaffold (suitable for forming a tridentate targeting group comprising three targeting ligands). The simplified diagram of the HIF-2αRNAi reagent further illustrates some possible uses for targeting ligands (in...) Figure 2 The site (represented as "TL") that is linked to the HIF-2αRNAi reagent includes four targeting ligands linked to the internal nucleotides.
[0139] Figures 3A to 3D The chemical structure representation of HIF-2αRNAi reagent AD06299 in free acid form shows the “TL” (in) at the 2' position of nucleotides 2, 4, 6, and 8 (3'→5') on the sense strand, starting from the first nucleotide that forms a base pair with the antisense strand. Figure 3D Starting from and continuing until Figure 3C “TL” represents the conjugation site of the target ligand on these internal nucleotides.
[0140] Figures 4A to 4B Based on the study described in Example 16 of this article, images of tumor size from tumor-bearing mice are shown on day 36. Figure 4A The tumor size from the mediator control group (D5W) is shown, with the left kidney being the contralateral kidney and the right kidney (larger) being the tumor kidney. Figure 4B The tumor size from mice treated with the HIF-2αRNAi reagent is shown, with the left kidney being the contralateral kidney and the right kidney being the tumor kidney.
[0141] Figures 5A to 5B Images of immunohistochemical (IHC) staining of HIF-2α protein from tumor-bearing mice administered according to Example 16 of this document are shown. Figure 5A The mediator control group (D5W) is shown, where dark spots indicate the presence of HIF-2α protein. Figure 5B Mice in the treatment group treated with HIF-2αRNAi reagent are shown.
[0142] Figure 6 A bar graph reflecting the tumor size of animals treated according to Example 19 of this document. Animals were categorized based on tumor size measurements taken on day 34.
[0143] Figures 7A to 7GSchematic diagram showing the nucleotide, nucleoside linkages, and sense chain modifications of AD05971, AD06153, AD06157, AD05930, AD05966, AD05967, and AD05972 synthesized on a solid support, where a, c, g, and u represent 2′-O-methyladenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2′-fluoroadenosine, cytidine, guanosine, and uridine, respectively; aAlk, cAlk, gAlk, and uAlk represent 2′-O-propargyladenosine, cytidine, guanosine, and uridine, respectively; o represents a phosphate ester bond, and s represents a thiophosphate ester bond; and invAb, 6-SS-6, C6-SS-C6, NH2-C6, and TriAlk14 are all as defined in Table 7. After cleavage from the solid support, the RNAi reagent in Figure 7 can be further modified, such as by adding targeting ligands and PK enhancers. Detailed Implementation
[0144] RNAi reagents
[0145] This document describes an RNAi agent (referred to herein as HIF-2α or HIF2α RNAi agent, or HIF-2α or HIF2α RNAi trigger) for inhibiting the expression of the HIF-2α (EPAS1) gene. The HIF-2α RNAi agent described herein comprises a sense strand (also referred to as the passenger strand) and an antisense strand (also referred to as the guide strand). The sense strand and antisense strand may be partially complementary, substantially complementary, or completely complementary to each other. The length of the sense strand and antisense strand of the RNAi agent described herein may each be 16-49 nucleotides. In some embodiments, the sense strand and antisense strand are independently 17-26 nucleotides long. The sense strand and antisense strand may be the same length or different lengths. In some embodiments, the sense strand and antisense strand are independently 21-26 nucleotides long. In some embodiments, the sense strand and antisense strand are independently 21-24 nucleotides long. In some embodiments, the sense strand and antisense strand are 21 nucleotides long. In some embodiments, the sense strand and / or antisense strand are independently 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. The RNAi reagent described herein, upon delivery to cells expressing HIF-2α, inhibits the expression of one or more HIF-2α (EPAS1) genes in vivo or in vitro.
[0146] One aspect described in this article is an RNAi agent for inhibiting the expression of the HIF-2α (EPAS1) gene, which comprises:
[0147] (i) An antisense strand containing at least 17 adjacent nucleotides that differs from any of the sequences provided in Table 3 by 0 or 1 nucleotide;
[0148] (ii) a sense strand comprising a nucleotide sequence at least partially complementary to the antisense strand; and
[0149] (iii) One or more targeted ligands.
[0150] In another aspect, an RNAi agent capable of inhibiting the expression of the HIF-2α (EPAS1) gene is described, comprising:
[0151] (i) An antisense strand of length between 18 and 49 nucleotides that is at least partially complementary to the HIF-2α (EPAS1) gene (SEQ ID NO: 1);
[0152] (ii) A sense chain that is at least partially complementary to the antisense chain;
[0153] (iii) A targeting ligand connected to the sense chain; and
[0154] (iv) A PK enhancer attached to the sense chain.
[0155] The antisense strand of the HIF-2αRNAi reagent described herein comprises at least 16 consecutive nucleotides, which is at least 85% complementary to the core sequence of the same number of nucleotides in the HIF-2α mRNA (also referred to herein as the "core segment" or "core sequence") and the core segment of the corresponding number of nucleotides in the sense strand. In some embodiments, the antisense strand core segment is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the antisense strand core segment is 19 nucleotides in length. In some embodiments, the antisense strand core segment is 17 nucleotides in length.
[0156] The sense strand of the HIF-2αRNAi reagent described herein comprises at least 16 consecutive nucleotides, which has at least 85% identity with a core segment of the same number of nucleotides in HIF-2α mRNA. In some embodiments, the sense strand core segment is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the sense strand core segment is 17 nucleotides in length. In some embodiments, the sense strand core segment is 19 nucleotides in length.
[0157] In some embodiments, the HIF-2α RNAi reagents disclosed herein target portions of the HIF-2α gene having any of the sequences disclosed in Table 1.
[0158] Examples of HIF-2αRNAi reagent antisense strands that may be included in the HIF-2αRNAi reagents disclosed herein are provided in Table 3. Examples of HIF-2αRNAi reagent antisense strands that may be included in the HIF-2αRNAi reagents disclosed herein are provided in Tables 4, 4.1, 4.2, and 4.3. Examples of HIF-2αRNAi reagent duplexes are provided in Table 5. Examples of 19-nucleotide core sequences that constitute or are included in the sense and antisense strands of the HIF-2αRNAi reagents disclosed herein are provided in Table 2.
[0159] In some embodiments, compositions are described herein that comprise one or more HIF-2αRNAi reagents having a double-stranded structure disclosed in Table 5.
[0160] In another aspect, the HIF-2α RNAi reagent disclosed herein can be delivered to target cells or tissues by covalently linking or conjugating the RNAi reagent to one or more targeting ligands (e.g., ligands comprising compounds having affinity for one or more cellular receptors located on cells expressing HIF-2α). In some embodiments, suitable targeting ligands include or consist of compounds having affinity for one or more integrins (or alternatively referred to as "integrin receptors").
[0161] HIF-2αRNAi reagents can be delivered to cells, including, but not limited to, cancer cells such as (ccRCC) cells, using any oligonucleotide delivery technology known in the art. Nucleic acid delivery methods include, but are not limited to, by linking or conjugating to a target ligand, by encapsulation in liposomes, by iontophoresis, or by incorporation with other mediators, such as hydrogels, cyclodextrins, biodegradable nanocapsules and bioadhesive microspheres, protein carriers, or dynamic polyconjugates. TM (DPC).
[0162] In some embodiments, the HIF-2αRNAi reagent is linked to a targeting ligand comprising a compound having affinity for one or more integrins (hereinafter referred to as an "integrin targeting ligand"). In some embodiments, a suitable targeting ligand for use with the HIF-2αRNAi reagent disclosed herein has affinity for integrin α-v-β3, integrin α-v-β-5, or both. The targeting ligand may be present alone (only one targeting compound is present), or two or more targeting ligands may be linked together via a branch point or scaffold to form a targeting group, and the branch point or scaffold of the targeting group is then individually linked to the RNAi reagent. The targeting group may include two targeting ligands (referred to as "bident"), three targeting ligands ("tridentent"), four targeting ligands ("tetradentent"), or more than four targeting ligands. In some embodiments, the HIF-2αRNAi reagent is linked to two or more targeting ligands. In some embodiments, the HIF-2αRNAi reagent is linked to 2-10 targeting ligands. In some embodiments, the HIF-2αRNAi reagent is linked to 7 targeting ligands. In some embodiments, the HIF-2αRNAi reagent is linked to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more targeting ligands.
[0163] In some embodiments, when the HIF-2α RNAi reagent is conjugated to a targeting ligand comprising a compound having affinity for integrin α-v-β3 and / or integrin α-v-β-5, the RNAi reagent is selectively internalized by ccRCC cells via receptor-mediated endocytosis or otherwise. Examples of targeting ligands and targeting groups having affinity for integrin α-v-β3 and / or integrin α-v-β-5 that can be used to deliver the HIF-2α RNAi reagent are disclosed, for example, in PCT Patent Publication No. WO2019 / 210200, which is incorporated herein by reference in its entirety.
[0164] The targeting ligand can be attached to the 3′ or 5′ end of the sense strand, the 3′ or 5′ end of the antisense strand, and / or internally attached to one or more individual nucleotides of the sense and / or antisense strands of the HIF-2α RNAi reagent. In some embodiments, the targeting ligand or targeting group is attached to the 3′ or 5′ end of the sense strand. In some embodiments, the targeting ligand or targeting group is attached to the 5′ end of the sense strand. In some embodiments, the targeting ligand or targeting group is internally attached to nucleotides of the sense and / or antisense strands of the RNAi reagent. In some embodiments, the targeting ligand or targeting group is attached to the 5′ end of the sense strand, and one or more targeting ligands are attached to one or more internal nucleotides of the sense strand. In some embodiments, the targeting ligand or targeting group is attached to the RNAi reagent via a linker.
[0165] With or without a adapter, a targeting ligand or targeting group may be attached to the 5′ or 3′ end of any sense and / or antisense strand disclosed in Tables 2, 3 or 4, 4.1, 4.2 or 4.3. With or without a targeting ligand or targeting group, a adapter may be attached to the 5′ or 3′ end of any sense and / or antisense strand disclosed in Tables 2, 3 or 4, 4.1, 4.2 or 4.3.
[0166] In another aspect, the HIF-2αRNAi reagents disclosed herein can be linked to or conjugated to one or more pharmacokinetic / pharmacodynamic (PK) enhancers. PK enhancers (also referred to as "pharmacokinetic (PK) modifiers") used herein are compounds that, when linked to oligonucleotide-based pharmaceutical products or other therapeutic agents, can increase the systemic circulation time (increased half-life or plasma residence time) of the therapeutic agent compared to its free form. This is achieved by limiting renal excretion without impeding delivery of the therapeutic agent to target cells or tissues, or otherwise provides a pharmacodynamic improvement compared to a therapeutic agent without a PK enhancer. Exemplary PK enhancers suitable for use with HIF-2αRNAi reagents are disclosed herein. Those skilled in the art will recognize that the selected therapeutic agent can be readily designed with relevant in vivo and / or in vitro studies to identify additional suitable PK enhancers. For example, studies comparing therapeutic agents with and without PK enhancers can be readily designed to quantify the amount of pharmaceutical product remaining in the systemic circulation of a subject at different time intervals, or to evaluate the effect or potency or duration of effect of the therapeutic agent at relevant time points. This is within the knowledge of someone skilled in the art.
[0167] In another aspect, this disclosure is characterized by a method for inhibiting the expression of the HIF-2α (EPAS1) gene, wherein the method comprises administering to a subject or to cells of a subject an amount of HIF-2α RNAi reagent capable of inhibiting the expression of the HIF-2α gene, wherein the HIF-2α RNAi reagent comprises a sense strand and an antisense strand, and wherein the antisense strand comprises a sequence of any antisense nucleotide sequence in Table 2 or Table 3. In some embodiments, this document discloses a method for inhibiting the expression of the HIF-2α gene, wherein the method comprises administering to a subject or to cells an amount of HIF-2α RNAi reagent capable of inhibiting the expression of the HIF-2α gene, wherein the HIF-2α RNAi reagent comprises a sense strand and an antisense strand, and wherein the sense strand comprises a sequence of any sense nucleotide sequence in Table 2, 4, 4.1, 4.2, or 4.3. Compositions for use in such methods are also described herein.
[0168] This document also discloses a method for delivering a HIF-2αRNAi reagent in vivo to cells expressing integrin (also referred to herein as "integrin receptor") in a subject (such as a mammal). In some embodiments, the delivery of the HIF-2αRNAi reagent to desired cells is facilitated by linking the HIF-2RNAi reagent to one or more targeting ligands and / or one or more PK enhancers. Compositions for use in such methods are also described.
[0169] In another aspect, this disclosure is characterized by methods for treating (including preventative or prophylactic treatment) a disease, condition, or symptom that may be at least partially mediated by a reduction in HIF-2α expression, including ccRCC, wherein the method comprises administering to a subject in need an HIF-2α RNAi reagent having an antisense strand comprising a sequence of any one of the sequences in Table 2 or 3. In some embodiments, methods for treating (including prophylactic treatment) a disease, symptom, or symptom that may be at least partially mediated by a reduction in HIF-2α expression, including ccRCC, wherein the method comprises administering to a subject in need an HIF-2α RNAi reagent having a sense strand comprising a sequence of any one of the sequences in Table 2, 4, 4.1, 4.2, or 4.3. Compositions for use in such methods are also described herein.
[0170] Methods for treating human subjects who have a pathological state (such as a symptom or disease) or are at risk of developing a pathological state mediated at least in part by HIF-2α gene expression are also described. The methods include administering a therapeutically effective amount of a HIF-2α RNAi agent and / or a composition containing a HIF-2α RNAi agent to the subject. The method of treating the subject with a HIF-2α RNAi agent and / or a composition containing a HIF-2α RNAi agent may optionally be combined with the administration of one or more additional (e.g., second, third, etc.) therapeutic agents or one or more steps of treatment. Additional therapeutic agents may be another HIF-2α RNAi agent (e.g., an HIF-2α RNAi agent targeting a different sequence within the HIF-2α gene). Additional therapeutic agents may also be small molecule drugs, antibodies, antibody fragments, and / or aptamers.
[0171] In another aspect, this document describes pharmaceutical compositions comprising one or more of the described HIF-2αRNAi agents, optionally in combination with one or more additional (second, third, etc.) therapeutic agents. In some embodiments, the pharmaceutical composition comprising one or more of the described HIF-2αRNAi agents, optionally in combination with one or more additional (e.g., second, third, etc.) therapeutic agents, may be formulated in a pharmaceutically acceptable carrier or diluent. In some embodiments, these compositions may be administered to a subject, such as a mammal. In some embodiments, the mammal is a human. In some embodiments, the optional one or more additional therapeutic agents are pharmaceutical products indicated for the treatment of cancer (such as one or more cancers). The HIF-2αRNAi agent and the additional therapeutic agent may be administered in a single composition, or they may be administered separately. In some embodiments, the one or more additional therapeutic agents are administered separately in a dosage form separate from the RNAi agent (e.g., the HIF-2αRNAi agent is administered by intravenous infusion or injection, while the additional therapeutic agent involved in the treatment regimen is administered orally). In some embodiments, the described HIF-2α RNAi agent is administered to a subject in need via intravenous infusion or injection, or by intravenous infusion, injection, or oral administration of one or more optional additional therapeutic agents, together providing a treatment regimen for diseases and conditions mediated by HIF-2α gene expression (such as ccRCC). In some embodiments, the HIF-2α RNAi agent and one or more additional therapeutic agents are combined in a single dosage form (e.g., a “mixture” of a single composition formulated for intravenous infusion or injection). With or without one or more additional therapeutic agents, the HIF-2α RNAi agent may be combined with one or more excipients to form a pharmaceutical composition.
[0172] In some embodiments, this document discloses a method for inhibiting the expression of the HIF-2α gene in cells or subjects, wherein the method comprises administering to cells or subjects an HIF-2α RNAi reagent having a sense strand and an antisense strand, the sense strand comprising a sequence of any one of the sequences in Tables 4, 4.1, 4.2 or 4.3, and the antisense strand comprising a sequence of any one of the sequences in Table 3.
[0173] In some embodiments, compositions for in vivo delivery of HIF-2αRNAi reagents to ccRCC cells are described, the compositions comprising: HIF-2αRNAi reagents conjugated to or conjugated to one or more targeting ligands. In some embodiments, the targeting ligands comprise compounds having affinity for integrin α-v-β-3 and / or integrin α-v-β-5. In some embodiments, the HIF-2αRNAi reagents conjugated to or conjugated to one or more targeting ligands are further conjugated to or conjugated to one or more PK enhancers.
[0174] In some embodiments, compositions for in vivo delivery of HIF-2αRNAi reagents to ccRCC cells are disclosed, said compositions comprising HIF-2αRNAi reagents conjugated to or linked to one or more targeting ligands and / or targeting groups. In some embodiments, the targeting ligands and / or targeting groups comprise compounds having affinity for one or more integrins. In some embodiments, compositions for in vivo delivery of HIF-2αRNAi reagents to ccRCC cells are described, said compositions comprising HIF-2αRNAi reagents linked to α-v-β-3 and / or α-v-β-5 integrin targeting ligands.
[0175] In some embodiments, this document discloses a method for inhibiting the expression of the HIF-2α (EPAS1) gene in cells, wherein the method comprises administering the cells an HIF-2α RNAi reagent comprising an antisense strand, the antisense strand being at least partially complementary to a portion of HIF-2α mRNA having a sequence in Table 1. In some embodiments, this document discloses a method for inhibiting the expression of the HIF-2α gene in cells, wherein the method comprises administering the cells an HIF-2α RNAi reagent comprising an antisense strand and a sense strand, the antisense strand comprising a sequence of any one of the sequences in Table 2 or 3, and the sense strand comprising any one of the sequences in Table 2 or Table 4, 4.1, 4.2, or 4.3 that is at least partially complementary to the antisense strand. In some embodiments, this document discloses a method for inhibiting the expression of the HIF-2α gene in cells, wherein the method comprises administering an HIF-2α RNAi reagent comprising a sense strand and an antisense strand, the sense strand comprising any one of the sequences in Table 2 or Table 4, 4.1, 4.2 or 4.3, and the antisense strand comprising a sequence of any one of the sequences in Table 2 or 3 that is at least partially complementary to the sense strand.
[0176] In some embodiments, this document discloses compositions for inhibiting the expression of the HIF-2α gene in cells, wherein the method comprises administering a composition containing a HIF-2αRNAi reagent having a double-stranded structure as shown in Table 5.
[0177] The HIF-2α RNAi reagent disclosed herein is designed to target a specific location on the HIF-2α (EPAS1) gene (SEQ ID NO:1). As defined herein, an antisense strand sequence is designed to target the HIF-2α gene at a given location on the gene when the 5′ terminal nucleobase of the antisense strand is aligned 19 nucleotides downstream (towards the 3′ end) of the location on the gene. For example, as shown in Tables 1 and 2 herein, an antisense strand sequence designed to target the HIF-2α gene at location 5033 requires that, when paired with the gene bases, the 5′ terminal nucleobase of the antisense strand is aligned with location 5051 of the HIF-2α (EPAS1) gene.
[0178] As provided herein, the HIF-2αRNAi reagent does not require the nucleotide at position 1 (5′→3′) of the antisense strand to be complementary to the gene, provided that the antisense strand and the gene have at least 85% complementarity over a core sequence of at least 16 consecutive nucleotides (e.g., at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity). For example, for the HIF-2α RNAi reagent disclosed herein designed to target position 5033 of the HIF-2α gene, the 5′ terminal nucleotide of the antisense strand of the HIF-2α RNAi reagent must be aligned with position 5051 of the gene; however, the 5′ terminal nucleotide of the antisense strand may be complementary to position 5051 of the HIF-2α gene, but this is not required, provided that the antisense strand and the gene have at least 85% complementarity over a core sequence of at least 16 consecutive nucleotides (e.g., at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity). As demonstrated, particularly by the embodiments disclosed herein, the antisense strand of the HIF-2αRNAi reagent and its specific binding site to the gene (e.g., whether the HIF-2αRNAi reagent is designed to target the HIF-2α(EPAS1) gene at position 5033 or at some other location) are important for the level of inhibition achieved by the HIF-2αRNAi reagent.
[0179] The described HIF-2α RNAi reagent can mediate RNA interference to inhibit the expression of one or more genes essential for the production of HIF-2α protein. The HIF-2α RNAi reagent can also be used to treat or prevent various diseases, disorders, or conditions, including ccRCC. Furthermore, compositions for delivering the HIF-2α RNAi reagent to ccRCC cells in vivo are described.
[0180] Pharmaceutical compositions comprising one or more HIF-2αRNAi agents can be administered in many ways, depending on whether local or systemic treatment is required. Administration can be, but is not limited to, intravenous, intra-arterial, subcutaneous, intraperitoneal, subdermal (e.g., via an implanted device), and intraparenchymal administration. In some embodiments, the pharmaceutical compositions described herein are administered by intravenous infusion or injection.
[0181] In some embodiments, the compositions described herein comprising one or more HIF-2αRNAi reagents are packaged in kits, containers, bags, dispensers, pre-filled syringes, infusion bags, or tubular bottles. In some embodiments, the compositions described herein are administered parenterally.
[0182] Each HIF-2αRNAi reagent comprises a sense strand and an antisense strand. The sense strand and antisense strand can each be 16-30 nucleotides in length. The sense strand and antisense strand can be the same length, or they can be different lengths. In some embodiments, the sense strand and antisense strand are each independently 17-27 nucleotides in length. In some embodiments, the sense strand and antisense strand are each independently 17-21 nucleotides in length. In some embodiments, the sense strand and antisense strand are each 21-26 nucleotides in length. In some embodiments, the sense strand and antisense strand are each 21-24 nucleotides in length. In some embodiments, the sense strand is about 19 nucleotides in length, and the antisense strand is about 21 nucleotides in length. In some embodiments, the sense strand is about 21 nucleotides in length, and the antisense strand is about 23 nucleotides in length. In some embodiments, the sense strand is 23 nucleotides in length and the antisense strand is 21 nucleotides in length. In some embodiments, the sense strand and antisense strand are each 21 nucleotides in length. In some embodiments, the sense strand and antisense strand of the RNAi reagent are each independently 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, or 27 nucleotides in length. In some embodiments, the double-stranded RNAi reagent has a double-stranded length of about 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides.
[0183] In some implementations, the region of perfect, substantially or partially complementarity between the sense and antisense strands is 16-26 nucleotides long (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or 26) and is located at or near the 5′ end of the antisense strand (e.g., this region may be 0, 1, 2, 3 or 4 nucleotides apart from the 5′ end of the antisense strand, and they are not perfectly, substantially or partially complementary).
[0184] Both the sense strand and the antisense strand contain a core segment of 16-23 nucleotides in length (also referred to herein as the "core sequence" or "core segment sequence"). The antisense core segment has 100% (perfect) complementarity or at least about 85% (substantially) complementarity with the nucleotide sequence present in the HIF-2α (EPAS1) mRNA target (sometimes referred to, for example, as the target sequence). The sense core segment sequence has 100% (perfect) complementarity or at least about 85% (substantially) complementarity with the core segment sequence in the antisense strand, and thus the sense core segment sequence generally has perfect or at least about 85% identity with the nucleotide sequence present in the HIF-2α mRNA target (the target sequence). The sense core segment sequence may be the same length as the corresponding antisense core sequence, or it may be a different length. In some embodiments, the antisense core segment sequence is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some implementations, the sense core sequence is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length.
[0185] Examples of nucleotide sequences used to form HIF-2α RNAi reagents are provided in Tables 2, 3, and 4 (as well as 4.1, 4.2, and 4.3). Examples of RNAi reagent duplexes including sense and antisense strand sequences from Tables 2, 3, and 4 are shown in Table 5.
[0186] The sense and antisense strands of the HIF-2αRNAi reagent anneal to form a doublet. The sense and antisense strands of the HIF-2αRNAi reagent can be partially, substantially, or completely complementary to each other. Within the complementary doublet region, the sense core sequence and the antisense core sequence have at least 85% or 100% complementarity. In some embodiments, the sense core sequence contains a sequence of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides, which has at least 85% or 100% complementarity with the corresponding 16, 17, 18, 19, 20, 21, 22, or 23 nucleotide sequence of the antisense core sequence (e.g., the sense and antisense core sequences of the HIF-2αRNAi reagent may have regions of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides with at least 85% or 100% base pairing).
[0187] In some embodiments, the antisense strand of the HIF-2αRNAi reagent disclosed herein differs from any antisense strand sequence in Table 2 or Table 3 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of the HIF-2αRNAi reagent disclosed herein differs from any sense strand sequence in Table 2 or Table 4, 4.1, 4.2, or 4.3 by 0, 1, 2, or 3 nucleotides.
[0188] The sense strand and / or antisense strand may optionally and independently contain 1, 2, 3, 4, 5, or 6 additional nucleotides (extensions) at the 3′, 5′, or both 3′ and 5′ ends of the core sequence. Additional antisense strand nucleotides, if present, may or may not be complementary to the corresponding sequence in HIF-2α mRNA. Additional sense strand nucleotides, if present, may or may not be identical to the corresponding sequence in HIF-2α mRNA. Additional antisense strand nucleotides (if present) may or may not be complementary to additional nucleotides of the corresponding sense strand (if present).
[0189] The extensions used herein comprise 1, 2, 3, 4, 5, or 6 nucleotides at the 5' and / or 3' ends of the sense strand core sequence and / or antisense strand core sequence. The extension nucleotides on the sense strand may or may not be complementary to the corresponding nucleotides (core sequence nucleotides or extension nucleotides) in the antisense strand. Conversely, the extension nucleotides on the antisense strand may or may not be complementary to the corresponding nucleotides (core sequence nucleotides or extension nucleotides) in the sense strand. In some embodiments, the sense and antisense strands of the RNAi reagent contain 3′ and 5′ extensions. In some embodiments, one or more of the 3′ extension nucleotides of one strand base-pair with one or more 5′ extension nucleotides of the other strand. In other embodiments, one or more of the 3′ extension nucleotides of one strand do not base-pair with one or more 5′ extension nucleotides of the other strand. In some embodiments, the HIF-2α RNAi reagent comprises an antisense strand with a 3′ extension and a sense strand with a 5′ extension. In some embodiments, the extension nucleotides are unpaired and form overhangs. As used herein, “protruding end” refers to a segment of one or more unpaired nucleotides located at the terminal end of the sense or antisense strand that does not form part of the hybridization or double-stranded portion of the RNAi reagent disclosed herein.
[0190] In some embodiments, the HIF-2αRNAi reagent comprises an antisense strand with a 3′ extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In other embodiments, the HIF-2αRNAi reagent comprises an antisense strand with a 3′ extension of 1, 2, or 3 nucleotides in length. In some embodiments, one or more of the antisense strand extension nucleotides contain nucleotides complementary to the corresponding HIF-2α mRNA sequence. In some embodiments, one or more of the antisense strand extension nucleotides contain nucleotides non-complementary to the corresponding HIF-2α mRNA sequence.
[0191] In some embodiments, the 5' and / or 3' ends of the antisense strand may include a debase residue (Ab), which may also be referred to as a "debase site" or "debase nucleotide". A debase residue (Ab) is a nucleotide or nucleoside lacking a nucleobase at the 1' position of the sugar moiety (see, for example, U.S. Patent No. 5,998,203, which is incorporated herein by reference). In some embodiments, the debase residue may be located inside the nucleotide sequence. In some embodiments, Ab or AbAb may be added to the 3' end of the antisense strand. In some embodiments, the 5' end of the sense strand may include one or more additional debase residues (e.g., (Ab) or (AbAb)). In some embodiments, UUAb, UAb, or Ab may be added to the 3' end of the sense strand. In some embodiments, a debase (deoxyribose) residue may be replaced with a ribitol (debase ribose) residue.
[0192] In some embodiments, the sense strand or the antisense strand may include a “terminal cap”, which, as used herein, is a nonnucleotide compound or other portion that may be incorporated into one or more ends of the strand of the RNAi reagent disclosed herein, and in some cases may provide certain beneficial properties to the RNAi reagent, such as protection against exonuclease degradation. In some embodiments, an inverted debase residue (invAb) is added as a terminal cap (see Table 7). (See, for example, F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16). Terminal caps are generally known in the art and include, for example, inverted debase residues and carbon chains such as terminal C3H7 (propyl), C6H 13 (Hexyl) or C 12 H 25 (Dodecyl) group. In some embodiments, the terminal cap is present at the 5′ end, the 3′ end, or both the 5′ and 3′ ends of the sense chain. In some embodiments, the 3′ end of the sense chain may include an additional debased residue or an inverted debased terminal cap.
[0193] In some embodiments, one or more inverted debase residues (invAbs) are added to the 3′ end of the sense strand. In some embodiments, one or more inverted debase residues (invAbs) are added to the 5′ end of the sense strand. In some embodiments, one or more inverted debase residues or inverted debase sites are inserted between the nucleotide sequences of the sense strand of the targeting ligand and the RNAi reagent. In some embodiments, the inclusion of one or more inverted debase residues or inverted debase sites at or near one or more terminal ends of the sense strand of the RNAi reagent allows for enhanced activity or other desired properties of the RNAi reagent.
[0194] In some embodiments, one or more inverted abase residues (invAb) are added to the 5′ end of the sense strand. In some embodiments, one or more inverted abase residues may be inserted between the nucleotide sequences of the sense strand of the targeting ligand and the RNAi reagent. In some embodiments, the inclusion of one or more inverted abase residues at or near one or more terminal ends of the sense strand of the RNAi reagent may allow for enhanced activity or other desired properties of the RNAi reagent. In some embodiments, inverted abase (deoxyribose) residues may be replaced with inverted ribitol (debase ribose) residues.
[0195] In some implementations, the 3′ end of the antisense core sequence or the 3′ end of the antisense sequence may include an inverted debasement residue (invAb (see Table 7)).
[0196] In some embodiments, the HIF-2αRNAi reagent comprises a sense strand having a 3′ extension of 1, 2, 3, 4, or 5 nucleotides in length. In some embodiments, one or more of the nucleotides in the sense extension comprise adenosine, uracil, or thymidine nucleotides, AT dinucleotides, or nucleotides corresponding to or identical to nucleotides in the HIF-2α mRNA sequence. In some embodiments, the 3′ sense extension comprises, but is not limited to, one of the following sequences: T, UT, TT, UU, UUT, TTT, or TTTT (each listed from 5′ to 3′).
[0197] In some embodiments, the HIF-2αRNAi reagent comprises a sense strand having a 5′ extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides contain nucleotides that correspond to or are identical to nucleotides in the HIF-2α mRNA sequence. In some embodiments, the sense strand 5′ extension is one of, but not limited to, the following sequences: CA, AUAGGC, AUAGG, AUAG, AUA, A, AA, AC, GCA, GGCA, GGC, UAUCA, UAUC, UCA, UAU, U, UU (each listed as 5′ to 3′). The sense strand may have a 3′ extension and / or a 5′ extension.
[0198] Examples of sequences used to form the HIF-2αRNAi reagent are provided in Tables 2, 3 and 4, 4.1, 4.2 and 4.3. In some embodiments, the HIF-2αRNAi reagent antisense strand includes a sequence from any of the sequences in Table 2 or 3. In some embodiments, the HIF-2αRNAi reagent antisense strand includes or is composed of any of the modified sequences in Table 3. In some embodiments, the HIF-2αRNAi reagent antisense strand includes nucleotides (from 5′ end to 3′ end) 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, or 2-21 from any of the sequences in Table 2 or 3. In some embodiments, the HIF-2αRNAi reagent sense strand includes a sequence from any of the sequences in Table 2 or 4. In some embodiments, the sense strand of the HIF-2αRNAi reagent comprises nucleotides (from 5′ end to 3′ end) 1-18, 1-19, 1-20, 1-21, 2-19, 2-20, 2-21, 3-20, 3-21, or 4-21 from any of the sequences in Table 2 or 4. In some embodiments, the sense strand of the HIF-2αRNAi reagent comprises or is composed of any of the modified sequences in Table 4, 4.1, 4.2, or 4.3.
