Compositions and methods for treating adipose tissue accumulation

Abstract

The present disclosure relates to methods of treating diseases or conditions associated with fat tissue accumulation, such as obesity, metabolic syndrome, type II diabetes, and the like. Administration of a composition comprising a monoclonal antibody directed against a ghrelin. This results in a decrease in weight gain rate, and a significant reduction in lipid synthesis and accumulation.

Description

[0001] This application is a divisional application of Chinese patent application filed on December 17, 2014, with application number 201480075779.1 and entitled "Composition and Method for Treating Adipose Tissue Accumulation". Technical Field

[0002] This application claims priority to U.S. Provisional Patent Application Serial No. 61 / 917,136, filed December 17, 2013; U.S. Provisional Patent Application Serial No. 61 / 974,660, filed April 3, 2014; U.S. Provisional Patent Application No. 62 / 007,255, filed June 3, 2014; U.S. Provisional Patent Application No. 62 / 045,189, filed September 3, 2014; U.S. Provisional Patent Application No. 62 / 074,225, filed November 3, 2014; U.S. Provisional Patent Application No. 62 / 074,227, filed November 3, 2014; and U.S. Provisional Patent Application No. 62 / 074,234, filed November 3, 2014. The disclosures of these applications are incorporated herein by reference in their entirety. Background Technology

[0003] In this document, the sequence list submitted is an ASCII text file named “MHMS200014US01_ST25.txt”, created on December 17, 2014, with a size of 24,995 bytes. Therefore, all material in that text file is incorporated herein by reference.

[0004] In various exemplary embodiments, this disclosure generally relates to a method of treating fat buildup in tissue using a molecular antagonist (such as a monoclonal antibody (mAb)) that binds to a glucose-dependent insulinotropic polypeptide (GIP). Fat buildup occurs in several different diseases or conditions that can be treated with such antagonists / monoclonal antibodies. The invention also relates to treating these diseases or conditions by improving glucose tolerance through the administration of such antagonists / monoclonal antibodies without requiring an increase in serum insulin.

[0005] Obesity is a medical condition in which excess body fat accumulates to a level that negatively impacts health. In the United States, a body mass index (BMI) of 30 kg / m² is considered obese. 2A person is considered obese if their body mass index (BMI) is above the average height of their body. BMI is calculated by dividing a person's weight by the square of their height. Obesity can be caused by a combination of factors, including excessive calorie intake, an unhealthy diet, lack of physical activity, genetics, age, and insufficient sleep. Obesity increases the likelihood of developing various diseases, including heart disease, type 2 diabetes, obstructive sleep apnea, certain cancers, and osteoarthritis.

[0006] Metabolic syndrome can be diagnosed when three of the following five medical conditions are confirmed: high blood pressure, excess body fat around the waist, high fasting blood glucose, high serum triglycerides, and low high-density lipoprotein (HDL) cholesterol levels. Metabolic syndrome also increases the risk of several diseases, including type 2 diabetes, coronary heart disease, lipid metabolism disorders, and some underlying mental illnesses. Treatment includes lifestyle modifications and medication.

[0007] Hyperlipidemia is a condition characterized by abnormally high levels of lipids and / or lipoproteins in the blood. Primary hyperlipidemia is usually caused by genetic factors, while secondary hyperlipidemia is induced by other underlying factors such as diabetes, the use of certain medications, and alcohol consumption. Hyperlipidemia can be classified into hypercholesterolemia and hypertriglyceridemia. In the United States, hypercholesterolemia is generally diagnosed when total cholesterol levels are higher than 240 mg / dL. In the United States, hypertriglyceridemia is generally diagnosed when triglyceride levels are higher than 500 mg / dL.

[0008] Non-insulin-dependent (type 2) diabetes occurs when the body's cells do not respond properly to insulin. This is a condition known as insulin resistance. The result is persistently high blood sugar levels. The main causes are being overweight and lack of exercise. Long-term complications can include cardiovascular disease, stroke, kidney failure, and eye damage.

[0009] Cushing's syndrome is associated with prolonged exposure to abnormally high levels of the hormone cortisol. Cortisol is produced in the adrenal glands and is usually induced by adrenocorticotropic hormone (ACTH). However, food-induced Cushing's syndrome occurs when the adrenal glands respond abnormally to gastric inhibitory peptide (GIP).

[0010] Fatty liver disease (FLD) is a global chronic health problem affecting adults and children. Clinically, FLD is divided into two main categories: non-alcoholic FLD (NAFLD) and alcoholic FLD (AFLD). NAFLD and AFLD are characterized by a liver fat content exceeding 5% to 10%, with the only distinguishing factor being the underlying cause of the disease. However, it is often difficult to differentiate between the two types of FLD based solely on morphological characteristics. Generally, FLD occurs in individuals who consume excessive alcohol, those with metabolic disorders or a genetic predisposition affecting fatty acid metabolism, and / or those who are obese. Common comorbidities include obesity, type 2 (non-insulin-dependent) diabetes, and hyperlipidemia.

[0011] The core pathologies of fatty liver disease (FLD) include hepatic steatosis and steatohepatitis, which can progress to cirrhosis. Steatosis occurs when the lipid content in the liver exceeds 5% to 10% by weight, characterized by abnormal retention of lipid vesicles and inhibition of fatty acid oxidation. Steatosis is considered reversible, provided the underlying cause of the disease can be identified and addressed.

[0012] If steatosis persists, it can develop into non-alcoholic steatohepatitis (NASH) or alcoholic steatohepatitis (ASH), depending on the severity and underlying cause. Unlike steatosis, NASH and ASH are irreversible and can only be treated. NASH and ASH are characterized by increased fat accumulation, mixed lobular inflammation, ballooning degeneration of hepatocytes, glycogenized hepatocyte nuclei, and pericellular fibrosis. They can progress to cirrhosis and eventually liver cancer.

[0013] Current treatments for FLD include: (1) following a reasonable diet and exercise plan, (2) avoiding the worsening of liver damage that may occur through sudden weight loss or drug abuse, (3) losing weight, (4) taking insulin sensitizers to reduce insulin resistance and control blood sugar, (5) using lipid-lowering drugs or drugs to improve liver disease, and (6) seeking a liver transplant.

[0014] In a clinical setting, appetite suppressants work to some extent by inducing nausea. Therefore, if someone is willing to experience discomfort during a weight loss process, then that person can lose weight. However, such side effects are undesirable when patients are specifically required to adhere to a weight loss plan.

[0015] It is hoped that other treatments exist for FLD and other diseases involving fat accumulation. Summary of the Invention

[0016] This disclosure relates to a monoclonal antibody (mAb) that binds to a gastric inhibitory peptide (GIP) and a method of using such a mAb to treat diseases involving fat accumulation in tissues. GIP is also known as a glucose-dependent insulinotropic peptide.

[0017] This document discloses methods for treating a variety of different diseases or conditions in various embodiments. These diseases include obesity, type II diabetes, food-induced Cushing's syndrome, or metabolic syndrome. Methods for reducing fat accumulation in liver tissue, omentum, or subcutaneous tissue are also disclosed. These methods all involve administering to a patient a composition containing a pharmaceutically effective amount of a molecular antagonist of gastric inhibitory peptide (GIP).

[0018] The molecular antagonist includes at least one complementarity-determining region (CDR) that has at least 80% identity with the amino acid sequence selected from the group consisting of SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 31, SEQ ID NO: 32 and SEQ ID NO: 33.

[0019] In a specific embodiment, the molecular antagonist includes a light chain variable domain having a first CDR and a second CDR, each CDR having at least 95% identity with an amino acid sequence selected from the group consisting of SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, and SEQ ID NO: 24. The first and second CDRs of the molecular antagonist are linked to each other by a linking group. This linking group can be an amino acid chain.

[0020] In other embodiments, the molecular antagonist includes a light chain variable domain having a first CDR having at least 80% identity with the amino acid sequence of SEQ ID NO: 20, a second CDR having at least 80% identity with the amino acid sequence of SEQ ID NO: 21, and a third CDR having at least 85% identity with the amino acid sequence of SEQ ID NO: 22. The first CDR, second CDR, and third CDR of the molecular antagonist are linked to each other by a linking group. This linking group may be an amino acid chain independently.

[0021] In some other embodiments, the molecular antagonist includes a light chain variable domain that has at least 80% identity with an amino acid sequence selected from the group consisting of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18 and SEQ ID NO: 19.

[0022] In some other embodiments, the molecular antagonist includes a heavy chain variable domain having a first CDR having at least 80% identity with the amino acid sequence of SEQ ID NO: 31, a second CDR having at least 80% identity with the amino acid sequence of SEQ ID NO: 32, and a third CDR having at least 80% identity with the amino acid sequence of SEQ ID NO: 33.

[0023] In some embodiments, the molecular antagonist includes a heavy chain variable domain that has at least 80% identity with an amino acid sequence selected from the group consisting of SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29 and SEQ ID NO: 30.

[0024] In a specific embodiment, the molecular antagonist includes a light chain variable domain and a heavy chain variable domain; wherein the light chain variable domain includes a first CDR and a second CDR, each CDR having at least 95% identity with an amino acid sequence selected from the group consisting of SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, and SEQ ID NO: 24; wherein the heavy chain variable domain includes a first CDR having at least 80% identity with the amino acid sequence of SEQ ID NO: 31, a second CDR having at least 80% identity with the amino acid sequence of SEQ ID NO: 32, and a third CDR having at least 80% identity with the amino acid sequence of SEQ ID NO: 33. The molecular antagonist may be a single-chain variable fragment (scFv), an F(ab')2 fragment, a Fab or Fab' fragment, a bivalent antibody, a trivalent antibody, a tetravalent antibody, or a monoclonal antibody.

[0025] In other embodiments, the molecular antagonist comprises a light chain variable domain and a heavy chain variable domain; wherein the light chain variable domain has at least 80% identity with an amino acid sequence selected from the group consisting of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, and SEQ ID NO: 19; wherein the heavy chain variable domain has at least 80% identity with an amino acid sequence selected from the group consisting of SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, and SEQ ID NO: 30. The molecular antagonist may be a single-chain variable fragment (scFv), an F(ab')2 fragment, a Fab or Fab' fragment, a bivalent antibody, a trivalent antibody, a tetravalent antibody, or a monoclonal antibody.

[0026] In a specific implementation, the molecular antagonist is a monoclonal antibody having a light chain variable domain and a heavy chain variable domain, wherein the light chain variable domain has at least 80% identity with SEQ ID NO: 18, and the heavy chain variable domain has at least 80% identity with the amino acid sequence selected from the group consisting of SEQ ID NO: 28, SEQ ID NO: 29 and SEQ ID NO: 30.

[0027] In a more specific embodiment, the molecular antagonist is a complete monoclonal antibody having a light chain variable domain and a heavy chain variable domain, wherein the light chain variable domain has at least 90% identity with SEQ ID NO: 18 and the heavy chain variable domain has at least 90% identity with SEQ ID NO: 29.

[0028] The molecular antagonist can bind to the amino acid sequence of GIP, which is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4.

[0029] In a particular embodiment, the molecular antagonist is a complete monoclonal antibody that includes the human constant region.

[0030] The molecular antagonist has a molecular weight of about 30 kDa to about 500 kDa. This molecular antagonist can have a binding affinity for GIP, characterized by IC... 50 It ranges from approximately 0.1 nM to approximately 7 nM.

[0031] This composition can be administered intravenously, intraperitoneally, or subcutaneously. The composition may further comprise an inert pharmaceutical excipient selected from the group consisting of buffers, surfactants, preservatives, fillers, polymers, and stabilizers. The composition may be in the form of a powder, injection, solution, suspension, or emulsion.

[0032] The composition may contain a monoclonal antibody antagonist in an amount of about 0.1 mg to about 1000 mg per liter of the composition. Sometimes, the composition is lyophilized.

[0033] Fatty liver disease can be either alcoholic fatty liver disease or non-alcoholic fatty liver disease.

[0034] This article also discloses molecular antagonists of gastric inhibitory peptides (GIPs), which can be in several forms, such as intact monoclonal antibodies and their variants. These molecular antagonists are described above.

[0035] This article also discloses a complementary DNA sequence that has at least 85% identity with the DNA sequences selected from the group consisting of SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41 and SEQ ID NO: 42.

[0036] These and other non-limiting features of this disclosure will be discussed in more detail below. Attached Figure Description

[0037] This patent or application document contains at least one drawing shown in color. Upon request and payment of the required fee, the official authority will provide a copy of the published text of this patent or application, including the color-illustrated drawings.

[0038] The following is a brief description of the accompanying drawings, which are used to illustrate exemplary embodiments of the invention disclosed herein, and are not intended to limit these embodiments.

[0039] Figure 1A This is a graph showing mouse body weight vs. time during a 15-week study period for three different groups of mice. C57BL / 6 mice fed a high-fat diet are a definitive model of diet-induced obesity and related metabolic syndrome. "HFD-control" mice were fed a high-fat diet (HFD) and administered phosphate-buffered saline (PBS) via intraperitoneal injection. "HFD-mAb" mice were fed an HFD diet and administered a gastric inhibitory peptide monoclonal antibody (GIP mAb) antagonist in PBS via intraperitoneal injection at 60 mg / kg body weight (BW) weekly. "Isocal diet" mice were fed a low-fat isocalcal diet and received no treatment. In the HFD diet, 60% of total calories came from fat, while in the isocalcal diet, approximately 10% of total calories came from fat. Mice administered GIP mAb showed less rapid weight gain. After a 17-week study period, the mean weight gain of the HFD-control mice was 21.5 ± 1.0 g. After a 17-week study period, the mean weight gain of HFD-mAb mice was 11.5 ± 0.5 g. The difference in weight gain between the two groups was statistically significant (p = 0.00000007).

[0040] Figure 1B The graph shows the percentage weight gain vs. time in three different groups of mice. Mice administered GIP mAb gained weight less rapidly. The weight gain in the HFD-control mice was almost twice that of the HFD-mAb mice.

[0041] Figure 2This is a graph representing the results of the intraperitoneal (ip) glucose tolerance test (IPGTT). After a 17-week study period, six mice from each group underwent the IPGTT. Blood was collected at 0, 10, 30, 60, and 120 minutes after intraperitoneal administration of glucose solution (2 mg glucose / kg mouse body weight), and glucose levels were measured. The graph plots blood glucose concentration versus time. HFD-control mice were less efficient at handling intraperitoneal glucose loads than HFD-mAB mice or isocaloric mice. This is consistent with the development of glucose intolerance in HFD-control mice, but not in HFD-mAB or isocaloric mice.

[0042] Figure 3 Representative magnetic resonance images of mice are shown. Representative images from HFD-control mice (left) and HFD-mAb mice (right) are shown. The images depict side views of the mice, with the front of the mouse in the upper part of the image and the rear of the mouse in the lower part. White or bright areas represent areas with high fat content.

[0043] Figure 4 The number of liver fat fractions obtained by relaxor-compensated fat grading (RCFF) MRI is shown. At the end of a 17-week feeding period, six mice from each group were anesthetized and MRI was performed. The number of liver fat fractions in each mouse was quantitatively assessed using the RCFF technique. The mean number of liver fat fractions for each treatment group is plotted. Compared with mice treated with GIP-specific mAb (p = 0.03), the control animals had almost twice the amount of fat accumulated in their livers.

[0044] Figure 5 The number of omental fat fractions obtained by relaxed compensated fat grading (RCFF) MRI after a 17-week feeding period is shown. The mean number of omental fat fractions for each treatment group is plotted. Compared with mice treated with GIP-specific mAbs, control animals accumulated almost 3.5 times more omental fat (p = 0.0005).

[0045] Figure 6 The number of subcutaneous fat fractions obtained by relaxation-compensated fat fraction (RCFF) MRI is shown. A plot is drawn using the mean number of subcutaneous fat fractions for each treatment group. The control animals accumulated approximately twice the amount of subcutaneous fat compared to mice treated with GIP-specific mAbs (p = 0.0002).

[0046] Figure 7Representative photographs of stained tissue cross sections from the livers of euthanized mice after a 17-week study period are shown. The livers were removed and fixed in formalin. Fixed tissue sections were stained with Oil Red O, and lysochrome diazo dye was used to stain neutral triglycerides and lipids. The images show representative samples, demonstrating a significant reduction in deep red fat droplets in the livers of HFD-mAb mice (right) compared to HFD-control mice (left).

[0047] Figure 8 These are two (or a set) comparative images of omental fat found in HFD-control mice (left) and HFD-mAb mice (right) after a 17-week study period. The fat is white, and more fat is visible in the HFD control mice.

[0048] Figure 9 The levels of triglycerides (TG) measured in mouse serum are shown. Mice were sacrificed at the end of a 17-week feeding period, whole blood was collected, serum was prepared, and serum triglycerides were measured. A plot is shown using the mean serum triglyceride levels of mice in each group. The TG level in the HFD-control mice was 1.44 times that in the HFD-mAb mice (p = 0.02). Higher TG levels were associated with obesity and metabolic syndrome.

[0049] Figure 10 The total cholesterol (TC) levels in the serum of mice after a 17-week feeding period are shown. The TC level in the HFD-control mice was 1.55 times higher than that in the HFD-mAb mice (p = 0.006). Higher TC levels are associated with obesity and metabolic syndrome.

[0050] Figure 11 The percentage of high-density lipoprotein (HDL) to total cholesterol (TC) in the serum of mice after a 17-week feeding period is shown. The values ​​are plotted using the mean values ​​from each group. The percentage of HDL to total cholesterol in HFD-mAb mice was 25% higher than that in HFD-control mice (p = 0.03). A higher percentage of HDL to total cholesterol is desirable, as a low percentage is associated with obesity and metabolic syndrome.

[0051] Figure 12 Low-density lipoprotein (HDL) levels were measured in the serum of mice after a 17-week feeding period. The mean serum LDL levels of mice in each group were plotted. LDL levels in HFD-control mice were 1.95 times higher than those in HFD-mAb mice (p = 0.007). Higher LDL (“bad” cholesterol) levels are associated with obesity and metabolic syndrome.

[0052] Figure 13The table shows serum insulin levels in mice after a 17-week feeding period. The average serum insulin levels from five mice in each group are plotted. Insulin levels in HFD-control mice were 2.6 times higher than those in HFD-mAb mice (p = 0.03). Higher insulin levels were associated with obesity, insulin resistance, and metabolic syndrome. Note that the y-axis is in picograms per milliliter.

[0053] Figure 14 The levels of adiponectin in the serum of mice after a 17-week feeding period are shown. A plot is created using the mean serum adiponectin levels of mice in each group. The adiponectin level in the HFD-control mice was 1.35 times that in the HFD-mAb mice. Higher adiponectin levels are associated with increased overall body fat. Note that the y-axis is in micrograms per milliliter.

[0054] Figure 15 The table shows leptin levels in the serum of mice after a 17-week feeding period. A plot is shown using the mean serum leptin levels of mice in each group. Leptin levels in the HFD-control mice were 5.73 times higher than those in the HFD-mAb mice. Higher leptin levels are associated with increased overall visceral fat. Note that the y-axis is in picograms per milliliter.

[0055] Figure 16 The levels of glucagon in the serum of mice after a 17-week feeding period are shown. A plot is created using the mean serum glucagon levels of mice in each group. There were no significant differences in serum glucagon levels between groups. Note that the y-axis is in picograms per milliliter.

[0056] Figure 17 The levels of glucagon-like peptide-1 (GLP-1) in the serum of mice after a 17-week feeding period are shown. A plot is created using the mean serum GLP-1 levels of mice in each group. There were no significant differences in serum GLP-1 levels between groups. Note that the Y-axis is in picograms per milliliter.

[0057] Figure 18 The diagram illustrates the relative activities of three humanized antibodies for GIP, along with the original antibody, positive control, and negative control, in an in vitro neutralization assay. The y-axis represents relative activity and is unitless. Invention Details

[0058] Unless otherwise explicitly stated in the context, the singular forms “a,” “one,” and “the” include their plural forms.

[0059] As used in this specification and claims, the open-ended transitional terms “comprising,” “including,” “having,” “containing,” and variations thereof require the presence of a specified ingredient / step and permit the presence of other ingredients / steps. These phrases should also be understood to disclose closed-ended phrases such as “consisting of” or “consisting substantially of” that permit only the specified ingredient / step and unavoidable impurities and exclude other ingredients / steps.

[0060] The numerical values ​​in the specification and claims of this application should be understood to include values ​​that are the same when retained to the same significant number, and values ​​that differ from the defined numerical values ​​by less than the experimental error that would occur with conventional measurement techniques described in this application.

[0061] All ranges disclosed herein include the introduced endpoint values ​​and can be combined individually (e.g., the range “from 2g to 10g” includes endpoints 2g and 10g as well as all intermediate values).

[0062] The term "approximately" can be used to include any numerical value that can vary without altering its underlying functionality. When used with a range, "approximately" also discloses a range defined by the absolute values ​​of its two endpoints. For example, the statement "from approximately 2 to approximately 4" also discloses a range "from 2 to 4". The term "approximately" can also refer to a given value ±10%.

[0063] The term "identity" refers to the similarity between a pair of sequences (nucleotides or amino acids). Identity is determined by dividing the number of identical residues by the total number of residues and multiplying the quotient by 100 to obtain a percentage. Therefore, two copies of an identical sequence have 100% identity, but sequences that are less highly conserved and have deletions, additions, or substitutions may have a lower degree of identity. Those skilled in the art will recognize that several computer programs can be used to determine sequence identity, such as those employing algorithms like BLAST. BLAST nucleotide searches are performed using the NBLAST program, and BLAST protein searches are performed using the BLASTP program, with the default parameters of each program used.

[0064] Two distinct sequences can be different from each other without affecting the overall function of the protein encoded by that sequence. In this regard, it is known in the art that chemically similar amino acids can substitute for each other, usually without altering function. Relevant properties can include acidity / basicity, polarity / nonpolarity, charge, hydrophobicity, and chemical structure. For example, basic residues Lys and Arg are considered chemically similar and often substitute for each other; other examples include acidic residues Asp and Glu, hydroxyl residues Ser and Thr, aromatic residues Tyr, Phe and Trp, and nonpolar residues Ala, Val, Ile, Leu, and Met. These substitutions are considered “conserved.” Similarly, nucleotide codons and acceptable variations are well known in the art. For example, codons ACT, ACC, ACA, and ACG all encode the amino acid threonine, meaning the third nucleotide can be changed without altering the resulting amino acid. Similarity is determined by dividing the number of similar residues by the total number of residues, and then multiplying the quotient by 100 to obtain a percentage. Note that similarity and identity measure different properties.

[0065] Antibodies are proteins used by the immune system to recognize target antigens. The basic functional unit of an antibody is an immunoglobulin monomer. A monomer consists of two identical heavy chains and two identical light chains forming a Y-shaped protein. Each light chain consists of one constant domain and one variable domain. For the light chain, the constant domain can also be called the "constant region," and the variable domain can also be called the "variable region." Each heavy chain consists of one variable domain and three or four constant domains. For the heavy chain, the constant domains together are called the "constant region," and the variable domain can also be called the "variable region." The arms of the Y are called fragments, antigen-binding (Fab) regions, and each arm is called a Fab fragment. Each Fab fragment consists of one constant domain and one variable domain from the heavy chain, and one constant domain and one variable domain from the light chain. The base of the Y is called the Fc region, which consists of two or three constant domains from each heavy chain. The variable domains of the heavy and light chains in the Fab region are the part of the antibody that binds to the GIP. More specifically, the complementarity-determining regions (CDRs) of the variable domains bind to their antigens (i.e., GIPs). Within the amino acid sequence of each variable domain, there are three non-contiguous CDRs. The term "complete" is used in this article to refer to an antibody that contains both the Fab and Fc regions.