[0199] In some embodiments, the sense and antisense strands of the RNAi reagent described herein contain the same number of nucleotides. In some embodiments, the sense and antisense strands of the RNAi reagent described herein contain different numbers of nucleotides. In some embodiments, the 5′ end of the sense strand and the 3′ end of the antisense strand of the RNAi reagent form blunt ends. In some embodiments, the 3′ end of the sense strand and the 5′ end of the antisense strand of the RNAi reagent form blunt ends. In some embodiments, both ends of the RNAi reagent form blunt ends. In some embodiments, neither end of the RNAi reagent is blunt. As used herein, "blunt end" refers to the end of a double-stranded RNAi reagent in which the terminal nucleotides of the two annealed strands are complementary (forming complementary base pairs).
[0200] In some embodiments, the 5′ end of the sense strand and the 3′ end of the antisense strand of the RNAi reagent form frayed ends. In some embodiments, the 3′ end of the sense strand and the 5′ end of the antisense strand of the RNAi reagent form frayed ends. In some embodiments, both ends of the RNAi reagent form frayed ends. In some embodiments, neither end of the RNAi reagent is a frayed end. As used herein, a frayed end refers to the end of a double-stranded RNAi reagent where the terminal nucleotides of the two annealed strands form a pair (no overhang) but are not complementary (non-complementary pair). In some embodiments, one or more unpaired nucleotides at the end of one strand of the double-stranded RNAi reagent form an overhang. The unpaired nucleotides can be on the sense strand or the antisense strand, thus establishing a 3′ or 5′ overhang. In some embodiments, the RNAi reagent contains: a blunt end and a flared end; a blunt end and a 5′ protruding end; a blunt end and a 3′ protruding end; a flared end and a 5′ protruding end; a flared end and a 3′ protruding end; two 5′ protruding ends; two 3′ protruding ends; a 5′ protruding end and a 3′ protruding end; two flared ends; or two blunt ends. Typically, when present, the protruding end is located at the 3′ end of the sense strand, antisense strand, or both sense and antisense strands.
[0201] When used in different polynucleotide or oligonucleotide constructs, the modified nucleotides can preserve the activity of the compound in cells while increasing the serum stability of these compounds, and can also minimize the possibility of activating interferon activity in humans after administration of the polynucleotide or oligonucleotide construct.
[0202] In some embodiments, the HIF-2αRNAi reagent is prepared or provided as a salt, a mixture of salts, or a free acid. In some embodiments, the HIF-2αRNAi reagent is prepared as a sodium salt. Such forms, well known in the art, are within the scope of the invention disclosed herein.
[0203] definition
[0204] As used in this article, the terms “oligonucleotide” and “polynucleotide” refer to polymers of linked nucleosides, each of which may be independently modified or unmodified.
[0205] As used herein, “RNAi reagent” (also referred to as “RNAi trigger”) means a composition containing RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecules capable of degrading or inhibiting (e.g., under appropriate conditions, degrading or inhibiting) the translation of messenger RNA (mRNA) transcripts of target mRNA in a sequence-specific manner. RNAi reagents as used herein may function via RNA interference mechanisms (e.g., by inducing RNA interference through interaction with RNA interference pathways in mammalian cells, such as RNA-induced silencing complexes or RISC), or via alternative mechanisms or pathways. Although it is believed, as the terminology is used herein, that RNAi reagents function primarily through RNA interference mechanisms, the disclosed RNAi reagents are not bound by or limited to any particular pathway or mechanism of action. The RNAi reagents disclosed herein contain sense and antisense strands and include, but are not limited to, short (or small) interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), and dicer substrates. The RNAi reagent described herein has an antisense strand that is at least partially complementary to the targeted mRNA (HIF-2α mRNA). The RNAi reagent may include one or more modified nucleotides and / or one or more non-phosphodiester bonds.
[0206] When referring to the expression of a given gene, the terms “silence,” “reduction,” “inhibition,” “downregulation,” or “knockdown” as used herein mean that, when a cell, cell assembly, tissue, organ, or subject is treated with the RNAi reagent described herein, the expression of said gene is reduced compared to a second cell, cell assembly, tissue, organ, or subject that has not been so treated, measured by the level of RNA transcribed from said gene or the level of polypeptide, protein, or protein subunit translated from mRNA in the cell, cell assembly, tissue, organ, or subject in which said gene is transcribed.
[0207] As used in this article, the terms “sequence” and “nucleotide sequence” refer to a series or sequence of nucleobases or nucleotides described by consecutive letters using standard nomenclature.
[0208] As used herein, “base,” “nucleotide base,” or “nucleobase” refers to heterocyclic pyrimidine or purine compounds that are components of nucleotides, and includes primary purine bases adenine and guanine, and primary pyrimidine bases cytosine, thymine, and uracil. Nucleobases may be further modified to include, but are not limited to, universal bases, hydrophobic bases, hybrid bases, size-enlarged bases, and fluorinated bases (see, for example, Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed., Wiley-VCH, 2008). The synthesis of such modified nucleobases (including phosphorous amide compounds containing modified nucleobases) is known in the art.
[0209] As used herein and unless otherwise stated, the term "complementary" when used to describe a first nucleobase or nucleotide sequence (e.g., a sense strand or targeted mRNA of an RNAi reagent) relative to a second nucleobase or nucleotide sequence (e.g., an antisense strand of an RNAi reagent or a single-stranded antisense oligonucleotide) refers to the ability of an oligonucleotide or polynucleotide containing the first nucleotide sequence to hybridize (forming base-pair hydrogen bonds under mammalian physiological conditions (or similar in vitro conditions)) and form a double-stranded or double-helix structure under certain standard conditions. A complementary sequence contains Watson-Crick base pairs or non-Watson-Crick base pairs and contains, at least to the extent required to satisfy the above hybridization requirements, a native or modified nucleotide or nucleotide mimic. Sequence identity or complementarity is independent of modification. For example, for the purpose of determining identity or complementarity, a and Af as defined herein are complementary to U (or T) and identical to A.
[0210] As used in this article, "perfect complementarity" or "complete complementarity" means that in a hybridization pair of nucleobase or nucleotide sequences, all (100%) bases in the sequential sequence of the first oligonucleotide will hybridize with the same number of bases in the sequential sequence of the second oligonucleotide. The sequential sequence may contain all or part of the first or second nucleotide sequence.
[0211] As used in this article, "partial complementarity" means that in a hybridization pair of nucleobase or nucleotide sequences, at least 70% (but not all) of the bases in the sequential sequence of the first oligonucleotide will hybridize with the same number of bases in the sequential sequence of the second oligonucleotide. The sequential sequence may contain all or part of the first or second nucleotide sequence.
[0212] As used herein, "substantially complementary" means that in a hybridization pair of nucleobase or nucleotide sequences, at least 85% (but not all) of the bases in the sequential sequence of the first oligonucleotide will hybridize with the same number of bases in the sequential sequence of the second oligonucleotide. The sequential sequence may contain all or part of the first or second nucleotide sequence.
[0213] As used herein, the terms “complementary,” “fully complementary,” “partially complementary,” and “substantially complementary” are used to describe nucleobase or nucleotide matching between the sense and antisense strands of the RNAi reagent or between the antisense strand of the RNAi reagent and the sequence of HIF-2α(EPAS1) mRNA.
[0214] As used herein, the terms "substantially identical" or "substantially identical" when applied to nucleic acid sequences mean that a nucleotide sequence (or a portion thereof) has at least about 85% sequence identity or higher compared to a reference sequence, for example, at least 90%, at least 95%, or at least 99% identity. The percentage of sequence identity is determined by comparing two best-aligned sequences in a comparison window. The percentage is calculated as follows: the number of positions in both sequences containing the same type of nucleic acid base is determined to produce the number of matching positions; the number of matching positions is divided by the total number of positions in the comparison window, and the result is multiplied by 100 to produce the percentage of sequence identity. The invention disclosed herein covers those nucleotide sequences that are substantially identical to those disclosed herein.
[0215] As used herein, the terms “treatment”, “management”, etc., refer to methods or procedures used to provide relief or reduction of the number, severity, and / or frequency of one or more symptoms of a disease in a subject. As used herein, “treatment” and “management” may include preventative treatment, management, preventative treatment, and / or suppression or reduction of the number, severity, and / or frequency of one or more symptoms of a disease in a subject.
[0216] When referring to RNAi reagents, the phrase “introduced into cells” as used herein means the functional delivery of RNAi reagents into cells. The phrase “functional delivery” means the delivery of RNAi reagents to cells in a manner that enables them to have the intended biological activity (e.g., sequence-specific inhibition of gene expression).
[0217] As used in this article, the term "isomer" refers to compounds that have the same molecular formula but differ in the bonding properties or order of their atoms or in the spatial arrangement of their atoms. Isomers with different spatial arrangements of atoms are called "stereoisomers." Stereoisomers that are not mirror images of each other are called "diastereomers," and stereoisomers that are non-overlapping mirror images are called "enantiomers" or sometimes optical isomers. A carbon atom bonded to four different substituents is called a "chiral center."
[0218] As used herein, unless specifically identified in the structure as having a particular conformation, each structure disclosed herein is intended to represent all such possible isomers, including both optically pure and racemic forms, for each structure in which an asymmetric center is present and thus produces enantiomers, diastereomers, or other stereoisomers. For example, the structures disclosed herein are intended to cover mixtures of diastereomers as well as single stereoisomers.
[0219] The phrase “consisting of” as used in the claims herein does not include any element, step, or ingredient not specified in the claims. When used in the claims herein, the phrase “consisting substantially of” limits the scope of the claims to the specified materials or steps and those that do not substantially affect the essential and novel features of the claimed invention.
[0220] Those skilled in the art will readily understand and recognize that, depending on the environment in which the compound or composition is situated, the compounds and compositions disclosed herein may have certain atoms (e.g., N, O, or S atoms) in a protonated or deprotonated state. Therefore, as used herein, the structures disclosed contemplate that certain functional groups (e.g., OH, SH, or NH) may be protonated or deprotonated. As will be readily understood by those skilled in the art, this disclosure is intended to cover the disclosed compounds and compositions regardless of their protonation state based on environmental factors such as pH.
[0221] When referring to a connection between two compounds or molecules, the term "connection" or "combination" as used herein means that the two molecules are bound together by a covalent bond or by a non-covalent bond (e.g., a hydrogen bond or an ionic bond). In some embodiments, the term "connection" or "combination" refers to a non-covalent bond between two molecules, where the binding of two different molecules in a physiologically acceptable buffer solution (e.g., buffered saline) has a strength of less than 1 x 10⁻⁶. -4 M (for example, less than 1x10) -5 M, less than 1x10 -6 M or less than 1x10 -7 M) of K DUnless otherwise stated, the terms “connection” and “combination” as used herein may refer to a connection between a first compound and a second compound, with or without any inserted atoms or groups.
[0222] As used herein, a linking group is one or more atoms that connects a molecule or a portion of a molecule to a second molecule or a second portion of a molecule. Similarly, as used in the art, the term scaffold is sometimes used interchangeably with linking group. A linking group may contain any number of atoms or functional groups. In some embodiments, the linking group may not promote any biological or pharmaceutical response, but is simply used to link two biologically active molecules.
[0223] Unless otherwise stated, the symbols used in this document are as follows. The application of this term means that any one or more groups can be attached thereto according to the scope of the invention described herein.
[0224] As used herein, the term "including" refers to the phrase "including, but not limited to," and is used interchangeably with that phrase. Unless the context clearly indicates otherwise, the term "or" refers to the term "and / or," and is used interchangeably with that term.
[0225] As used in the claims herein, the phrase “consisting of” excludes any element, step, or ingredient not specified in the claims. When used in the claims herein, the phrase “consisting substantially of” limits the scope of the claims to the specified materials or steps and those that do not substantially affect the essential and novel features of the claimed invention.
[0226] Modified nucleotides
[0227] In some embodiments, the HIF-2αRNAi reagent contains one or more modified nucleotides. As used herein, "modified nucleotide" refers to a nucleotide other than a ribonucleotide (2′-hydroxynucleotide). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides are modified nucleotides. Modified nucleotides used in this document may include, but are not limited to: deoxyribonucleotides, nucleotide mimics, debased nucleotides, 2′-modified nucleotides, inverted nucleotides, nucleotides containing modified nucleosides, bridged nucleotides, peptide nucleic acids (PNAs), 2′,3′-open-ring nucleotide mimics (unlocked nucleobase analogs), locked nucleotides, 3′-O-methoxy (2′ nucleoside-linked) nucleotides, 2′-F-arabinonucleotides, 5′-Me, 2′-fluoronucleotides, morpholinonucleotides, vinylphosphonate deoxyribonucleotides, nucleotides containing vinylphosphonates, and nucleotides containing cyclopropylphosphonates. 2′-Modified nucleotides (i.e., nucleotides having a group other than a hydroxyl group at the 2′ position of the five-membered sugar ring) include, but are not limited to: 2′-O-methyl nucleotides, 2′-fluoronucleotides (also referred to herein as 2′-deoxy-2′-fluoronucleotides), 2′-deoxynucleotides, 2′-methoxyethyl (2′-O-2-methoxyethyl) nucleotides (also referred to herein as 2′-MOE), 2′-amino nucleotides, and 2′-alkyl nucleotides. All positions in a given compound are not necessarily uniformly modified. Instead, more than one modification may be incorporated into a single HIF-2αRNAi reagent or even into a single nucleotide. Sense and antisense strands of HIF-2αRNAi reagents can be synthesized and / or modified using methods known in the art. Modification at one nucleotide is independent of modification at another nucleotide.
[0228] Modified nucleobases include synthetic and natural nucleobases, such as 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines (e.g., 2-aminopropyladenine, 5-propynyluracil, or 5-propynylcytosine), 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, inosine, xanthine, hypoxanthine, 2-aminoadenine, adenine, and guanine's 6-alkyl (e.g., 6-methyl, 6-ethyl, 6-isopropyl, or 6-n-butyl) derivatives, adenine and guanine's 2-alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl, or 2-n-butyl) and other alkyl derivatives, 2-thiouracil, 2... -Thiothymine, 2-thiocytosine, 5-halogenated uracil, cytosine, 5-propynyluracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halogenated, 8-amino, 8-mercapto, 8-thioalkyl, 8-hydroxy and other 8-substituted adenine and guanine, 5-halogenated (e.g., 5-bromo), 5-trifluoromethyl and other 5-substituted uracil and cytosine, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazoguanine, 7-deazoadenine, 3-deazoguanine and 3-deazoadenine.
[0229] In some embodiments, all or substantially all of the nucleotides in the RNAi reagent are modified nucleotides. As used herein, an RNAi reagent in which substantially all of the present nucleotides are modified nucleotides is an RNAi reagent having four or fewer (i.e., 0, 1, 2, 3, or 4) nucleotides that are ribonucleotides (unmodified) in both the sense and antisense strands. As used herein, a sense strand in which substantially all of the present nucleotides are modified nucleotides is a sense strand having two or fewer (i.e., 0, 1, or 2) nucleotides that are unmodified ribonucleotides in the sense strand. As used herein, an antisense strand in which substantially all of the present nucleotides are modified nucleotides is an antisense strand having two or fewer (i.e., 0, 1, or 2) nucleotides that are unmodified ribonucleotides in the antisense strand. In some embodiments, one or more nucleotides in the RNAi reagent are unmodified ribonucleotides.
[0230] As mentioned elsewhere herein, in some embodiments, the HIF-2αRNAi reagent disclosed herein may be linked to one or more targeting ligands and / or one or more PK enhancers to an internal nucleotide of the sense or antisense strand of the RNAi reagent to facilitate in vivo delivery of the HIF-2αRNAi reagent. In some embodiments, the targeting ligand or PK enhancer is attached to or conjugated to one or more internal nucleotides of the sense strand of the HIF-2αRNAi reagent. For example, the targeting ligand may be attached to a single nucleotide at the 2' position, the 3' position, or the 1' position of the ribonucleotide, or to a nucleobase of the nucleotide, the 4' position, or the 5' position of the nucleotide, or to an oxygen atom on the ribonucleotide. A hypothetical ribonucleotide is described below, wherein the carbon atoms are numbered:
[0231]
[0232] In some embodiments, to facilitate the attachment of one or more targeting ligands to the internal nucleotide, a 2'-O-propargyl-modified nucleotide is incorporated into the nucleotide sequence (see, for example, Tables 7 and 4, 4.1, 4.2 and 4.3). After synthesis of the individual chains, the 2'-O-propargyl-modified nucleotide can be attached or conjugated at the 2' position to the targeting ligand, targeting group, and / or PK enhancer using standard coupling techniques known in the art.
[0233] In some embodiments, the HIF-2αRNAi reagent disclosed herein can be synthesized to have at least one 2'-O-propyne-modified nucleotide in the sense strand to facilitate linkage with a target ligand or target group. In some embodiments, the sense strand of the RNAi reagent is synthesized to include at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, or more than 10 2'-O-propyne-modified nucleotides to facilitate linkage with at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, or more than 10 target ligands and / or target groups to the internal nucleotide. In some embodiments, the HIF-2αRNAi reagent disclosed herein can be synthesized to have one 2'-O-propyne-modified nucleotide in the sense strand. In some embodiments, the HIF-2αRNAi reagent disclosed herein can be synthesized to have two 2'-O-propyne-modified nucleotides in the sense strand. In some embodiments, the HIF-2αRNAi reagent disclosed herein can be synthesized having three 2'-O-propynyl-modified nucleotides in the sense strand. In some embodiments, the HIF-2αRNAi reagent disclosed herein can be synthesized having four 2'-O-propynyl-modified nucleotides in the sense strand. In some embodiments, the HIF-2αRNAi reagent disclosed herein can be synthesized having five 2'-O-propynyl-modified nucleotides in the sense strand. In some embodiments, the HIF-2αRNAi reagent disclosed herein can be synthesized having more than five 2'-O-propynyl-modified nucleotides in the sense strand.
[0234] Modified nucleoside linkages
[0235] In some embodiments, one or more nucleotides of the HIF-2αRNAi reagent are linked via non-standard bonds or the backbone (e.g., modified internucleotide links or modified backbones). Modified internucleotide links or backbones include, but are not limited to: thiophosphate groups (represented herein as lowercase "s"), chiral thiophosphates, thiophosphates, dithiophosphates, phosphate triesters, aminoalkyl-phosphate triesters, alkylphosphonates (e.g., methylphosphonates or 3′-alkylenephosphonates), chiral phosphonates, hypophosphonates, aminophosphates (e.g., 3′-aminoaminophosphates, aminoalkylaminophosphates, or thiocarbonylaminophosphates), thiocarbonyl alkyl-phosphonates, thiocarbonyl alkyl phosphate triesters, morpholino links, borophosphates with normal 3′-5′ links, analogs of 2′-5′ links of borophosphates, or borophosphates with inverted polarity, wherein adjacent nucleoside unit pairs are linked 3′-5′ to 5′-3′ or 2′-5′ to 5′-2′. In some embodiments, the modified internucleotide links or backbone lack phosphorus atoms. Modified internucleotide links lacking phosphorus atoms include, but are not limited to, links between short-chain alkyl or cycloalkyl sugars, links between mixed heteroatoms and alkyl or cycloalkyl sugars, or links between one or more short-chain heteroatoms or heterocyclic sugars. In some embodiments, the modified internucleotide backbone includes, but is not limited to, siloxane backbones, sulfide backbones, sulfoxide backbones, sulfone backbones, methylacetyl and thiomethylacetyl backbones, methylenemethylacetyl and thiomethylacetyl backbones, olefin-containing backbones, aminosulfonate backbones, methyleneimino and methylenehydrazine backbones, sulfonate and sulfonamide backbones, amide backbones, and other backbones having mixed N, O, S, and CH2 components.
[0236] In some embodiments, the sense strand of the HIF-2αRNAi reagent may contain 1, 2, 3, 4, 5, or 6 phosphate-thioester bonds, and the antisense strand of the HIF-2αRNAi reagent may contain 1, 2, 3, 4, 5, or 6 phosphate-thioester bonds, or both the sense and antisense strands may independently contain 1, 2, 3, 4, 5, or 6 phosphate-thioester bonds. In some embodiments, the sense strand of the HIF-2αRNAi reagent may contain 1, 2, 3, or 4 phosphate-thioester bonds, and the antisense strand of the HIF-2αRNAi reagent may contain 1, 2, 3, or 4 phosphate-thioester bonds, or both the sense and antisense strands may independently contain 1, 2, 3, or 4 phosphate-thioester bonds.
[0237] In some embodiments, the sense strand of the HIF-2αRNAi reagent contains at least two phosphate-thioester nucleoside links. In some embodiments, the at least two phosphate-thioester nucleoside links are located between nucleotides at positions 1-3 starting from the 3' end of the sense strand. In some embodiments, one phosphate-thioester nucleoside link is located at the 5' end of the sense strand, and the other phosphate-thioester bond is located at the 3' end of the sense strand. In some embodiments, two phosphate-thioester nucleoside links are located at the 5' end of the sense strand, and the other phosphate-thioester bond is located at the 3' end of the sense strand. In some embodiments, the sense strand does not include any phosphate-thioester nucleoside links between nucleotides, but contains one, two, or three phosphate-thioester bonds between terminal nucleotides at the 5' and 3' ends, and optionally has an inverted debasement end cap. In some embodiments, the targeting ligand is attached to the sense strand via phosphate-thioester bonds.
[0238] In some embodiments, the antisense strand of the HIF-2αRNAi reagent contains four phosphate-thioester nucleoside links. In some embodiments, the four phosphate-thioester nucleoside links are located between nucleotides at positions 1-3 starting from the 5' end of the antisense strand, and between nucleotides at positions 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 starting from the 5' end. In some embodiments, three phosphate-thioester nucleoside links are located between positions 1-4 starting from the 5' end of the antisense strand, and a fourth phosphate-thioester nucleoside link is located between positions 20-21 starting from the 5' end of the antisense strand. In some embodiments, the HIF-2αRNAi reagent contains at least three or four phosphate-thioester nucleoside links in the antisense strand.
[0239] In some embodiments, the HIF-2αRNAi reagent contains one or more modified nucleotides and one or more modified nucleosides linked together. In some embodiments, a 2′-modified nucleoside is combined with a modified nucleoside linker.
[0240] HIF-2αRNAi reagent
[0241] In some embodiments, the HIF-2α RNAi reagent disclosed herein targets the HIF-2α gene at or near the location of the HIF-2α gene sequence shown in Table 1. In some embodiments, the antisense strand of the HIF-2α RNAi reagent disclosed herein includes a core sequence that is completely, substantially, or at least partially complementary to the target HIF-2α 19-mer sequence disclosed in Table 1.
[0242] Table 1. HIF-2α 19-mer mRNA target sequence (derived from the transcript of human endothelial PAS domain protein 1 (EPAS1 or HIF-2α), GenBank NM_001430.4 (SEQ ID NO:1))
[0243]
[0244] In some embodiments, the HIF-2αRNAi reagent includes an antisense strand, wherein position 19 of the antisense strand (5′→3′) is capable of forming a base pair with position 1 of the 19-mer target sequence disclosed in Table 1.
[0245] In some embodiments, the HIF-2αRNAi reagent includes an antisense strand, wherein position 2 of the antisense strand (5′→3′) is capable of forming a base pair with position 18 of the 19-mer target sequence disclosed in Table 1. In some embodiments, the HIF-2αRNAi reagent includes an antisense strand, wherein positions 2 to 18 of the antisense strand (5′→3′) are capable of forming a base pair with each of the complementary bases located at positions 18 to 2 of the 19-mer target sequence disclosed in Table 1.
[0246] For the RNAi reagents disclosed herein, the nucleotide at position 1 on the antisense strand (from the 5′ end to the 3′ end) may or may not be complementary to the HIF-2α gene. In some embodiments, the nucleotide at position 1 on the antisense strand (from the 5′ end to the 3′ end) is U, A, or dT. In some embodiments, the nucleotide at position 1 on the antisense strand (from the 5′ end to the 3′ end) forms an A:U or U:A base pair with the sense strand.
[0247] In some embodiments, the HIF-2αRNAi reagent antisense strand comprises a sequence of nucleotides (from 5′ end to 3′ end) 2-18 or 2-19 of any antisense strand sequence in Table 2 or Table 3. In some embodiments, the HIF-2αRNAi sense strand comprises a sequence of nucleotides (from 5′ end to 3′ end) 1-17, 1-18, or 2-18 of any sense strand sequence in Table 2 or Tables 4, 4.1, 4.2, or 4.3.
[0248] In some embodiments, the HIF-2αRNAi reagent comprises: (i) an antisense strand containing a sequence of nucleotides (from 5′ end to 3′ end) 2-18 or 2-19 of any antisense strand sequence in Table 2 or Table 3; and (ii) a sense strand containing a sequence of nucleotides (from 5′ end to 3′ end) 1-17 or 1-18 of any sense strand sequence in Table 2 or Tables 4, 4.1, 4.2 or 4.3.
[0249] In some embodiments, the HIF-2αRNAi reagent comprises the core 19-mer nucleotide sequence shown in Table 2 below.
[0250]
[0251] The sense and antisense strands of HIF-2αRNAi reagents containing or composed of the sequences in Table 2 can be modified or unmodified nucleotides. In some embodiments, HIF-2αRNAi reagents having sense and antisense strand sequences (containing or composed of the sequences in Table 2) are all or substantially all modified nucleotides.
[0252] In some embodiments, the antisense strand of the HIF-2αRNAi reagent disclosed herein differs from any of the antisense strand sequences in Table 2 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of the HIF-2αRNAi reagent disclosed herein differs from any of the sense strand sequences in Table 2 by 0, 1, 2, or 3 nucleotides.
[0253] As used herein, each N listed in the sequences disclosed in Table 2 may be independently selected from any and all nucleobases (including those found on modified and unmodified nucleotides). In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have nucleobases complementary to the corresponding N nucleotides on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have nucleobases not complementary to the corresponding N nucleotides on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have the same nucleobases as the corresponding N nucleotides on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have nucleobases different from the corresponding N nucleotides on the other strand.
[0254] The antisense strands of certain modified HIF-2αRNAi reagents, and their underlying unmodified nucleotide sequences, are provided in Table 3. The sense strands of certain modified HIF-2αRNAi reagents, and their underlying unmodified nucleotide sequences, are provided in Table 4 (and reflected in 4.1, 4.2, and 4.3). In the formation of HIF-2αRNAi reagents, each nucleotide in the respective underlying nucleotide sequences listed in Tables 3 and 4, and Table 2 above, can be a modified nucleotide.
[0255] The HIF-2αRNAi reagent described herein is formed by annealing the antisense strand with the sense strand. A sense strand containing the sequences listed in Table 2 or Table 4, 4.1, 4.2 or 4.3 can hybridize with any antisense strand containing the sequences listed in Table 2 or Table 3, provided that the two sequences have at least 85% complementarity over a consecutive 16, 17, 18, 19, 20 or 21 nucleotide sequence.
[0256] In some implementations, the HIF-2αRNAi reagent antisense strand contains a nucleotide sequence of any one of the sequences in Table 2 or Table 3.
[0257] In some embodiments, the HIF-2αRNAi reagent comprises or is composed of a double strand having a sense strand and an antisense strand nucleobase sequence of any one of the sequences in Tables 2, 3, 4, 4.1, 4.2, or 4.3.
[0258] Examples of antisense strands containing modified nucleotides are provided in Table 3. Examples of sense strands containing modified nucleotides are provided in Table 4.
[0259] As used in Tables 3 and 4 and 4.1, 4.2 and 4.3, the following notes are used to indicate the modified nucleotides, targeting groups, and linking groups:
[0260] A = adenosine-3′-phosphate;
[0261] C = cytidine-3′-phosphate;
[0262] G = guanosine-3′-phosphate;
[0263] U = uridine-3′-phosphate
[0264] I = Inosine-3′-phosphate
[0265] a = 2′-O-methyladenosine-3′-phosphate
[0266] as = 2′-O-methyladenosine-3′-thiophosphate
[0267] c = 2′-O-methylcytidine-3′-phosphate
[0268] cs = 2′-O-methylcytidine-3′-thiophosphate
[0269] g = 2′-O-methylguanosine-3′-phosphate
[0270] gs = 2′-O-methylguanosine-3′-thiophosphate
[0271] t = 2′-O-methyl-5-methyluridine-3′-phosphate
[0272] ts = 2′-O-methyl-5-methyluridine-3′-thiophosphate
[0273] u = 2′-O-methyluridine-3′-phosphate
[0274] us = 2′-O-methyluridine-3′-thiophosphate
[0275] i = 2′-O-methylinosine-3′-phosphate
[0276] is = 2′-O-methylinosine-3′-thiophosphate
[0277] Af = 2′-fluoroadenosine-3′-phosphate
[0278] Afs = 2′-fluoroadenosine-3′-thiophosphate
[0279] Cf = 2′-fluorocytidine-3′-phosphate
[0280] Cfs = 2′-Fluorocytidine-3′-Thiophosphate
[0281] Gf = 2′-Fluoroguanosine-3′-phosphate
[0282] Gfs = 2′-Fluoroguanosine-3′-thiophosphate
[0283] Tf = 2′-fluoro-5′-methyluridine-3′-phosphate
[0284] Tfs = 2′-fluoro-5′-methyluridine-3′-thiophosphate
[0285] Uf = 2′-fluorouridine-3′-phosphate
[0286] Ufs = 2′-fluorouridine-3′-thiophosphate
[0287] dA = 2′-deoxyadenosine-3′-phosphate
[0288] dAs = 2′-deoxyadenosine-3′-thiophosphate
[0289] dC = 2′-deoxycytidine-3′-phosphate
[0290] dCs = 2′-deoxycytidine-3′-thiophosphate
[0291] dG = 2′-deoxyguanosine-3′-phosphate
[0292] dGs = 2′-deoxyguanosine-3′-thiophosphate
[0293] dT = 2′-deoxythymidine-3′-phosphate
[0294] dTs = 2′-deoxythymidine-3′-thiophosphate
[0295] dU = 2′-deoxyuridine-3′-phosphate
[0296] dUs = 2′-deoxyuridine-3′-thiophosphate
[0297] A UNA =2′,3′-open-ring-adenosine-3′-phosphate
[0298] A UNA s = 2′,3′-open-ring-adenosine-3′-thiophosphate
[0299] C UNA =2′,3′-open-ring-cytidine-3′-phosphate
[0300] C UNA s = 2′,3′-open-cytidine-3′-thiophosphate
[0301] G UNA =2′,3′-open-ring-guanosine-3′-phosphate
[0302] G UNA s = 2′,3′-open-ring-guanosine-3′-thiophosphate
[0303] U UNA =2′,3′-open-ring-uridine-3′-phosphate
[0304] U UNA s = 2′,3′-open-ring-uridine-3′-thiophosphate
[0305] aAlk = 2′-O-propargyl adenosine-3′-phosphate ester, see Table 7
[0306] aAlks = 2′-O-propargyl adenosine-3′-thiophosphate ester, see Table 7
[0307] cAlk = 2′-O-propylated cytidine-3′-phosphate ester, see Table 7
[0308] cAlks = 2′-O-propylated cytidine-3′-thiophosphate ester, see Table 7
[0309] gAlk = 2′-O-propargylguanosine-3′-phosphate ester, see Table 7
[0310] gAlks = 2′-O-propargylguanosine-3′-thiophosphate, see Table 7
[0311] tAlk = 2′-O-propynyl-5-methyluridine-3′-phosphate, see Table 7
[0312] tAlks = 2′-O-propynyl-5-methyluridine-3′-thiophosphate, see Table 7
[0313] uAlk = 2′-O-propargyluridine-3′-phosphate ester, see Table 7
[0314] uAlks = 2′-O-propargyluridine-3′-thiophosphate ester, see Table 7
[0315] a_2N = See Table 7
[0316] a_2Ns = See Table 7
[0317] (invAb) = inverted debased deoxyribonucleotide, see Table 7
[0318] (invAb)s = inverted debased deoxyribonucleotide-5′-thiophosphate, see Table 7
[0319] s = thiophosphate bond
[0320] (C6-SS-Alk) = See Table 7
[0321] (C6-SS-C6) = See Table 7
[0322] (C3-SS-C3) = See Table 7
[0323] (6-SS-6) = See Table 7
[0324] (NH2-C6) = See Table 7
[0325] (C6-NH2) = See Table 7
[0326] (TriAlk#) = See Table 7
[0327] (TriAlk#)s = See Table 7
[0328] As will be readily understood by those skilled in the art, unless otherwise specified by sequence (e.g., by thiophosphate bond "s"), nucleotide monomers in oligonucleotides are interconnected by 5'-3'-phosphodiester bonds. As will be clearly understood by those skilled in the art, thiophosphate bonds, including those shown in the modified nucleotide sequences disclosed herein, replace the phosphodiester bonds typically present in oligonucleotides. Furthermore, it will be readily understood by those skilled in the art that the terminal nucleotide at the 3' end of a given oligonucleotide sequence will typically have a hydroxyl (-OH) group at the corresponding 3' position of the given monomer, rather than an isolated phosphate moiety. Additionally, for the embodiments disclosed herein, when viewing each chain in 5'→3' order, an inverted debasement is inserted such that the 3' position of the deoxyribose is attached to the 3' end of the prior monomer on each chain. Furthermore, as will be readily understood and appreciated by those skilled in the art, although the thiophosphate chemical structures described herein generally show anions on sulfur atoms, the invention disclosed herein covers all thiophosphate tautomers (e.g., where the sulfur atom has a double bond and the anion is on an oxygen atom). Unless otherwise expressly stated herein, such understanding by those skilled in the art is used when describing the HIF-2αRNAi reagents and compositions thereof disclosed herein.