[0066] According to this disclosure, "GIP antagonists" are molecules that bind to GIP and interfere with the biological effects of GIP.

[0067] This disclosure relates to a method of treating patients using molecules that antagonize GIP (i.e., bind to GIP). In this regard, glucose-dependent insulinotropic peptides (also known as gastric inhibitory peptides or GIPs) are insulinotropic peptides released by intestinal K-cells after a meal. As an intestinal hypoglycemic agent, GIPs stimulate insulin secretion by stimulating pancreatic β-cells in response to food intake. GIPs (also described herein as GIP(1-42)) primarily circulate as a 42-amino acid polypeptide, but also exist in a form lacking the first two N-terminal amino acids (GIP(3-42)). GIP(1-30)-NH2 or GIP(1-30)-α-amides are synthetic derivatives of GIP(1-42) lacking the last 12 C-terminal amino acids. GIP(1-30)-NH2 has the same biological function as GIP(1-42). Naturally occurring GIP(1-30)-NH2 has been presumed, but has not yet been identified in any biological species.

[0068] GIP exerts its effects by binding to its homologous receptor (GIPR) on the surface of target cells. GIPR is a member of the glucagon-secreting hormone family of G-protein-coupled receptors (GPCRs) with seven transmembrane domains. Natural GIP(1-42) and the synthetic derivative GIP(1-30)-NH2 bind to GIPR with high affinity and exhibit agonist properties. GIP receptors are also expressed in adipocytes, where elevated GIP levels occur in response to increased glucose uptake, fatty acid synthesis, and the influx of fatty acids into lipids within adipocytes. Natural GIP(1-42) and the synthetic derivative GIP(1-30)-NH2 also inhibit intracellular lipolysis induced by glucagon and β-adrenergic receptor agonists, including isoproterenol.

[0069] GIP is highly conserved among humans (Homo sapiens) (SEQ ID NO: 1), mice (house mice) (SEQ ID NO: 2), rats (brown rats) (SEQ ID NO: 3), and pigs (wild boars) (SEQ ID NO: 4). Only four substitutions exist between these four sequences, all of which are conserved. The 42 amino acid sequences from these four species are shown below:

[0070] SEQ ID NO: 1: YAEGT FISDY SIAMD KIHQQ DFVNW LLAQK GKKND WKHNI TQ

[0071] SEQ ID NO: 2: YAEGT FISDY SIAMD KIRQQ DFVNW LLAQR GKKSD WKHNI TQ

[0072] SEQ ID NO: 3: YAEGT FISDY SIAMD KIRQQ DFVNW LLAQK GKKND WKHNL TQ

[0073] SEQ ID NO: 4: YAEGT FISDY SIAMD KIRQQ DFVNW LLAQK GKKSD WKHNI TQ

[0074] This application relates to a method of treating fatty liver disease (FLD) using a composition comprising a molecular antagonist containing GIP, and also to methods of treating other diseases associated with adipose tissue accumulation. In a particular embodiment, the molecular antagonist is a complete monoclonal antibody (i.e., GIP mAb). In fatty liver, steatosis leads to the accumulation of triglyceride fat within hepatocytes. It is known that after oral glucose administration, serum GIP levels increase 5 to 6 times, stimulating insulin release, which promotes glucose uptake. GIP also activates Akt / PKB, promoting membrane translocation of glucose transporter 4, thereby leading to enhanced glucose uptake by adipocytes, resulting in fat production and storage. As a result, it is presumed that antagonizing GIP and reducing its biological activity will inhibit glucose uptake, thereby leading to reduced fat production and storage. This disclosure demonstrates that fat retention in the liver, omentum, or subcutaneous tissue can be reduced by administering to a patient a composition comprising a GIP monoclonal antibody antagonist. Other molecular antagonists (which exhibit variations in the CDR of the monoclonal antibody) can also effectively reduce adipose tissue accumulation.

[0075] The GIP molecular antagonists described in this article can also be used to improve other diseases or conditions that can be treated by reducing GIP expression or by reducing calorie intake or losing weight, such as obesity, metabolic syndrome, hyperlipidemia, type II diabetes, and food-induced Cushing's syndrome.

[0076] The GIP monoclonal antibody antagonist disclosed herein can be produced and secreted via the following pathway. Two peptides having the following amino acid sequences are chemically synthesized:

[0077] GIP(1-17)+C:YAEGT FISDY SIAMD KIC(SEQ ID NO:5)

[0078] C+mGIP(26-42): CLLAQ RGKKS DWKHN ITQ (SEQ ID NO: 6)

[0079] The amino acid sequence of GIP(1-17)+C corresponds to the first 17 amino acids typically shared by mature human, mouse, rat, and porcine GIPs. This sequence also includes an additional cysteine ​​residue at the N-terminus to facilitate conjugation to keyhole hemocyanin (KLH). The amino acid sequence of C+mGIP(26-42) corresponds to the last 17 amino acids of mature mouse GIP, with only two amino acid substitutions compared to non-morcine GIP or porcine GIP, and only three amino acid substitutions compared to rat GIP. This sequence also includes an additional cysteine ​​residue at the C-terminus to facilitate conjugation to KLH. Both peptides were conjugated to KLH. Each conjugate was then injected into a cohort of four mice at four different times. Injections were performed at weeks 1, 4, 7, 10, and 24, followed by spleen collection.

[0080] Spleens were removed from immunized mice, and spleen cells were isolated and then fused with B cells in vitro using myeloma cells that proliferated indefinitely. Polyethylene glycol (PEG) was added during this fusion process to improve efficiency. The fused cells, or hybridomas, were cultured in hypoxanthine-aminopterin-thymidine (HAT) medium for 14 days to kill myeloma cells that did not fuse with B cells. The hybridoma cells were then diluted with culture medium and transferred to a series of 96-well plates. The dilution was such that approximately one cell was contained in each well. The hybridoma cells were allowed to grow for several days, after which the conditioning medium or supernatant was collected for screening.

[0081] 50 μl of PBS solution containing 4 μg / ml synthetic mouse GIP (1-42) (Phoenix Pharmaceuticals) was used to cover 96-well plates. The supernatant from the hybridomas was then collected and added to the wells containing mouse GIP (1-42), and incubated at 37°C for 4 hours. The supernatant was then removed and washed to remove any antibodies not bound to the mouse GIP. Next, a solution of goat anti-mouse IgG conjugated with horseradish peroxidase (HRP) was added to the wells. Goat anti-mouse IgG-HRP was obtained from Jackson's laboratory and diluted 1:5000. After incubation at 37°C for 1 hour, the antibody solution was removed, and the wells were washed twice with PBS solution containing 0.4 mg / ml BSA.

[0082] A solution containing 4 mg / ml o-phenylenediamine dihydrochloride (OPO) and 0.05 M phosphate-citrate in 0.4 mg / ml hydrourea peroxide, at pH 5.0, was then added to each well. To quantify HRP activity, the absorbance of each well was measured at 490 nm using an ELISA plate reader. This allowed for the identification of monoclonal antibodies produced within the wells that would bind to mouse GIP, via hybridoma analysis.

[0083] Next, the supernatant from the identified hybridomas was mixed with 4 μg / ml mouse GIP solution for 30 minutes at 37°C and then added to wells coated with mouse GIP as described above. After incubation at 37°C for 1 hour, the wells were washed, and goat anti-mouse IgG-HRP was added to the wells. After incubation for 1 hour, the samples were washed, and a solution containing 4 mg / ml OPO of HRP substrate in 0.4 mg / ml hydrourea peroxide and 0.05 M phosphate-citrate at pH 5.0 was added to each well. The HPR activity in each well was quantified. In this screening, monoclonal antibodies binding to GIP in suspension would be "neutral" and would not bind to GIP immobilized in the wells. Therefore, wells with low HPR activity corresponded to monoclonal antibodies that more effectively bound to GIP in suspension. Using these criteria, five hybridomas were identified that optimally produced monoclonal antibodies (mAbs) that bound to mouse GIP in suspension. Given the high degree of identity between mouse GIP and human GIP, it is expected that these monoclonal antibodies that bind to mouse GIP will also bind to human GIP.

[0084] Next, the ability of hybridoma supernatants to neutralize GIP and inhibit ligand-receptor interactions, receptor activation, and receptor-dependent signal transduction was tested using a cell culture system. This system used reporter cells (LGIPR2 cells) with the lacZ gene controlled by a cyclic adenosine monophosphate (cAMP-) responsive promoter and expressing rat GIPR on their cell surface. Adding GIP to these cells led to GIPR activation, inducing a signaling cascade that led to cAMP accumulation, inducing the lacZ gene, and synthesizing β-galactosidase. After adding the sample and incubating for 4 hours, the β-galactosidase content in cell lysates was measured colorimetrically. Changes in color intensity were proportional to the level of β-galactosidase activity. The level of β-galactosidase activity depended on the amount of free, biologically active GIP in the sample.

[0085] The supernatants from five hybridoma clones grown in culture (which scored positive in the suspension assay) were diluted 1:1 and 1:20 using mouse or human GIP, respectively. The mixtures were then added to LGIPR2 cells and cultured, followed by washing and β-galactosidase assay. At the 1:1 dilution, three of the five supernatants showed significant inhibition of mouse GIP, and at the 1:20 dilution, two of the three supernatants showed significant inhibition of mouse GIP.

[0086] To demonstrate the specificity of the monoclonal antibody against GIP, the supernatant of five hybridomas (which scored positive in the suspension assay) was diluted 1:1 with 0.1 nM human glucagon-like peptide-1 (GLP-1) solution. The mixture was then added to LGLP-1R cells. LGLP-1R cells are similar to LGIPR2 cells, except that they express the GLP-1 receptor instead of GIPR. The cells were incubated at 37°C for 4 hours, after which the mixture was removed, the cells were washed, and β-galactosidase levels were measured. No inhibition of native GLP-1 was observed in the supernatant, indicating that the monoclonal antibody is specific for GIP.

[0087] Next, the two hybridomas were amplified, and ~5 x 10⁻⁶ samples were collected. 5 Total RNA was prepared from two hybridomas using a kit purchased from Ambion (RNaqueous-4PCR, Life Technologies), where the two hybridomas produced supernatants that showed significant inhibition of mouse GIP at a 1:20 dilution. Using 2 μg of total RNA, first-strand cDNA was prepared using the Superscript III first-strand system for cDNA synthesis, purchased from Life Technologies. The resulting cDNA was used to amplify cDNA encoding variable sequences of the heavy and light chains in two separate polymerase chain reactions (PCR).

[0088] To amplify the heavy chain variable sequence, an oligonucleotide sequence CAGTCGAAGCTTTGAGGAGA CGGTGACCGTGGTCCCTTGGC CCCAG (SEQ ID NO: 43) was used as the reverse primer, and an oligonucleotide sequence CAACTAGGATCCAGGTSMAR CTGCAGSAGT CWGG (SEQ ID NO: 44) was used as the forward primer. The reverse primer contained the sequence AAGCTTT (SEQ ID NO: 45) at its 5' end, which is the recognition sequence for the restriction endonuclease HindIII. The forward primer contained the sequence GGATCC (SEQ ID NO: 46) at its 5' end, which is the recognition sequence for the restriction endonuclease BamHI. The PCR product was digested with restriction endonucleases HindIII and BamHI, and then ligated into plasmid pUC18, which was also digested with restriction endonucleases HindIII and BamHI. The ligation reaction was performed using the Fast-Link kit purchased from Epicentre. The ligation reaction was used to transform *E. coli* DH5α cells (Life Technologies). Bacteria carrying the plasmid were screened on agar plates containing 50 μg / ml carbenicillin. Colonies growing on the carbenicillin agar plates were picked and incubated in 2 ml of medium for 16 hours. Bacteria were collected and plasmid DNA was isolated using the alkaline lysis micropreparation method. The purified plasmid DNA was digested with restriction endonucleases BamHI and HindIII, and then resolved by electrophoresis on a 1.2% agarose gel in Tris-borate buffer. DNA fragments in the gel were stained with ethidium bromide and observed under UV light. The plasmid, which produced a restriction fragment of approximately 374 base pairs, was sequenced using a device purchased from Eurofins MWG Operon (Huntsville, AL).