[0329] Specific examples of linker groups used with the HIF-2αRNAi reagents disclosed herein are provided in Table 7 below. Examples of targeting ligands and / or targeting groups and PK enhancers that can be linked or conjugated to the HIF-2αRNAi reagents disclosed herein are also disclosed herein. For example, certain example PK enhancer compounds are provided in Table 6 below. Furthermore, in some embodiments, the PK enhancer may be located at the 3' end of the sense strand of the HIF-2αRNAi reagent.
[0330] The linking groups include, but are not limited to, the following, whose chemical structures are provided in Table 7 below: (NH2-C6), (C6-NH2), (C6-SS-C6), (6-SS-6), (TriAlk1), (TriAlk1)s, (TriAlk2), (TriAlk2)s, (TriAlk3), (TriAlk3)s, (TriAlk4), (TriAlk4)s, (TriAlk5), (TriAlk5)s, (TriAlk6), (Tr The sequence may contain (TriAlk6)s, (TriAlk7), (TriAlk7)s, (TriAlk8), (TriAlk8)s, (TriAlk9), (TriAlk9)s, (TriAlk10), (TriAlk10)s, (TriAlk11), (TriAlk11)s, (TriAlk12), (TriAlk12)s, (TriAlk13), (TriAlk13)s, (TriAlk14) or (TriAlk14)s. Each sense strand and / or antisense strand may have any of the target ligands or target groups, linking groups and / or PK enhancers listed herein conjugated to the 5′ and / or 3′ ends of the sequence, as well as other target ligands / groups, other linking groups and / or other PK enhancers.
[0331]
[0332]
[0333]
[0334]
[0335]
[0336]
[0337]
[0338]
[0339]
[0340]
[0341]
[0342]
[0343]
[0344]
[0345]
[0346] As shown in Table 4 above, numerous examples of HIF-2α nucleotide sequences are presented to further include reactive linker groups at the 5', 3', or both 5' and 3' ends of the sense strand nucleotide sequence. For example, several HIF-2α nucleotide sequences shown in Table 4 above have (NH2-C6) or (TriAlk) linker groups at the 5' end of the nucleotide sequence. Similarly, several HIF-2α nucleotide sequences shown in Table 4 above have (C6-SS-C6) or (6-SS-6) linker groups at the 3' end of the nucleotide sequence. Such reactive linker groups are positioned to facilitate the linkage of targeting ligands, targeting groups, and / or PK enhancers with the HIF-2α RNAi reagents disclosed herein. Linkage or conjugation reactions are well known in the art and provide for the formation of a covalent bond between two molecules or reactants. Suitable conjugation reactions for use within the scope of this invention include, but are not limited to, amide coupling reactions, Michael addition reactions, hydrazone formation reactions, and click cycloaddition reactions.
[0347] In some embodiments, the targeting ligand can be synthesized as a tetrafluorophenyl (TFP) ester, which can be replaced by a reactive amino group (e.g., NH2-C6) to link the targeting ligand to the HIF-2αRNAi reagent disclosed herein. In some embodiments, the targeting ligand is synthesized as an azide, which can be conjugated to a propargyl or DBCO group, for example, via a click cycloaddition reaction.
[0348] In addition, several nucleotide sequences were synthesized with a dT nucleotide at the 3' end of the sense strand, followed by a (3'→5') linker (e.g., C6-SS-C6), which in some embodiments can be used to facilitate linkage with other components (e.g., PK enhancers or one or more targeting ligands) after being cleaved from the resin. Synthesis in this manner involves linking the dT to the resin, followed by coupling the linker and the remaining nucleotides of the sense strand. As described herein, the terminal dT is cleaved from the molecule after conjugation with the desired PK enhancer (or targeting ligand). Table 4.1 below shows the nucleotide sequences identified in Table 4 above, but does not include the 3' terminal dT nucleotide.
[0349] In addition, Table 4.2 below shows the nucleotide sequences identified in Table 4 above, but without terminal linkers.
[0350]
[0351]
[0352]
[0353]
[0354]
[0355]
[0356]
[0357]
[0358]
[0359]
[0360]
[0361]
[0362]
[0363] As discussed herein, in some embodiments, one or more targeting ligands and / or PK enhancers are linked or conjugated to the RNAi reagent. In some embodiments, the targeting ligand (or targeting group) and / or PK enhancer are linked to the 5' end of the sense strand, the 3' end of the sense strand, and / or one or more internal nucleotides. The synthesis of the sense strand and / or antisense strand can be designed such that reactive groups are readily available to facilitate linkage with additional components, such as the targeting ligand or PK enhancer. Table 4.3 below depicts the sense strand of the HIF-2α RNAi reagent disclosed in Table 4 above after linkage with one or more targeting ligands and / or PK enhancers (collectively shown as Z below).
[0364] Table 4.3. Sense sequences of HIF-2αRNAi reagents showing the locations of the targeting ligand and / or PK enhancer.
[0365] (Each X, Y, and Z is independently a pharmacological component (e.g., a targeting ligand, a targeting group, and / or a PK enhancer); (Z)3 = three linked ligands (e.g., a tridentate targeting group); u Z a Z g Z and c Z These represent uridine, adenosine, guanosine, and cytidine, respectively, wherein the pharmacological portion (e.g., a targeting ligand, a targeting group, and / or a PK enhancer) is linked to the 2' position of the nucleotide (which, for the HIF-2αRNAi reagent disclosed in the embodiments herein, terminates by coupling to a 2'-O-propyne).
[0366]
[0367]
[0368]
[0369]
[0370]
[0371]
[0372]
[0373]
[0374]
[0375] The HIF-2αRNAi reagent described herein is formed by annealing the antisense strand with the sense strand. A sense strand containing the sequences listed in Table 2 or Table 4 (or 4.1, 4.2, or 4.3) can hybridize with any antisense strand containing the sequences listed in Table 2 or Table 3, provided that the two sequences have at least 85% complementarity over a consecutive 16, 17, 18, 19, 20, or 21 nucleotide sequences.
[0376] In some embodiments, the antisense strand of the HIF-2αRNAi reagent disclosed herein differs from any of the antisense strand sequences in Table 3 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of the HIF-2αRNAi reagent disclosed herein differs from any of the sense strand sequences in Table 4 by 0, 1, 2, or 3 nucleotides.
[0377] In some embodiments, the HIF-2αRNAi reagent antisense strand comprises the nucleotide sequence of any one of the sequences in Table 2 or Table 3. In some embodiments, the HIF-2αRNAi reagent antisense strand comprises the nucleotide sequence (from 5′ end to 3′ end) 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, or 2-24 of any one of the sequences in Table 2 or Table 3. In some embodiments, the HIF-2αRNAi reagent antisense strand comprises or consists of any modified sequence of any one of the modified sequences in Table 3.
[0378] In some implementations, the sense strand of the HIF-2αRNAi reagent comprises a nucleotide sequence of any one of the sequences in Table 2 or Table 4 (or Tables 4.1, 4.2 or 4.3). In some embodiments, the sense strand of the HIF-2αRNAi reagent comprises any of the nucleotide sequences (from 5′ end to 3′ end) in Table 2 or Table 4 (or Table 4.1, 4.2 or 4.3) 1-17, 2-17, 3-17, 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 3-20, 4-20, 1-21, 2-21, 3-21, 4-21, 1-22, 2-22, 3-22, 4-22, 1-23, 2-23, 3-23, 4-23, 1-24, 2-24, 3-24 or 4-24. In some implementations, the sense strand of the HIF-2αRNAi reagent comprises or consists of any of the modified sequences in Table 4 (or Tables 4.1, 4.2, or 4.3).
[0379] For the HIF-2α RNAi reagent disclosed herein, the nucleotide at position 1 of the antisense strand (from the 5′ end to the 3′ end) can be perfectly complementary to the HIF-2α gene, or it can be non-complementary to the HIF-2α gene. In some embodiments, the nucleotide at position 1 of the antisense strand (from the 5′ end to the 3′ end) is U, A, or dT (or a modified form thereof). In some embodiments, the nucleotide at position 1 of the antisense strand (from the 5′ end to the 3′ end) forms an A:U or U:A base pair with the sense strand.
[0380] In some embodiments, the HIF-2αRNAi reagent antisense strand comprises a sequence of nucleotides (from 5′ end to 3′ end) 2-18 or 2-19 of any antisense strand sequence in Table 2 or Table 3. In some embodiments, the HIF-2αRNAi sense strand comprises a sequence of nucleotides (from 5′ end to 3′ end) 1-17 or 1-18 of any sense strand sequence in Table 2 or Table 4 (or Tables 4.1, 4.2 or 4.3).
[0381] In some embodiments, the HIF-2αRNAi reagent comprises: (i) an antisense strand containing a sequence of 2-18 or 2-19 nucleotides (from 5′ end to 3′ end) of any antisense strand sequence in Table 2 or Table 3, and (ii) a sense strand containing a sequence of 1-17 or 1-18 nucleotides (from 5′ end to 3′ end) of any sense strand sequence in Table 2 or Table 4 (or Table 4.1, 4.2 or 4.3).
[0382] A sense strand containing a sequence listed in Table 2 or Table 4 can hybridize with any antisense strand containing a sequence listed in Table 2 or Table 3, provided that the two sequences have at least 85% complementarity over a consecutive 16, 17, 18, 19, 20, or 21 nucleotide sequence. In some embodiments, the HIF-2αRNAi reagent has a sense strand consisting of a modified sequence of any of the modified sequences in Table 4 (or Tables 4.1, 4.2, or 4.3) and an antisense strand consisting of a modified sequence of any of the modified sequences in Table 3. Some representative sequence pairings are illustrated by the duplex ID No. shown in Table 5.
[0383] In some embodiments, the HIF-2αRNAi reagent comprises, is composed of, or is substantially composed of, a duplex represented by any of the duplex ID Nos presented herein. In some embodiments, the HIF-2αRNAi reagent comprises the sense and antisense nucleotide sequences of any duplex represented by any of the duplex ID Nos presented herein. In some embodiments, the HIF-2αRNAi reagent comprises the sense and antisense nucleotide sequences of any duplex represented by any of the duplex ID Nos presented herein, as well as a targeting ligand, a targeting group, and / or a linker group, wherein the targeting ligand, targeting group, and / or linker group are covalently linked (conjugated) to the sense strand or the antisense strand. In some embodiments, the HIF-2αRNAi reagent comprises nucleotide sequences modified with the sense and antisense strands of any of the duplex ID Nos presented herein. In some embodiments, the HIF-2αRNAi reagent comprises a sense and antisense strand modified nucleotide sequence of any of the duplex ID Nos presented herein, as well as a targeting ligand, targeting group, and / or linker group, wherein the targeting ligand, targeting group, and / or linker group are covalently linked to the sense strand or the antisense strand.
[0384] In some embodiments, the HIF-2αRNAi reagent comprises an antisense strand and a sense strand having a nucleotide sequence of any one of the antisense / sense duplexes in Table 2 or Table 5, and further comprises a targeting group. In some embodiments, the HIF-2αRNAi reagent comprises an antisense strand and a sense strand having a nucleotide sequence of any one of the antisense / sense duplexes in Table 5, and further comprises an integrin receptor ligand targeting group.
[0385] In some embodiments, the HIF-2αRNAi reagent comprises an antisense strand and a sense strand having any one of the antisense / sense duplexes in Table 5, and further comprises one or more linker groups selected from: (NH2-C6), (C6-NH2), (C6-SS-C6), (6-SS-6), (TriAlk1), (TriAlk1)s, (TriAlk2), (TriAlk2)s, (TriAlk3), (TriAlk3)s, (TriAlk4), (TriAlk4)s, (TriAlk5), (Tri... Alk5)s, (TriAlk6), (TriAlk6)s, (TriAlk7), (TriAlk7)s, (TriAlk8), (TriAlk8)s, (TriAlk9), (TriAlk9)s, (TriAlk10), (TriAlk10)s, (TriAlk11), (TriAlk11)s, (TriAlk12), (TriAlk12)s, (TriAlk13), (TriAlk13)s, (TriAlk14) or (TriAlk14)s, each as defined in Table 7.
[0386] In some embodiments, the HIF-2αRNAi reagent comprises an antisense strand and a sense strand having any one of the antisense strand and / or sense strand nucleotide sequences in Table 3 or Table 4, 4.1, 4.2 or 4.3.
[0387] In some embodiments, the HIF-2αRNAi reagent comprises an antisense strand and a sense strand of any antisense strand and / or sense strand nucleotide sequence having any of the duplexes in Table 5, and further comprises an integrin targeting group.
[0388] In some implementations, the HIF-2αRNAi reagent comprises, is composed of, or is substantially composed of any of the double strands listed in Table 5.
[0389] Table 5. HIF-2αRNAi reagent duplexes with corresponding sense and antisense strand IDs
[0390]
[0391]
[0392]
[0393]
[0394]
[0395]
[0396]
[0397]
[0398] In some embodiments, the HIF-2α RNAi reagent is prepared or provided as a salt, a mixture of salts, or a free acid before or after optional attachment or conjugation to one or more targeting ligands, targeting groups, and / or PK enhancers. Upon delivery to cells expressing the HIF-2α gene, the RNAi reagent described herein inhibits or knocks down the expression of one or more HIF-2α genes in vivo and / or in vitro.
[0399] Targeting ligands and targeting groups
[0400] Targeting groups or targeting moieties enhance the pharmacokinetic or biodistribution properties of the conjugates or RNAi reagents to which they are attached, thereby improving cell-specific (including, in some cases, organ-specific) distribution and cell-specific (or organ-specific) uptake of the conjugates or RNAi reagents. Targeting groups can be monovalent, divalent, trivalent, tetravalent, or have a higher valence state for their target. Representative targeting groups include, but are not limited to, compounds with affinity for cell surface molecules, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments, and antibody mimics with affinity for cell surface molecules. In some embodiments, the targeting group is linked to the RNAi reagent using a linker (such as a PEG linker) or one, two, or three debased residues and / or ribitol (debased ribose) residues (which may act as linkers in some cases). In some embodiments, the targeting group comprises an integrin-targeting ligand.
[0401] In some embodiments, the RNAi reagent described herein is conjugated to a targeting group. In some embodiments, the targeting ligand enhances the ability of the RNAi reagent to bind to specific cellular receptors on target cells. In some embodiments, the targeting ligand conjugated to the RNAi reagent described herein has an affinity for integrin receptors. In some embodiments, a suitable targeting ligand for use with the HIF-2α RNAi reagent disclosed herein has an affinity for integrin α-v-β3, integrin α-v-β-5, or both integrins.
[0402] In some embodiments, the HIF-2αRNAi reagent disclosed herein is linked to one or more integrin-targeting ligands, said ligands comprising compounds of the following formula:
[0403]
[0404] in,
[0405] X is -C(R) 3 )2-、-NR 3 -、
[0406] Y is an optionally substituted alkylene group, wherein the alkylene chain has 1-8 carbon atoms;
[0407] Z represents O and NR. 3 Or S;
[0408] R 1 It is an optionally substituted aryl group, an optionally substituted heteroaryl group, an optionally substituted heterocyclic group, an optionally substituted cycloalkyl group, or R 1 Includes RNAi reagents;
[0409] R 2 It is H, optionally substituted alkyl, or R 2 Includes RNAi reagents;
[0410] R 3 Each instance is independently selected from H and optionally substituted alkyl groups, or R. 3 Includes RNAi reagents;
[0411] R 4 It is H or an alkyl group that is optionally substituted; and
[0412] Among them, Y and R 1 R 2 At least one of them, R 3 Any instance and R 4 Includes RNAi reagents.
[0413] In some embodiments, the HIF-2αRNAi reagent disclosed herein is linked to one or more integrin-targeting ligands, said ligands comprising one of the following structures:
[0414]
[0415]
[0416]
[0417]
[0418]
[0419]
[0420] in Indicates the connection point with the HIF-2αRNAi reagent.
[0421] In some embodiments, a "click" chemical reaction is used to conjugate a targeting group to the RNAi reagent. In some embodiments, the RNAi reagent is functionalized with one or more alkyne-containing groups, and the targeting ligand includes an azide-containing group. After the reaction, the azide and alkyne form a triazole. An example reaction scheme is shown below:
[0422]
[0423] TL contains a targeting ligand, and RNA contains an RNAi reagent.
[0424] HIF-2αRNAi reagents may contain more than one targeting ligand. In some embodiments, HIF-2αRNAi reagents contain 1 to 20 targeting ligands. In some embodiments, HIF-2αRNAi reagents contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 targeting ligands to 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 targeting ligands.
[0425] In some embodiments, the HIF-2αRNAi reagent comprises a targeting group, which includes two or more targeting ligands. In some embodiments, the targeting group may be conjugated to the 5' or 3' end of the sense strand of the HIF-2αRNAi reagent. In some embodiments, the targeting group may be conjugated to an internal nucleotide of the HIF-2RNAi reagent. In some embodiments, the targeting group may consist of two targeting ligands linked together, referred to as a "bident" targeting group. In some embodiments, the targeting group may consist of three targeting ligands linked together, referred to as a "tridentent" targeting group. In some embodiments, the targeting group may consist of four targeting ligands linked together, referred to as a "tetradentent" targeting group.
[0426] In some embodiments, the HIF-2αRNAi reagent may comprise a targeting group conjugated to the 3' or 5' end of the sense strand, and additional targeting ligands conjugated to internal nucleotides. In some embodiments, a tripentate targeting group is conjugated to the 5' end of the sense strand of the HIF-2αRNAi reagent, and at least one targeting ligand is conjugated to an internal nucleotide of the sense strand. In other embodiments, a tripentate targeting group is conjugated to the 5' end of the sense strand of the HIF-2αRNAi reagent, and four targeting ligands are conjugated to internal nucleotides of the sense strand. In some embodiments, four targeting ligands are conjugated to nucleotide positions 2, 4, 6, and 8 of the sense strand.
[0427] In some implementations, the HIF-2αRNAi reagent is linked to one or more targeting groups of the following formula:
[0428]
[0429] in Indicating the linkage point. In some embodiments, the linkage point is the 5' end of the sense strand of the HIF-2αRNAi reagent.
[0430] Internally linked targeted ligands
[0431] Some embodiments of the HIF-2αRNAi reagent described herein include targeting ligands conjugated to internal nucleotides of the sense or antisense strand. In some embodiments, up to 15 targeting ligands may be conjugated to internal nucleotides of the sense strand of the HIF-2αRNAi reagent. In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 targeting ligands may be conjugated to internal nucleotides of the sense strand of the HIF-2αRNAi reagent. In some embodiments, 1-5 (e.g., 1, 2, 3, 4, or 5) targeting ligands are conjugated to internal nucleotides of the sense strand of the HIF-2αRNAi reagent. In some embodiments, 3-4 targeting ligands are conjugated to internal nucleotides of the sense strand of the HIF-2αRNAi reagent.
[0432] In some embodiments, the placement of the internal targeting ligand may affect the potency or efficacy of the HIF-2αRNAi reagent. In some embodiments of the HIF-2αRNAi reagent, the targeting group is conjugated to the 5' end of the sense strand, and at least 10 nucleotides are positioned between the tridentate targeting group at the 5' end of the sense strand and the next nearest targeting ligand on the sense strand. In some embodiments, at least 5 nucleotides are positioned between the tridentate targeting group at the 5' end of the sense strand and the next nearest targeting ligand on the sense strand.
[0433] In some embodiments, two or more target ligands are conjugated to internal nucleotides of the sense strand of the HIF-2αRNAi reagent, with at least one nucleotide space not conjugated to a target ligand located between the two internal nucleotides conjugated to the target ligand. In some embodiments, two or more target ligands are conjugated to the sense strand of the HIF-2αRNAi reagent, and at least two nucleotides not conjugated to the target ligand are located between the two internal nucleotides conjugated to the target ligand.
[0434] In some embodiments, the targeting ligand is conjugated to nucleotides 2, 4, and 6 of the sense strand, numbered from 3' to 5' starting from the furthest 3' nucleotide that forms a base pair with the 5' terminal nucleotide on the antisense strand. In some embodiments, the targeting ligand is conjugated to nucleotides 2, 4, 6, and 8 (3'→5'), starting from the 3' terminal nucleotide that forms a base pair with the 5' terminal nucleotide on the antisense strand.
[0435] Pharmacokinetic enhancers
[0436] In some embodiments, a pharmacokinetic (PK) enhancer is linked to the HIF-2α RNAi reagent disclosed herein to facilitate the delivery of the RNAi reagent to desired cells or tissues. PK enhancer compounds having readily available reactive groups (such as maleimide or azide) can be synthesized to facilitate linkage with one or more linkers on the HIF-2α RNAi reagent. In some embodiments, the PK enhancer can be synthesized as a maleimide and conjugated to the RNAi reagent using the reactions described herein. Other conjugation reactions such as "click" chemistry or amide conjugation can also be used.
[0437] In some embodiments, the PK enhancer may include molecules such as fatty acids, lipids, albumin binders, antibody binders, polyesters, polyacrylates, poly-amino acids, and straight-chain or branched polyethylene glycol (PEG) moieties having about 20-1000 ethylene oxide (CH2-CH2-O) units.
[0438] In some embodiments, the HIF-2RNAi reagent is linked to a PK enhancer, which comprises a compound having the following structure:
[0439] Where Y is an optional saturated or unsaturated aliphatic chain that is substituted, and n is an integer from 5 to 25.
[0440] In some embodiments, the HIF-2RNAi reagent is linked to a PK enhancer, which comprises a compound having the following structure:
[0441]
[0442] In some embodiments, the HIF-2RNAi reagent is linked to a PK enhancer, which comprises a compound having the following structure:
[0443]
[0444] Table 6 below shows some exemplary PK-enhancing compounds that can be used as starting materials to link to the HIF-2αRNAi reagents disclosed herein. PK-enhancing compounds can be added to the HIF-2αRNAi reagents using any method known in the art.
[0445] Table 6. Exemplary PK enhancer compounds suitable for use in HIF-2αRNAi linkage reagents
[0446]
[0447]
[0448]
[0449]
[0450]
[0451]
[0452] In some embodiments, the HIF-2αRNAi reagent may contain one or more PK enhancers. In some embodiments, the HIF-2αRNAi reagent contains 1, 2, 3, 4, 5, 6, 7 or more PK enhancers.
[0453] A PK enhancer can be conjugated to a HIF-2α RNAi reagent using any method known in the art. In some embodiments, the PK enhancer may include a maleimide moiety and react with the disulfide-containing RNAi reagent to form an RNAi reagent containing the PK enhancer. The disulfide can be reduced and added to the maleimide via a Michael addition reaction. An example reaction scheme is shown below:
[0454]
[0455] Wherein PK comprises a PK enhancer, RNA comprises an RNAi reagent, and R can be any suitable group known in the art. In some of the above reaction schemes, R is an alkyl group such as hexyl (C6H2O). 13 ).
[0456] In some embodiments, the PK enhancer may include an azide moiety and react with an RNAi reagent containing an alkyne to form an RNAi reagent containing the PK enhancer. The reaction can be carried out using a "click" reaction with the following general reaction protocol:
[0457]
[0458] PK includes PK enhancers, and RNA includes RNAi reagents.
[0459] In some embodiments, the PK enhancer can be conjugated to the 5' end of the sense or antisense strand, the 3' end of the sense or antisense strand, or an internal nucleotide of the HIF-2αRNAi reagent. In some embodiments, the HIF-2αRNAi reagent can be synthesized having a disulfide-containing moiety at the 3' end of the sense strand, and the PK enhancer can be conjugated to the 3' end of the sense strand using the general synthetic protocol shown above. In some embodiments, the HIF-2αRNAi reagent is synthesized to include a nucleotide modified with a 2'-O-propyne (see, for example, Table 7), and the PK enhancer can be conjugated to an internal nucleotide using the general synthetic protocol shown above.
[0460] In some implementations, after the PK enhancer has been conjugated to the RNAi reagent, the PK enhancer may have the following formula:
[0461]
[0462]
[0463]
[0464]
[0465]
[0466]
[0467] in Indicates the connection point with the RNAi reagent.
[0468] Linking groups and delivery media
[0469] In some embodiments, the HIF-2α RNAi reagent contains or is conjugated to one or more nonnucleotide groups, which include, but are not limited to, linker groups or delivery mediators. The nonnucleotide groups can enhance the targeting, delivery, or attachment of the RNAi reagent. Non-limiting examples of linker groups are provided in Table 7. The nonnucleotide groups can be covalently linked to the 3′ and / or 5′ ends of the sense strand and / or antisense strand. In some embodiments, the HIF-2α RNAi reagent contains nonnucleotide groups linked to the 3′ and / or 5′ ends of the sense strand. In some embodiments, the nonnucleotide groups are linked to the 5′ end of the sense strand of the HIF-2α RNAi reagent. The nonnucleotide groups can be linked to the RNAi reagent directly or indirectly via linker groups. In some embodiments, the nonnucleotide groups are linked to the RNAi reagent via unstable, cleavable, or reversible bonds or linkers.
[0470] In some embodiments, the nonnucleotide group enhances the pharmacokinetic or biodistribution properties of the RNAi reagent or conjugate to which it is attached, thereby improving the cell- or tissue-specific distribution and cell-specific uptake of the conjugate. In some embodiments, the nonnucleotide group enhances the endocytosis of the RNAi reagent.
[0471] The HIF-2αRNAi reagents described herein can be synthesized with reactive groups such as amino groups (also referred to herein as amines) at the 5′- and / or 3′-terminus. These reactive groups can then be used to connect the target moiety using methods typical in the art.
[0472] For example, in some embodiments, the HIF-2αRNAi reagent disclosed herein is synthesized having an NH2-C6 group at the 5′ end of the sense strand of the RNAi reagent. The terminal amino group can then react to form a conjugate, for example, by reacting with a group comprising a compound or PK enhancer having an affinity for one or more integrins (integrin targeting ligands). In some embodiments, the HIF-2αRNAi reagent disclosed herein is synthesized having one or more alkyne groups at the 5′ end of the sense strand of the RNAi reagent. The terminal alkyne groups can then react to form a conjugate, for example, by reacting with a group comprising a targeting ligand.
[0473] In some embodiments, the targeting group comprises an integrin targeting ligand. In some embodiments, the integrin targeting ligand comprises a compound having an affinity for integrin α-v-β3 and / or integrin α-v-β5. The application of the integrin targeting ligand can facilitate cell-specific targeting to cells having various integrins on their respective surfaces, and binding of the integrin targeting ligand can facilitate the entry of the HIF-2αRNAi reagent to which it is attached into cells (such as ccRCC cells). Using methods generally known in the art, the targeting ligand, targeting group, and / or PK enhancer can be attached to the 3′ and / or 5′ ends of the HIF-2αRNAi reagent and / or internal nucleotides of the HIF-2αRNAi reagent. The preparation of the targeting ligand and targeting group (such as integrin αvβ3 / αvβ5) is described, for example, in U.S. Provisional Patent Application No. 62 / 663,763, the contents of which are incorporated herein by reference in their entirety.
[0474] Embodiments of this disclosure include pharmaceutical compositions for in vivo delivery of HIF-2αRNAi reagents to ccRCC cells. Such pharmaceutical compositions may include, for example, an HIF-2αRNAi reagent conjugated to a targeting group comprising an integrin-targeting ligand having affinity for integrin αvβ3 and / or integrin αvβ5. In some embodiments, the targeting ligand comprises a compound having affinity for integrin αvβ3 and / or integrin αvβ5.
[0475] In some embodiments, an HIF-2αRNAi reagent is synthesized having a linker group, which can then facilitate covalent linkage of the HIF-2αRNAi reagent to a targeting ligand, a targeting group, a PK enhancer, or another class of delivery mediators (such as delivery polymers). The linker group can be attached to the 3′ and / or 5′ end of the sense or antisense strand of the RNAi reagent. In some embodiments, the linker group is attached to the sense strand of the RNAi reagent. In some embodiments, the linker group is conjugated to the 5′ or 3′ end of the sense strand of the RNAi reagent. In some embodiments, the linker group is conjugated to the 5′ end of the sense strand of the RNAi reagent. Examples of linker groups include, but are not limited to, Alk-SMPT-C6, Alk-SS-C6, DBCO-TEG, Me-Alk-SS-C6 and C6-SS-Alk-Me, reactive groups such as primary amines and alkynes, alkyl groups, debased residues / nucleotides, amino acids, triyne-functionalized groups, ribitols, and / or PEG groups.
[0476] A linker or connecting group is a connection between two atoms that links one target chemical group (such as an RNAi reagent) or segment to another target chemical group (such as a targeting ligand, targeting group, PK enhancer, or delivery polymer) or segment via one or more covalent bonds. Unstable connections contain unstable bonds. The connection may optionally include a spacer region that increases the distance between the two connected atoms. The spacer region may further add flexibility and / or length to the connection. Spacer regions include, but are not limited to, alkyl, alkenyl, alkynyl, aryl, aralkyl, areneyl, and arynyl; each may contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and sugars. Spacer regions are well known in the art, and the foregoing list is not intended to limit the scope of the specification.
[0477] In some embodiments, the targeting group is linked to the HIF-2α RNAi reagent without using additional adapters. In some embodiments, the targeting group is designed with readily available adapters to facilitate linkage with the HIF-2α RNAi reagent. In some embodiments, when two or more RNAi reagents are included in the composition, the same adapter can be used to link the two or more RNAi reagents to their respective targeting groups. In some embodiments, when two or more RNAi reagents are included in the composition, different adapters are used to link the two or more RNAi reagents to their respective targeting groups.
[0478] Any HIF-2αRNAi reagent nucleotide sequence listed in Tables 2, 3, and 4 (or Tables 4.1, 4.2, or 4.3), whether modified or unmodified, may contain 3′ and / or 5′ targeting groups, linker groups, and / or pharmacokinetic enhancers. Any HIF-2αRNAi reagent sequence listed in Tables 3 and 4 or otherwise described herein that contains a 3′ or 5′ targeting ligand, targeting group, linker group, or linker group may alternatively not contain a 3′ or 5′ targeting ligand, targeting group, linker group, or pharmacokinetic enhancer, or may contain different 3′ or 5′ targeting ligands, targeting groups, linker groups, or pharmacokinetic enhancers, including, but not limited to, those shown in Tables 6 and 7. Any HIF-2αRNAi reagent duplex listed in Table 5, whether modified or unmodified, may further include a targeting ligand, a targeting group, a linker group, or a PK enhancer, including, but not limited to, those shown in Tables 6 and 7, and the targeting group or linker group may be attached to the 3′ or 5′ end of the sense or antisense strand of the HIF-2αRNAi reagent duplex.