[0089] To amplify the light chain variable sequence, the same steps as described above were generally followed. The main difference was that an oligonucleotide with the sequence CAGTCGAAGC TTGTTAGATC TCCAGCTTG GTCCC (SEQ ID NO: 47) was used as the forward primer, and an oligonucleotide with the sequence CAACTAGGAT CCGACATTCA GCTGACCCAG TCTCCA (SEQ ID NO: 48) was used as the reverse primer. The forward primer still contained the HindIII recognition sequence (SEQ ID NO: 45), and the reverse primer contained the BamHI recognition sequence (SEQ ID NO: 46). The plasmid, which produced a restriction fragment of approximately 355 base pairs, was sequenced using a device purchased from Eurofins MWG Operon (Huntsville, AL).

[0090] The mAbs obtained using the above steps are mouse antibodies. These mouse antibodies are partially humanized by forming chimeric antibodies, which have mouse heavy chain variable domains and light chain variable domains fused into the human heavy chain constant region and light chain constant region, respectively. This is accomplished by amplifying the heavy chain and light chain variable sequences using polymerase chain reaction (PCR). The template used in PCR is a pUC18 derivative containing the corresponding variable heavy chain cDNA sequence or variable light chain cDNA sequence. The heavy chain variable region is amplified using an oligonucleotide with the sequence TCACGAATTC TCAGGTCCAG CTGCAGGAGT (SEQ ID NO: 49) as a forward primer and an oligonucleotide with the sequence TTGGTGCTAG CTGAGGAGAC GGTGACCGT (SEQ ID NO: 50) as a reverse primer. The forward primer contains the sequence GAATTC (SEQ ID NO: 51) at its 5' end, which is the recognition sequence for the restriction endonuclease EcoRI. The reverse primer contained the sequence GCTAGC (SEQ ID NO: 52) at its 5' end, which is the recognition sequence for the restriction endonuclease NheI. After PCR amplification, the DNA fragment was digested with EcoRI and NheI and ligated into the plasmid pFUSEss-CHIg-hG1, which was also digested with the restriction endonucleases EcoRI and NheI. The plasmid pFUSEss-CHIg-hG1 was a mammalian expression vector purchased from InvivoGen (San Diego, CA). The variable heavy chain cDNA sequence was cloned into this plasmid to generate a gene encoding a chimeric heavy chain consisting of mouse and human variable regions. The ligation reaction was performed using the Fast-Link kit purchased from Epicentre. The ligation reaction was used to transform *E. coli* DH5α cells (Life Technologies). Bacteria carrying the plasmid were screened on agar plates containing 50 μg / ml bleomycin. Colonies growing on bleomycin agar plates were picked and incubated in 2 ml of medium for 16 hours. Bacteria were collected and plasmid DNA was isolated using a small-scale alkaline lysis method. The purified plasmid DNA was digested with restriction endonucleases EcoRII and NheI, and then resolved by electrophoresis on a 1.2% agarose gel in Tris-borate buffer. DNA fragments in the gel were stained with ethidium bromide and observed under UV light. Cloning was confirmed by identifying a DNA fragment with a molecular size of 373 base pairs.

[0091] The light chain variable region was amplified using an oligonucleotide with the sequence GTCACGAATTCAGACATTCAGCTGACCCAG (SEQ ID NO: 55) as the forward primer and the sequence AGCCACCGTA CGTTTGATCT CCAGCTTGGT CCCA (SEQ ID NO: 53) as the reverse primer. The forward primer sequence contained the recognition sequence of the restriction endonuclease EcoRI (SEQ ID NO: 51). The reverse primer contained the sequence CGTACG (SEQ ID NO: 54) at its 5' end, which is the recognition sequence of the restriction endonuclease BsiWI. After PCR amplification, the DNA fragment was digested with EcoRI and BswiI and ligated into the plasmid pFUSE2ss-CLIg-hK, which was also digested with the restriction endonucleases EcoRI and BswiI. The plasmid pFUSE2ss-CLIg-hK was a mammalian expression vector purchased from InvivoGen (San Diego, CA). The variable light chain cDNA sequence was cloned into the plasmid to generate a gene encoding a chimeric light chain consisting of a mouse variable region and a human constant region. Ligation was performed using the Fast-Link kit from Epicentre. The ligation reaction was used to transform *E. coli* DH5α cells (Life Technologies). Bacteria carrying the plasmid were screened on agar plates containing 50 μg / ml blastocidin. Colonies growing on the blastocidin agar plates were picked and incubated in 2 ml of medium for 16 hours. Bacteria were collected and plasmid DNA was isolated using the alkaline lysis microparticle method. The purified plasmid DNA was digested with restriction endonucleases EcoRII and BsiWI, and then separated by electrophoresis on a 1.2% agarose gel in Tris-borate buffer. DNA fragments in the gel were stained with ethidium bromide and observed under UV light. Cloning was confirmed by identification of a DNA fragment with a molecular size of 353 base pairs.

[0092] To express chimeric vectors containing variable regions cloned from hybridomas and human constant regions, pFUSEss-CHIg-hG1 and pFUSE2ss-CLIg-hK derivatives, containing variable heavy and light chain sequences respectively, were introduced into Chinese hamster ovary (CHO-1) cells. Plasmid DNA was introduced via transfection using the cationic lipid reagent Turbofect (Thermo Scientific, Pittsburgh, PA), facilitating DNA entry into the cultured cells. Two days post-transfection, cell supernatants were collected, and GIP neutralization activity was analyzed. To demonstrate the GIP neutralization ability of the chimeric mAb, the cell supernatant was mixed with an equal volume of 2 x 10⁻⁶ ppm of... -9M hGIP was mixed, and then LGIPR2 cells were added to the culture. After incubation at 37°C for 4 hours, the cells were lysed and β-galactosidase activity was measured. In this assay, plasmid combinations containing variable light chain and variable heavy chain sequences from hybridomas designated as 10g10 exhibited GIP-neutralizing activity in a cell-based reporting analysis.

[0093] The variable region of the mAb prepared and identified using the steps disclosed above is retained, and the constant region is replaced with a human constant region. Optionally, a GIP mAb antagonist can be produced using transgenic mice, thereby generating a "fully" human mAb, or other techniques can be used. For example, amino acids in the variable domain conserved in mouse antibodies can be replaced with amino acids conserved in human antibodies.

[0094] The resulting monoclonal antibody antagonist binds to GIP. In a specific embodiment, the molecular antagonist used in the compositions of this disclosure can bind to an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4. In other words, the antagonist (e.g., a monoclonal antibody) binds to an epitope contained in these four sequences.

[0095] In various embodiments, the molecular antagonist has a molecular weight of about 30 kDa to about 500 kDa, including about 120 kDa to 500 kDa. In other embodiments, the molecular antagonist has a binding affinity for GIP, characterized by IC 50 It ranges from approximately 0.1 nM to approximately 7 nM.

[0096] As previously described, the GIP-binding monoclonal antibody antagonist has a light chain variable domain and a heavy chain variable domain that bind to GIP, or more specifically, a CDR of the light chain variable domain and a CDR of the heavy chain variable domain that bind to GIP. It is generally contemplated that the molecular antagonist of this disclosure comprises at least one GIP-binding complementarity-determining region (CDR). More specifically, the molecular antagonist comprises at least one CDR having at least 80% identity with an amino acid sequence selected from the group consisting of SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 31, SEQ ID NO: 32, and SEQ ID NO: 33. These CDRs are identified through various modifications to the variable domains in the light and heavy chains identified in the aforementioned 10g10 hybridoma. These modifications will be discussed in more detail in the Examples section below. More ideally, the CDR(s) have / have at least 85%, or at least 90%, or at least 95%, or at least 100% identity with these amino acid sequences. In a more specific embodiment, the molecular antagonist comprises two, three, four, five, or six CDRs that have the necessary identity with two, three, four, five, or six different amino acids from the group described above.

[0097] In a more specific embodiment, the molecular antagonist comprises a light chain variable domain having a first CDR and a second CDR, each CDR having at least 95% identity with an amino acid sequence selected from the group consisting of SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, and SEQ ID NO: 24. These CDRs are identified within the variable domain of the light chain. More ideally, the CDRs have 100% identity with these amino acid sequences.

[0098] In other specific embodiments, the molecular antagonist comprises a light chain variable domain having a first CDR having at least 80% identity with the amino acid sequence of SEQ ID NO: 20, a second CDR having at least 80% identity with the amino acid sequence of SEQ ID NO: 21, and a third CDR having at least 80% identity with the amino acid sequence of SEQ ID NO: 22. Variable domains containing a combination of these three CDRs have been identified as having very high GIP binding affinity. More ideally, the three CDRs have at least 85%, or at least 90%, or at least 95%, or 100% identity with these amino acid sequences.

[0099] In another embodiment, the molecular antagonist comprises a heavy chain variable domain having a first CDR having at least 80% identity with the amino acid sequence of SEQ ID NO: 31, a second CDR having at least 80% identity with the amino acid sequence of SEQ ID NO: 32, and a third CDR having at least 80% identity with the amino acid sequence of SEQ ID NO: 33. The variable domain containing a combination of these three CDRs has been identified as having very high GIP binding affinity. More ideally, the three CDRs have at least 85%, or at least 90%, or at least 95%, or 100% identity with these amino acid sequences.

[0100] Typically, these variable domains are envisioned to contain two or three CDRs as specified above, and the CDRs are linked to each other by a linker group. The linker group can generally be any group that allows the CDRs to bind to the GIP. For example, the linker group can be an amino acid chain, as is present in the native variable domains of the antibody. Amino acids can have any desired length.

[0101] In a particular embodiment, the molecular antagonist includes a light chain variable domain that has at least 80% identity with an amino acid sequence selected from the group consisting of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, and SEQ ID NO: 19. More ideally, the light chain variable domain has at least 85%, or at least 90%, or at least 95%, or 100% identity with one of these amino acid sequences. These variable domains comprise various combinations of light chain CDRs of SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, and SEQ ID NO: 24 linked to amino acids.

[0102] In other embodiments, the molecular antagonist includes a heavy chain variable domain that has at least 80% identity with an amino acid sequence selected from the group consisting of SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, and SEQ ID NO: 30. More ideally, the heavy chain variable domain has at least 85%, or at least 90%, or at least 95%, or 100% identity with one of these amino acid sequences. These variable domains comprise various combinations of heavy chain CDRs of SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, and SEQ ID NO: 34 linked to amino acids.

[0103] Molecular antagonists having any combination of the light chain variable domains and heavy chain variable domains disclosed above are also considered. More specifically, some molecular antagonists contain only one light chain variable domain and one heavy chain variable domain. Other molecular antagonists contain multiple light chain variable domains and heavy chain variable domains; in these embodiments, generally speaking, the multiple light chain variable domains are identical, and the multiple heavy chain variable domains are identical.

[0104] In some specific embodiments, the molecular antagonist comprises a light chain variable domain and a heavy chain variable domain. The light chain variable domain includes a first CDR and a second CDR, each CDR having at least 95% identity with an amino acid sequence selected from the group consisting of SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, and SEQ ID NO: 24; and the heavy chain variable domain includes a first CDR having at least 80% identity with the amino acid sequence of SEQ ID NO: 31, a second CDR having at least 80% identity with the amino acid sequence of SEQ ID NO: 32, and a third CDR having at least 80% identity with the amino acid sequence of SEQ ID NO: 33. The light chain variable domain may have 100% identity with one of the listed amino acid sequences. More specifically, the heavy chain variable domain has at least 85%, or at least 90%, or at least 95%, or 100% identity with one of the listed amino acid sequences.