[0479] In some embodiments, the linker group may be synthetically conjugated to the 5' or 3' end of the sense strand of the HIF-2αRNAi reagent described herein. In some embodiments, the linker group is synthetically conjugated to the 5' end of the sense strand of the HIF-2αRNAi reagent. In some embodiments, the linker group conjugated to the HIF-2αRNAi reagent may be a triyne linker group.
[0480] In some embodiments, the HIF-2αRNAi reagent is linked to one or more tridentate targeting groups having the following formula or a pharmaceutically acceptable salt thereof:
[0481]
[0482] Formula II
[0483] in,
[0484] L 1 L 2 and L 3 Each is independently a connector containing optionally substituted alkylene groups;
[0485] L 4 It is a connector containing optionally substituted alkylene, optionally substituted aryl, or optionally substituted cycloalkyl groups;
[0486] R 5 It is H or an alkyl group that is optionally substituted;
[0487] TL is a targeted ligand; and
[0488] Y is either O or S.
[0489] In other embodiments, the HIF-2αRNAi reagent is linked to one or more tridentate targeting groups using a linker having any of the formulas TriAlk 1-14 shown in Table 7 below. Methods for synthesizing compounds of formula II are described in PCT application number PCT / US19 / 18232 entitled “Trialkyne Linking Agents and Methods of Use”.
[0490] Examples of certain modified nucleotides and linker groups are provided in Table 7.
[0491] Table 7. Structures of nucleotides and linking groups with various modifications
[0492]
[0493]
[0494]
[0495]
[0496]
[0497]
[0498]
[0499]
[0500]
[0501]
[0502]
[0503]
[0504]
[0505]
[0506] In some embodiments, the RNAi reagent includes a linker having the following structure: TriAlk 14:
[0507]
[0508] Or TriAlk 14s: TL contains a targeting ligand, which is the result of a "click" reaction between a compound of (TriAlk14) or (TriAlk14)s and a targeting ligand containing an azide.
[0509] Alternatively, other linking groups known in the art can be used.
[0510] In addition to linking the HIF-2α RNAi reagent to one or more targeting ligands, targeting groups, and / or PK enhancers, or alternatively, in some embodiments, a delivery medium may be used to deliver the RNAi reagent to cells or tissues. The delivery medium is a compound that can improve the delivery of the RNAi reagent to cells or tissues and may include, but is not limited to: polymers (such as amphiphilic polymers), membrane-active polymers, peptides, melittin peptides, melittin-like peptides (MLPs), lipids, reversibly modified polymers or peptides, or reversibly modified membrane-active polyamines, or compositions thereof.
[0511] In some embodiments, the RNAi reagent may be combined with lipids, nanoparticles, polymers, liposomes, micelles, DPCs, or other delivery systems available in the art. The RNAi reagent may also be chemically conjugated to a target group, lipids (including, but not limited to, cholesterol and cholesterol derivatives), nanoparticles, polymers, liposomes, micelles, DPCs (see, for example, WO 2000 / 053722, WO 2008 / 022309, WO 2011 / 104169 and WO 2012 / 083185, WO 2013 / 032829, WO 2013 / 158141, each of which is incorporated herein by reference) or other delivery systems available in the art.
[0512] Pharmaceutical Composition
[0513] In some embodiments, this disclosure provides pharmaceutical compositions comprising, consisting of, or substantially consisting of one or more of the HIF-2αRNAi reagents disclosed herein.
[0514] As used herein, a “pharmaceutical composition” comprises a pharmacologically effective amount of an active pharmaceutical ingredient (API) and optionally one or more pharmaceutically acceptable excipients. A pharmaceutically acceptable excipient (excipient) is a substance other than the active pharmaceutical ingredient (API, therapeutic product) intentionally included in a drug delivery system. The excipient does not exert a therapeutic effect at the intended dose or is not intended to exert a therapeutic effect. Excipients may serve to: a) facilitate the processing of the drug delivery system during manufacturing; b) protect, support, or enhance the stability, bioavailability, or patient acceptability of the API; c) facilitate product identification; and / or d) enhance any other properties of the overall safety and effectiveness of API delivery during storage or use. Pharmaceutically acceptable excipients may or may not be inert substances.
[0515] Excipients include, but are not limited to: absorption enhancers, anti-adhesion agents, defoamers, antioxidants, adhesives, buffers, carriers, coating agents, colorants, delivery enhancers, delivery polymers, dextran, dextrose, diluents, disintegrants, emulsifiers, extenders, fillers, flavoring agents, flow aids, humectants, lubricants, oils, polymers, preservatives, brine, salt, solvents, sugars, suspending agents, sustained-release matrices, sweeteners, thickeners, tensioning agents, mediators, waterproofing agents, and wetting agents.
[0516] The pharmaceutical compositions described herein may contain other additional components that are typically present in pharmaceutical compositions. In some embodiments, said additional component is a pharmaceutically active substance. Pharmaceutically active substances include, but are not limited to: antipruritic agents, astringents, local anesthetics or anti-inflammatory agents (e.g., antihistamines, diphenhydramine, etc.), small molecule drugs, antibodies, antibody fragments, aptamers and / or vaccines.
[0517] Pharmaceutical compositions may also contain preservatives, solubilizers, stabilizers, wetting agents, emulsifiers, sweeteners, colorants, flavorings, salts for altering osmotic pressure, buffers, coating agents, or antioxidants. They may also contain other agents with known therapeutic benefits.
[0518] The pharmaceutical composition can be administered in a variety of ways, depending on whether local or systemic treatment is required and the area to be treated. It can be administered by any method known in the art, such as, but not limited to, local (e.g., via a transdermal patch), pulmonary (e.g., by inhalation or blowing of a powder or aerosol, including via nebulizer, intratracheal, or intranasal), epidermal, transdermal, oral, or parenteral administration. Parenteral administration includes, but is not limited to, intravenous, intra-arterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion; subdermal (e.g., via an implanted device), intracranial, intraparenchymal, intrasheath, and intravenous administration. In some embodiments, the pharmaceutical composition described herein is administered by subcutaneous injection. The pharmaceutical composition can be administered orally, for example, in the form of tablets, coated tablets, sugar lozenges, hard or soft gelatin capsules, solutions, emulsions, or suspensions. It can also be administered rectally, for example, using suppositories; locally or transdermally, for example using ointments, creams, gels, or solutions; or parenterally, for example using injectable solutions.
[0519] Suitable pharmaceutical compositions for injection include sterile aqueous solutions (in the case of water solubility) or dispersions, as well as sterile powders for immediate preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, antibacterial water, Cremophor EL™ (BASF, Parsippany, NJ), or phosphate-buffered saline. It should be stable under manufacturing and storage conditions and should be preserved free from contamination by microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. Appropriate flowability can be maintained, for example, by using coating agents such as lecithin, by maintaining the desired particle size (in the case of dispersions), and by using surfactants. In many cases, it is preferable to include isotonic agents in the composition, such as sugars, polyols such as mannitol, sorbitol, and sodium chloride. Prolonged absorption of the injectable composition can be achieved by including agents that delay absorption, such as aluminum monostearate and gelatin.
[0520] Sterile injectable solutions can be prepared by incorporating the active compound in the desired amount into a suitable solvent having one or a combination of the components listed above, followed by filtration and sterilization. Dispersions are typically prepared by incorporating the active compound into a sterile medium containing a base dispersion medium and other desired components from those listed above. For sterile powders used to prepare sterile injectable solutions, preparation methods include vacuum drying and freeze-drying, which produce powders of the active ingredient and any other desired components from their previously sterile filtered solutions.
[0521] Formulations suitable for intra-articular administration may be in the form of sterile aqueous formulations of any ligand described herein, which may be in microcrystalline form, such as in an aqueous microcrystalline suspension. Liposome formulations or biodegradable polymer systems may also be used to deliver any ligand described herein for intra-articular and ophthalmic administration.
[0522] Active compounds can be prepared using carriers that protect the compounds from rapid elimination from the body, such as controlled-release formulations, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid can be used. Methods for preparing such formulations will be understood by those skilled in the art. Liposome suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Patent No. 4,522,811.
[0523] Pharmaceutical compositions may contain other additional components commonly found in pharmaceutical compositions. Such additional components include, but are not limited to, antipruritic agents, astringents, local anesthetics, or anti-inflammatory agents (e.g., antihistamines, diphenhydramine, etc.). As used herein, “pharmacologically effective amount,” “therapeuticly effective amount,” or simply “effective amount,” refers to the amount of a pharmaceutically active agent that produces a pharmacological, therapeutic, or preventative result.
[0524] Drugs containing HIF-2αRNAi reagents are also an object of this invention, as are methods for manufacturing such drugs, which include preparing one or more compounds containing HIF-2αRNAi reagents, and, if necessary, one or more other substances having known therapeutic benefits, into a pharmaceutically acceptable form.
[0525] The described HIF-2αRNAi reagent and the pharmaceutical compositions containing the HIF-2αRNAi reagent disclosed herein may be packaged or included in kits, containers, pouches, or dispensers. The HIF-2αRNAi reagent and the pharmaceutical compositions containing the HIF-2αRNAi reagent may be packaged in pre-filled syringes or vials.
[0526] Treatment methods and inhibition of expression
[0527] The HIF-2α RNAi reagent disclosed herein can be used to treat subjects (e.g., humans or other mammals) with diseases or disorders that would benefit from the administration of the RNAi reagent. In some embodiments, the RNAi reagent disclosed herein can be used to treat subjects (e.g., humans) who would benefit from reduced and / or inhibited expression of HIF-2α mRNA and / or HIF-2α (EPAS1) protein levels, such as those who have been diagnosed with or are suffering from symptoms associated with cancer, renal cell carcinoma, clear cell renal cell carcinoma, non-small cell lung cancer, astrocytoma (brain cancer), bladder cancer, breast cancer, chondrosarcoma, colorectal cancer, gastric cancer, glioblastoma, head and neck squamous cell carcinoma, hepatocellular carcinoma, lung adenocarcinoma, neuroblastoma, melanoma, multiple myeloma, ovarian cancer, rectal cancer, metastasis, gingivitis, psoriasis, Kaposi's sarcoma-associated herpesvirus, preeclampsia, inflammation, chronic inflammation, neovascularization, and rheumatoid arthritis.
[0528] In some embodiments, a therapeutically effective amount of any one or more HIF-2αRNAi agents is administered to the subject. Treatment of the subject may include therapeutic and / or prophylactic treatment. A therapeutically effective amount of any one or more HIF-2αRNAi agents described herein is administered to the subject. The subject may be a human, a patient, or a human patient. The subject may be an adult, adolescent, child, or infant. The pharmaceutical compositions described herein may be administered to humans or animals.
[0529] The HIF-2α RNAi agents described herein can be used to treat at least one symptom in a subject who has an HIF-2α-related disease or disorder, or a disease or disorder at least partially mediated by HIF-2α gene expression. In some embodiments, the HIF-2α RNAi agents are used to treat or manage the clinical presentation of a subject with a disease or disorder that would benefit from or be at least partially mediated by a reduction in HIF-2α mRNA. A therapeutically effective amount of one or more of the HIF-2α RNAi agents described herein or compositions containing HIF-2α RNAi agents is administered to the subject. In some embodiments, the methods disclosed herein include administering a composition containing the HIF-2α RNAi agents described herein to a subject to be treated. In some embodiments, a preventatively effective amount of any one or more of the described HIF-2α RNAi agents is administered to the subject, thereby treating the subject by preventing or suppressing at least one symptom.
[0530] In some embodiments, this disclosure provides methods for treating in patients who require treatment a disease, disorder, symptom, or pathological state that is at least partially mediated by HIF-2α gene expression, wherein the methods include administering to the patient any of the HIF-2α RNAi reagents described herein.
[0531] In some implementations, compared with subjects before administration of the HIF-2α RNAi reagent, or compared with subjects who did not receive the HIF-2α RNAi reagent, subjects given the described HIF-2α RNAi reagent showed a reduction in gene expression levels and / or mRNA levels of the HIF-2α gene by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 95%, 96%, 97%, 98%, 99%, or greater than 99%. Gene expression levels and / or mRNA levels in the subjects may be reduced in the subjects' cells, cell aggregates, and / or tissues.
[0532] In some implementations, compared with subjects who had received the described HIF-2α RNAi reagent, or compared with subjects who had not received the HIF-2α RNAi reagent, subjects who had received the described HIF-2α RNAi reagent showed a reduction in HIF-2α protein levels of at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99%. Protein levels in the subjects may be reduced in the subjects' cells, cell aggregates, tissues, blood, and / or other fluids.
[0533] A reduction in HIF-2α mRNA and HIF-2α protein levels can be assessed using any method known in the art. As used herein, a reduction or decrease in HIF-2α mRNA and / or protein levels is collectively referred to herein as a reduction or decrease in HIF-2α, or inhibition or reduction of HIF-2α expression. The examples described herein illustrate known methods for assessing inhibition of HIF-2α gene expression.
[0534] In some embodiments, the HIF-2α RNAi reagent can be used to prepare a pharmaceutical composition for treating a disease, disorder, or symptom at least partially mediated by HIF-2α gene expression. In some embodiments, the disease, disorder, or symptom at least partially mediated by HIF-2α gene expression is cancer, renal cell carcinoma, clear cell renal cell carcinoma, non-small cell lung cancer, astrocytoma (brain cancer), bladder cancer, breast cancer, chondrosarcoma, colorectal cancer, gastric cancer, glioblastoma, head and neck squamous cell carcinoma, hepatocellular carcinoma, lung adenocarcinoma, neuroblastoma, melanoma, multiple myeloma, ovarian cancer, rectal cancer, metastasis, gingivitis, psoriasis, Kaposi's sarcoma-associated herpesvirus, preeclampsia, inflammation, chronic inflammation, neovascularization, or rheumatoid arthritis.
[0535] In some embodiments, the method of treating the subject depends on the subject's weight. In some embodiments, the HIF-2αRNAi agent may be administered at a dose of about 3 mg / kg to about 80 mg / kg of the subject's body weight. In other embodiments, the HIF-2αRNAi agent may be administered at a dose of about 5 mg / kg to about 20 mg / kg of the subject's body weight.
[0536] In some implementations, the HIF-2αRNAi reagent can be administered in fractionated doses, meaning that two doses are given to the subject over a short period of time (e.g., less than 24 hours). In some implementations, approximately half of the desired daily dose is administered on the first administration, and the remaining approximately half of the desired daily dose is administered approximately 4 hours after the first administration.
[0537] In some implementations, the HIF-2αRNAi reagent can be administered once a week. In other implementations, the HIF-2αRNAi reagent can be administered every two weeks.
[0538] In some embodiments, the HIF-2αRNAi reagent is administered at a fixed dose of 225 mg per week. In some embodiments, the HIF-2αRNAi reagent is administered at a fixed dose of 525 mg per week. In some embodiments, the HIF-2αRNAi reagent is administered at a fixed dose of 1,050 mg per week. In some embodiments, the HIF-2αRNAi reagent is administered via intravenous infusion.
[0539] In some embodiments, the HIF-2α RNAi agent or a composition containing the HIF-2α RNAi agent can be used to treat diseases, disorders, or symptoms that are at least partially mediated by HIF-2α (EPAS1) gene expression. In some embodiments, the disease, disorder, or symptom at least partially mediated by HIF-2α (EPAS1) gene expression is ccRCC.
[0540] Cells, tissues and non-human objects
[0541] This encompasses cells, tissues, and non-human objects, including at least one of the HIF-2αRNAi reagents described herein. The HIF-2αRNAi reagent is delivered to the cells, tissues, or non-human objects by any method available in the art to prepare the cells, tissues, or non-human objects. In some embodiments, the cells are mammalian cells, including, but not limited to, human cells.
[0542] The above-described implementation schemes and projects will now be illustrated by the following non-limiting embodiments.
[0543] Example
[0544] The following examples are not limiting and are intended to illustrate certain implementations disclosed herein.
[0545] Example 1. Synthesis of HIF-2αRNAi reagent and composition containing HIF-2αRNAi reagent.
[0546] The following describes a general procedure for synthesizing certain HIF-2αRNAi reagents and their conjugates, illustrated in the non-limiting examples set forth herein.
[0547] Synthesis of RNAi reagents. RNAi reagents can be synthesized using methods generally known in the art. Regarding the synthesis of the RNAi reagents exemplified in the examples described herein, the sense and antisense strands of the RNAi reagents are synthesized according to the phosphoramidite technique on a solid phase used in oligonucleotide synthesis. Depending on the scale, the synthesis is carried out using… (Bioautomation) (Bioautomation) or Oligopilot 100 (GE Healthcare). Made of controllable porosity glass (CPG, or Synthesis was performed on solid supports made of Prime Synthesis (Aston, PA, USA) or polystyrene (Kinovate, Oceanside, CA, USA). All RNA and 2′-modified RNA phosphoramides were purchased from Thermo Fisher Scientific (Milwaukee, WI, USA), ChemGenes (Wilmington, MA, USA), or Hongene Biotech (Morrisville, NC, USA). Specifically, the 2′-O-methylphosphoramides used included those described below: (5′-O-dimethoxytriphenylmethyl-N 6 -(benzoyl)-2′-O-methyl-adenosine-3′-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide, 5′-O-dimethoxy-triphenylmethyl-N 4 -(acetyl)-2′-O-methyl-cytidine-3′-O-(2-cyanoethyl-N,N-diisopropyl-amino)phosphamide, (5′-O-dimethoxytriphenylmethyl-N 2-(isobutyryl)-2′-O-methyl-guanosine-3′-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide and 5′-O-dimethoxytriphenylmethyl-2′-O-methyl-uridine-3′-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide. 2′-deoxy-2′-fluorophosphamide and 2′-O-propargylphosphamide carry the same protecting group as 2′-O-methylphosphamide. 5′-dimethoxytriphenylmethyl-2′-O-methyl-inosine-3′-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide was purchased from Glen Research (Virginia). Inverted debasing (3′-O-dimethoxytriphenylmethyl-2′-deoxyribose-5′-O-(2-cyanoethyl-N,N-diisopropylamino)phosphamide was purchased from ChemGenes. The following UNA phosphoramids were used: 5′-(4,4′-dimethoxytriphenylmethyl)-N6-(benzoyl)-2′,3′-open-ring-adenosine, 2′-benzoyl-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphamide, 5′-(4,4′-dimethoxytriphenylmethyl)-N-acetyl-2′,3′-open-ring-cytosine, 2′-benzoyl-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphamide, 5′-(4,4'-dimethoxytriphenylmethyl)-N-isobutyryl-2′,3′-open-ring-guanosine, 2′-benzoyl-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramide, and 5′-(4,4'-dimethoxytriphenylmethyl)-2′,3′-open-ring-uridine, 2′-benzoyl-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramide. To introduce the thiophosphate bond, a 100 mM solution of 3-phenyl-1,2,4-diathiazolin-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile or a 200 mM solution of xanthane hydride (TCI America, Portland, OR, USA) in pyridine was used.
[0548] Thermo Fisher also commercially purchased TFA amino-linked phosphorous amide to introduce (NH2-C6) reactive group linkers. The TFA amino-linked phosphorous amide was dissolved in anhydrous acetonitrile (50 mM) and molecular sieves were added. 5-Benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) was used as the activating agent solution. Coupling times were 10 min (RNA), 90 s (2′O-Me), and 60 s (2′F). Triyne-containing phosphorous amides were synthesized to introduce various (TriAlk#) linkers. When used in conjunction with the RNAi reagents presented in some examples herein, the triyne-containing phosphorous amide was dissolved in anhydrous dichloromethane or anhydrous acetonitrile (50 mM), while all other amidates were dissolved in anhydrous acetonitrile (50 mM) and molecular sieves were added. 5-Benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) was used as the activating agent solution. The coupling times were 10 min (RNA), 90 s (2′O-Me), and 60 s (2′F).
[0549] For some RNAi reagents, adapters such as C6-SS-C6 or 6-SS-6 groups are introduced at the 3' end of the sense strand. Preloaded resins with various adapters are commercially available. Alternatively, for some sense strands, dT resin is used, and various adapters are then added via standard phosphoramide synthesis.
[0550] Cleavage and deprotection of the oligomers bound to the support. After solid-phase synthesis, the dried solid support was treated with a 1:1 volume solution of 40% by weight methylamine aqueous solution and 28%-31% ammonium hydroxide solution (Aldrich) at 30°C for 1.5 hours. The solution was evaporated and the solid residue was reconstituted in water (see below).
[0551] Purification. Crude oligomers were purified by anion-exchange HPLC using a TSKgel SuperQ-5PW 13μm column and a Shimadzu LC-8 system. Buffer A was 20mM Tris, 5mM EDTA, pH 9.0, and contained 20% acetonitrile. Buffer B was identical to Buffer A except for the addition of 1.5M sodium chloride. UV traces were recorded at 260 nm. Appropriate fractions were combined and then run on size-resistance HPLC using a GE Healthcare XK 16 / 40 column packed with Sephadex G25 fines and a run buffer of 100mM ammonium bicarbonate (pH 6.7) and 20% acetonitrile or filtered water.
[0552] Annealing. An RNAi reagent was prepared by combining equimolar RNA solutions (sense and antisense) in 1×PBS (phosphate-buffered saline, 1×, Corning, Cellgro) to mix complementary strands. Some of the RNAi reagent was lyophilized under low pressure and stored at -15 to -25°C. The duplex concentration was determined by measuring the absorbance of the solution in 1×PBS on a UV-Vis spectrometer. The duplex concentration was then determined by multiplying the absorbance of the solution at 260 nm by a conversion factor and a dilution factor. The conversion factor used was 0.037 mg / (mL·cm), or calculated from an experimentally determined extinction coefficient.
[0553] Synthesis of the linker TriAlk 14
[0554] In some embodiments, the linker, such as TriAlk 14, can be attached to the RNAi reagent in a phosphorus amide form as follows: by reacting a phosphorus amide containing a triyne, or by synthesizing an RNAi reagent containing a reactive group (such as a terminal amine) and reacting the RNAi reagent with a triyne moiety containing an activated ester after the RNAi reagent has been cleaved from the resin. The following procedure provides a method for synthesizing the activated ester form of TriAlk 14 (compound 22) or the phosphorus amide form of TriAlk 14 (compound 14).
[0555]
[0556] 500 mL of DCM and 4 (75.0 g, 0.16 mol) were added to a 3-L jacketed reactor. The internal temperature of the reactants was cooled to 0 °C and TBTU (170.0 g, 0.53 mol) was added. The suspension was then treated dropwise with amine 5 (75.5 g, 0.53 mol) while maintaining the internal temperature below 5 °C. The reactants were then slowly treated with DIPEA (72.3 g, 0.56 mol) while maintaining the internal temperature below 5 °C. After the addition was complete, the reactants were heated to 23 °C over 1 hour and stirred for 3 hours. A 10% kicker loading of all three reagents was added and stirred for another 3 hours. The reaction was considered complete when <1% of 4 remained. The reaction mixture was washed with saturated ammonium chloride solution (2 x 500 mL) and once with saturated sodium bicarbonate solution (500 mL). The organic layer was then dried over sodium sulfate and concentrated to an oil. The crude oil weighed 188 g and contained 72% 6 as determined by QNMR. The crude oil will be used in the next step. C 46 H 60 N4O 11 The calculated mass is 845.0 m / z. The measured mass [M+H] is 846.0.
[0557]
[0558] 121.2 g of crude oil containing 72 wt% of compound 6 (86.0 g, 0.10 mol) was dissolved in DMF (344 mL) and treated with TEA (86 mL, 20 v / v%) while maintaining the internal temperature below 23 °C. The formation of dibenzo-rich olefins (DBF) relative to the consumption of Fmoc-amine 6 was monitored by HPLC method 1. Figure 2 The reaction proceeded within 10 hours. Glutaric anhydride (12.8 g, 0.11 mol) was added to the solution, and intermediate amine 7 was converted to compound 8 within 2 hours. After completion, DMF and TEA were removed under reduced pressure at 30 °C to obtain 100 g of crude oil. Due to the high solubility of compound 7 in water, aqueous post-treatment was not possible, and chromatography was the only method for removing DBF, TMU, and glutaric anhydride. The crude oil (75 g) was divided into three fractions and processed at Teledyne ISCO Combi- Purification was performed using a purification system. The crude oil (25 g) was loaded onto a 330 g silica gel column and eluted with 0–20% methanol / DCM over 30 minutes to give 42 g of compound 8 (54% yield after 3 steps). 36 H 55 N4O 12 The calculated mass is 736.4 m / z. The measured mass [M+H] is 737.0.
[0559]
[0560] Compound 8 (42.0 g, 0.057 mol) was co-exfoliated with 10 volumes of acetonitrile before use to remove any residual methanol from the chromatographic solvent. The oil was redissolved in DMF (210 mL) and cooled to 0 °C. The solution was treated successively with 4-nitrophenol (8.7 g, 0.063 mol) and EDC-hydrochloride (12.0 g, 0.063 mol), and complete treatment was observed within 10 hours. The solution was cooled to 0 °C, and 10 volumes of ethyl acetate were added, followed by 10 volumes of saturated ammonium chloride solution, while maintaining the internal temperature below 15 °C. Layer separation was allowed, and the ethyl acetate layer was washed with brine. The combined aqueous layers were extracted twice with 5 volumes of ethyl acetate. The combined organic layers were dried over sodium sulfate and concentrated to an oil. The crude oil (55 g) was aliquoted into three fractions and processed at Teledyne ISCO Combi- Purification was performed using a purification system. The crude oil (25 g) was loaded onto a 330 g silica gel column and eluted from 0–10% methanol / DCM for 30 minutes to give 22 g of pure compound 9 (compound 22) (50% yield). 42 H 59 N5O 14The calculated mass is 857.4 m / z. The measured mass [M+H] is 858.0.
[0561]
[0562] A solution of ester 9 (49.0 g, 57.1 mmol) and 6-amino-1-hexanol (7.36 g, 6.28 mmol) in dichloromethane (3 volumes) was treated dropwise with triethylamine (11.56 g, 111.4 mmol). The reaction was monitored by observing the disappearance of compound 9 on HPLC method 1 and was found to be completed within 10 minutes. The crude reaction mixture was diluted with 5 volumes of dichloromethane and washed with saturated ammonium chloride (5 volumes) and brine (5 volumes). The organic layer was dried over sodium sulfate and concentrated to an oil. The crude oil was then subjected to chromatography on a 330 g silica gel column in Teledyne ISCO Combi- Purification was performed using a purification system. 4-Nitrophenol was eluted with 100% ethyl acetate, and the column was washed with 20% methanol / DCM to give a colorless oil (39 g, 81% yield). 42 H 69 N5O 12 The calculated mass is 836.0 m / z. The measured mass [M+H] is 837.0.
[0563]
[0564] Alcohol 10 was co-eluted twice with 10 volumes of acetonitrile to remove any residual methanol from the chromatographic solvent, and then co-eluted once more with dry dichloromethane (KF < 60 ppm) to remove trace amounts of water. Alcohol 10 (2.30 g, 2.8 mmol) was dissolved in 5 volumes of dry dichloromethane (KF < 50 ppm) and treated with diisopropylammonium tetrazolide (188 mg, 1.1 mmol). The solution was cooled to 0 °C and treated dropwise with 2-cyanoethyl N,N,N',N'-tetraisopropylphosphonamide (1.00 g, 3.3 mmol). The solution was removed from the ice bath and stirred at 20 °C. The reaction was observed to complete within 3–6 hours. The reaction mixture was cooled to 0 °C and treated with 10 volumes of a 1:1 solution of saturated ammonium bicarbonate / salt water, then warmed to ambient temperature for 1 minute and stirred at 20 °C for another 3 minutes. The two-phase mixture was transferred to a separatory funnel and 10 volumes of dichloromethane were added. The organic layer was separated and washed with 10 volumes of saturated sodium bicarbonate solution to hydrolyze unreacted bis-phosphorous reagent. The organic layer was dried over sodium sulfate and concentrated to an oil to give 3.08 g of 94 wt% compound 14. 51 H 86 N7O 13The calculated mass of P is 1035.6 m / z. The measured mass [M+H] is 1036.
[0565] Synthetic post-conjugation of triyne scaffolds. Before or after annealing, the 5′ or 3′ amine-functionalized sense strand of the RNAi reagent can be conjugated to a triyne scaffold. The conjugation of the triyne scaffold with the annealed duplex is described below: The amine-functionalized duplex was dissolved in 90% DMSO / 10% H2O at approximately 50–70 mg / mL. 40 equivalents of triethylamine were added, followed by 3 equivalents of triyne-PNP. Once complete, the conjugate was precipitated twice in a 1x phosphate-buffered saline / acetonitrile (1:14 ratio) solvent system and dried.
[0566] Conjugation of Targeting Ligands to HIF-2RNAi Reagents. One or more targeting ligands can be conjugated to the HIF-2RNAi reagents disclosed herein, before or after annealing and before or after conjugation with PK enhancers. The following describes a general conjugation procedure for conjugating integrin targeting ligands to alkyne-functionalized linkers (e.g., (TriAlk) or 2'-O-propargyl) on internal nucleotides. The procedure describes the addition of three targeting ligands to a tridentate targeting scaffold. The same procedure can be used to conjugate targeting ligands to internal nucleotides, although the equivalent number of targeting ligands can be adjusted considering the number of targeting ligands to be added: stock solutions of 0.5 M tris(3-hydroxypropyltriazolylmethyl)amine (THPTA), 0.5 M copper(II) sulfate pentahydrate (Cu(II)SO4·5H2O), and 2 M sodium ascorbate solution are prepared in deionized water. A solution of the desired integrin ligand at 75 mg / mL is prepared in DMSO. In a flask containing the sense chain (75 mg / mL in deionized water), the integrin ligand was added to the reactants (2 equivalents / alkyne) with stirring. Triethylamine (40 equivalents / sense chain) was added to the reaction flask. In a separate flask, 5 parts of 0.5 M THPTA were mixed with 1 part of 0.5 M Cu(II)SO4·5H2O, vortexed, and incubated at room temperature for 5 min. After 5 min, a THPTA / Cu solution (0.5 equivalents Cu / alkyne) was added to the reaction flask. Then, 2 M ascorbate (5 equivalents / Cu) was immediately added to the reaction flask. Once the reaction was complete (usually within 0.5–1 h), the reactants were immediately purified by non-denaturing anion exchange chromatography. Unless otherwise indicated, all constructs including a tridentate targeting group described in the examples below comprise groups having the following structures:
[0567] TriAlk14:
[0568]
[0569] TriAlk14s:
[0570] TL includes targeted ligands and Indicates the connection point with the RNAi reagent.
[0571] Conjugation of PK enhancers to HIF-2RNAi reagents. One or more PK enhancers can be ligated to the HIF-2αRNAi reagents disclosed herein, before or after annealing and before or after conjugation of one or more targeting ligands. The following describes a general conjugation process for ligating PK enhancers to the constructs illustrated in the examples described herein. The following describes a general method for ligating maleimide-functionalized PK enhancers to the (C6-SS-C6) or (6-SS-6) functionalized sense strand of the HIF-2αRNAi reagent, which is achieved by dithiothreitol reduction of the disulfide bond followed by thiol-Michael addition of the various PK enhancers: In a vial, the functionalized sense strand is dissolved at 75 mg / mL in 0.1 M Hepes pH 8.5 buffer, and 25 equivalents of dithiothreitol are added. Once the reaction is complete (usually within 0.5–1 h), immediately precipitate the conjugate three times in a 1x phosphate-buffered saline / acetonitrile (1:40) solvent system and dry. Then prepare a solution of 75 mg / mL maleimide-functionalized PK enhancer in DMSO. Dissolve the disulfide-reduced (3′C6-SH, 5′HS-C6, or 3′6-SH-functionalized) sense chain in deionized water at 100 mg / mL and add 3 equivalents of maleimide-functionalized PK enhancer. Once the reaction is complete (usually within 1–3 h), precipitate the conjugate in a 1x phosphate-buffered saline / acetonitrile (1:40) solvent system and dry.
[0572] Methods for preparing targeted ligands
[0573] Some abbreviations used in the following experimental details of the synthesis in the examples are defined as follows: h or hr = hour; min = minute; mol = mole; mmol = millimole; M = mole; μM = micromole; g = gram; μg = microgram; rt or RT = room temperature; L = liter; mL = milliliter; wt = weight; Et2O = diethyl ether; THF = tetrahydrofuran; DMSO = dimethyl sulfoxide; EtOAc = ethyl acetate; Et3N or TEA = triethylamine; i-Pr2NEt or DIPEA or DIEA = diisopropylethylamine; CH2Cl2 or DCM = dichloromethane; CHCl3 = chloroform; CDCl3 = deuterated chloroform; CCl4 = carbon tetrachloride; MeOH = methanol; EtOH = ethanol; DMF = dimethylformamide; BOC = tert-butoxycarbonyl; CBZ = benzyloxycarbonyl; TBS = tert-butoxycarbonyl tert-butyldimethylsilyl chloride; TBSCl or TBDMSCl = tert-butyldimethylsilyl chloride; TFA = trifluoroacetic acid; DMAP = 4-dimethylaminopyridine; NaN3 = sodium azide; Na2SO4 = sodium sulfate; NaHCO3 = sodium bicarbonate; NaOH = sodium hydroxide; MgSO4 = magnesium sulfate; K2CO3 = potassium carbonate; KOH = potassium hydroxide; NH4OH = ammonium hydroxide; NH4Cl = ammonium chloride; SiO2 = silicon dioxide; Pd-C = palladium supported on carbon; HCl = hydrogen chloride or hydrochloric acid; NMM = N-methylmorpholine; H2 = hydrogen; KF = potassium fluoride; EDC-HCl = N-(3-dimethylaminopropyl)-N′-ethylcarbodiimide hydrochloride; MTBE = methyl-tert-butyl ether; MeOH = methanol; Ar = argon; N2 = nitrogen; SiO2 = silicon dioxide; R T = Retention time; PTSA = p-toluenesulfonic acid; PPTS = pyridinium p-toluenesulfonate.
[0574] Synthesis of structure 1c((S)-3-(6-((1-azido-15-oxo-3,6,9,12-tetraoxa-16-azanonadecan-19-yl)oxy)pyridin-3-yl)-3-(2-oxo-3-(3-(5,6,7,8-tetrahydro-1,8-naphthidin-2-yl)propyl)imidazolidine-1-yl)propionic acid).
[0575]
[0576] A mixture containing compound 1 (1.03 g, 8.23 mmol), compound 2 (0.92 g, 14.8 mol), and PTSA hydrate (156 mg, 0.82 mmol) in benzene (25 mL) was refluxed overnight in a Dean Stark apparatus. The following morning, the reaction mixture was poured into saturated sodium bicarbonate, followed by the addition of ethyl acetate. The organic phase was separated, filtered through sodium sulfate, and concentrated to give compound 3 in 95% yield, which was then used without further purification.
[0577]
[0578] Compound 4 (5.39 g, 53.3 mmol) contained in DMF (100 mL) and Sodium hydride (60 wt%, 2.13 g, 53.3 mmol) was added to the molecular sieve solution, and the reaction mixture was stirred for 1 hour. Then, a solution of compound 3 (7.52 g, 7.52 g) in DMF (20 mL) was added, and the suspension was heated at 80 °C overnight. After the reaction, the suspension was filtered through a cotton plug and concentrated under reduced pressure. The residue was partitioned between diethyl ether and water, and the organic phase was separated, filtered through sodium sulfate, and concentrated under reduced pressure. The residue was treated with 20 mL of 10% H₂O in TFA and stirred for 30 minutes. After the reaction, the solution was cooled to 0 °C and the pH was adjusted to 11 with 6 M NaOH, after which the product precipitated as an oil. Compound 5 was extracted three times from the oil suspension with diethyl ether. The organic phases were combined, filtered through sodium sulfate, and concentrated. Then, compound 5 was separated on silica gel by gradient elution with ethyl acetate in hexane to a yield of 26%.
[0579]
[0580] A mixture containing compound 5 (2.29 g, 9.94 mmol), compound 6 (4.82 g, 39.8 mmol), PPTS (125 mg, 0.50 mmol), magnesium sulfate (3 g, 24.9 mmol), copper sulfate (3.97 g, 24.9 mmol), and a 3 Å molecular sieve in DCM (22 mL) was heated to reflux overnight. Afterward, the mixture was filtered and concentrated under reduced pressure. Compound 7 was then separated in 76% yield by gradient elution with ethyl acetate in hexane on silica gel.
[0581]
[0582] A flame-dried flask was filled with THF (40 mL) and diisopropylamine (2.29 g, 22.6 mmol). The flask was cooled to -20 °C, and n-BuLi (2.5 M, 8.64 mL, 21.6 mmol) was added via a tube. The solution was stirred at -20 °C for 10 min, then cooled to -78 °C. Compound 8 (2.02 mL, 20.6 mmol) was added dropwise with vigorous stirring. After addition, the solution was stirred at -78 °C for 30 min. Next, a solution of ClTi(iPrO)3 (11.26 g, 43.2 mmol) in THF (10 mL) was added with vigorous stirring via a feeding funnel over approximately 10 min. The reactants were stirred at -78 °C for 30 min. Finally, a suspension of compound 7 (2.29 g, 6.86 mmol) in THF was added dropwise, and the mixture was stirred at -78 °C for 1.25 h until the reaction was complete. A saturated aqueous solution of ammonium chloride was added to the reactants at -78°C. The reactants were then removed from the cooling process, and the aqueous phase was allowed to gradually melt and quench (the yellow-orange color disappeared). The mixture was partitioned between EtOAc and the saturated aqueous solution of ammonium chloride. The organic phase was separated, and the aqueous phase was extracted twice with EtOAc. The organic phases were combined and dried over brine, then over sodium sulfate, filtered, and concentrated. The residue was purified on silica gel, eluted with a gradient of ethyl acetate in hexane. Compound 9, as a single diastereomer, was given in 75% yield after purification.
[0583]
[0584] Compound 9 (1.28 g, 3.21 mmol) in MeOH (3.2 mL) was treated with a solution of HCl in dioxane (4 M, 3.2 mL, 12.9 mmol) and stirred at room temperature for 30 min. After treatment, the reaction mixture was diluted with water and washed with diethyl ether. Subsequently, the pH was adjusted to 11 using an aqueous solution of 2N NaOH, and the product was extracted with ethyl acetate. The organic phase was dried over sodium sulfate, filtered, and concentrated to give compound 10 in 92% yield, which was then used without further purification.
[0585]
[0586] STAB-H solid (1.29 g, 6.12 mmol) was added fractionally to a mixture of compound 10 (0.78 g, 2.67 mmol) and compound 11 (0.60 g, 3.46 mmol) in THF (6 mL) at 15 °C. After addition, the mixture was removed from the heat and cooled, and stirred for approximately 2.5 hours until complete. The reaction was quenched by adding a saturated aqueous sodium bicarbonate solution and adjusting the pH to 9. The product was extracted three times with EtOAc, the organic phases were combined, dried over brine, filtered through sodium sulfate, and concentrated. Compound 12 was separated on silica gel by gradient elution with ethyl acetate in hexane, yielding 85% of the product.
[0587]
[0588] n-BuLi (2.5M, 19.9mL, 49.8mmol) was added to DIPEA (7.53mL, 53.75mmol) in THF (35mL) over 2 minutes at -10°C via a dried, airtight syringe. The mixture was stirred at -10°C for 10 minutes, then cooled to -60°C, and a solution of dimethyl methylphosphonate (6.42g, 51.8mmol) in THF (8mL) was added dropwise over 5–10 minutes. After aging at -60°C for approximately 1 hour, a solution of compound 13 (7.37g, 39.82mmol) in THF (15mL) was added dropwise over 5 minutes at -60°C. The reaction mixture was stirred at -60°C for 1 hour, and then at -41°C for approximately 1.5 hours. The reaction was quenched by adding 2.6 equivalents of H₂SO₄ (2.0M) and extracted three times with ethyl acetate (approximately 50mL). The organic phases were combined and dried with brine, filtered through sodium sulfate, and simply concentrated to determine the weight of the crude product, which was then sampled for NMR. After determining the dry weight, compound 14 was dissolved in MeOH without further purification for the next reaction. The yield was calculated to be 75.83%. The crude product weight / wt% was determined to be 76.3% by NMR. 1 H NMR: 400MHz CDCl3δ4.75(s,1H),3.81(s,3H),3.78(s,3H),3.10-3.14(m,2H),3.04-3.09(m,2H),2.68(t,2H),1.82-1.75(m,2H),1.44(s,9H).
[0589]
[0590] A solution of NaOH (1.45 g, 36.2 mmol) in water (1.5 mL) was added to compound 14 (9.33 g by weight, NMR from about 12 g crude extract, 30.16 mmol) in MeOH (40 mL). The mixture was heated to 50 °C and compound 15 (2.76 g, 22.62 mmol) was added. After stirring for 30 minutes, a second portion of compound 15 (736 mg, 6.03 mmol) was added, and the reaction mixture was stirred overnight at 50 °C. The reaction mixture was then concentrated to an oil and partitioned between 2 volumes of EtOAc and 1 volume of H2O. The organic phase was separated and washed with 1 volume of water. The aqueous washes were combined and back-extracted with EtOAc (2x, 1 volume). The combined organic phases were dried over sodium sulfate, filtered, and concentrated. The crude compound was dried on approximately 20 g of silica gel and separated by separation on silica gel, followed by gradient elution with ethyl acetate in hexane containing 1% triethylamine, yielding compound 16 in 69%. 1 H NMR: 400MHz CDCl3δ9.09(dd,1H),8.17(dd,1H),8.12(d,1H),7.46(dd,1H),7.4 1(d,1H),4.78(s,1H),3.24(q,2H),3.10(t,2H),2.12(quin,2H),1.43(s,9H).
[0591]
[0592] Palladium (10% on carbon, 2.22 g, 2.08 mmol) and hydrogen were added to a solution of compound 16 (5.98 g, 20.8 mmol) in EtOH (50 mL) at 1 atm. The reaction mixture was stirred overnight at room temperature. After stirring, the reaction mixture was... The mixture was filtered and concentrated. Compound 17 was separated in 79% yield by gradient elution with ethyl acetate in hexane containing 1% triethylamine on silica gel. 1 H NMR:400MHz CDCl3δ7.05(d,1H),6.34(d,1H),5.48(s,1H),4.81(s,1H),3.36-3.43(m,2H),3. 16(q,2H),2.68(t,2H),2.59(t,2H),1.90(dt,2H),1.83(quin,2H),1.44(s,9H).
[0593]
[0594] Compound 17 (4.81 g, 16.53 mmol) was dissolved in 16.4 mL of 6 M HCl aqueous solution and heated at 42 °C for 2 hours. Then, another portion of 6 M HCl (2.8 mL) was added, and the reaction mixture was stirred for another 2 hours. Sodium chloride was added to the reaction mixture, followed by 2 N NaOH aqueous solution until the product precipitated as an oil (pH > 12). The mixture was extracted three times with 2-butanol. The combined organic phases were dried over sodium sulfate, filtered, and concentrated. Compound 18 was given in 85% yield and subsequently used without further purification. 1 H NMR:400MHz CDC13δ7.06(d,1H),6.35(d,1H),4.83(s,1H),3.35-3.46(m,2H),2.75-2.67(m,4H),2.58(t,2H),1.88-1.95(m,2H),1.84-1.76(m,4H).
[0595]
[0596] Compound 18 (236 mg, 0.62 mmol) and a solution of TEA (0.134 mL, 0.96 mmol) in THF (0.5 mL) were added dropwise to a flame-dried flask at -10 °C. The reaction mixture was warmed to room temperature. After TLC indicated complete reaction, another 0.134 mL of TEA was added, followed by compound 12 (166 mg, 0.87 mmol) as a solid. The heterogeneous mixture was heated at 50 °C for 2 hours with vigorous stirring. After completion, the reaction mixture was quenched with 1 volume of water and extracted three times with EtOAc. The combined organic phases were dried over brine, filtered through sodium sulfate, and concentrated. Compound 19 was given in 100% yield and subsequently used without further purification.
[0597]
[0598] To crude compound 19 (400 mg, assumed 0.62 mmol) dissolved in THF (37 mL), 0.6 mL of 2 M H₂SO₄ was added, and the mixture was stirred overnight at room temperature. The next morning, another portion of H₂SO₄ (0.65 equivalents) was added. The reaction was complete after 4 hours. The reaction mixture was diluted with ethyl acetate. The organic phase was separated, and the aqueous phase was back-extracted once with ethyl acetate. The combined organic phases were filtered through sodium sulfate and concentrated. Compound 20 was separated on silica gel by gradient elution with MeOH in DCM, yielding 75% of the mixture.
[0599]
[0600] H2 was introduced to 1 atm to a suspension of compound 20 (251 mg, 0.47 mmol) and Pd / C (10 wt%, 100 mg, 0.094 mmol) in ethanol (9 mL), and the mixture was stirred overnight at 35 °C. Afterwards, the mixture was... Palladium is removed by top filtration. Using C... 18 Compound 21, a TFA salt, was separated by reversed-phase HPLC in 20% yield using a 5u 19x250mm BEH column (Waters Corp.) and gradient elution with acetonitrile in H2O containing 1% TFA.
[0601]
[0602] TEA (8 μL, 0.24 mmol) was added to a solution of compound 21 (61 mg, 0.097 mmol) in DCM (250 μL), followed by a solution of NHS-PEG4-N3 (41.4 mg, 0.11 mmol) in DCM (275 μL). The reaction mixture was stirred for 15 minutes and examined by LC-MS, which indicated the end of the reaction. All volatiles were removed, and the residue was dissolved in EtOH (0.4 mL) and water (0.4 mL). LiOH (11.2 mg, 0.47 mmol) was added, and the reaction mixture was heated at 40 °C for 2 hours. After completion, the reaction mixture was concentrated under reduced pressure. Using C 18 Compound 22 (structure 1c) was separated in 42% yield by reversed-phase HPLC using a 5u 19x250 mm BEH column (Waters Corp.) and gradient elution with acetonitrile in H2O containing 1% TFA.
[0603] Synthesis of structure 2c((S)-3-(4-(2-(2-(2-(2-azidoethoxy)ethoxy)ethoxy)ethoxy)-3-fluorophenyl)-3-(2-oxo-3-(3-(5,6,7,8-tetrahydro-1,8-naphthidin-2-yl)propyl)imidazolidine-1-yl)propionic acid).
[0604]
[0605] Compound 6 (21.1 g, 0.17 mol), PPTS (0.55 g, 2.2 mmol), and then acetic acid (1.24 mL, 21.7 mmol) were added to a solution of compound 23 (10 g, 43.4 mmol) in toluene (80 mL). The reaction vessel was equipped with a Dean Stark separator and then heated to reflux overnight. After completion, the reaction mixture was concentrated, dried on 60 g silica gel, and purified on SiO2 using a gradient of ethyl acetate in hexane to yield compound 24 in 66% yield. 1 H NMR: 400MHz CDC13δ8.47(s,1H),7.68(d,1H),7.31-7.56(m,6H),6.98-7.16(m,1H),5.23(s,2H),1.26(s,9H).
[0606]
[0607] A flame-dried flask was filled with 190 mL of THF and 9.07 g (89.7 mmol) and cooled to -20 °C. Then, n-BuLi (2.5 M, 34.2 mL, 85.6 mmol) was added via a tube. The solution was stirred at -20 °C for 10 min and then cooled to -78 °C. Compound 8 (8 mL, 81.5 mmol) was added dropwise with vigorous stirring. After addition, the mixture was stirred at -78 °C for 30 min. Next, a solution of ClTi(iPrO)3 (44.6 g, 0.171 mol) in 40 mL of THF was added over a 10-minute feeding funnel. The reaction mixture was stirred at -78 °C for 30 min. Finally, a suspension of compound 24 (9.06 g, 27.2 mmol) in 20 mL of THF was added dropwise, and the mixture was stirred at -78 °C for 1.25 h until the reaction was complete. A saturated aqueous solution of ammonium chloride was added to the reactants at -78°C. The reactants were then removed from the cooling process, and the aqueous phase was allowed to gradually melt and quench (the yellow-orange color disappeared). The mixture was partitioned between EtOAc and the saturated aqueous solution of ammonium chloride. The organic phase was separated, and the aqueous phase was washed twice with EtOAc. The organic phases were combined and dried over brine, then dried over sodium sulfate, filtered, and concentrated. Compound 25, as a single diastereomer, was given in 70% yield by separation on silica gel and elution with a gradient of ethyl acetate in hexane. 1 H NMR: 400MHz CDCl3δ7.31-7.48(m,5H),7.09(dd,1H),6.89-7.04(m,2H),5.1 3(s,2H),4.59-4.76(m,2H),4.13(q,2H),2.81(dd,2H),1.21-1.25(m,12H).
[0608]
[0609] To compound 25 (8.07 g, 19.1 mmol), an aqueous solution of HCl (6 M, 20.7 mL, 0.124 mol) was added, followed by the addition of MeOH (60 mL). THF was added until a homogeneous solution was obtained, and the reaction mixture was stirred at room temperature for 6 hours. The reaction mixture was alkalized to pH 10 with an aqueous solution of 2 N NaOH and then extracted three times with EtOAc. The combined organic phases were dried over brine, filtered through sodium sulfate, and concentrated. Compound 26 was given in 95% yield and subsequently used without further purification. 1 H NMR:400MHz CDC13δ7.28-7.46(m,6H),7.18(d,1H),6.99(t,1H),5.11(s,2H),4.57(t,1H),4.09(q,2H),2.97-3.09(m,1H),2.81-2.93(m,1H),1.18(t,3H).
[0610]
[0611] STAB-H solid (8.85 g, 41.8 mmol) was added fractionally to a mixture of compound 26 (5.76 g, 18.2 mmol) and compound 27 (4.09 g, 23.6 mmol) in THF (40 mL) at 0 °C. After the final addition, the mixture was removed from the heat and stirred for approximately 2.5 hours until finished. The reaction mixture was quenched by adding a saturated aqueous sodium bicarbonate solution. The mixture was extracted three times with EtOAc. The combined organic phases were dried over brine, filtered through sodium sulfate, and concentrated. Compound 28 was separated on silica gel by gradient elution with ethyl acetate in hexane, yielding 73%. 1 H NMR:400MHz CDCl3δ7.30-7.49(m,5H),7.11(dd,1H),6.88-7.02(m,2H),5.13(s,2H),4.40(t,1H), 4.10(q,2H),4.00(dd,1H),3.35(s,3H),3.31(s,3H),2.47-2.75(m,4H),1.20(t,3H).
[0612]
[0613] Compound 19 (3.64 g, 8.99 mmol) and a solution of TEA (1.94 mmol, 13.9 mmol) in THF (6 mL) were added dropwise to a flame-dried flask at -10 °C to a solution of triphosgene (1.2 g, 4.04 mmol) in THF (24 mL). The reaction mixture was warmed to room temperature. After TLC indicated complete reaction, a further 3.3 mL of TEA (23.6 mmol) was added, followed by compound 28 (2.61 g, 13.7 mmol) as a solid. The heterogeneous mixture was heated at 50 °C for 2 hours with vigorous stirring. After completion, the reaction mixture was quenched with 1 volume of water and extracted three times with EtOAc. The combined organic phases were dried over brine, filtered through sodium sulfate, and concentrated. Compound 29 was given in 100% yield, and the crude extract was subsequently used without further purification.
[0614]
[0615] To compound 29 (5.59 g, 8.97 mmol) dissolved in THF (37 mL), water (0.8 mL) and H₂SO₄ (2 M, 8.07 mL, 16.2 mmol) were added, and the reaction mixture was stirred overnight at 28 °C. The following morning, the pH of the mixture was adjusted to 9 using sodium bicarbonate, and the mixture was extracted three times with DCM. The combined organic phases were dried over brine, filtered through sodium sulfate, and concentrated. Compound 30 was separated on silica gel by gradient elution with MeOH in DCM containing 1% TEA, yielding 82%.
[0616]
[0617] Compound 30 (4.13 g, 7.39 mmol) dissolved in EtOH (30 mL) was loaded. Palladium (10 wt%, 3.15 g, 2.96 mmol) and hydrogen gas were added to 50 psi. The mixture was stirred overnight at room temperature. The next day, the reaction was 64% complete. The reaction mixture was then... The mixture was filtered and concentrated. The residue was dissolved in EtOH and loaded with palladium (10 wt%, 1.57 g, 1.48 mmol) and hydrogen to 50 psi. After stirring for 48 hours, the reaction mixture was heated to 30 °C and stirred for another 24 hours. After completion, the suspension was... The mixture was filtered and all volatiles were removed under vacuum. The residue was purified on silica gel and eluted with a gradient of MeOH in DCM to produce compound 31 in 72% yield. 1H NMR:400MHz DMSO-d6δ9.88(s,1H),7.02-7.14(m,2H),6.86-6.93(m,2H),6.50-6.76(m,1H),6.31(d,1H),5.17(t,1H),4 .00(q,2H),3.23-3.28(m,4H),2.79-3.18(m,7H),2.61(t,2H),2.41(t,2H),1.65-1.78(m,4H),1.09(t,3H).
[0618]
[0619] A solution of DEAD was added dropwise to a solution of PPh3 (699 mg, 2.66 mmol) in THF (0.47 mL) at -10 °C. The mixture was warmed to room temperature and then added to a pure mixture of compound 31 (600 mg, 1.33 mmol) and HO-PEG4-N3 (466 mg, 3.06 mmol) and stirred overnight. The reaction mixture was then concentrated under reduced pressure, and the residue was purified on silica gel by gradient elution with MeOH in DCM to give compound 32 in 50% yield. 1 H NMR:400MHz DMSO-d6δ7.10-7.19(m,2H),6.97-7.06(m,2H),6.18-6.31(m,2H),5.20(t,1H),4.13-4.16(m,1H),3.98-4.04(m,2H),3.71-3.80(m,2H),3 .52-3.61(m,8H),3.38-3.37(m,5H),3.10-3.25(m,5H),2.79-3.08(m ,5H),2.59(t,2H),2.31-2.42(m,2H),1.65-1.75(m,4H),1.10(t,3H).
[0620]
[0621] To compound 32 (826 mg, 1.23 mmol), EtOH (3 mL) and H₂O (3 mL) were added, followed by LiOH (97 mg, 4.05 mmol). The mixture was stirred overnight at 30 °C. After the reaction, the mixture was neutralized to pH 5 using 6 M HCl aqueous solution and concentrated. The residue was purified by reversed-phase HPLC using a Phenomenex Gemini C18 column, 50 x 250 mm, 10 μm, with gradient elution of acetonitrile in water containing 0.1% TFA, yielding compound 33 (structure 2c) in 81% yield. 1HNMR:400MHz D2Oδ7.30(d,1H),7.01-7.19(m,3H),6.45(d,1H),5.24(t,1H),4.14-4.32(m,2H),3.84-3.92(m,2H),3.59-3.7 7(m,10H),3.14-3.45(m,8H),.02-3.12(m,1H),2.97(d,2H),2.85(q,1H),2.50-2.72(m,4H),1.68-1.94(m,4H).
[0622] Synthesis of structure 2.1c((S)-3-(4-((11-azidoundecyl)oxy)-3-fluorophenyl)-3-(2-oxo-3-(3-(5,6,7,8-tetrahydro-1,8-naphthidin-2-yl)propyl)imidazolidine-1-yl)propionic acid).
[0623]
[0624] A solution of DEAD was added dropwise to a solution of PPh3 in THF at room temperature. The mixture was then transferred to a container containing compound 31 and OH-(CH2). 11 The mixture of -N3 was bottled and the reaction mixture was stirred overnight at room temperature. Volatile substances were removed from the reaction mixture, and the crude product was dissolved in EtOH. A solution of LiOH in H2O was added, followed by additional water / EtOH until the reaction mixture became homogeneous. After stirring at room temperature for 1.5 hours, the mixture was acidified to pH 3 with H2SO4, concentrated, and purified by reversed-phase HPLC (Phenomenex Gemini C18, 50x250mm, 10μm, 0.1% TFA in acetonitrile / water, gradient elution).
[0625] Synthesis of structure 2.2c((S)-3-(4-(2-(1-(6-azidohexanoyl)piperidin-4-yl)ethoxy)-3-fluorophenyl)-3-(2-oxo-3-(3-(5,6,7,8-tetrahydro-1,8-naphthidin-2-yl)propyl)imidazolidine-1-yl)propionic acid).
[0626]
[0627] Compound 35, dissolved in DCM, was treated with EDAC at 0°C, and acetonitrile was added to aid dissolution. After 5 minutes, TEA and compound 36 were added, the mixture was removed from the heat source, cooled, and stirred for another 2 hours. Afterward, saturated ammonium chloride was added, the organic phase was separated, filtered through sodium sulfate, and concentrated. The resulting crude product was then used without further purification.
[0628]
[0629] A solution of DEAD was added dropwise to a solution of PPh3 in THF at room temperature with vigorous stirring. The mixture was transferred to a flask containing a mixture of compounds 31 and 37, and the reaction mixture was stirred overnight at room temperature. Volatiles were removed from the reaction mixture, and the crude product was dissolved in EtOH. A solution of LiOH in H2O was added, followed by additional water until the reaction mixture became homogeneous. After stirring at room temperature for 1.5 hours, the mixture was acidified to pH 3 with H2SO4, concentrated, and purified by reversed-phase HPLC (Phenomenex Gemini C18, 50x250mm, 10μm, 0.1% TFA in acetonitrile / water, gradient elution) to yield compound 38 (structure 2.2c).
[0630] Synthesis of structure 2.3c((S)-3-(4-(2-((1r,4S)-4-(5-azidopentanylamino)cyclohexyl)ethoxy)-3-fluorophenyl)-3-(2-oxo-3-(3-(5,6,7,8-tetrahydro-1,8-naphthidin-2-yl)propyl)imidazolidine-1-yl)propionic acid).
[0631]
[0632] A solution of EDAC in DCM was added to a suspension of compound 35 in DCM at 0°C. After 5 minutes, the mixture was removed from the heat and compound 39 was added, followed by TEA. The heterogeneous mixture was stirred overnight at room temperature. The next day, the reactants were diluted with DCM to dissolve the precipitate. The mixture was washed twice with 5% KHSO4 and once with brine. The organic phase was filtered through sodium sulfate and concentrated. The crude residue containing compound 40 was used without further purification.
[0633]
[0634] A solution of DEAD was added dropwise to a solution of PPh3 in THF at room temperature with vigorous stirring. The mixture was transferred to a flask containing a mixture of compounds 31 and 40, and the reaction mixture was stirred overnight at room temperature. Volatiles were removed from the reaction mixture, and the crude product was dissolved in EtOH. A solution of LiOH in H2O was added, followed by additional water until the reaction mixture became homogeneous. After stirring at room temperature for 1.5 hours, the mixture was acidified to pH 3 with H2SO4, concentrated, and purified by reversed-phase HPLC (Phenomenex Gemini C18, 50x250mm, 10μm, 0.1% TFA in acetonitrile / water, gradient elution) to yield compound 41 (structure 2.3c).
[0635] Synthesis of structure 2,4c((S)-3-(4-(4-(5-azidopentanylamino)phenethoxy)-3-fluorophenyl)-3-(2-oxo-3-(3-(5,6,7,8-tetrahydro-1,8-naphthidin-2-yl)propyl)imidazolidine-1-yl)propionic acid).
[0636]
[0637] EEDQ was added to a mixture of compounds 35 and 42 in DCM, and the solution was stirred overnight at room temperature. The reaction mixture was then diluted with DCM, washed three times with 1M HCl, and once with brine. The organic phase was dried over sodium sulfate, filtered, and concentrated. Compound 43 was then used without further purification.
[0638]
[0639] A solution of DEAD was added dropwise to a solution of PPh3 in THF at room temperature with vigorous stirring. The mixture was transferred to a flask containing a mixture of compounds 31 and 43, and the reaction mixture was stirred overnight at room temperature. Volatiles were removed from the reaction mixture, and the crude product was dissolved in EtOH. A solution of LiOH in H2O was added, followed by additional water until the reaction mixture became homogeneous. After stirring at room temperature for 1.5 hours, the mixture was acidified to pH 3 with H2SO4, concentrated, and purified by reversed-phase HPLC (Phenomenex Gemini C18, 50x250mm, 10μm, 0.1% TFA in acetonitrile / water, gradient elution) to yield compound 44 (structure 2.4c).
[0640] Synthesis of structure 2.5c((S)-3-(4-(4-((5-azidopentyl)oxy)phenethoxy)-3-fluorophenyl)-3-(2-oxo-3-(3-(5,6,7,8-tetrahydro-1,8-naphthidin-2-yl)propyl)imidazolidine-1-yl)propionic acid).
[0641]
[0642] Potassium carbonate was added to a solution of compounds 45 and 46 in acetone. The mixture was heated overnight in a sealed flask as a suspension under vigorous stirring under N2 protection to 65°C. The reactants were then filtered, concentrated, and purified on silica gel, eluted with a gradient of ethyl acetate in hexane to yield compound 47.
[0643]
[0644] Sodium azide was added to a solution of compound 47 in DMF, and the mixture was stirred overnight at 80°C under nitrogen protection in a sealed flask. After the reaction, 1 volume of water was added, and the product was extracted with ethyl acetate. The separated organic phase was filtered through sodium sulfate and concentrated. The crude extract of compound 48 was used without further purification.
[0645]
[0646] A solution of DEAD was added dropwise to a solution of PPh3 in THF at room temperature with vigorous stirring. The mixture was transferred to a flask containing a mixture of compounds 31 and 48, and the reaction mixture was stirred overnight at room temperature. Volatiles were removed from the reaction mixture, and the crude product was dissolved in EtOH. A solution of LiOH in H2O was added, followed by additional water until the reaction mixture became homogeneous. After stirring at room temperature for 1.5 hours, the mixture was acidified to pH 3 with H2SO4, concentrated, and purified by reversed-phase HPLC (Phenomenex Gemini C18, 50x250mm, 10μm, 0.1% TFA in acetonitrile / water, gradient elution) to yield compound 49 (structure 2.5c).
[0647] Synthesis of structure 2.6c((S)-3-(3-(3-(3-(17-azido-3-oxo-6,9,12,15-tetraoxa-2-azaheptadecyl)-5,6,7,8-tetrahydro-1,8-naphthidin-2-yl)propyl)-2-oxoimidazolidine-1-yl)-3-(3-fluoro-4-methoxyphenyl)propionic acid).
[0648]
[0649] A solution of DEAD was added dropwise to a solution of PPh3 in THF at 0°C. After complete addition, the mixture was transferred to a flask containing a pure mixture of compound 31 and MeOH. The flask was capped with N2 and stirred overnight at room temperature. After completion, all volatiles were removed, and the resulting crude product was purified on silica gel by gradient elution with MeOH in DCM to yield compound 50.
[0650]
[0651] Bromine was added to a solution of compound 50 in AcOH, and the mixture was stirred for 0.5 hours. Afterward, the reaction mixture was diluted with 5 volumes of ethyl acetate and 2.5 volumes of water. The aqueous layer was neutralized to pH 7 with a saturated sodium bicarbonate solution, and the organic phase was separated. The aqueous layer was extracted twice more with ethyl acetate. The combined organic phases were dried over sodium sulfate, filtered, and concentrated. The crude product of compound 51 was then used without further purification.
[0652]
[0653] The solution of compound 51, Pd(PPh3)4, and Zn(CN)2 in DMAC was degassed with nitrogen for 30 minutes. The mixture was heated overnight at 128°C in a sealed flask. After heating, the mixture was diluted with 5 volumes of EtOAc. The organic phase was separated, washed twice with water, and twice with brine. The organic phase was then filtered through sodium sulfate and concentrated. The residue was purified on silica gel and eluted with 100% EtOAc to yield compound 52.