[0105] In some other specific embodiments, the molecular antagonist includes a light chain variable domain and a heavy chain variable domain. The light chain variable domain has at least 80% identity with an amino acid sequence selected from the group consisting of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, and SEQ ID NO: 19; and the heavy chain variable domain has at least 80% identity with an amino acid sequence selected from the group consisting of SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, and SEQ ID NO: 30. More specifically, the light chain variable domain and / or the heavy chain variable domain has at least 85%, or at least 90%, or at least 95%, or 100% identity with one of the listed amino acid sequences.

[0106] In some more specific embodiments, the molecular antagonist includes a light chain variable domain having at least 80% identity with SEQ ID NO: 18, and a heavy chain variable domain having at least 80% identity with an amino acid sequence selected from the group consisting of SEQ ID NO: 28, SEQ ID NO: 29, and SEQ ID NO: 30. Furthermore, these variable domains are capable of having at least 85%, at least 90%, at least 95%, or 100% identity with one of the listed amino acid sequences.

[0107] In a particularly advantageous embodiment, the molecular antagonist comprises a light chain variable domain having at least 90% identity with SEQ ID NO: 18 and a heavy chain variable domain having at least 90% identity with SEQ ID NO: 29. In a more specific embodiment, these variable domains are capable of having at least 95% or 100% identity with one of the amino acid sequences listed therein.

[0108] In some different embodiments, the molecular antagonist of this disclosure has light chain variable domains and heavy chain variable domains as described above. In particular, it is contemplated that the molecular antagonist may be a single-chain variable fragment (scFv), an F(ab')2 fragment, a Fab or Fab' fragment, a bivalent antibody, a trivalent antibody, a tetravalent antibody, or a monoclonal antibody, wherein these variable domains are a subset of those described above.

[0109] Single-chain variable fragments (scFvs) consist of light chain variable domains and heavy chain variable domains, typically linked together by a linker group that is usually about 10 to about 25 amino acids in length (though it doesn't necessarily have to be within this range). The N-terminus of one variable domain is attached to the C-terminus of the other variable domain. If desired, the scFv can be PEGylated (with polyethylene glycol) to increase its size, as can be done using certolizumab monoclonal antibody. Two scFvs can be linked together using another linker group to create tandem scFvs.

[0110] If the light chain variable domain and the heavy chain variable domain are linked together by a short linker to form an scFv, then the two variable domains cannot fold together, and the scFv will dimerize to form a divalent antibody. Even shorter linkers may lead to the formation of trimers (i.e., trivalent antibodies) and tetramers (i.e., tetravalent antibodies).

[0111] A complete monoclonal antibody is formed from two heavy chains and two light chains. Again, each light chain and each heavy chain contains a variable domain. Each light chain binds to a heavy chain. The two heavy chains are joined together at the hinge region. If the heavy chain constant region below the hinge region is removed, an F(ab')2 fragment containing a total of four variable domains is generated. This F(ab')2 fragment can be split into two Fab' fragments. The Fab' fragment contains thiol groups from the hinge region. When the heavy chain constant region above the hinge region is removed, the Fab fragment is formed and does not contain thiol groups from the hinge region. However, all of these fragments contain both light chain and heavy chain variable domains.

[0112] In the desired implementation explored in the experiments described below, the molecular antagonist is a complete monoclonal antibody formed from the aforementioned light and heavy chains having variable regions / domains together with a human constant region. The heavy chain constant region can be any human isotype, including IgA1, IgA2, IgD, IgE, IgG1, IgG2, IgG3, IgG4, or IgM. The human light chain constant region can be a κ or λ isotype. In a specific implementation, the heavy chain constant region is the IgG1 isotype, and the light chain constant region is the κ isotype.

[0113] In a particular embodiment, the molecular antagonist is a monoclonal antibody having a light chain variable domain and a heavy chain variable domain, wherein the light chain variable domain has at least 80% identity with SEQ ID NO: 18, and the heavy chain variable domain has at least 80% identity with an amino acid sequence selected from the group consisting of SEQ ID NO: 28, SEQ ID NO: 29, and SEQ ID NO: 30. These variable domains may have at least 85%, at least 90%, at least 95%, or 100% identity with one of the listed amino acid sequences.

[0114] In other specific embodiments, the molecular antagonist is a complete monoclonal antibody having a light chain variable domain and a heavy chain variable domain, wherein the light chain variable domain has at least 90% identity with SEQ ID NO: 18 and the heavy chain variable domain has at least 90% identity with SEQ ID NO: 29. These variable domains are capable of having at least 95% or 100% identity with one of the amino acid sequences listed therein.

[0115] Then, a molecular antagonist of GIP (specifically, a monoclonal antibody) can be used in a composition administered to a patient. The composition contains a pharmaceutically effective amount of the molecular antagonist of GIP. In a particular embodiment, the amount of the molecular antagonist in the composition is from about 0.1 to about 1000 mg / mL of the composition (w / v).

[0116] Pharmaceutical compositions containing GIP molecular antagonists are typically administered via a parenteral route (i.e., subcutaneous, intramuscular, intravenous, intraperitoneal, intrapleural, intracapsular, or intrathecal), chosen based on the drug and disease requirements. The dosage used in a particular formulation or application will be determined by the requirements of the disease-specific state and by limiting factors posed by the capabilities of the carrier material. It is anticipated that, in the most advantageous form, the composition will be administered intravenously, intraperitoneally, or subcutaneously.

[0117] Pharmaceutical compositions may include pharmaceutically acceptable carriers. These carriers act as a medium for delivering the molecular antagonist. Examples of pharmaceutically acceptable carriers include liquid carriers (such as water, oil, and alcohol) in which the molecular antagonist can be dissolved or suspended.

[0118] Pharmaceutical compositions may also include excipients. Specific excipients include buffers, surfactants, preservatives, fillers, polymers, and stabilizers, which are useful as antagonists of these molecules. Buffers are used to control the pH of the composition. Surfactants are used to stabilize proteins, inhibit protein aggregation, inhibit protein adsorption to surfaces, and assist protein refolding. Exemplary surfactants include Tween 80, Tween 20, Brij 35, Triton X-10, Pluronic F127, and sodium dodecyl sulfate. Preservatives are used to inhibit microbial growth. Examples of preservatives include benzyl alcohol, m-cresol, and phenol. Fillers are used in the lyophilization process to increase volume. Hydrophilic polymers (such as dextran, hydroxyethyl starch, polyethylene glycol, and gelatin) can be used to stabilize proteins. Polymers with nonpolar moieties (such as polyethylene glycol polymers) can also be used as surfactants. Protein stabilizers may include polyols, sugars, amino acids, amines, and salts. Suitable sugars include sucrose and trehalose. Amino acids include histidine, arginine, glycine, methionine, proline, lysine, glutamic acid, and mixtures thereof. Proteins such as human serum albumin can also competitively adsorb onto surfaces and reduce the aggregation of protein-like molecule antagonists. It should be noted that specific molecules can be used for multiple purposes. For example, histidine can act as a buffer and antioxidant. Glycine can be used as a buffer and filler.

[0119] The pharmaceutical composition may be in the form of a powder, injection, solution, suspension, or emulsion. It is conceivable that the composition will be delivered by injection. Sometimes, the molecular antagonist of the GIP can be lyophilized using standard techniques known in the art. The lyophilized antagonist can then be reconstituted using, for example, suitable diluents (such as physiological saline, sterile water, glacial acetic acid, sodium acetate, combinations thereof, and analogues).

[0120] Dosage will depend on a variety of factors, including the therapeutic index of the drug, disease type, patient age, patient weight, and tolerability. A typically chosen dose is one that achieves a serum concentration of approximately 0.1 μg / ml to 1000 μg / ml in the patient. The specific dose for a particular patient can be determined by an experienced clinician using standard pharmacological methods taking into account the factors mentioned above. Response to treatment can be monitored by blood or fluid level analysis of glucose or insulin levels, or by monitoring fat levels in the patient. An experienced clinician will adjust the dose based on the response to treatment revealed by these measurements. Single administration is usually sufficient to produce a therapeutic effect, but multiple administrations are expected to ensure a sustained response over a prolonged period. Due to the protein-like nature of the molecular antagonist disclosed herein, it is believed that the antagonist will have a long half-life in vivo, so the composition will only need to be administered once or twice a month, or possibly once a week. The circulating concentration of the molecular antagonist should be sufficient to neutralize GIP generated during and after meals.

[0121] Pharmaceutical compositions containing the GIP molecule antagonist disclosed herein can be used to treat fatty liver disease or other diseases involving the accumulation of fat in tissues. The term "treatment" is used to refer to slowing the progression of disease, resolving disease, and / or preventively reducing the likelihood of disease occurrence. This can be determined in several different ways, such as by the amount of liver fat, omental fat, or subcutaneous fat.

[0122] In obese individuals, GIP molecular antagonists are believed to inhibit GIP binding to its receptors within intestinal epithelial cells, thereby reducing postprandial glucose uptake by inhibiting GIP-induced sodium / glucose transport from the cytoplasm to the luminal membrane (SGLT1). GIP-induced insulin secretion from pancreatic β-cells is also reduced, decreasing nutrient storage associated with elevated insulin response. Inhibition of GIP binding to its receptors in adipocytes should also reduce GIP-induced glucose uptake into adipocytes and prevent GIP's lipolysis-inhibiting effects. Overall, this leads to inefficient nutrient absorption and storage, promoting weight loss. These effects are also beneficial for patients with metabolic syndrome or hyperlipidemia.

[0123] For patients with type 2 diabetes, inhibiting the binding of GIP to its receptors in intestinal epithelial cells will reduce postprandial glucose absorption and lower blood sugar. Patients who overeat will also benefit from neutralizing the weight loss effect of GIP.

[0124] For patients who are prone to or have fatty liver disease, inhibiting the binding of GIP to its receptors in β cells will reduce postprandial insulin secretion, thereby reducing insulin-induced fat accumulation in the liver.

[0125] For patients with food-induced Cushing's syndrome, inhibiting the binding of GIP to its receptors in adrenal cells will reduce or prevent the increase in GIP-induced cortisol secretion after food intake.

[0126] The present invention will be further described in the following three sets of non-limiting working embodiments. It should be understood that these embodiments are for illustrative purposes only and not for limiting the materials, conditions, process parameters, etc., referenced herein. Unless otherwise stated, all proportions are based on weight. Example

[0127] Example 1

[0128] As described above, hybridomas were used to generate and screen monoclonal antibodies to identify monoclonal antibodies with high affinity for gastric inhibitory peptide (GIP) in suspension. This resulted in the identification of 10g10 monoclonal antibodies.

[0129] The 10g10 light chain variable domain has the amino acid sequence of SEQ ID NO: 16. The first CDR of the light chain variable domain has the amino acid sequence of SEQ ID NO: 25. The second CDR of the light chain variable domain has the amino acid sequence of SEQ ID NO: 26. The third CDR of the light chain variable domain has the amino acid sequence of SEQ ID NO: 22. The cDNA encoding the 10g10 light chain variable domain has the nucleotide sequence of SEQ ID NO: 35.

[0130] The 10g10 heavy chain variable domain has the amino acid sequence of SEQ ID NO: 27. The first CDR of the heavy chain variable domain has the amino acid sequence of SEQ ID NO: 31. The second CDR of the heavy chain variable domain has the amino acid sequence of SEQ ID NO: 34. The third CDR of the heavy chain variable domain has the amino acid sequence of SEQ ID NO: 33. The cDNA encoding the 10g10 heavy chain variable domain has the nucleotide sequence of SEQ ID NO: 39.

[0131] For comparison, a 14B9 antibody with no binding affinity for GIP was identified. The 10g10 light chain variable domain has the amino acid sequence of SEQ ID NO: 16. The first CDR of the 14B9 light chain variable domain has the amino acid sequence of SEQ ID NO: 7. The second CDR of this light chain variable domain has the amino acid sequence of SEQ ID NO: 26. The third CDR of this light chain variable domain has the amino acid sequence of SEQ ID NO: 10. The cDNA encoding the 14B9 light chain variable domain has the nucleotide sequence of SEQ ID NO: 8.