[0654]
[0655] Ammonia was added to a solution of compound 52 in MeOH, followed by the addition of Lanny nickel slurry pre-washed three times with methanol. The flask was purged with hydrogen to 60 psi and stirred at room temperature for 16 hours. After the reaction, the suspension was filtered and concentrated. The resulting crude residue was redissolved in DMF. DIEA and NHS-PEG4-N3 were added, and the mixture was stirred for 1 hour. After the reaction, all volatiles were removed, and the crude residue was redissolved in a mixture of MeOH and THF. A solution of LiOH in H2O was added, and the mixture was stirred at room temperature for 17 hours. After the reaction, the pH was adjusted to 3 with TFA, and the mixture was directly injected into a semi-preparative reversed-phase HPLC (Phenomenex Gemini C18, 250x21.2 mm, 5 μm, 0.1% TFA in water / ACN, gradient elution) to produce compound 53 (structure 2.6c).
[0656] Synthesis of structures 2.7c ((S)-N-(2-(2-(2-(2-azidoethoxy)ethoxy)ethoxy)ethyl)-3-(3-fluoro-4-methoxyphenyl)-3-(2-oxo-3-(3-(5,6,7,8-tetrahydro-1,8-naphthidin-2-yl)propyl)imidazolidine-1-yl)propionamide), 2.8c, 2.9c, and 2.10c.
[0657]
[0658] A solution of THF, PPh3, and DEAD was added dropwise to compound 31 at 0°C. The mixture was stirred at room temperature for 16 hours. The mixture was then cooled to -20°C and held for 1 hour, followed by filtration to remove triphenylphosphine oxide. The filtrate was concentrated, and the O-alkylated intermediate was separated by purification on silica gel, eluting with a gradient of ethyl acetate in hexane containing 1% TEA. The separated intermediate was then suspended in a mixture of THF and H2O, treated with a solution of LiOH in H2O, and stirred at 35°C for 16 hours. After completion, the pH was adjusted to 7 with 2M HCl, and all volatiles were removed. The crude product was suspended in H2O; sodium chloride was added, and compound 54 was extracted five times with ethyl acetate. The organic phases were combined, filtered through sodium sulfate, and concentrated. Compound 54 was then used without further purification.
[0659]
[0660] The solution of compound 54 in DMF was treated with HBTU and stirred for 5 minutes. DIEA and N3-PEG3-NH2 were then added, and the mixture was stirred at room temperature for 16 hours. Afterward, the pH was adjusted to 3 with TFA, and compound 55 was separated by direct injection into a semi-preparative reversed-phase HPLC system (Phenomenex Gemini C18, 250x21.2 mm, 5 μm, 0.1% TFA in water / ACN, gradient elution) to yield compound 55.
[0661] Using N3-PEG respectively 11 -NH2, N3-PEG 23 -NH2 and N3-PEG 35 -NH2, compounds 2.8c, 2.9c and 2.10c were synthesized using a similar procedure.
[0662] Synthesis of structure 2.11c((R)-3-(4-(2-(2-(2-(2-azidoethoxy)ethoxy)ethoxy)ethoxy)-3-fluorophenyl)-3-(2-oxo-3-(3-(5,6,7,8-tetrahydro-1,8-naphthidin-2-yl)propyl)imidazolidine-1-yl)propionic acid).
[0663]
[0664] In a 3-L 4-necked round-bottom flask purified and maintained under a nitrogen inert atmosphere, 1.50 L of THF, 150.00 mL of DIPEA (716.000 mmol, 0.88 equivalents), and 430.00 mL of n-BuLi (680.000 mmol, 0.84 equivalents) were added. Trimethyl phosphite (195.00 mL) was then added at -60 °C and the mixture was stirred at -60 °C for 1 h. Tert-butyl 2-oxopyrrolidine-1-carboxylate (150.00 g, 809.835 mmol, 1.00 equivalents) was added at -60 °C. The resulting solution was stirred at -60 °C for 1 h in a liquid nitrogen bath. The reaction mixture was then quenched by adding 350 mL of H₂SO₄ (2N) and diluted with 1.5 L of H₂O. The resulting solution was extracted with 2 x 1 L of ethyl acetate. The resulting mixture was washed with 1 x 1 L H₂O, dried over anhydrous sodium sulfate, and concentrated under vacuum. This yielded 200 g (crude) of N-[5-(dimethoxyphosphoryl)-4-oxopentyl]carbamate tert-butyl ester as a yellow oil.
[0665]
[0666] In a 3-L round-bottom flask, N-[5-(dimethoxyphosphoryl)-4-oxopentyl]tert-butyl carbamate (200.00 g, 1500.00 mmol, 1.50 equivalent), MeOH (1.50 L), 2-aminopyridine-3-carboxaldehyde (53.00 g, 1000.00 mmol, 1.00 equivalent), and NaOH (50.00 g, 1500.00 mmol, 1.50 equivalent) were added. The resulting solution was stirred in an oil bath at 50 °C for 16 h. The pH of the solution was adjusted to 8 with NaHCO3 (aqueous solution). The resulting mixture was concentrated. The reaction mixture was then quenched by adding 1.5 L of water and extracted with 2 x 1.5 L of ethyl acetate. The combined organic layers were dried over anhydrous sodium sulfate and concentrated under vacuum. This produces 160g (crude) of N-[3-(1,8-naphthid-2-yl)propyl]carbamate tert-butyl ester as a yellow oil.
[0667]
[0668] In a 5-L round-bottom flask, N-[3-(1,8-naphthid-2-yl)propyl]tert-butyl carbamate (160.00 g, 556.787 mmol, 1.00 equivalent), MeOH (2.00 L), Rh / C (140.00 g, 1.360 mmol), and H2 (40 Psi) were added. The resulting solution was stirred at 25 °C for 16 h. The solid was filtered off. The resulting mixture was concentrated. This yielded 106 g (65.33%) of N-[3-(5,6,7,8-tetrahydro-1,8-naphthid-2-yl)propyl]tert-butyl carbamate as a yellow solid.
[0669]
[0670] In a 1-L round-bottom flask, N-[3-(5,6,7,8-tetrahydro-1,8-naphthid-2-yl)propyl]carbamate tert-butyl ester (106.00 g, 363.767 mmol, 1.00 equivalent), EtOAc (500.00 mL), and a solution of HCl in EtOAc (4 M, 400.00 mL) were placed. The resulting solution was stirred at 25 °C for 3 h. The resulting solution was diluted with 1 L H₂O. The pH was adjusted to 11 using NaOH (aqueous solution). The resulting solution was extracted with 2 x 1 L ethyl acetate. The combined organic layers were dried over anhydrous sodium sulfate and concentrated under vacuum. This yielded 56 g (80.48%) of 3-(5,6,7,8-tetrahydro-1,8-naphthid-2-yl)propane-1-amine as a yellow solid.
[0671]
[0672] In a 2-L round-bottom flask, 140.00 g of 3-fluoro-4-hydroxybenzaldehyde (999.194 mmol, 1.00 equivalent), 1000 mL of ACN, 205.08 g of (bromomethyl)benzene (1199.039 mmol, 1.20 equivalent), and 414.28 g of K₂CO₃ (2997.581 mmol, 3.00 equivalent) were added. The resulting solution was stirred at 25 °C for 16 h. The solid was filtered off. The resulting mixture was concentrated. This yielded 230 g (99.98%) of 4-(benzyloxy)-3-fluorobenzaldehyde as a white solid.
[0673]
[0674] In a 3-L round-bottom flask, 230.00 g of 4-(benzyloxy)-3-fluorobenzaldehyde (998.966 mmol, 1.00 equivalent), 1600 mL of DCM, 145.29 g of (S)-2-methylpropane-2-sulfinamide (1198.762 mmol, 1.20 equivalent), and 650.97 g of Cs₂CO₃ (650.97 g, 1997.933 mmol, 2.00 equivalent) were added. The resulting solution was stirred in an oil bath at 50 °C for 6 h. The solid was filtered off. The resulting mixture was concentrated. This yielded 260 g (78.06%) of (S)-N-[[4-(benzyloxy)-3-fluorophenyl]methylene]-2-methylpropane-2-sulfinamide as a white solid.
[0675]
[0676] In a 3-L round-bottom flask purified and maintained under a nitrogen inert atmosphere, add 2.0L of THF, 1.02kg of Zn (15595.945mmol, 20.00 equivalents), 115.80g of CuCl (1169.696mmol, 1.50 equivalents), 325.57g of ethyl 2-bromoacetate (325.57g, 1949.498mmol, 2.50 equivalents), and (S)-N-[[4-(benzyloxy)-3-fluorophenyl]methylene]-2-methylpropane-2-sulfinamide (260.00g, 779.797mmol, 1.00 equivalents). Stir the resulting solution at 0°C for 30 min in a water / ice bath. Allow the solution to react for another 2 h with stirring while maintaining the temperature at 50°C in an oil bath. Filter off the solids. Concentrate the resulting mixture. Then quench the reaction mixture with 2L of water and extract with 2x2L of ethyl acetate. The combined organic layers were dried over anhydrous sodium sulfate and concentrated under vacuum. This yielded 150 g (45.63%) of ethyl (3R)-3-[4-(benzyloxy)-3-fluorophenyl]-3-[[(S)-2-methylpropane-2-sulfinyl]amino]propionate as a yellow oil.
[0677]
[0678] In a 1-L round-bottom flask, ethyl (3R)-3-[4-(benzyloxy)-3-fluorophenyl]-3-[[(S)-2-methylpropane-2-sulfinyl]amino]propionate (150.00 g, 355.847 mmol, 1.00 equivalent) and a solution of HCl in 1,4-dioxane (400.00 mL, 4 M) were placed. The resulting solution was stirred at 25 °C for 2 h. The resulting mixture was concentrated. The reaction mixture was then quenched by adding 1 L of water. The pH was adjusted to 8 using NaHCO3 (aqueous solution). The resulting solution was extracted with 2 x 1 L of ethyl acetate, dried over anhydrous sodium sulfate, and concentrated. This yielded 100 g (88.55%) of ethyl (3R)-3-amino-3-[4-(benzyloxy)-3-fluorophenyl]propionate as a yellow oil.
[0679]
[0680] In a 2-L round-bottom flask, ethyl (3R)-3-amino-3-[4-(benzyloxy)-3-fluorophenyl]propionate (100.00 g, 315.100 mmol, 1.00 equivalent), THF (1.00 L), 2,2-dimethoxyacetaldehyde (49.21 g, 472.696 mmol, 1.50 equivalent), and NaBH(OAc)3 (133.57 g, 630.199 mmol, 2.00 equivalent) were added. The resulting solution was stirred at 25 °C for 2 h. The reaction mixture was then quenched by adding 1 L of water. The resulting solution was extracted with 2 x 1 L of ethyl acetate, dried over Na2SO4, and concentrated under vacuum. This yielded 80 g (62.62%) of ethyl (3R)-3-[4-(benzyloxy)-3-fluorophenyl]-3-[(2,2-dimethoxyethyl)amino]propionate as a yellow oil.
[0681]
[0682] In a 2-L 3-necked round-bottom flask, triphosgene (22.25 g, 74.975 mmol, 0.38 equivalents), THF (500 mL), ethyl (3R)-3-[4-(benzyloxy)-3-fluorophenyl]-3-[(2,2-dimethoxyethyl)amino]propionate (80.00 g, 197.304 mmol, 1.00 equivalents), TEA (29.95 g, 295.956 mmol, 1.50 equivalents), and 3-(5,6,7,8-tetrahydro-1,8-naphthid-2-yl)propane-1-amine (compound 177, 33.97 g, 177.573 mmol, 0.90 equivalents) were added. The resulting solution was stirred in an oil bath at 50 °C for 1 h. The reaction mixture was then quenched by adding 1 L of water. The pH was adjusted to 8 using NaHCO3 (aqueous solution). The resulting solution was extracted with 2 x 1 L of ethyl acetate, dried over anhydrous sodium sulfate, and concentrated. This yielded 96 g (78.13%) of (3R)-3-[4-(benzyloxy)-3-fluorophenyl]-3-[(2,2-dimethoxyethyl)([[3-(5,6,7,8-tetrahydro-1,8-naphthid-2-yl)propyl]carbamoyl])amino]propionate as a yellow crude oil.
[0683]
[0684] In a 1000-mL round-bottom flask, place ethyl (3R)-3-[4-(benzyloxy)-3-fluorophenyl]-3-[(2,2-dimethoxyethyl)([[3-(5,6,7,8-tetrahydro-1,8-naphthid-2-yl)propyl]carbamoyl])amino]propionate (96.00 g, 154.158 mmol, 1.00 equivalent), THF (500.00 mL), and H₂SO₄ (180.00 mL, 2 M). Stir the resulting solution at 25 °C for 16 h. Adjust the pH to 8 using NaOH (5 M). Extract the resulting solution with 2 x 1 L of dichloromethane, dry to anhydrous sodium sulfate, and concentrate. Apply the residue to a silica gel column with dichloromethane / methanol (50 / 1). Combine the collected fractions and concentrate. This yields 73g (84.76%) of (3R)-3-[4-(benzyloxy)-3-fluorophenyl]-3-[2-oxo-3-[3-(5,6,7,8-tetrahydro-1,8-naphthidin-2-yl)propyl]-2,3-dihydro-1H-imidazol-1-yl]propionate as a yellow oil.
[0685]
[0686] In a 3-L round-bottom flask, place ethyl (3R)-3-[4-(benzyloxy)-3-fluorophenyl]-3-[2-oxo-3-[3-(5,6,7,8-tetrahydro-1,8-naphthidin-2-yl)propyl]-2,3-dihydro-1H-imidazol-1-yl]propionate (73.00 g, 130.671 mmol, 1.00 equivalent), EtOH (1.50 L), Pd(OH)₂ / C (60.00 g, 427.259 mmol, 3.27 equivalent), and H₂ (50 atm). Stir the resulting solution at 25 °C for 72 h. Filter off the solids. Apply the residue to a silica gel column with dichloromethane / methanol (9 / 1). Combine the collected fractions and concentrate. This yields 41.0415 g (66.75%) of (3R)-3-(3-fluoro-4-hydroxyphenyl)-3-[2-oxo-3-[3-(5,6,7,8-tetrahydro-1,8-naphthidin-2-yl)propyl]imidazolidine-1-yl]propionate as a yellow oil.
[0687] LCMS-PH-ARP-052-0:[MS+1]+=471
[0688] Optical rotation [a] D 20.0 = +37.5° (C = 1g / 100ml in MeOH)
[0689] H-NMR: (300MHz, DMSO-d6, ppm) δ9.84(s,1H),7.07-7.00(m,2H),6.95-6.850(m,2H),6.24(d,2H),5.18( t,1H),4.06-3.96(m,2H),3.32-2.75(m,10H),2.60(t,2H),2.37(t,2H),1.77-1.67(m,4H),1.10(t,3H).
[0690]
[0691] A solution of DEAD was added dropwise to a solution of PPh3 in THF at -10°C. The mixture was warmed to room temperature and a pure mixture of compound 185 and HO-PEG4-N3 was added, and the mixture was stirred overnight. The reaction mixture was then concentrated under reduced pressure, and the residue was purified on silica gel by gradient elution with MeOH in DCM to yield compound 186.
[0692]
[0693] EtOH and H₂O were added to compound 186, followed by LiOH. The mixture was stirred overnight at 30°C. After the reaction, the mixture was neutralized to pH 5 with 6M HCl aqueous solution and concentrated. The residue was purified by reversed-phase HPLC using a Phenomenex Gemini C18 column (50x250 mm, 10 μm) with gradient elution of acetonitrile in water containing 0.1% TFA to yield compound 187 (structure 2.11c).
[0694] Synthesis of structures 28c (compound 118a), 29c (compound 118b), 31c (compound 119a), and 30c (compound 119b).
[0695]
[0696] Compound 103 (2-methyl-[1,8]naphthidine (12.5 g, 86.7 mmol)) in THF (180 mL) was added dropwise to a solution of LHMDS (1.0 M in THF, 95 mL, 95 mmol) and THF (60 mL). After stirring for 30 minutes, a solution of compound 104 (5-bromo-1-pentene (19.4 g, 130 mmol)) in THF (120 mL) was added dropwise to the reaction mixture. The reaction mixture was warmed to 0 °C and stirred for 4 hours. The reaction mixture was quenched with saturated NH4Cl aqueous solution (100 mL) and deionized water (100 mL), and then extracted with ethyl acetate (2 x 400 mL). The combined organic phases were dried over Na2SO4, filtered, concentrated, and compound 105 was extracted. Separation was performed by gradient elution with 50-100% ethyl acetate in hexane. Yield of compound 105: 7.93 g (43%).
[0697]
[0698] To a solution of compound 105 (2.50 g, 11.8 mmol) in acetone (67.5 mL), water (7.5 mL), and 2,6-dimethylpyridine (2.74 mL, 23.6 mmol), 4-methylmorpholine N-oxide (2.07 g, 17.7 mmol) and osmium tetroxide (2.5 wt% in tert-butanol, 2.40 g, 0.24 mmol) were added at room temperature. After stirring for 75 minutes, (diacetoxyiodo)benzene (5.69 g, 17.7 mmol) was added to the reaction mixture. The reaction mixture was stirred for 2 hours, then quenched with a saturated aqueous solution of sodium thiosulfate (100 mL) and extracted with ethyl acetate (2 x 100 mL). The combined organic phases were dried over Na₂SO₄, filtered, concentrated, and compound 106 was extracted using... Separation was performed by gradient elution with 0-5% methanol in ethyl acetate. Yield of compound 106: 1.12 g (44%).
[0699]
[0700] A solution of compound 107 ((N-methoxy-N-methylcarbamoylmethyl)phosphonate diethyl ester) (1.06 g, 4.43 mmol) in THF (9 mL) was added to a suspension of sodium hydride (60% dispersion in mineral oil, 0.185 g, 4.64 mmol) in THF (9 mL) at 0 °C. After stirring for 30 min, a solution of compound 106 (0.903 g, 4.21 mmol) in THF (9 mL) was added dropwise. The reaction mixture was stirred at 0 °C for 10 min, then quenched with saturated NH4Cl aqueous solution (30 mL) and extracted with ethyl acetate (3 x 30 mL). The combined organic phases were washed twice with semi-saturated NaHCO3 aqueous solution. The organic phases were dried over Na2SO4, filtered, and concentrated. Yield of compound 108: 1.40 g (assuming 100% yield and no further purification for use in subsequent steps).
[0701]
[0702] Pd / C (10% loaded, 0.466 g, 0.44 mmol) was added to a solution of compound 108 (1.31 g, 4.38 mmol) in ethyl acetate (20 mL). The reaction vessel was pressurized to 50 PSI with H2. After stirring for 3.5 hours, the reaction mixture was transferred to… Filter the solution and wash with methanol. Concentrate the filtrate and pass compound 109 through... Separation was performed by gradient elution of 50-100% ethyl acetate in hexane containing 1% triethylamine. Yield of compound 109: 0.833 g (62%).
[0703]
[0704] To a solution of compound 109 (0.833 g, 2.73 mmol) in THF (10 mL), DIEA (0.590 mL, 3.41 mmol) and di-tert-butyl dicarbonate (0.744 g, 3.41 mmol) were added. The reaction mixture was heated to 50 °C and maintained for 5 hours. Based on LC / MS, the reaction was incomplete, and a further portion of DIEA (0.590 mL, 3.41 mmol) and di-tert-butyl dicarbonate (0.744 g, 3.41 mmol) were added. The reaction mixture was heated at 50 °C for an additional 16 hours. The reaction mixture was concentrated and analyzed by... Compound 110 was isolated by gradient elution with 50-100% ethyl acetate in hexane. Yield of compound 110: 0.934 g (84%).
[0705]
[0706] A solution of compound 111 (5-bromo-2-(phenylmethoxy)-pyridine) (0.465 g, 1.8 mmol) in THF (0.8 mL) was added dropwise to a solution of n-butyllithium (2.5 M in hexane, 0.70 mL, 1.8 mmol) and THF (1.5 mL) over a period of 3 minutes at -78 °C. Then, a solution of compound 110 (0.535 g, 1.3 mmol) in THF (1 mL) was added. After stirring for 30 minutes, the reaction mixture was heated to 0 °C, quenched with saturated NH4Cl aqueous solution (10 mL), and further acidified to pH 7 with 6 M HCl aqueous solution. The mixture was extracted with ethyl acetate (3 x 10 mL). The combined organic phases were dried over Na2SO4, filtered, and concentrated. DIEA (0.94 mL, 5.4 mmol) and di-tert-butyl dicarbonate (1.18 g, 5.4 mmol) were added to a solution of the crude product in THF (8 mL). Stir the mixture overnight at 40°C. Concentrate the reaction mixture and... Compound 112 was isolated by gradient elution with 0-40% ethyl acetate in hexane. Yield of compound 112: 471 mg (50%).
[0707]
[0708] A solution of compound 113 (triethyl phosphonoacetate) (0.593 g, 2.65 mmol) in dimethoxyethane (1 mL) was added to a suspension of sodium hydride (60% dispersion in mineral oil, 0.106 g, 2.65 mmol) in dimethoxyethane (2 mL) at 0 °C. After stirring for 20 min, the reaction mixture was warmed to room temperature, and a solution of compound 112 (0.467 g, 0.88 mmol) in dimethoxyethane (2 mL) was added. The reaction mixture was heated at 70 °C for 4 h. The reaction was quenched with saturated NH4Cl aqueous solution (10 mL), and the product was extracted with ethyl acetate (3 x 15 mL). The organic phase was dried over Na2SO4, filtered, concentrated, and compound 114 was extracted with ethyl acetate. Separated as a 1:1 mixture of cis:trans isomers, eluted with a gradient of 0-30% ethyl acetate in hexane. Yield of compound 114: 392 mg (74%).
[0709]
[0710] Pd / C (10% loading, 69 mg, 0.07 mmol) was added to a solution of compound 114 (390 mg, 0.65 mmol) in ethanol (6 mL). The reaction vessel was pressurized to 50 PSI with H2. After stirring for 4 hours, the reaction mixture was transferred to… Filter and wash with methanol. Concentrate the filtrate and pass compound 115 through... The mixture was separated into racemic fractions and eluted with a gradient of 0-10% methanol in DCM. The yield of compound 115 was 95 mg (29%). Chiral semi-preparative HPLC (250 x 21 mm) was used. (AD column, 5 μm, 90 / 10 hexane / EtOH, 40 mL / min) separated 42 mg of the first eluted R-isomer (R... T =12-14m, >99% ee, compound 115a) and 40 mg of the second eluted S-isomer (R T =15-18m, >98% ee, compound 115b). Based on the elution sequence of structurally similar compounds reported by Coleman et al. 47 J. Med. Chem. 4834 (2004), the identities of the R- and S-isomers were assigned.
[0711] Structure 28c((R)-3-(6-(2-(2-(2-(2-azidoethoxy)ethoxy)ethoxy)ethoxy)pyridine- 3-yl)-9-(5,6,7,8-tetrahydro-1,8-naphthid-2-yl)nonanoic acid) and 31c((R)-3-(1-(2-(2-(2-(2-azidoethyl) (Oxy)ethoxy)ethoxy)ethyl)-6-oxo-1,6-dihydropyridin-3-yl)-9-(5,6,7,8-tetrahydro-1,8-naphthyl- 2-yl)nonanoic acid)
[0712]
[0713] Cesium carbonate (53 mg, 0.16 mmol) was added to a solution of compound 115a (41 mg, 0.08 mmol) and N3-PEG4-OTs (61 mg, 0.16 mmol) in DMF (0.5 mL). The reaction mixture was stirred at 40 °C for 1 hour. The reaction mixture was quenched with an aqueous solution of NaHCO3 (1 mL) and then extracted with ethyl acetate (3 x 3 mL). The organic phase was concentrated under reduced pressure. The crude mixture of the N- and O-alkylated positional isomers was then used without further purification.
[0714]
[0715] Lithium hydroxide (6 mg, 0.25 mmol) was added to a solution of compounds 116a and 117a (58 mg, 0.08 mmol, a 4:6 mixture of 9a:10a) in THF (1.0 mL) and deionized water (1.0 mL). The reaction mixture was stirred at room temperature for 1 hour, and then at 35 °C for 2 hours. Another portion of lithium hydroxide (4 mg, 0.16 mmol) was added, and the reaction temperature was raised to 40 °C. After stirring for 3 hours, the final portion of lithium hydroxide (4 mg, 0.25 mmol, total 16 mg, 0.66 mmol) was added. The reaction mixture was stirred at 50 °C for 3 hours. The reaction mixture was acidified to pH 7 with 6N HCl aqueous solution and concentrated under reduced pressure. The positional isomers 118a and 119a were separated by gradient elution with 0–5% methanol in DCM containing 0.5% acetic acid. Compound 118a was then subjected to reversed-phase HPLC (Thermo Scientific). TM Aquasil TM C18, 250x21.2mm, 5μm, 20mL / min, 0.1% TFA in water / ACN, gradient elution) further purified to yield 13 mg of compound 118a (structure 28c). Compound 119a was purified under the same conditions to yield 16 mg of compound 119a (structure 31c).
[0716] Structure 29c((S)-3-(6-(2-(2-(2-(2-azidoethoxy)ethoxy)ethoxy)ethoxy)pyridine- 3-yl)-9-(5,6,7,8-tetrahydro-1,8-naphthid-2-yl)nonanoic acid) and 30c((S)-3-(1-(2-(2-(2-(2-azidoethyl) (Oxy)ethoxy)ethoxy)ethyl)-6-oxo-1,6-dihydropyridin-3-yl)-9-(5,6,7,8-tetrahydro-1,8-naphthyl- 2-yl)nonanoic acid)
[0717]
[0718] Cesium carbonate (51 mg, 0.16 mmol) was added to a solution of compound 115b (40 mg, 0.08 mmol) and N3-PEG4-OTs (58 mg, 0.16 mmol) in DMF (0.5 mL). The reaction mixture was stirred at 40 °C for 30 min. The reaction mixture was quenched with an aqueous solution of NaHCO3 (1 mL) and then extracted with ethyl acetate (3 x 3 mL). The organic phase was concentrated under reduced pressure. The crude mixture of the N- and O-alkylated positional isomers was then used without further purification.
[0719]
[0720] Lithium hydroxide (6 mg, 0.25 mmol) was added to a solution of compounds 116b and 117b (56 mg, 0.08 mmol, a 4:6 mixture of 9a:10a) in THF (0.75 mL) and deionized water (0.75 mL). The reaction mixture was stirred at 45 °C for 2.5 h. Another portion of lithium hydroxide (6 mg, 0.25 mmol) was added and the reaction mixture was stirred for 2.5 h. The reaction temperature was lowered to 35 °C and the mixture was stirred overnight. The reaction mixture was acidified to pH 7 with 6N HCl aqueous solution and concentrated under reduced pressure. The positional isomers 118b and 119b were separated by CombiFlash elution using a gradient of 0–5% methanol in DCM containing 0.5% acetic acid. Compound 118b was separated by reversed-phase HPLC (Thermo Scientific). TM Aquasil TM C18, 250x21.2mm, 5μm, 20mL / min, 0.1% TFA in water / ACN, gradient elution) further purified to yield 14 mg of compound 118b (structure 29c). Compound 119b was purified under the same conditions to yield 18 mg of compound 119b (structure 30c).
[0721] Synthesis of structure 32c((R)-3-(4-(2-(2-(2-azidoethoxy)ethoxy)ethoxy)-3-fluorophenyl)-3-(N-methyl-5-(5,6,7,8-tetrahydro-1,8-naphthidin-2-yl)pentanoylamino)propionic acid)
[0722]
[0723] To pass Compound 120 (2.75 g, 11.94 mmol) was sieved into a solution of toluene (80 mL) and compound 121 (5.79 g, 47.78 mmol) was added, followed by PPTS (300 mg, 1.19 mmol), and then AcOH (683 μL, 11.94 mmol). The reaction mixture was refluxed overnight. After completion, the reaction was quenched by adding saturated sodium bicarbonate. The organic layer was diluted with 2 volumes of ethyl acetate, separated, and filtered through sodium sulfate. The product was separated on silica gel and eluted with a gradient of ethyl acetate (0–30%) in hexane, yielding 2.054 g (54%).
[0724]
[0725] A 2.5 M n-BuLi solution (7.76 mL, 19.41 mmol) was added dropwise to a solution of DIA (2.85 mL, 20.33 mmol) in THF (15 mL) at -78 °C. Stirring was continued at -78 °C for 5 minutes, and ethyl acetate (1.81 mL, 18.48 mmol) was added dropwise. Stirring was continued at -78 °C for another 10 minutes, and a solution of triisopropyl titanium chloride (9.27 mL, 38.381 mmol) in THF (10 mL) was added dropwise. Stirring was continued at -78 °C for another 15 minutes, and a solution of compound 122 (2.054 g, 6.16 mmol) in THF (10 mL) was added dropwise. Stirring was continued at -78 °C for 1.5 hours. At the end of the reaction, the reaction was quenched by adding saturated ammonium bicarbonate. The suspension was diluted with 6 volumes of ethyl acetate, the organic layer was separated, dried over sodium sulfate, filtered, and concentrated. The product was separated on silica gel and eluted with a gradient of ethyl acetate in hexane to produce 1.043 g (53%).
[0726]
[0727] A solution of 4M HCl in dioxane (3.09 mL, 12.37 mmol) was added to a stirred solution of compound 123 (1.043 g, 2.47 mmol) in MeOH (3 mL). After complete deprotection, the solution was diluted with water (8 mL) and washed twice with diethyl ether (6 mL). The aqueous layer was then adjusted to pH 11 with sodium hydroxide. The precipitate was extracted with ethyl acetate, and the combined organic extracts were dried over sodium sulfate, filtered, and concentrated to yield 0.616 g (78.5%) of product 124, which was used without further purification.
[0728]
[0729] DCC (68.1 mg, 0.331 mmol) was added to a solution of compound 125 (92.1 mg, 0.275 mmol) in THF (1.5 mL) at 0 °C. After 5 minutes, PNP (106.1 mg, 0.331 mmol) was added, the ice bath was removed, and stirring was continued for 1 hour. After completion, the suspension was cooled to -20 °C and held for 1 hour, and the precipitate was removed by filtration. The supernatant was concentrated to yield 129 mg (103%) of crude product 126, which was then used without further purification.
[0730]
[0731] A mixture containing compound 124 (148.6 mg, 0.468 mmol) and potassium carbonate (129 mg, 0.937 mmol) in DMF (2 mL) was treated with iodomethane (66.5 mg, 0.468 mmol) and stirred at 50 °C for 3 hours. After alkylation, all volatiles were removed, and the product was separated on silica gel by gradient elution with ethyl acetate in hexane, each buffered with 1% TEA, yielding 94.6 mg (61%).
[0732]
[0733] To a solution of compound 127 (94.5 mg, 0.285 mmol) in DMF (2 mL), DIEA (149 μL, 0.856 mmol) was added, followed by compound 126 (129.9 mg, 0.285 mmol), and the mixture was stirred at 80 °C for 1 hour. Afterward, all volatiles were removed, and the crude product was dissolved in MeOH, treated with 10% palladium on carbon (20 mg), and the flask was purged with 60 PSI of hydrogen. Afterward, the suspension was filtered. The supernatant was concentrated, and the resulting crude product was then used without further purification.
[0734]
[0735] A mixture containing compound 128 (159 mg, 0.285 mmol), bromo-PEG2-azide compound (74.7 mg, 0.314 mmol), and cesium carbonate (204 mg, 0.627 mmol) in DMF (2 mL) was heated to 60 °C and held for 2 hours. Afterward, all volatiles were removed, and the crude product was treated with a solution of 4 M HCl in dioxane (0.5 mL, 2 mmol) and heated to 40 °C for 3 hours. Afterward, all volatiles were removed. The crude product was suspended in a mixture of THF (1 mL), MeOH (1.5 mL), and H2O (1.5 mL), treated with lithium hydroxide (83.5 mg, 3.48 mmol), and heated to 40 °C for 16 hours. Afterward, the pH was adjusted to 3 with TFA, and the product was passed through… Separation was performed on a C18 column (21.2 x 250 mm, 5 μm) and eluted with acetonitrile in water containing 0.1% TFA using a gradient to produce 33.1 mg (20%).