[0132] The 14B9 heavy chain variable domain has the amino acid sequence of SEQ ID NO: 11. The first CDR of this heavy chain variable domain has the amino acid sequence of SEQ ID NO: 13. The second CDR of this heavy chain variable domain has the amino acid sequence of SEQ ID NO: 14. The third CDR of this heavy chain variable domain has the amino acid sequence of SEQ ID NO: 15. The cDNA encoding the 14B9 heavy chain variable domain has the nucleotide sequence of SEQ ID NO: 12.

[0133] Example 2

[0134] Materials and methods

[0135] Thirty nine-week-old male C57BL / 6 mice were purchased from Jackson Laboratories (Bar Harbor, ME). On the first day of the study, each mouse weighed between 19 and 25 grams. The mice were then randomly divided into three groups of 10 mice each.

[0136] All mice had free access to food and water throughout the study. All mice were housed in cages maintained at 22±2°C under a 12-hour light / 12-hour dark cycle. Five mice were housed in each cage until they reached a weight of 25 grams. Mice were then housed in groups of two to three per cage.

[0137] The High Fat Diet (HFD) (catalog number TD.06414) and the Low Fat Iscalorie Diet (catalog number TD.08806) were purchased from Harlan-Teklad (Indianapolis, IN). The HFD, by weight, consists of approximately 23.5% protein, 27.3% carbohydrates, and 34.3% fat. The HFD provides 18.4% of the total calories from protein, 21.3% from carbohydrates, and 60.3% from fat, for a total of 5.1 kcal / g. The Iscalorie Diet, by weight, consists of approximately 18.6% protein, 62.6% carbohydrates, and 4.2% fat. The Iscalorie Diet provides 20.5% of the total calories from protein, 69.1% from carbohydrates, and 10.4% from fat, for a total of 3.6 kcal / g.

[0138] Ten mice (HFD-control group) were fed HFD for 17 weeks and administered 0.1 mL of phosphate-buffered saline (PBS) five times a week via intraperitoneal (ip) injection.

[0139] The second group of 10 mice (HFD-mAb group) were fed HFD for 17 weeks and administered 10g of GIP mAb in PBS five times weekly. From Monday to Thursday, 0.1mL of a solution containing 0.2mg / mL mAb in PBS was administered via intraperitoneal injection. On Fridays, 0.1mL of a solution containing 0.4mg / mL mAb in PBS was administered via intraperitoneal injection. This resulted in four days of administration of 10mg / kg BW GIP mAb and one day of administration of 20mg / kg BW GIP mAb for each week of the study. This dosing regimen was continued throughout the study.

[0140] The third group of 10 mice (isokinetic diet group) was fed an isokinetic diet for 17 weeks. This group did not receive any injections.

[0141] Throughout the study, the weight of each mouse was measured and recorded every Monday evening. Additionally, the food consumption of each group of mice was measured and recorded throughout the study.

[0142] result

[0143] The weight gain rate in the HFD-control group was nearly twice that of the HFD-mAb group or the isocaloric diet group.

[0144] exist Figure 1A The graph shows the total weight changing over time. Figure 1B The percentage of weight gain per week is shown. After one week of the special diet, both high-fat diet (HFD) groups (those given GIP mAb and those not) gained approximately 10% of their body weight. The weight gains in the two HFD groups remained essentially equal until week 4. At week 4, the weight gain in the HFD-mAb group began to decline slowly, while the weight gain in the HFD-control group remained stable. By week 7, the difference in weight gain became highly significant (P < 0.001). Throughout the study period, the mice in the isocaloric diet group gained body weight at a slower rate. The HFD-mAb group and the isocaloric diet group had nearly identical weight gains after 17 weeks. The use of GIP mAb antagonists had a clear effect on weight gain in mice.

[0145] based on Figure 1B It appears that the effects of GIP mAb are not immediate, but require sustained administration over a period of time. During weeks 1-4 of the experiment, both groups of mice fed HFD experienced almost identical weight gains. Only in week 5 did the weight gain in the HFD-mAb group begin to increase at a slower rate compared to the HFD-control group.

[0146] MRI

[0147] Materials and methods

[0148] After 17 weeks of special diet, six mice were randomly selected from the HFD control group and six mice were randomly selected from the HFD-mAb group for magnetic resonance imaging (MRI). All mice were anesthetized before imaging at the Case Western Reserve University Imaging Research Core Facility.

[0149] Two-dimensional T1-weighted asymmetric echoes were rapidly acquired using a relaxation enhancement (aRARE) sequence on a Bruker Biospec 7T small animal MRI scanner (Bruker Biospin, Billerica, MA) (TR = 1087 ms, TE = 9.1 ms, FOV = 100 x 50 mm, 512 x 256 matrix, 4 averages, echo train length = 4, slice thickness = 1 mm). This aRARE sequence provides users with selectable echo delays, enabling variations of π / 6, 5π / 6, and 3π / 2 radians between fat and water (echo variations of 79, 396, and 714 microseconds at 7T).

[0150] The MR images acquired by aRARE were used to generate separate fat and water images using IDEAL image reconstruction technology with altered 7T a, and were able to be used to determine the lipid biodistribution in mice. In this respect, obesity, metabolic syndrome, and NAFLD depend not only on total weight, but also on the location of excess fat storage.

[0151] result

[0152] Figure 3 Representative magnetic resonance images from HFD-control mice (left) and HFD-mAb mice (right) are shown. The images depict side views of the mice, with the anterior portion of the mouse in the upper part of the image and the posterior portion in the lower part. White or bright areas represent areas with high fat content. HFD-control mice have more fat compared to HFD-mAb mice.

[0153] Figure 4 The number of liver fat fractions obtained by relaxation-compensated fat fraction (RCFF) MRI is shown. Compared with the HFD-mAb group, the HFD-control group had twice the amount of fat accumulation in the liver.

[0154] Figure 5 The number of omental fat fractions obtained by relaxation-compensated fat fraction (RCFF) MRI is shown. Compared with the HFD-mAb group, the HFD-control group animals accumulated almost 3.5 times more omental fat.

[0155] Figure 6 The number of subcutaneous fat fractions obtained from relaxation-compensated fat fraction (RCFF) MRI is shown. Compared with the HFD-mAb group, the HFD-control group had approximately more than twice the amount of subcutaneous fat accumulation.

[0156] Figure 7 Representative photographs of stained tissue cross sections from the livers of euthanized mice are shown. The livers were removed and fixed in formalin. The fixed tissue sections were then stained with Oil Red O, and lysochromediazo dye was used for staining neutral triglycerides and lipids. The HFD-control liver is shown on the left, and the HFD-mAb group liver on the right. Compared to the HFD-mAb group liver, the HFD-control liver contained more red-stained (dark) fat droplets. Furthermore, the fat droplets in the HFD-control liver were larger than those in the HFD-mAb group liver. This indicates that fat accumulation in the liver is reduced when GIP mAb is administered. These results are consistent with… Figure 4 The amount of fat in the liver is consistent.

[0157] Figure 8 These are two (or a set of) comparative images of omental fat found in HFD-control mice (left) and HFD-mAb mice (right). The fat is white, and more fat is visible in the HFD control mice.

[0158] In summary, these data demonstrate that administration of a GIP-binding monoclonal antibody antagonist significantly reduces the amount of stored fat in mice fed a high-fat diet. This includes fat stored in the liver, omentum, and under the skin.

[0159] glucose tolerance test

[0160] Materials and methods

[0161] After 17 weeks of special diet, six mice from each diet group were randomly selected for the intraperitoneal glucose tolerance test (IPGTT). All animals were initially fasted for 6 hours, followed by a blood sample of approximately 2 μL collected from the tail vein of each mouse. On the IPGTT curve, these first samples represent the baseline blood glucose level or time zero. Truetest was used. TM A blood glucose meter (NIPRODiagnostics, Fort Lauderdale, FL) measures blood glucose.

[0162] Mice were then administered glucose at approximately 2 mg / kg body weight via intraperitoneal injection. The glucose was delivered as a 20% aqueous solution. Approximately 2 μL of blood was collected from the tail vein of each mouse at 10, 30, 60, and 120 minutes after administration. Blood glucose levels were measured and recorded.

[0163] result

[0164] The results are shown in Figure 2 In HFD-control mice, serum glucose levels were elevated to significantly higher concentrations compared to HFD-mAb mice and isocaloric mice. Furthermore, serum glucose levels began to decline earlier in HFD-mAb and isocaloric mice. This is consistent with the progression of glucose tolerance in HFD-control mice, but differs from that in HFD-mAb or isocaloric mice.

[0165] Serum test

[0166] Materials and methods

[0167] After 17 weeks of a special diet, the mice in the three groups were sacrificed. Whole blood was collected, serum was prepared, and the levels of many different components were measured.

[0168] result

[0169] Figure 9 Serum triglyceride (TG) levels in mice from each group are shown. TG levels in the HFD-control group were 1.44 times higher than those in the HFD-mAb group. Higher TG levels are associated with obesity and metabolic syndrome.

[0170] Figure 10 The serum total cholesterol (TC) levels of mice in each group are shown. The TC level in the HFD-control mice was 1.55 times that in the HFD-mAb mice. Higher TC levels are associated with obesity and metabolic syndrome.

[0171] Figure 11 The average percentage of high-density lipoprotein (HDL) to total cholesterol (TC) measured in the serum of mice in each group is shown. The percentage of HDL to total cholesterol in HFD-control mice was 20% lower than that in HFD-mAb mice. A low percentage of HDL to total cholesterol is associated with obesity and metabolic syndrome.

[0172] Figure 12 The mean low-density lipoprotein (HDL) levels measured in the serum of mice in each group were recorded. LDL levels in HFD-control mice were 1.95 times higher than in HFD-mAb mice. Higher LDL (“bad” cholesterol) levels are associated with obesity and metabolic syndrome.

[0173] Figure 13 The mean insulin levels measured in the serum of mice in each group are shown. Insulin levels in HFD-control mice were 2.6 times higher than those in HFD-mAb mice. Higher insulin levels were associated with obesity, insulin resistance, and metabolic syndrome.

[0174] Figure 14 The mean adiponectin levels measured in the serum of mice in each group are shown. Adiponectin levels in HFD-control mice were 1.35 times higher than those in HFD-mAb mice. Higher adiponectin levels were associated with increased overall body fat.

[0175] Figure 15 The mean leptin levels measured in the serum of mice in each group are shown. Leptin levels in HFD-control mice were 5.73 times higher than those in HFD-mAb mice. Higher leptin levels were associated with increased overall visceral fat.

[0176] Figure 16 The serum glucagon levels measured in mice from each group are shown. There were no significant differences in serum glucagon levels between the groups.

[0177] Figure 17 The levels of glucagon-like peptide-1 (GLP-1) measured in the serum of mice in each group are shown. There were no significant differences in serum GLP-1 levels among the groups.

[0178] In summary, these data demonstrate that administration of a monoclonal antibody antagonist binding to GIP significantly improved all biomarkers associated with obesity and metabolic syndrome. This data suggests that mAb administration can reduce complications associated with obesity and metabolic syndrome. The fact that there was no change in serum glucagon or GLP-1 levels indicates that the mAb is specific to GIP and suggests only minor side effects (if any) for the inhibition of glucagon or GLP-1. Glucagon or GLP-1 share some common biological pathways with GIP, but they also have some other biological effects not shared with GIP.

[0179] discuss

[0180] These experimental results demonstrate that intraperitoneal delivery of GIP-binding monoclonal antibodies significantly reduces fat accumulation in adipose tissue and the liver. Mice fed a high-fat diet (HFD) and simultaneously receiving GIP mAbs had significantly less fat content than HFD control mice. This reduction in fat content was observed in the liver, omentum, and subcutaneous fat. This suggests that appropriate GIP mAb antagonists can reduce or prevent fat accumulation in tissues by inhibiting GIP. GIP inhibition reduces intestinal glucose uptake, decreases intestinal peptide absorption, reduces postprandial insulin secretion, reduces glucose uptake in adipocytes, increases lipolysis, and inhibits nutrient absorption. Changes in serum levels of markers associated with obesity and metabolic syndrome also suggest that GIP mAb antagonists can be used to combat these conditions and achieve healthy outcomes.

[0181] Example 3: Antibody Modification

[0182] The light chain variable region of 10g10 mAb was further modified by replacing specific amino acids conserved in mouse antibodies with those conserved in human antibodies. This was done to "humanize" the light chain variable region, making it more similar to human variable regions and increasing the probability that the human immune system would not recognize the "humanized" monoclonal antibody as a foreign substance. To humanize the light chain variable region, an oligonucleotide was chemically synthesized. Except for specific base changes, the sequence of this oligonucleotide was similar to the sequence of the 10g10 mAb light chain variable region. It is speculated that when the sequence is translated into a protein, base pair changes will alter specific amino acids in the light chain variable region. A DNA synthesis reaction was used to produce double-stranded (ds) DNA. Three different double-stranded oligonucleotides were synthesized, digested with restriction endonucleases HindIII and NotI, and then ligated into a mammalian expression vector. The mammalian expression vector contained a signal sequence and the constant region of the human light chain. Ds-oligonucleotides are linked into the vector in such a way that when the variable and constant regions are expressed as mRNA and subsequently translated into protein, antibody light chains are generated.

[0183] Here, the three obtained humanized light chains are designated LC1, LC2, and LC3. The amino acid sequence of LC1 is SEQ ID NO: 17, and the cDNA sequence of LC1 is SEQ ID NO: 36. The amino acid sequence of LC2 is SEQ ID NO: 18, and the cDNA sequence of LC1 is SEQ ID NO: 37. The amino acid sequence of LC3 is SEQ ID NO: 19, and the cDNA sequence of LC1 is SEQ ID NO: 38.

[0184] The variable region of the 10g10 mAb heavy chain can be further modified in the same manner. It is again hypothesized that base pair changes during protein translation will alter specific amino acids in the variable region of the heavy chain. Three different ds-oligonucleotide chains were synthesized and then ligated into a mammalian expression vector. The mammalian expression vector contains a signal sequence and the constant region of the human heavy chain. The ds-oligonucleotides are ligated into the vector in such a way that when the variable and constant regions are expressed as mRNA and subsequently translated into protein, an antibody heavy chain will be generated.

[0185] Here, the three obtained humanized heavy chains are referred to as HCl, HC2, and HC3. The amino acid sequence of HC1 is SEQ ID NO: 28, and the cDNA sequence of HC1 is SEQ ID NO: 40. The amino acid sequence of HC2 is SEQ ID NO: 29, and the cDNA sequence of HC1 is SEQ ID NO: 41. The amino acid sequence of HC3 is SEQ ID NO: 30, and the cDNA sequence of HC1 is SEQ ID NO: 42.

[0186] Monoclonal antibodies (mAbs) containing humanized light chain and heavy chain variable regions were generated in CHO cells. Mammalian vectors encoding the antibody light chain were co-transfected with mammalian vectors containing sequences encoding the antibody heavy chain. Nine unique combinations were transfected into CHO cells: LC1 / HCl, LC1 / HC2, LC1 / HC3, LC2 / HCl, LC2 / HC2, LC2 / HC3, LC3 / HCl, LC3 / HC2, and LC3 / HC3. Monoclonal antibodies derived from these combinations were compared with 10g / 10 mAbs.

[0187] CHO cells co-transfected with a mammalian expression vector were grown in culture medium, and the supernatant was collected. The presence of GIP-bound mAbs in the supernatant was evaluated by direct-binding ELISA. Human GIP was immobilized at the bottom of the wells of a 96-well plate. A series of dilutions of the supernatant were added to different wells of the 96-well plate. After one hour of incubation, the wells were washed twice with PBS, and then secondary antibodies specifically binding to human IgG were added to each well. The antibodies specifically binding to human IgG were conjugated with horseradish peroxidase (HRP). After one hour of incubation, the wells were washed with PBS, and then HRP substrate was added. If HRP was present in the well, the substrate was converted into a colored compound. The amount of color intensity was read using a spectrophotometer. The amount of color produced was proportional to the amount of HRP antibody conjugate remaining in each well. The amount of color produced was also proportional to the amount of hGIP-bound mAbs in each well.

[0188] The results of this evaluation indicate that various combinations of light / heavy chain vectors bind to human GIP in the following order (from highest affinity to lowest affinity): LC2 / HC1, LC2 / HC2, LC3 / HC2, LC1 / HC2, LC2 / HC3, LC3 / HC1, LC1 / HC1, 10g10, LC1 / HC3, and LC3 / HC3.

[0189] Antibodies generated from 100 ml of CHO cell suspension culture co-transfected with a combination of expression vectors LC2 / HC1, LC2 / HC2, and LC2 / HC3 were purified using protein A agarose.

[0190] Next, the ability of these three purified mAbs to neutralize hGIP and prevent ligand-receptor interactions, receptor activation, and receptor-dependent signal transduction was tested using a cell culture system. The system used reporter cells (LGIPR3a cells) with the lacZ gene controlled by a cyclic adenosine monophosphate (cAMP) responsive promoter and expressing rat GIPR on their cell surface. Adding GIP to these cells led to GIPR activation, inducing a signaling cascade that led to cAMP accumulation, inducing the lacZ gene, and synthesizing β-galactosidase. After adding the sample and incubating for 4 hours, the β-galactosidase content in the cell lysates was measured colorimetrically. Changes in color intensity were proportional to the level of β-galactosidase activity. The level of β-galactosidase activity depended on the amount of free, biologically active GIP in the sample.

[0191] mAb was mixed with human GIP (hGIP) solution in DMEM medium to a final concentration of 25 g / ml for mAb and 0.1 nM for hGIP. The mixture was then added to LGIPR3a cells and cultured, followed by washing for β-galactosidase analysis. Results are shown in... Figure 18 In the diagram, 10g10 represents the original mouse mAb. GIP serves as a positive control. Fc represents the purified human Fc fragment, which serves as a negative control.

[0192] The results showed that the humanized antibody neutralized hGIP in vitro in a manner similar to that of the 10g10 mouse mAb. The LC2 / HC2 humanized antibody was the most potent of the three humanized mAbs. It was also more potent than the original mouse mAb. What was required here was a lower relative activity, and LC2 / HC2 had a relative activity of 0.0035, while the relative activity of the 10g10 mouse mAb was 0.0055.

[0193] The complementary variable region (CDR) of six humanized light chains (LC1, LC2, LC3) and heavy chains (HCl, HC2, HC3) was also identified. LC1 has CDRs of SEQ ID NO: 20, SEQ ID NO: 23, and SEQ ID NO: 22. LC2 has CDRs of SEQ ID NO: 20, SEQ ID NO: 21, and SEQ ID NO: 22. LC3 has CDRs of SEQ ID NO: 20, SEQ ID NO: 24, and SEQ ID NO: 22. HC1, HC2, and HC3 have the same CDRs, which are SEQ ID NO: 31, SEQ ID NO: 32, and SEQ ID NO: 33.