[0736] Synthesis of structure 33c ((R)-1-azido-13-(3-fluoro-4-methoxyphenyl)-12-(5-(5,6,7,8-tetrahydro-1,8-naphthidin-2-yl)pentanoyl)-3,6,9-trioxa-12-azapentadecan-15-acid)
[0737]
[0738] A mixture containing compound 130 (1.5 g, 9.73 mmol) in toluene (45 mL), (R) tert-butylsulfinamide (2.36 g, 19.46 mmol), and AcOH (0.14 mL) was refluxed in a flask equipped with a Dean-Stark separator for 16 hours. Afterward, the reaction was quenched by adding saturated sodium bicarbonate. The organic layer was separated, dried over sodium sulfate, filtered, and concentrated. The product was separated on silica gel by gradient elution with ethyl acetate in hexane, yielding 1.714 g (68.4%).
[0739]
[0740] A 2.5 M n-BuLi solution (8.324 mL, 20.81 mmol) was added dropwise to a solution of DIA (3.056 mL, 21.80 mmol) in 18 mL of THF at -78 °C. Stirring was continued at -78 °C for 5 minutes, and ethyl acetate (1.94 mL, 19.82 mmol) was added dropwise. Stirring was continued at -78 °C for another 10 minutes, and a solution of triisopropyl titanium chloride (9.94 mL, 41.62 mmol) in 10 mL of THF was added dropwise. Stirring was continued at -78 °C for another 15 minutes, and a solution of compound 131 (1.70 g, 6.61 mmol) in 12 mL of THF was added dropwise. Stirring was continued at -78 °C for 1.5 hours. At the end of the reaction, the reaction was quenched by adding saturated ammonium bicarbonate. The suspension was diluted with 7 volumes of ethyl acetate, the organic layer was separated, dried over sodium sulfate, filtered, and concentrated. The product was separated on silica gel and eluted with a gradient of ethyl acetate in hexane to produce 0.984 g (43%).
[0741]
[0742] To a solution of compound 132 (0.975 g, 2.82 mmol) in EtOH (6 mL), 4 M HCl (2.12 mL, 8.47 mmol) in dioxane was added and the mixture was stirred for 30 minutes at 0 °C. Afterward, the reaction mixture was diluted with water (15 mL) and washed with diethyl ether. The organic layer was separated, and the pH of the aqueous layer was adjusted to 12 with sodium hydroxide. The aqueous layer was washed with 5 volumes of ethyl acetate, and the organic layer was separated, filtered through sodium sulfate, and concentrated. The product was separated by silica gel elution using a gradient elution of ethyl acetate in hexane containing 1% TEA to yield 0.434 g (64%).
[0743]
[0744] To pass A mixture of compound 133 (0.120 g, 0.497 mmol) and PEG (0.151 g, 0.696 mmol) in THF (2 mL) was added to STAB-H (0.253 g, 1.19 mmol), and the suspension was stirred at room temperature for 16 hours. Afterward, the reaction was quenched by adding saturated sodium bicarbonate, and the crude extract was extracted with three fractions of ethyl acetate. The separated organic extracts were combined, dried over sodium sulfate, filtered, and concentrated. The resulting crude extract was then used without further purification.
[0745]
[0746] Compound 134 (0.200 g, 0.597 mmol) in DMF (2 mL) was treated with HATU (0.227 g, 0.597 mmol) and stirred for 5 minutes. DIEA (0.259 mL, 1.49 mmol) was added to the activated ester, followed by compound 125 (0.220 g, 0.497 mmol) in DMF (1 mL), and the resulting mixture was stirred for 1 hour. All volatiles were removed, and the resulting crude product was treated with pure TFA (3.8 mL) and stirred at 40 °C for 3 hours. After BOC removal, all volatiles were removed, and the crude product was suspended in a mixture of THF (4 mL), water (8 mL), and MeOH (8 mL). The resulting mixture was treated with LiOH (71.6 mg, 2.98 mmol) and heated to 40 °C for 16 hours. After this, the pH was adjusted to 3 with TFA, and the product was passed through… Separation was performed on a C18 column (21.2 x 250 mm, 5 μm) and eluted with acetonitrile in water containing 0.1% TFA using a gradient to produce 56.2 mg (18%, 3-step).
[0747] Synthesis of structure 34c ((S)-1-azido-13-(3-fluoro-4-methoxyphenyl)-12-(5-(5,6,7,8-tetrahydro-1,8-naphthidin-2-yl)pentyl)-3,6,9-trioxa-12-azapentadecan-15-acid)
[0748]
[0749] Compound 136 (0.500 g, 1.45 mmol) in a mixture of THF (9.0 mL) and MeOH (0.5 mL) was treated with lithium borohydride (94.5 mg, 4.34 mmol) at 0 °C. The mixture was removed, cooled, and stirred until gas formation ceased. The reaction mixture was diluted with 5 volumes of EtOAc. The organic layer was washed with ammonium bicarbonate, dried over sodium sulfate, filtered, and concentrated. The product was separated by elution on silica gel using a gradient of ethyl acetate in hexane, yielding 309 mg (67%).
[0750]
[0751] Martin's reagent, fractionated into several portions, was added to a solution containing compound 137 (0.305 g, 0.952 mmol) in DCM (9 mL) at 0 °C. A few drops of water were added, the mixture was removed from the heat, and the reaction mixture was stirred for 3 hours. After the reaction was complete, the mixture was washed with saturated sodium bicarbonate, followed by saturated sodium thiosulfate. The separated organic layer was dried over sodium sulfate, filtered, and concentrated. Product 138 was separated on silica gel and eluted with a gradient of MeOH in DCM, yielding 140 mg (46%).
[0752]
[0753] To pass A mixture of molecular sieves containing compound 1 (85.2 mg, 0.353 mmol) and 138 (134.9 mg, 0.424 mmol) in THF (2.5 mL) was supplemented with STAB-H (0.150 g, 0.706 mmol), and the resulting suspension was heated to 40 °C and maintained for 16 hours. Afterward, the reaction mixture was diluted with 5 volumes of ethyl acetate and treated with saturated sodium bicarbonate. The organic layer was separated, dried over sodium sulfate, filtered, and concentrated. The product was separated on silica gel by gradient elution with MeOH in DCM containing 1% TEA to yield 64 mg (33%).
[0754]
[0755] To pass A mixture of molecular sieves containing compound 140 (60 mg, 0.110 mmol), Ald-PEG3-N3 (71.9 mg, 0.331 mmol), and AcOH (3 μL, 0.0276 mmol) in MeOH (1 mL) was mixed with sodium cyanoborohydride (28.9 mg, 0.276 mmol), and the reaction mixture was stirred at 40 °C for 3 hours. After the reaction was complete, the mixture was cooled to 0 °C, water (0.15 mL) was added, and the solution was acidified to pH 7 using a solution of 4 M HCl in dioxane. Subsequently, all methanol was removed, a solution of 4 M HCl (0.138 mL, 0.552 mmol) in dioxane was added, and the mixture was stirred at 40 °C for 2 hours. After BOC removal, all volatiles were removed, and the crude product was suspended in a mixture of THF (1 mL), water (2 mL), and MeOH (2 mL) and treated with lithium hydroxide (26.5 mg, 1.104 mmol). After ester removal, the pH was adjusted to 3 by adding TFA, and the product was passed through... Separation was performed on a (21.2x250mm) C18 column, with gradient elution of acetonitrile in water containing 0.1% TFA to produce 16.4 mg (24%, 3-step).
[0756] Synthesis of structure 36c((S)-3-(4-(2-(2-(2-(2-azidoethoxy)ethoxy)ethoxy)ethoxy)-3-fluorophenyl)-9-(5,6,7,8-tetrahydro-1,8-naphthid-2-yl)nonanoic acid)
[0757]
[0758] Concentrated H₂SO₄ (0.18 mL, 3.4 mmol) was added to a solution of 6-oxohepanoic acid (9.74 g, 68 mmol) in DCM (30 mL) and MeOH (75 mL) at room temperature. The reaction mixture was refluxed overnight. The reaction mixture was then concentrated to an oil, dissolved in DCM (150 mL), and washed with saturated NaHCO₃ aqueous solution (2 x 40 mL) and brine (40 mL). The organic layer was dried over Na₂SO₄, filtered, and concentrated. The product was used in the next step without further purification. Yield of compound 141: 10.2 g (95%). 1 H NMR (400MHz, DMSO-d6): δ3.58(s,3H),2.43(t,2H),2.29(t,2H),1.46(m,4H).
[0759]
[0760] L-proline (3.72 g, 32 mmol) was added to a solution of compound 141 (10.2 g, 65 mmol) and 2-amino-3-carboxypyridine (7.89 g, 65 mmol) in EtOH (80 mL). The reaction mixture was refluxed and heated overnight. The reaction mixture was then concentrated, dissolved in EtOAc (50 mL), and washed with water (3 x 30 mL). The organic phase was dried over Na2SO4, filtered, and concentrated. The residue was purified by CombiFlash using silica gel as the stationary phase and eluted with a gradient of EtOAc in DCM (10–100%). Yield of compound 142: 6.08 g (39%). 14 H 16 N₂O₂[M+H] + The calculated quality is 245.13, while the actual measured quality is 245.21.
[0761]
[0762] Pd / C (10% loaded, Degussa type, 1.99 g, 1.87 mmol) was added to a solution of compound 142 (6.08 g, 24.9 mmol) in MeOH (50 mL). The reaction flask was purged with nitrogen, evacuated, and backfilled with nitrogen three times. This process was repeated with hydrogen, and the reaction vessel was finally purged with hydrogen (1 atm) and stirred overnight at room temperature. The reaction mixture was then transferred to… The mixture was filtered, the pad was washed with MeOH, and the filtrate was concentrated. Assuming a 100% yield, product compound 143 was used in the next step without further purification. 14 H 20 N₂O₂[M+H] + The calculated quality is 249.16, while the actual measured quality is 249.08.
[0763]
[0764] An n-BuLi solution (2.5 M in hexane, 40 mL, 100 mmol) was added to a solution of dimethyl methylphosphonate (12.3 g, 100 mmol) in anhydrous THF (120 mL) at -78 °C for 1 h using a syringe pump. A solution of compound 143 (6.175 g, 24.9 mmol) in THF (40 mL) was added to the reaction mixture at -78 °C for 45 min. After stirring at -78 °C for 20 min, the reaction mixture was quenched with a saturated aqueous NH4Cl solution (200 mL), warmed to room temperature, and extracted with EtOAc (400 mL). The organic layer was washed with water (200 mL) and brine (200 mL). The organic phase was separated, dried over Na2SO4, filtered, and concentrated. The product was used for the next step without further purification. Yield of compound 144: 7.86 g (93%). C 16 H 25 N₂O₄P[M+H] + The calculated quality is 341.17, and the actual measured quality is 341.17.
[0765]
[0766] A suspension of 3-fluoro-4-(phenylmethoxy)-benzaldehyde (0.38 g, 1.65 mmol), compound 144 (0.67 g, 1.98 mmol), and anhydrous potassium carbonate (0.547 g, 3.96 mmol) in THF (13.5 mL) was refluxed and heated overnight. Additional 3-fluoro-4-(phenylmethoxy)-benzaldehyde (0.19 g, 0.83 mmol) and potassium carbonate (0.23 g, 1.65 mmol) were added, and the reaction mixture was refluxed for another 4 h. The mixture was diluted with EtOAc (100 mL) and washed with water (30 mL) and brine (30 mL). The organic phase was separated, dried over Na₂SO₄, filtered, and concentrated. The residue was purified by CombiFlash using silica gel as the stationary phase and eluted with a gradient of MeOH in DCM (0–10%). Yield of compound 145: 446 mg (61%). 28 H 29 FN2O2[M+H] + The calculated quality is 445.23, while the actual measured quality is 445.41.
[0767]
[0768] Preparation of R-BINAL: A solution of EtOH (0.492 g, 10.65 mmol, 1.00 equivalent) in THF (3.2 mL) was added to a slurry of LAH (0.396 g, 10.4 mmol, 0.98 equivalent) in dry THF (34 mL) over 10 minutes, while maintaining an internal temperature <35°C. After aging for 30 minutes, a solution of R-BINOL (3.05 g, 10.65 mmol, 1.00 equivalent) in THF (10 mL) was added, maintaining an internal temperature <35°C (approximately 10 minutes). After stirring at room temperature for 2 hours, the reaction mixture was cooled to -78°C on a dry ice / acetone bath.
[0769] Compound 145 (1.18 g, 2.65 mmol) was azeotropically dried with anhydrous toluene (50 mL) and dissolved in anhydrous THF (12 mL). The solution of compound 145 was added dropwise to a solution of R-BINAL over 45 minutes at -78 °C using a syringe pump. After 1.5 h, the reaction vessel was transferred to a very large Dewar flask filled with dry ice / acetone and covered with aluminum foil. The reaction mixture was stirred overnight at -78 °C. Most of the reduction occurred within the first 1.5 h, with only a small amount of additional conversion overnight. The reaction mixture was quenched by adding saturated aqueous NH4Cl solution (150 mL) and warmed to room temperature. The mixture was further acidified to pH 7 using 6N HCl, followed by extraction with EtOAc (2 x 250 mL). The combined organic phases were washed with water (125 mL) and brine (125 mL). The organic phase was dried over Na2SO4, filtered, and concentrated. The residue was purified by CombiFlash using silica gel as the stationary phase and eluted with a gradient (0-5%) of MeOH in DCM. The yield of compound 146 was 634 mg (53%). Chiral purity was determined by analytical chiral HPLC using a Chiralpak AD-H column (4.6 x 250 mm, 5 μm), EtOH 0.1% diethylamine isocratic, 1.75 mL / min. The first eluted R isomer was 86 area % pure, corresponding to 72% ee. Compound 146 was further purified by chiral semi-preparative HPLC (Chiralpak AD-H 21.2 x 250 mm, 5 μm, EtOH 0.1% diethylamine, 20 mL / min). The final yield of compound 146 was 445 mg (98% ee). 28 H 31 FN2O2[M+H] + The calculated quality is 447.25, while the actual measured quality is 447.30.
[0770]
[0771] A solution of DMAP (9 mg, 0.073 mmol) in DCM was added to a solution of compound 146 (0.325 g, 0.73 mmol) and monomethyl malonate (0.103 g, 0.87 mmol) in DCM (3 mL). The mixture was cooled to 0 °C and DCC (0.180 g, 0.87 mmol) was added. The cooling bath was removed, and the reaction mixture was stirred overnight at room temperature. The reaction mixture was then diluted with DCM (10 mL) and filtered. The filtrate was concentrated and purified by CombiFlash using silica gel as the stationary phase and eluting with a gradient of MeOH (0–5%) in DCM. Yield of compound 147: 142 mg (37%). 32 H 35 FN2O5[M+H] + The calculated quality is 547.26, and the actual measured quality is 547.58.
[0772]
[0773] N,O-bis(trimethylsilyl)acetamide (0.229 g, 1.12 mmol) was added to a solution of compound 147 (0.232 g, 0.42 mmol) in NMP (0.5 mL) at room temperature. The mixture was heated at 60 °C for 30 min. Two fractions of brine (58 μL) were added over 5 min. The reaction mixture was then heated at 90 °C for 3 h, followed by overnight at room temperature. The reaction mixture was diluted with EtOAc (12 mL) and washed with water (3 mL). The aqueous layer was back-extracted with EtOAc (12 mL). The combined organic layers were concentrated. The residue was purified by CombiFlash using silica gel as the stationary phase and eluted with a gradient of MeOH in DCM. Yield of compound 148: 140 mg (66%). 31 H 35 FN2O3[M+H] + The calculated quality is 503.27, and the measured quality is 503.29.
[0774]
[0775] To a solution of compound 148 (0.169 g, 0.34 mmol) in EtOH (3 mL), a slurry of Pd / C (10% loaded, 36 mg, 0.034 mmol) in EtOH (1 mL) was added. The reaction vessel was pressurized with hydrogen and vented three times. The reaction vessel was then repressurized to 55 psi and maintained for 3 h. The reaction mixture was diluted with MeOH (5 mL) and filtered. The filtrate was concentrated, and the product compound 149 was used in the next step without further purification, assuming a 100% yield. 24 H 31FN2O3[M+H] + The calculated quality is 415.24, while the actual measured quality is 415.07.
[0776]
[0777] Cesium carbonate (164 mg, 0.50 mmol) was added to a solution of compound 149 (139 mg, 0.34 mmol) and azido-PEG4-toluenesulfonate (0.188 mg, 0.50 mmol) in DMF (2.5 mL). The reaction mixture was heated at 40 °C for 1 h, then quenched with a saturated aqueous solution of NaHCO3 (3 mL). The mixture was extracted with EtOAc (3 x 10 mL). The combined organic phases were washed with water (2 x 5 mL). The organic phases were dried over Na2SO4, filtered, concentrated, and used in the next step without further purification. 32 H 46 FN5O6[M+H] + The calculated quality is 616.35, while the actual measured quality is 616.90.
[0778]
[0779] Lithium hydroxide (0.040 g, 1.68 mmol) was added to a solution of compound 150 (0.207 mg, 0.34 mmol) in THF (1.5 mL) and water (1.5 mL). The reaction mixture was heated to 40 °C overnight. The next morning, the reaction mixture was acidified to pH 7 with 6 N HCl and concentrated under reduced pressure. The residue was dissolved in 35% ACN / H₂O and 0.1% TFA and purified by RP-HPLC (Thermo Aquasil C18, 250 x 21 mm, 5 μm, 20 mL / min, gradient of ACN in H₂O containing 0.1% TFA). Yield of compound 151 (SM 36): 125 mg (52%, after 3 steps). 31 H 44 FN5O6[M+H] + The calculated quality is 602.34, while the actual measured quality is 602.85.
[0780] Synthesis of structure 37c((S)-3-(4-(2-(2-(2-(2-azidoethoxy)ethoxy)ethoxy)ethoxy)-3-fluorophenyl)-3-(5-(5,6,7,8-tetrahydro-1,8-naphthidin-2-yl)pentanoylamino)propionic acid)
[0781]
[0782] Compound 169 (90 mg, 0.268 mmol) in DMF (1.5 mL) was treated with HATU (112 mg, 0.295 mmol) and stirred for 5 minutes. A mixture containing compound 170 (94 mg, 0.295 mmol) and DIEA (0.154 mL, 0.884 mmol) in DMF (0.5 mL) was then added and stirring continued for 1 hour. Afterward, all volatiles were removed, and compound 171 was separated by silica gel elution with a gradient of MeOH in DCM, yielding 123 mg (72%).
[0783]
[0784] A suspension containing 10% carbon-supported palladium (21 mg, 0.0194 mmol) and compound 171 (123 mg, 0.194 mmol) in MeOH (2 mL) was aerated with 60 PSI hydrogen and stirred for 1 hour. Afterward, the suspension was... The sample was filtered and concentrated to produce 88 mg (83%) of crude product, which was then used without further purification.
[0785]
[0786] A suspension containing compound 172 (87 mg, 0.160 mmol), Br-PEG3-N3 (50 mg, 0.176 mmol), and cesium carbonate (115 mg, 0.352 mmol) in DMF (1 mL) was heated to 60 °C and stirred for 2 hours. Afterward, all volatiles were removed, and compound 173 was separated by silica gel elution with a gradient of MeOH in DCM, yielding 91 mg (76%).
[0787]
[0788] Compound 173 (50 mg, 0.067 mmol) in dioxane (0.5 mL) was treated with a solution of 4 M HCl (0.671 mmol, 0.168 mL) in dioxane and stirred at 40 °C for 3 h. After treatment, all volatiles were removed. The crude product was dissolved in a mixture of H₂O (0.4 mL), THF (0.2 mL), and MeOH (0.4 mL), treated with LiOH (8 mg, 0.356 mmol), and stirred at 40 °C for 16 h. After treatment, the pH was adjusted to 3 with TFA, and the product was separated by elution on a Phenomenx Gemini C18 column (21.2 x 250 mm, 5 μm) using a gradient elution with acetonitrile in water containing 0.1% TFA to produce 25 mg (60%, 2-step).
[0789] Synthesis of structures 38c((S)-3-(2-(3-((2-(2-(2-(2-azidoethoxy)ethoxy)ethyl)amino)-3-oxopropyl)pyrimidin-5-yl)-9-(5,6,7,8-tetrahydro-1,8-naphthidin-2-yl)nonanoic acid) and 39c((S)-3-(2-(1-azido-12-oxo-3,6,9-trioxa-13-azahexadecane-16-yl)pyrimidin-5-yl)-9-(5,6,7,8-tetrahydro-1,8-naphthidin-2-yl)nonanoic acid)
[0790]
[0791] A solution of i-PrMgBr in THF (0.75 M, 56 mL, 42.0 mmol) was added to a solution of 5-bromo-2-iodopyrimidine (8.00 g, 28.1 mmol) in anhydrous THF (95 mL) at -78 °C, while maintaining an internal temperature < -70 °C (approximately 15 min). The resulting solution was then stirred for 15 min, followed by the addition of a solution of CuCN·2LiCl in THF (1 M, 31 mL, 31.0 mmol), and then a solution of allyl bromide (5.10 g, 42 mmol) in THF (10 mL). The reaction mixture was warmed to room temperature and stirred for 1 h. The reaction mixture was quenched with MeOH (40 mL) and concentrated. The residue was purified by CombiFlash using silica gel as the stationary phase and eluted with a gradient of EtOAc in hexane (0-20%). Yield of compound 152: 4.13 g (74%). C7H7BrN2[M+H] + The calculated quality is 198.99, while the actual measured quality is 199.05.
[0792]
[0793] A solution of 9-BBN in THF (0.5 M, 131 mL, 65.8 mmol) was added to a solution of compound 152 (7.70 g, 38.7 mmol) in THF (115 mL) for 30 minutes at 0 °C. The reaction mixture was warmed to room temperature and stirred overnight. A slurry of NaHCO3 (48.7 g, 580 mmol) in water (100 mL) was added to the reaction mixture at 0 °C, followed by a slurry of NaBO3 monohydrate (46.3 g, 464 mmol) in water (100 mL). The cooling bath was removed, and the mixture was stirred vigorously for 1 h. The reaction mixture was transferred to a separatory funnel and the layers were separated. The aqueous layer was extracted with EtOAc (200 mL). The organic phases were combined and washed with brine (100 mL). The brine layer was back-extracted with EtOAc (100 mL). The combined organic phases were dried over Na2SO4, filtered, and concentrated to produce approximately 15 g of crude yellow oil. The crude compound was purified by CombiFlash using silica gel as the stationary phase and eluted with a gradient (50-100%) of EtOAc in hexane. Yield of compound 153: 3.44 g (41%). C7H9BrN2O[M+H] + The calculated quality is 217.00, while the actual quality is 216.97.
[0794]
[0795] To a solution of compound 153 (3.44 g, 15.8 mmol) in DCM (40 mL), add imidazole (1.73 g, 25.4 mmol) and a solution of TBDPSCl (5.23 g, 19.0 mmol) in DCM (12 mL). Warm the reaction mixture to room temperature and stir overnight. Dilute the reaction mixture with DCM (75 mL) and wash with water (50 mL) and brine (50 mL). Dry the organic layer with Na₂SO₄, filter, and concentrate. Purify the residue using CombiFlash, eluting with silica gel as the stationary phase and a gradient of EtOAc (0–8%) in hexane. Yield of compound 154: 5.56 g (77%). 23 H 27 BrN2OSi[M+H] + The calculated quality is 455.12, while the actual measured quality is 455.44.
[0796]
[0797] A solution of nBuLi in THF (2.5 M, 5.6 mL, 14.0 mmol) was added dropwise to a solution of compound 154 (6.07 g, 13.3 mmol) in THF (150 mL) at -75 °C, maintaining an internal temperature < -70 °C (approximately 10 minutes). After 3 minutes, a solution of ethyl formate (1.04 g, 1.13 mL, 14.0 mmol) in THF (5 mL) was added dropwise, maintaining an internal temperature < -70 °C. The mixture was stirred at -78 °C for 20 minutes, then quenched with a solution of HCl in dioxane (4 M, 3.67 mL, 14.7 mmol), further diluted with THF (5 mL), maintaining an internal temperature < -65 °C. The cooling bath was removed, and the reaction mixture was warmed to ambient temperature and concentrated. The residue was purified by CombiFlash using silica gel as the stationary phase and eluted with a gradient of EtOAc in hexane (0-20%). Yield of compound 155: 1.79 g (33%). 1 H NMR (400MHz, CDCl3): δ10.09(s,1H),9.06(s,2H),7.64(m,4H),7.38(m,6H),3.77(t,2H),3.20(t,2H),2.17(q,2H),1.03(s,9H).
[0798]
[0799] K₂CO₃ (0.861 g, 6.23 mmol) was added to a solution of compound 144 (1.68 g, 4.15 mmol) and compound 155 (1.70 g, 4.98 mmol) in THF (25 mL). The reaction mixture was heated to 40 °C and maintained for 2.5 h, then maintained at 50 °C for 12 h. The reaction mixture was diluted with EtOAc (100 mL) and washed with water (50 mL) and brine (50 mL). The organic phase was dried over Na₂SO₄, filtered, and concentrated. The residue was purified by CombiFlash using silica gel as the stationary phase and eluted with a gradient of EtOAc (0-100%) in hexane containing 1% triethylamine. Yield of compound 156: 2.04 g (79%). C 38 H 46 N4O2Si[M+H] + The calculated quality is 619.35, while the actual measured quality is 619.69.
[0800]
[0801] Preparation of R-BINAL: LAH (1.169 g, 30.8 mmol) was pulped in dry THF (90 mL). A solution of EtOH in THF (6 M, 5.2 mL, 31.4 mmol) was added to the pulp, and the solution was kept at a constant temperature (T). 内部 <40℃. Age the mixture at 35℃ for 40 minutes, then cool to 30℃. Add a solution of R-(binaphthol) (9.00 g, 31.4 mmol) in THF (45 mL), maintaining T40. 内部 <40℃. Aged the mixture at 50℃ for 1 hour, cooled to ambient temperature, then heated to 50℃ and added TMEDA (14.1 mL, 11.0 g, 94.3 mmol). Aged the mixture at 50℃ for 1 hour, cooled to ambient temperature, and then used with compound 156.
[0802] Compound 16 (1.16 g, 1.88 mmol) in THF was added to a solution of R-BINAL (approximately 0.2 M, 110 mL, 22.0 mmol) in THF over a period of 5 minutes at -78°C. After 30 minutes, the reaction mixture was quenched with a saturated aqueous NH4Cl solution, warmed to room temperature, and the product was extracted with EtOAc (3 x 125 mL). The organic layer was dried over Na2SO4, filtered, and concentrated. The residue was purified by CombiFlash using silica gel as the stationary phase and eluted with a gradient of MeOH (0-5%) in EtOAc containing 1% triethylamine. Yield of compound 157: 0.96 g (82%). Chiral purity was determined by analytical chiral HPLC (Chiralpak AD-H column 4.6 x 250 mm, 5 μm, 25% EtOH, 75% hexane, 0.1% diethylamine isocratic, 2 mL / min). The second eluted R isomer was approximately 95 area % pure, corresponding to approximately 90% ee. 38 H 48 N4O2Si[M+H] + The calculated quality is 621.36, and the actual quality is 621.71.
[0803]
[0804] A solution of propionic acid in trimethyl orthoacetate (0.15 M, 0.55 mL, 0.08 mmol) was added to a solution of compound 157 (0.925 g, 1.49 mmol) in triethyl orthoacetate (9.25 mL). The reaction mixture was heated at 140 °C for 1.5 h in a sealed flask. The reaction mixture was concentrated, and the residue was purified by CombiFlash using silica gel as the stationary phase and eluting with a gradient of EtOAc (0-50%) in hexane containing 1% triethylamine. Yield of compound 158: 0.898 g (87%). 42 H 54 N4O3Si[M+H] + The calculated quality is 691.41, while the actual measured quality is 691.93.
[0805]
[0806] A slurry of Pd / C (loading: 10 wt%, 0.138 g, 0.13 mmol) in EtOH (4 mL) was added to a solution of compound 158 (0.893 g, 1.30 mmol) in EtOH (10 mL). The reaction mixture was aerated with 50 psi H2 and stirred for 4.5 h. The reaction mixture was filtered, concentrated, and used for the next step without further purification. Yield of compound 159: 0.885 g (99%). 42 H 56 N4O3Si[M+H] + The calculated quality is 693.42, while the actual measured quality is 693.82.
[0807]
[0808] A solution of Boc anhydride (0.836 g, 3.83 mmol) in THF (2.5 mL) was added to compound 159 (0.885 g, 1.28 mmol), followed by a solution of DMAP (20 mg / mL in THF, 155 μL, 0.0031 g, 0.026 mmol). The mixture was heated to 60 °C and held for 6 h. The reaction mixture was concentrated and the residue was purified by CombiFlash using silica gel as the stationary phase and eluting with a gradient of EtOAc (0-50%) in hexane. Yield of compound 160: 0.721 g (71%). 47 H 64 N4O5Si[M+H] + The calculated quality is 793.47, and the measured quality is 794.28.
[0809]
[0810] A solution of TBAF in THF (1M, 1.2mL, 1.2mmol) was added to a solution of compound 160 (0.621g, 0.783mmol) in THF (6mL) at 0℃. The reaction mixture was warmed to room temperature and stirred for 2h. The reaction mixture was diluted with EtOAc (30mL) and washed with saturated NH4Cl aqueous solution (2 x 10mL). The organic layer was concentrated. The residue was purified by CombiFlash using silica gel as the stationary phase and eluted with a gradient of EtOAc (50-100%) in hexane. Yield of compound 21: 0.362g (83%). Chiral purity was determined by analytical chiral HPLC, Chiralpak AD-H column 4.6 x 250mm, 5µm, 20% EtOH, 80% hexane, 0.1% diethylamine, isocratic, 1.5mL / min. The second eluted R isomer was 93% pure, corresponding to 86% ee. Compound 161 was further purified by chiral semi-preparative HPLC (Chiralpak AD-H 21.2x250mm, 5µm, 20% EtOH, 80% hexane, 0.1% diethylamine, 60mL / min). The final yield of compound 161 was 308 mg (99% ee). 31 H 46 N4O5[M+H] + The calculated quality is 555.36, and the actual measured quality is 555.72.
[0811]
[0812] At room temperature, BAIB (0.042 g, 0.130 mmol) and TEMPO (2.5 mg, 0.016 mmol) were added to a solution of compound 161 (0.030 g, 0.054 mmol) in ACN (0.30 mL), followed by the addition of water (0.30 mL). After 2 hours, the reaction mixture was concentrated. The residue was purified by RP-HPLC (Phenomenex Gemini C18 21.2 x 250 mm, 5 μm, 0.1% TFA / water / ACN, 30–80% ACN gradient). Yield of compound 162: 0.030 g (97%). 31 H 44 N4O6[M+H] + The calculated quality is 569.34, and the actual measured quality is 569.68.
[0813]
[0814] TBTU (32 mg, 0.099 mmol) was added to a solution of compound 162 (33 mg, 0.058 mmol) and amino-PEG2-azide compound (15 mg, 0.087 mmol) in DMF (0.5 mL) at 0 °C, followed by DIEA (35 μL, 26 mg, 0.203 mmol). The reaction mixture was warmed to room temperature and stirred for 30 minutes. The reaction mixture was concentrated, and the product compound 163 was used for the next step without purification. 37 H 56 N8O7[M+H] + The calculated quality is 725.44, and the actual quality is 725.77.
[0815]
[0816] To a solution of compound 163 (42 mg, 0.058 mmol) in THF (0.30 mL), 1 M LiOH solution (0.174 mL, 0.174 mmol) was added. The reaction mixture was heated at 40 °C for 1 hour. Another portion of LiOH (0.174 mL, 0.174 mmol) was added. After 3 hours, the reaction was stopped, and another portion of LiOH (0.174 mL, 0.174 mmol) was added. The reaction mixture was stirred for another 2 hours (9 equivalents of LiOH, for a total of 5 hours). The reaction mixture was neutralized to pH 5 with 3N HCl and concentrated. The residue was dissolved in TFA:water [95:5] and stirred at room temperature for 2 hours. The reaction mixture was concentrated, and the residue was purified by RP-HPLC (Phenomenex Gemini C18 21.2 x 250 mm, 5 μm, water / ACN containing 0.1% TFA, 20–50% ACN gradient). Yield of compound 164 (structure 38c): 23 mg (66%). 30 H 44 N8O5[M+H] + The calculated quality is 597.35, and the actual measured quality is 597.85.
[0817]
[0818] Diphenylphosphoazide (35 μL, 45 mg, 0.162 mmol) was added to a solution of compound 161 (30 mg, 0.054 mmol) in THF (150 μL) at 0 °C, followed by DBU (12 μL, 12 mg, 0.081 mmol). The reaction mixture was warmed to room temperature and stirred overnight. The next morning, the reaction mixture was heated at 60 °C for 7 h. The reaction mixture was concentrated and purified by RP-HPLC (Phenomenex Gemini C18 21.2 x 250 mm, 5 μm, 0.1% TFA / water / ACN, 32–60% ACN gradient). Yield of compound 165: 14 mg (44%). 31 H 45 N7O4[M+H] + The calculated quality is 580.36, and the actual measured quality is 580.66.
[0819]
[0820] A slurry of Pd / C (10% loaded, 3.3 mg, 0.003 mmol) in EtOH (170 μL) was added to a solution of compound 165 (18 mg, 0.031 mmol) in EtOH (100 μL). The reaction vessel was purged with H2, then evacuated three times, and then purged with H2 (1 atm). After 30 minutes, the reaction mixture was filtered, concentrated, and used for the next step without further purification. Yield of compound 166: 17 mg (99%). 31 H 47 N5O4[M+H] + The calculated quality is 554.37, and the actual measured quality is 554.73.
[0821]
[0822] DIEA (16 μL, 12 mg, 0.092 mmol) was added to a solution of compound 166 (17 mg, 0.031 mmol) and azido-PEG3-NHS ester (14 mg, 0.040 mmol) in DMF (170 μL) at room temperature. The reaction mixture was stirred at room temperature for 1 h, concentrated, and then used for the next step without purification. 40 H 62 N8O8[M+H] + The calculated quality is 783.48, and the actual measured quality is 783.84.
[0823]
[0824] A 1M LiOH solution (153 μL, 0.153 mmol) was added to a solution of compound 167 (24 mg, 0.031 mmol) in THF (180 μL). The reaction mixture was heated at 40 °C. After 1 hour, another portion of LiOH (153 μL, 0.153 mmol, 5 equivalents) was added. The reaction mixture was stirred at 40 °C for 3 hours, then stirred overnight at room temperature. The reaction mixture was neutralized to pH 5 with 3N HCl and concentrated. The residue was dissolved in TFA:water [95:5] and stirred at room temperature for 3 hours. The reaction mixture was concentrated, and the residue was purified by RP-HPLC (Phenomenex Gemini C18 21.2 x 250 mm, 5 μm, water / ACN containing 0.1% TFA, 15–45% ACN gradient). Yield of compound 168 (structure 39c): 9.8 mg (49%). 33 H 50 N8O6[M+H] + The calculated quality is 655.40, while the actual measured quality is 656.01.
[0825] Synthesis of pharmacokinetic enhancers
[0826] Mal-C22-dioic acid
[0827]
[0828] Compound 1 (0.200 g) was mixed with TBTU (0.182 g) in 2 mL of DMF. DIPEA (0.207 mL) was added dropwise. Then, after 5 minutes, Compound 2 (0.227 g) was added. The mixture was stirred for 1 hour. The mixture was then diluted with 40 mL of DCM, washed with 5% citric acid (4 x 30 mL), dried over Na₂SO₄, filtered, and concentrated. The product was dried on a rotary evaporator under high vacuum. The resulting solid was dried and loaded onto a... 12G on On an Rf column, Hex:EtOAc 0 => 80% was applied for 30 minutes. Yield: 53 mg (39.2%).
[0829]
[0830] Compound 1 was azeotropically distilled twice with toluene, a 20% solution of piperidine in DMF, and a mixture of Et3N. The yield was 50 mg.
[0831]
[0832] Compounds 1 (0.0350 g) and 2 (0.105 g) were combined in DMF and Et3N (0.095 mL) was added. The reaction was stopped after 1 hour. The mixture was then diluted with DCM, washed with 5% citric acid (3 x 8 mL), dried with Na2SO4, filtered, and concentrated. The product was dissolved in 1 mL of toluene and loaded into a container... On a 4G Redi-Sep Rf column, the mobile phase was changed to Hex:EtOAc0 => 100% EtOAc for 15 minutes. Then the mobile phase was changed to DCM:DCM0 containing 20% MeOH => 100% for 20 minutes. Yield: 12 mg (24.9%).
[0833]
[0834] Compound 1 (0.012 g) was dissolved in 1 mL of a 1:1 mixture of DCM and TFA. The reaction mixture was stirred for 3 hours. The product was dried under high vacuum using a rotary evaporator. Yield: 0.0110 g (99.6%).
[0835] C18-diacid-N3
[0836]
[0837] Compound 1 (0.500 g, Asta Tech) was used. Compound #64704 and compound 2 (0.454 g, Chem-Impex #16167) were dissolved in DMF and TBTU (0.442 g) and DIPEA (0.586 mL) were added. The mixture was stirred for 2 hours. The mixture was then diluted with DCM (40 mL), washed with H2O (4 x 40 mL), dried over Na2SO4, filtered, and concentrated. The product was dissolved in 2 mL of DCM and loaded into a container... The product was concentrated on a Redi-Sep Rf column (mobile phase DCM: DCM0 containing 20% MeOH => 20% for 25 minutes). Yield: 740 mg (85%).
[0838]
[0839] Compound 1 (0.720 g) was dissolved in 5 mL of MeOH in a flask. A diaphragm was placed on the flask, and atmospheric pressure was applied, followed by purging with nitrogen twice. Then, 30% Pd / C (0.200 g) was added via weighing paper. The diaphragm was replaced, and atmospheric pressure was applied again, followed by purging with hydrogen twice. The reaction mixture was stirred at room temperature for 1 hour. The mixture was filtered, and the filtrate was dried under high vacuum on a rotary evaporator. Yield: 665 mg.
[0840]
[0841] Compound 1 (0.150 g) and compound 2 (0.0618 g) were dissolved in DMF, and TBTU (0.0884 g) and DIPEA (0.117 mL) were added to the mixture. The reaction mixture was stirred at room temperature for 1 hour. The mixture was then diluted with DCM (12 mL), washed with water (4 x 8 mL), dried over Na2SO4, filtered, and concentrated under high vacuum. The product was dissolved in DCM (1 mL) and loaded into a... On a 4G Redi-Sep Rf column (mobile phase DCM: DCM containing 20% methanol, 0 => 50% over 25 minutes). Yield: 162 mg (79%).
[0842]
[0843] Compound 1 (0.155 g) was dissolved in a 1:1 mixture of DCM and TFA. The reaction mixture was stirred at room temperature for 2 hours. The product was concentrated on a rotary evaporator under high vacuum. Yield: 129 mg (97%).
[0844] Mal-C18-dioic acid (D-form)
[0845]
[0846] Compound 1 (0.500 g) and compound 2 (0.4539 g) were dissolved in DMF, and TBTU (0.4418 g) and DIPEA (0.586 mL) were added to the mixture. The reaction mixture was stirred at room temperature for 2 hours. The mixture was then diluted with DCM (40 mL), washed with water (4 x 40 mL), dried over Na2SO4, filtered, and concentrated under high vacuum. The product was dissolved in DCM (2 mL) and loaded into... On a 4G Redi-Sep Rf column (mobile phase DCM: DCM containing 20% methanol, 0 => 50% over 25 minutes). Yield: 740 mg (85%).
[0847]
[0848] Compound 1 (0.720 g) was dissolved in 5 mL of MeOH. A diaphragm was then placed on a flask and N2 was applied twice. Next, Pd / C (0.200 g) was added via weighing paper, the diaphragm was replaced, and vacuum and H2 were applied twice consecutively. The reaction mixture was stirred at room temperature for 1 hour. The product was filtered, and the filtrate was dried on a rotary evaporator under high vacuum. Yield: 655 mg.
[0849]
[0850] Compound 1 (0.100 g) and compound 2 (0.0318 g) were dissolved in DMF, and TBTU (0.0589 g) and DIPEA (0.078 mL) were added to the mixture. The reaction mixture was stirred at room temperature for 1 hour. The mixture was then diluted with DCM (10 mL), washed with water (4 x 7 mL), dried over Na2SO4, filtered, and concentrated under high vacuum. The product was dissolved in DCM (0.5 mL) and loaded into a... On a 4G Redi-Sep Rf column (mobile phase DCM: DCM containing 20% methanol, 0 => 50% over 25 minutes). Yield: 100 mg (82%).
[0851]
[0852] Compound 1 (96 mg) was dissolved in a 1:1 mixture of TFA and DCM. The reaction mixture was stirred at room temperature for 2 hours. The product was concentrated and placed under high vacuum. Yield: 80 mg (99%).
[0853] Mal-C18-methyl-trisic acid
[0854]
[0855] Compound 2 ( A solution of #254487 (0.405 g) in 1 mL of THF was added to a suspension of NaH in 3.5 mL of THF. The reaction mixture was warmed to room temperature and stirred for 20 minutes. The reaction mixture was mixed until it became clear. Then, compound 1 (…) was added dropwise at 0 °C. #684511 (0.436 g) was dissolved in 2 mL of THF and stirred for 0.5 h. The ice bath was then removed and the reaction mixture was stirred overnight at room temperature. The reaction mixture was then diluted with DCM (35 mL) and washed with NH4Cl solution (1 x 8 mL). The organic phase was back-extracted with DCM (1 x 8 mL). The organic phases were combined and washed with H2O (2 x 8 mL). The organic phases were dried over Na2SO4, filtered, and concentrated. The product was purified by chromatography and wet-loaded into toluene (1 mL). On 12G RediSep Rf Gold, mobile phase hexane: hexane containing 10% EA => 0 => 50% over 25 minutes. Yield: 390 mg (64.5%).
[0856]
[0857] Compound 1 (0.100 g in 0.5 mL THF) was added to a suspension of NaH in 0.75 mL THF at 0 °C. The reaction mixture was warmed to room temperature and stirred for 20 minutes. The reaction mixture became clear. Then, compound 2 (…) was added dropwise at 0 °C. 67692, 0.016 mL in 0.5 mL THF and stirred for 0.5 h. Remove from ice bath and stir the reaction mixture overnight at room temperature. Dilute the reaction mixture with DCM (20 mL) and wash with NH4Cl (1 x 5 mL). Back-extract the organic layer with DCM (1 x 5 mL). Combine the organic phases and wash with H2O (2 x 5 mL). Dry the organic phases over Na2SO4, filter and concentrate. Purify the product by chromatography and wet load it in toluene (1 mL). On 12GRediSep Rf Gold, mobile phase hexane: hexane containing 10% EA (0 => 50% over 25 minutes). Yield: 30 mg (29.2%).
[0858]
[0859] Compound 1 (0.0300 g) was dissolved in 0.4 mL THF. Then, LiOH (480 mg in 10 mL THF) was added. The reaction mixture was stirred for 16 hours. The mixture was acidified with citric acid to pH 3. The organic layers were extracted with 2 x 6 mL DCM, and the organic matter was combined, dried over Na₂SO₄, filtered, and concentrated. Yield: 25 mg (85.7%).
[0860]
[0861] Compound 1 (0.0250 g) and Compound 2 (Chem) #30487 (0.0238 g) was dissolved in DMF, and TBTU (0.0190 g) and DIPEA (0.022 mL) were added to the mixture. The reaction mixture was stirred at room temperature for 1 hour. The mixture was then diluted to 9 mL with DCM, washed with water (3 x 7 mL), dried over Na2SO4, filtered, and concentrated under high vacuum. The product was dissolved in DCM (0.5 mL) and loaded into a... On a 4G Redi-Sep Rf column (mobile phase DCM: DCM containing 20% methanol 0 => 25% for 15 minutes). Yield: 37.1 mg (84.7%).
[0862]
[0863] Compound 1 (0.0320 g) was dissolved in 0.5 mL of a 20% piperidine solution in DMF. The reaction mixture was stirred at room temperature for 1 hour. The product was concentrated under high vacuum, then dissolved in toluene and concentrated under high vacuum. The product was dissolved in 0.5 mL of DCM (containing 2 x 0.25 mL wash buffer) and wet-loaded into… Pre-equilibrated 4g RediSep Gold Rf column (mobile phase DCM => DCM 0 containing 20% MeOH => 50% over 20 minutes). Yield: 0.020g (84.7%).
[0864]
[0865] Compound 1 (0.0200 g) was added to a solution of Et3N (0.022 mL) in DMF (0.4 mL). Then compound 2 (Asta) was added. #24961, 0.0246 g). The reactants were stirred at room temperature for 1 hour. The reactants were diluted to 10 mL with DCM and washed with a 5% citric acid solution in water (3 x 5 mL), dried over Na2SO4, filtered, and concentrated under high vacuum. The product was wet-loaded in 0.5 mL of DCM (containing 2 x 0.3 mL wash buffer) onto a pre-equilibrated 4 g Redi Sep Gold Rf column (mobile phase DCM => 20% MeOH / DCM 0 => 30% for 20 minutes). Yield: 20 mg.
[0866] The product was then dissolved in 2 mL of a 1:1 TFA:DCM mixture and stirred for 2 hours. The product was then concentrated under high vacuum using a rotary evaporator. Yield: 13 mg.
[0867] Mal-C 17 -Fluoro-PO3 monoacid
[0868]
[0869] Compound 1 ( #177490, 5.00 g) was dissolved in a mixture of 70 mL THF and 20 mL DMF. Then, Dess-Martin periodide ( #274623, 11.7g). The reactants were stirred for 3 hours. The mixture was concentrated under high vacuum on a rotary evaporator, then dried and loaded onto a plate. On a 120g Redi-Sep Gold Rf column, the mobile phase was hexane:EtOAc,0=>30% containing 10% DCM for 30 minutes. Yield: 2.86g.
[0870]
[0871] Compound 1 (2.85 g) and benzyl alcohol (1.36 mL) were mixed in 50 mL of DCM and cooled to 0 °C. Then, EDC (2.53 g) and DMAP (0.257 g) were added sequentially. The reaction mixture was warmed to room temperature and stirred for 2 hours, monitored by TLC. The mixture was extracted with NH4Cl (1 x 50 mL) solution and DCM. The organic phase was dried over Na2SO4, concentrated, and dried before being loaded onto an 80 g RediSep Gold Rf column with a mobile phase of ethyl acetate:hexane, 0 °C > 15% for 30 minutes. Yield: 2.31 g (61.0%).
[0872]
[0873] Add 0.047 mL of NaH (60% in oil) to a flask and load the flask with 15 mL of THF. Cool the flask to 0 °C and add dropwise a solution of compound 1 (AK Scientific #J91196, 0.500 g) in 2 mL of THF. Stir the reaction mixture for 5 minutes, then remove the ice and stir at room temperature for 15 minutes. Cool the reaction mixture to 0 °C and add compound 2 (Tokyo Chemical Industry Co. #f0358, 0.768 g) as a solid fraction. Then add 0.3 mL of anhydrous DMF, followed by removing the ice bath. Stir the reaction mixture at room temperature overnight. Then dilute the reaction mixture with DCM (50 mL) and wash with saturated NH4Cl (1 x 12 mL). Wash the aqueous layer with DCM (1 x 10 mL). Combine the organic compounds, wash with H2O (2 x 10 mL), dry with Na2SO4, filter, and concentrate under high vacuum on a rotary evaporator. The product was loaded into a 4G Redi-Sep Gold Rf column on a CombiFlash in 1.5 mL of DCM. The mobile phase was DCM containing 20% MeOH, 0 => 30%, over 20 minutes. The yield was 157 mg (36.2%).
[0874]
[0875] Compound 2 (0.149 g in 0.5 mL THF) was added to a suspension of NaH in THF (0.75 mL) at 0 °C. The reaction mixture was warmed to room temperature and stirred for 20 min. A solution of compound 1 (0.140 g) in 1.25 mL THF was gradually added at 0 °C and stirred for 0.5 h. The reaction mixture was then diluted with DCM (20 mL) and washed with saturated NH4Cl (1 x 5 mL). The product was back-extracted with DCM (1 x 5 mL). The combined organic layers were washed with H2O (2 x 5 mL). The organic phase was dried over Na2SO4, filtered, and concentrated. The product was dried and loaded onto 1 g silica gel, 4 g RediSep Rf Gold, and a mobile phase of hexane:EtOAc 0 => 50%. Yield: 67 mg (33.7%).
[0876]
[0877] Compound 1 (0.0530 g) was dissolved in 2 mL of MeOH. A diaphragm was then placed on a flask and N2 was applied twice. Pd / C (0.0250 g) was then added through weighing paper, the diaphragm was replaced, and vacuum and H2 were applied twice consecutively. The reaction mixture was stirred at room temperature for 2 hours. The product was filtered through a syringe filter, and the filtrate was dried on a rotary evaporator under high vacuum. Yield: 36 mg (82.0%).
[0878]
[0879] Compound 1 (0.0200 g) was dissolved in 0.3 mL of DMF, then TBTU (0.0174 g) and DIPEA (0.021 mL) were added. The mixture was stirred for 5 minutes, then compound 2 (Chem) was added. #30487, 0.0217 g). The reactants were stirred at room temperature for 1 hour. The mixture was then diluted with 6 mL of DCM, washed with H2O (3 x 3 mL), dried over Na2SO4, filtered, and concentrated under high vacuum on a rotary evaporator. The product was loaded into 1 mL of DCM and placed into a container... On a RediSep 4G Gold Rf column, the mobile phase was DCM containing 20% MeOH, with a concentration of 0 to 30% over 15 minutes. The yield was 10 mg (88.8%).
[0880]
[0881] Compound 1 (0.0330 g) was dissolved in 0.5 mL of DMF containing 20% piperidine. The reaction mixture was stirred at room temperature for 1 hour. The reaction mixture was concentrated under high vacuum using a rotary evaporator. The product was loaded into 1 mL of DCM onto a 4G RediSep Gold Rf column on a CombiFlash platform. The mobile phase was DCM containing 20% MeOH, 0 => 50% for 20 minutes. Yield: 11.5 mg (48.5%).
[0882]
[0883] Compound 1 (0.0115 g) was dissolved in 0.3 mL of DMF, and compound 2 (Asta) was added. #24961 (0.0156 g) and Et3N (0.014 mL). The reactants were stirred overnight at room temperature. The reactants were then diluted with DCM (6 mL), washed with 5% citric acid (3 x 3 mL), dried over Na2SO4, filtered, and concentrated. The product was loaded into 1 mL of DCM onto a 4G RediSep Gold Rf column on a CombiFlash, with the mobile phase being DCM containing 20% MeOH, and the concentration was increased from 0% to 35% over 20 minutes. Yield: 10 mg (64.9%).
[0884]
[0885] Compound 1 (0.0100 g) was dissolved in 0.3 mL of DCM and the mixture was cooled to 0 °C. Then, 0.051 mL of TMS-Br was added and the reaction mixture was stirred at 0 °C for 4 hours, followed by stirring at room temperature for 3 hours. The reaction mixture was dried and 1 mL of MeOH was added. The reaction mixture was stirred overnight. The product was dried under high vacuum in a rotary evaporator by azeotropic mixing with toluene (3 x 1 mL). The reaction mixture was then dissolved in DCM:TFA 1:1 (1 mL) and stirred at room temperature. After 1.5 h, the reaction mixture was concentrated under high vacuum in a rotary evaporator. Yield: 8.5 mg (99%).
[0886] Mal-C 17 -Fluorine-PO3
[0887]
[0888] Compound 1 (0.0150 g) was dissolved in 0.25 mL of DMF. TBTU (0.0125 g) was then added to the mixture, followed by DIEA (0.015 mL), and the mixture was stirred for 5 minutes. Compound 2 (0.0062 g) was then added to the mixture, and the reaction mixture was stirred at room temperature for 1 hour. The reaction mixture was then diluted with DCM (6 mL), washed with H2O (3 x 3 mL), dried over Na2SO4, filtered, and concentrated under high vacuum on a rotary evaporator. The product was loaded into 1 mL of DCM onto a 4G RediSep Gold Rf column on a CombiFlash, with the mobile phase being DCM containing 20% MeOH, from 0 to 30% over 15 minutes. Yield: 12.5 mg (64.7%).
[0889]
[0890] A solution of compound 1 (0.0125 g) in 0.4 mL of DCM was cooled to 0 °C and TMSBr was added dropwise. The reaction mixture was stirred at 0 °C for 3 hours. Volatile substances were completely removed by rotary evaporation under high vacuum. The residue was stirred with MeOH for 2 hours to remove TMS. The mixture was dried under high vacuum on a rotary evaporator. Yield: 11.5 mg (98.8%).
[0891] Synthesis of Mal-C18-diacids and related compounds
[0892]
[0893] Step 1: Compound 1 (molecular weight = 370.57, 0.741 g, 2 mmol) was dissolved in 10 mL of DMF. TBTU (molecular weight = 321, 0.642 g, 2 mmol) and DIPEA (molecular weight = 129, 0.87 mL, 5 mmol) were added sequentially, and the mixture was stirred for 5 minutes. Compound 2 (molecular weight = 418.9, 0.838 g, 2 mmol) was added. The solution was stirred for 1 hour. The solution was diluted with 40 mL of DCM and washed three times with water (40 mL each time). The organic phase was evaporated and purified by column chromatography (EA:HEX = 0%-100%) to give compound 3 (80% yield). (Observed mass, M+1 = 736).
[0894] Step 2: Treat compound 3 with a 20% piperidine solution in DMF for half an hour. Evaporate the solvent and purify the residue by chromatography (MeOH:DCM = 0%-10%). (Observed mass, M+1 = 514). (Observed mass, M+1 = 707).
[0895] Step 3: Compound 4 (molecular weight = 513, 50 mg, 0.0975 mmol) was dissolved in 1 mL of DMF. Compound 5 (molecular weight = 308, 36 mg, 1.2 equivalents) and TEA (0.041 mL, 3 equivalents) were added. The reaction mixture was stirred for 2 hours. The solution was diluted with DCM and washed three times with water. The organic phase was evaporated and purified by chromatography (EA:HEX = 0%-100%) to obtain compound 6 (observed mass, M+1 = 594).
[0896] Step 4: Compound 6 was treated with a solution of 50% TFA in DCM for 2 hours. The solvent was evaporated to obtain compound 7 (Mal-C18-diacid) (observed mass, M+1 = 594).
[0897] Mal-C18-triacid
[0898]
[0899] Step 1: Compound 9 (1.2 equivalents) was added to a solution of NaH (1.2 equivalents) in 3 mL of THF at 0 °C and stirred at room temperature for 0.5 h. Then, a solution of compound 8 (1 mmol, 1 equivalent) in 1 mL of THF was added dropwise to the mixture at 0 °C. The mixture was stirred at 0 °C for 0.5 h until the solution was clear. The solution was then raised to room temperature and slowly turned into a slurry. After 5 h, the reaction was quenched with NH4Cl and extracted with DCM. The product was purified on a column (Hex: 10% EtOAc in hexane), and the peak appeared at approximately 0%–3% EtOAc (42% yield, 200 mg) (observed mass, M+1 = 486).
[0900] Step 2: Dissolve compound 10 in THF (3 mL) and add 1 M LiOH (3 mL). Stir the reaction mixture at 25 °C for 16 hours. Then, acidify the solution with citric acid to pH 3 and extract with DCM (3 x 10 mL). Combine the organic phases and concentrate under vacuum without further purification. (Observed mass, M+1 = 472).
[0901] Mal-C18-triacid (observed mass, M+1 = 638) was synthesized by substituting compound 11 for compound 1 in the same synthesis described for Mal-C18-diacid.
[0902] Mal-C 18 -Diacid-PO3
[0903]
[0904] Step 1: Compound 12 (2.64 mmol, 1 equivalent) and compound 13 (2.909 mmol, 1.1 equivalent) were mixed together in DCM and the mixture was cooled to 0°C. EDC (1.1 equivalent) and DMAP (0.2 equivalent) were added sequentially. The reaction mixture was warmed to room temperature. The reaction mixture was stirred for 2 hours and monitored by TLC (hexane:EtOAc 8:2). The organic phase was extracted with NH4Cl solution and DCM. The organic phase was dried over Na2SO4, concentrated, and purified by chromatography (EA:HEX = 0% to 10%). Product spots appeared in approximately 2% EA (observed mass, M+1 = 426).
[0905] Step 2: Compound 15 (1.2 equivalents) was added to a solution of NaH (1.2 equivalents) in 3 mL of THF at 0 °C and stirred at room temperature for 0.5 h. A solution of Compound 14 (0.470 mmol, 1 equivalent) in 1 mL of THF was added dropwise to the mixture at 0 °C. The reactants were stirred at 0 °C for 0.5 h until the solution was clear. The mixture was then raised to room temperature, and the solution slowly turned into a slurry. After 5 h, the reaction was quen...
Claims
1. An RNAi reagent comprising an antisense strand containing the sequence usUfsusCfaUfgAfaAfuCfgUfuAfcGfuUfsg (SEQ ID NO: 30) and an antisense strand containing the sequence Y-(NH-C6)scsaacguaaCfGfAfuuu Z ca Z ug Z aa Z The sense chain of sa(invAb)(6-S)-X (SEQ ID NO:761), where a, c, g, and u represent 2′-O-methyladenosine, 2′-O-methylcytidine, 2′-O-methylguanosine, and 2′-O-methyluridine, respectively; Af, Cf, Gf, and Uf represent 2′-fluoroadenosine, 2′-fluorocytidine, 2′-fluoroguanosine, and 2′-fluorouridine, respectively; s represents a phosphate thioester bond; u Z a Z g Z and c Z These represent uridine, adenosine, guanosine, and cytidine, respectively, with the pharmacological moiety of Z linked to the 2′ position of the nucleotide; Y-(NH-C6)s represents: (invAb) represents: (6-S) represents: And each X, Y, and Z independently represents: (i) a targeting group comprising one or more targeting ligands, wherein the targeting ligands are selected from: in Indicate connection point; (ii) Targeting ligands having structures selected from: structure 2a, structure 2.11a, structure 29a, and structure 32a; or (iii) PK enhancers having a structure selected from the following: in Indicates the connection point.
2. The RNAi reagent of claim 1, wherein each Z is a targeting ligand having a structure of structure 2a: in Indicates the connection point.
3. The RNAi reagent of claim 1, wherein each Z is a targeting ligand having a structure having structure 2.11a: in Indicates the connection point.
4. The RNAi reagent of claim 1, wherein each Z is a targeting ligand having a structure of structure 29a: in Indicates the connection point.
5. The RNAi reagent of claim 1, wherein each Z is a targeting ligand having a structure having structure 32a: in Indicates the connection point.
6. The RNAi reagent of any one of claims 1-5, wherein X is a PK enhancer having a C-18 diacid structure: in Indicates the connection point.
7. The RNAi reagent of any one of claims 1-5, wherein X is a PK enhancer having a Mal-C-18 triacid structure: in Indicates the connection point.
8. The RNAi reagent of any one of claims 1-5, wherein X is a PK enhancer having a structure of Mal-C17-vinylPO3: in Indicates the connection point.
9. The RNAi reagent of any one of claims 1-5, wherein X is a PK enhancer having a Mal-C20 acid structure: in Indicates the connection point.
10. The RNAi reagent of any one of claims 1-5, wherein the RNAi reagent comprises 2, 3, 4, 5, 6, 7, 8, 9 or 10 targeting ligands.
11. The RNAi reagent of claim 10, wherein the RNAi reagent comprises 7 targeting ligands.
12. The RNAi reagent of claim 11, wherein Y is a targeting group having the following structure: TriAlk 14: or TriAlk 14s: TL includes targeting ligands selected from the following: structure 2a, structure 2.11a, structure 29a and structure 32a.
13. The RNAi reagent of claim 12, wherein each TL comprises structure 2a: in Indicates the connection point.
14. The RNAi reagent of claim 12, wherein each TL comprises structure 2.11a: in Indicates the connection point.
15. The RNAi reagent of claim 12, wherein each TL comprises structure 29a: in Indicates the connection point.
16. The RNAi reagent of claim 12, wherein each TL comprises structure 32a: in Indicates the connection point.
17. The RNAi reagent of any one of claims 1-5, wherein the nucleotide of the antisense strand is composed of the nucleotide of SEQ ID NO:
30.
18. The RNAi reagent of any one of claims 1-5, wherein the sense strand of the nucleotide is composed of the nucleotide of SEQ ID NO:
761.
19. A composition comprising the RNAi reagent of any one of claims 1-18, wherein the composition comprises a pharmaceutically acceptable excipient.
20. The composition according to claim 19, further comprising a second RNAi agent for inhibiting the expression of HIF-2α.
21. The composition according to claim 19 or 20, further comprising one or more additional therapeutic agents.
22. Use of the RNAi reagent of any one of claims 1-18 or the composition of any one of claims 19-21 in the preparation of a medicament for inhibiting the expression of the HIF-2α (EPAS1) gene in cells, comprising introducing an effective amount of the RNAi reagent of any one of claims 1-18 or the composition of any one of claims 19-21 into the cells.
23. The use according to claim 22, wherein the cells are in the body of a subject.
24. The use according to claim 23, wherein the subject is a human subject.
25. The use according to any one of claims 22-24, wherein the HIF2-α gene expression is suppressed in vivo by at least about 30%.
26. Use of the composition of any one of claims 19-21 in the preparation of a medicament for treating HIF2-α-related diseases or disorders, comprising administering a therapeutically effective amount of the composition of any one of claims 19-21 to a human subject in need, wherein said disease or disorder is renal cell carcinoma, chondrosarcoma, melanoma, multiple myeloma, inflammation, or neovascularization.
27. The use according to claim 26, wherein the disease or disorder is chronic inflammation.
28. The use according to claim 26, wherein the disease or disorder is rheumatoid arthritis.
29. The use according to claim 26, wherein the disease is clear cell renal cell carcinoma (ccRCC).
30. The use according to any one of claims 22-24, wherein the RNAi reagent is administered at a dose of 3 mg / kg to 80 mg / kg of human subject body weight.
31. The use according to claim 30, wherein the RNAi reagent is administered at a dose of 5 mg / kg to 20 mg / kg of human subject body weight.
32. The use according to claim 30, wherein the RNAi reagent is administered in fractionated doses, wherein approximately half of the desired daily dose is administered in the initial administration, and the remaining approximately half of the desired daily dose is administered approximately 4 hours after the initial administration.
33. The use according to claim 30, wherein one or more doses of the RNAi reagent are administered once weekly.
34. The use according to any one of claims 31-33, wherein the dose or fractionated dose of the RNAi reagent is applied once every 2 weeks (every other week).
35. Use of the RNAi reagent of any one of claims 1-18 or the composition of any one of claims 19-21 in the preparation of a medicament for treating at least partially mediated diseases, disorders, or symptoms caused by HIF-2α (EPAS1) gene expression, wherein said diseases, disorders, or symptoms are renal cell carcinoma, chondrosarcoma, melanoma, multiple myeloma, inflammation, or neovascularization.
36. The use according to claim 35, wherein the disease is ccRCC.
37. Use of the RNAi reagent of any one of claims 1-18 or the composition of any one of claims 19-21 for the preparation of a pharmaceutical composition for the treatment of a disease, disorder, or symptom at least partially mediated by HIF-2α (EPAS1) gene expression, wherein the disease or disorder is renal cell carcinoma, chondrosarcoma, melanoma, multiple myeloma, inflammation, or neovascularization.
38. The use according to claim 37, wherein the disease is ccRCC.
Citation Information
Patent Citations
Serial injection of muramyldipeptides and liposomes enhances the anti-infective activity of muramyldipeptides
US4522811A
Enzymatic nucleic acids containing 5'-and / or 3'-cap structures
US5998203A
Delivery of substances to cells
WO2000053722A2
Polyconjugates for in vivo delivery of polynucleotides
WO2008022309A2
Compositions for targeted delivery of sirna
WO2011104169A1