[0194] Although specific implementations have been described, alternatives, modifications, variations, improvements, and substantial equivalents of the above implementations may exist or be unforeseeable to the applicant or other skilled personnel. Therefore, the appended claims and any amended claims are intended to cover all such alternatives, modifications, variations, improvements, and substantial equivalents. SEQUENCE LISTING <110> MHS Kerr Innovation Co., Ltd. WOLFE, M. MICHAEL BOYLAN, MICHAEL O <120> Compositions and methods for treating adipose tissue accumulation <130> MHMS 200014US01 <150> 62 / 045,189 <151> 2014-09-03 <150> 62 / 007,255 <151> 2014-06-03 <150> 61 / 917,136 <151> 2013-12-17 <150> 61 / 974,660 <151> 2014-04-03 <150> 62 / 074,225 <151> 2014-11-03 <150> 62 / 074,227 <151> 2014-11-03 <150> 62 / 074,234 <151> 2014-11-03 <160> 55 <170> PatentIn version 3.5 <210> 1 <211> 42 <212> PRT <213> Homo sapiens <400> 1 Tyr Ala Glu Gly Thr Phe Ile Ser Asp Tyr Ser Ile Ala Met Asp Lys 1 5 10 15 Ile His Gln Gln Asp Phe Val Asn Trp Leu Leu Ala Gln Lys Gly Lys 20 25 30 Lys Asn Asp Trp Lys His Asn Ile Thr Gln 35 40 <210> 2 <211> 42 <212> PRT <213> Mouse (Mus musculus) <400> 2 Tyr Ala Glu Gly Thr Phe Ile Ser Asp Tyr Ser Ile Ala Met Asp Lys 1 5 10 15 Ile Arg Gln Gln Asp Phe Val Asn Trp Leu Leu Ala Gln Arg Gly Lys 20 25 30 Lys Ser Asp Trp Lys His Asn Ile Thr Gln 35 40 <210> 3 <211> 42 <212> PRT <213> Brown rat (Rattus norvegicus) <400> 3 Tyr Ala Glu Gly Thr Phe Ile Ser Asp Tyr Ser Ile Ala Met Asp Lys 1 5 10 15 Ile Arg Gln Gln Asp Phe Val Asn Trp Leu Leu Ala Gln Lys Gly Lys 20 25 30 Lys Asn Asp Trp Lys His Asn Leu Thr Gln 35 40 <210> 4 <211> 42 <212> PRT <213> Wild boar (Sus scrofa) <400> 4 Tyr Ala Glu Gly Thr Phe Ile Ser Asp Tyr Ser Ile Ala Met Asp Lys 1 5 10 15 Ile Arg Gln Gln Asp Phe Val Asn Trp Leu Leu Ala Gln Lys Gly Lys 20 25 30 Lys Ser Asp Trp Lys His Asn Ile Thr Gln 35 40 <210> 5 <211> 18 <212> PRT <213> Artificial Sequence <220> <223> Artificially screened peptides <400> 5 Tyr Ala Glu Gly Thr Phe Ile Ser Asp Tyr Ser Ile Ala Met Asp Lys 1 5 10 15 Ile Cys <210> 6 <211> 18 <212> PRT <213> Artificial Sequence <220> <223> Artificially screened peptides <400> 6 Cys Leu Leu Ala Gln Arg Gly Lys Lys Ser Asp Trp Lys His Asn Ile 1 5 10 15 Thr Gln <210> 7 <211> 109 <212> PRT <213> Mouse (Mus musculus) <400> 7 Asp Ile Gln Leu Thr Gln Ser Pro Ala Ile Met Ala Ala Ser Leu Gly 1 5 10 15 Gln Lys Val Thr Met Thr Cys Ser Ala Ser Ser Ser Val Ser Ser Ser 20 25 30 Tyr Leu His Trp Tyr Gln Gln Lys Ser Gly Ala Ser Pro Lys Ser Leu 35 40 45 Ile His Arg Thr Ser Asn Leu Ala Ser Gly Val Pro Ala Arg Phe Ser 50 55 60 Gly Ser Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Ser Val Glu 65 70 75 80 Ala Glu Asp Asp Ala Thr Tyr Tyr Cys Leu Gln Trp Ser Gly Phe Pro 85 90 95 Phe Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile Lys Arg 100 105 <210> 8 <211> 327 <212> DNA <213> Artificial Sequence <220> <223> artificial <400> 8 gacattcagc tgacccagtc tccagcaata atggctgcct ctctggggca gaaggtcacc 60 atgacctgca gtgccagctc aagtgtaagt tccagttact tgcactggta ccagcagaag 120 tcaggcgctt cccccaaatc cttgattcat aggacatcca acctggcttc tggagtccca 180 gctcgcttca gtggcagtgg gtctgggacc tcttactctc tcacaatcag cagcgtggag 240 gctgaagatg atgcaactta ttactgcctg cagtggagtg gtttcccatt cacgttcggc 300 tcggggacca agctggagat caaacgt 327 <210> 9 <211> 12 <212> PRT <213> Mouse (Mus musculus) <400> 9 Ser Ala Ser Ser Ser Val Ser Ser Ser Tyr Leu His 1 5 10 <210> 10 <211> 9 <212> PRT <213> Mouse (Mus musculus) <400> 10 Leu Gln Trp Ser Gly Phe Pro Phe Thr 1 5 <210> 11 <211> 117 <212> PRT <213> Mouse (Mus musculus) <400> 11 Gln Val Gln Leu Gln Glu Ser Gly Ala Ala Leu Val Arg Ser Gly Ala 1 5 10 15 Ser Val Lys Leu Ser Cys Thr Ala Ser Gly Phe Asn Ile Lys Asp Tyr 20 25 30 Tyr Phe His Trp Val Lys Gln Arg Pro Asp Gln Gly Leu Glu Trp Ile 35 40 45 Gly Trp Ile Asp Pro Glu Asn Gly Asp Thr Glu Tyr Ala Pro Asn Phe 50 55 60 Gln Val Lys Ala Thr Met Thr Ala Asp Thr Tyr Ser Asn Thr Ala Tyr 65 70 75 80 Leu His Leu Ser Ser Leu Thr Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Asn Ser Tyr Gly Asn Asn Tyr Phe Asp Tyr Trp Gly Gln Gly Thr Thr 100 105 110 Val Thr Val Ser Ser 115 <210> 12 <211> 351 <212> DNA <213> Artificial Sequence <220> <223> Artificial <400> 12 caggtccagc tgcaggagtc tggggcagcg cttgtgaggt caggggcctc agtcaaattg 60 tcctgcacag cttctggctt caacattaaa gactactatt ttcactgggt gaagcagagg 120 cctgaccagg gcctggagtg gattggatgg attgatcctg agaatggtga tactgaatat 180 gccccgaact tccaggtcaa ggccactatg actgcagaca catattccaa cacagcctac 240 ctgcatctca gcagcctgac atctgaggac actgccgtct attactgtaa ttcctacggt 300 aataactact ttgactactg gggccaaggg accacggtca ccgtctcctc a 351 <210> 13 <211> 10 <212> PRT <213> Mouse (Mus musculus) <400> 13 Gly Phe Asn Ile Lys Asp Tyr Tyr Phe His 1 5 10 <210> 14 <211> 7 <212> PRT <213> Mouse (Mus musculus) <400> 14 Ala Pro Asn Phe Gln Val Lys 1 5 <210> 15 <211> 10 <212> PRT <213> Mouse (Mus musculus) <400> 15 Asn Ser Tyr Gly Asn Asn Tyr Phe Asp Tyr 1 5 10 <210> 16 <211> 111 <212> PRT <213> Mouse (Mus musculus) <400> 16 Asp Ile Gln Leu Thr Gln Ser Pro Ser Thr Met Ala Ala Ser Pro Gly 1 5 10 15 Glu Lys Ile Thr Ile Thr Cys Ser Ala Ser Ser Ser Ile Ser Ser Asn 20 25 30 Ser Leu His Trp Tyr Gln Gln Lys Pro Gly Phe Ser Pro Lys Leu Leu 35 40 45 Ile Tyr Arg Thr Ser Asn Leu Ala Ser Gly Val Pro Gly Arg Phe Ser 50 55 60 Gly Ser Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Gly Thr Met Glu 65 70 75 80 Thr Glu Asp Val Ala Thr Tyr Tyr Cys Gln Gln Gly Ser Ser Phe Pro 85 90 95 Arg Met Leu Thr Phe Gly Thr Gly Thr Lys Leu Glu Ile Lys Arg 100 105 110 <210> 17 <211> 111 <212> PRT <213> Artificial Sequence <220> <223> Humanized <400> 17 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Val Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Ser Ser Ile Ser Ser Asn 20 25 30 Ser Leu His Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu 35 40 45 Ile Tyr Arg Thr Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser 50 55 60 Gly Ser Gly Ser Gly Thr Asp Tyr Thr Leu Thr Ile Ser Ser Leu Gln 65 70 75 80 Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Gly Ser Ser Phe Pro 85 90 95 Arg Met Leu Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys Arg 100 105 110 <210> 18 <211> 111 <212> PRT <213> Artificial Sequence <220> <223> Humanized <400> 18 Asp Ile Gln Leu Thr Gln Ser Pro Ser Ser Val Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Ser Ser Ile Ser Ser Asn 20 25 30 Ser Leu His Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu 35 40 45 Ile Tyr Arg Thr Ser Asn Leu Gln Ser Gly Val Pro Ser Arg Phe Ser 50 55 60 Gly Ser Gly Ser Gly Thr Asp Tyr Thr Leu Thr Ile Ser Ser Leu Gln 65 70 75 80 Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Gly Ser Ser Phe Pro 85 90 95 Arg Met Leu Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys Arg 100 105 110 <210> 19 <211> 111 <212> PRT <213> Artificial Sequence[[ID=2�]] <220> <223> Humanized <400> 19 Asp Ile Gln Met Thr Gln Ser Pro Gly Thr Leu Ser Leu Ser Pro Gly 1 5 10 15 Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Ser Ser Ile Ser Ser Asn 20 25 30 Ser Leu His Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu 35 40 45 Ile Tyr Arg Thr Ser Asn Arg Ala Thr Gly Ile Pro Ala Arg Phe Ser 50 55 60 Gly Ser Gly Ser Gly Thr Asp Tyr Thr Leu Thr Ile Ser Ser Leu Glu 65 70 75 80 Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Gly Ser Ser Phe Pro 85 90 95 Arg Met Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Arg 100 105 110 <210> 20 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> Humanization <400> 20 Arg Ala Ser Ser Ser Ile Ser Ser Asn Ser Leu His 1 5 10 <210> twenty one <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Humanization <400> twenty one Arg Thr Ser Asn Leu Gln Ser 1 5 <210> twenty two <211> 11 <212> PRT <213> Artificial Sequence <220> <223> Humanization <400> twenty two Gln Gln Gly Ser Ser Phe Pro Arg Met Leu Thr 1 5 10 <210> twenty three <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Humanization <400> twenty three Arg Thr Ser Ser Leu Gln Ser 1 5 <210> twenty four <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Humanization <400> twenty four Arg Thr Ser Asn Arg Ala Thr 1 5 <210> 25 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> Humanization <400> 25 Ser Ala Ser Ser Ser Ile Ser Ser Asn Ser Leu His 1 5 10 <210> 26 <211> 7 <212> PRT <213> Mouse (Mus musculus) <400> 26 Arg Thr Ser Asn Leu Ala Ser 1 5 <210> 27 <211> 117 <212> PRT <213> Mouse (Mus musculus) <400> 27 Gln Val Gln Leu Gln Glu Ser Gly Ala Glu Leu Val Arg Ser Gly Ala 1 5 10 15 Ser Val Lys Leu Ser Cys Thr Ala Ser Gly Phe Asn Ile Arg Asp Tyr 20 25 30 Tyr Leu His Trp Ile Lys Gln Arg Pro Glu Gln Gly Leu Glu Trp Ile 35 40 45 Gly Trp Ile Asp Pro Glu Asn Gly Asp Thr Glu Tyr Ala Pro Lys Phe 50 55 60 Gln Asp Lys Ala Thr Val Thr Ala Asp Thr Ser Ser Asn Thr Ala Tyr 65 70 75 80 Leu Gln Leu Asn Ser Leu Thr Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Asn Val Tyr Gly Ile Tyr Phe Met Asp Tyr Trp Gly Gln Gly Thr Thr 100 105 110 Val Thr Val Ser Ser 115 <210> 28 <211> 117 <212> PRT <213> Artificial Sequence <220> <223> Humanized <400> 28 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala 1 5 10 15 Thr Val Lys Ile Ser Cys Lys Val Ser Gly Phe Asn Ile Arg Asp Tyr 20 25 30 Tyr Leu His Trp Val Gln Gln Ala Pro Gly Lys Gly Leu Glu Trp Met 35 40 45 Gly Trp Ile Asp Pro Glu Asn Gly Asp Thr Glu Tyr Ala Pro Lys Phe 50 55 60 Gln Gly Arg Val Thr Ile Thr Ala Asp Thr Ser Thr Asp Thr Ala Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Asn Val Tyr Gly Ile Tyr Phe Met Asp Tyr Trp Gly Gln Gly Thr Met 100 105 110 Val Thr Val Ser Ser 115 <210> 29 <211> 117 <212> PRT <213> Artificial Sequence <220> <223> Humanized <400> 29 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala 1 5 10 15 Thr Val Lys Ile Ser Cys Lys Ala Ser Gly Phe Asn Ile Arg Asp Tyr 20 25 30 Tyr Leu His Trp Val Gln Gln Ala Pro Gly Lys Gly Leu Glu Trp Met 35 40 45 Gly Trp Ile Asp Pro Glu Asn Gly Asp Thr Glu Tyr Ala Pro Lys Phe 50 55 60 Gln Gly Arg Val Thr Ile Thr Ala Asp Thr Ser Thr Asn Thr Ala Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Asn Val Tyr Gly Ile Tyr Phe Met Asp Tyr Trp Gly Gln Gly Thr Met 100 105 110 Val Thr Val Ser Ser 115 <210> 30 <211> 117 <212> PRT <213> Artificial Sequence <220> <223> Humanized <400> 30 Gln Val Gln Leu Gln Glu Ser Gly Ala Glu Val Lys Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Val Ser Cys Lys Ala Ser Gly Phe Asn Ile Arg Asp Tyr 20 25 30 Tyr Leu His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45 Gly Trp Ile Asp Pro Glu Asn Gly Asp Thr Glu Tyr Ala Pro Lys Phe 50 55 60 Gln Gly Arg Val Thr Thr Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Asn Val Tyr Gly Ile Tyr Phe Met Asp Tyr Trp Gly Gln Gly Thr Leu 100 105 110 Val Thr Val Ser Ser 115 <210> 31 <211> 10 <212> PRT <213> Mouse (Mus musculus) <400> 31 Gly Phe Asn Ile Arg Asp Tyr Tyr Leu His 1 5 10 <210> 32 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Humanized <400> 32 Ala Pro Lys Phe Gln Gly Arg 1 5 <210> 33 <211> 10 <212> PRT <213> Mouse (Mus musculus) <400> 33 Asn Val Tyr Gly Ile Tyr Phe Met Asp Tyr 1 5 10 <210> 34 <211> 7 <212> PRT <213> Mouse (Mus musculus) <400> 34 Ala Pro Lys Phe Gln Asp Lys 1 5 <210> 35 <211> 333 <212> DNA <213> Artificial Sequence <220> <223> Artificial <400> 35 gacattcagc tgacccagtc tccatccacc atggctgcat ctcccgggga gaagatcact 60 atcacctgca gtgccagctc aagtataagt tccaattcct tgcattggta tcagcagaag 120 ccaggattct cccctaaact cttgatttat aggacatcca atctggcttc tggagtccca 180 ggtcgcttca gtggcagtgg gtctgggacc tcttactctc tcacaattgg caccatggag 240 actgaagatg ttgccactta ctactgccag cagggtagta gttttccacg catgctcacg 300 ttcggtactg ggaccaagct ggagatcaaa cgt 333 <210> 36 <211> 333 <212> DNA <213> Artificial Sequence <220> <223> Artificial <400> 36 gacatccaga tgacccagtc cccctcctcc gtgtctgctt ctgtgggcga cagagtgaca 60 attacctgcc gggcctcctc ctccatctcc tccaattccc tgcactggta tcagcagaag 120 cccggcaagg cccccaagct gctgatctac cggacctcca gcctgcagtc cggcgtgccc 180 tctagattct ccggctctgg ctctggcacc gactataccc tgaccatctc cagcctgcag 240 cccgaggact tcgccaccta ctactgtcag cagggctcct ccttcccccg gatgctgaca 300 tttggccagg gcaccaagct ggaaatcaag cgg 333 <210> 37 <211> 333 <212> DNA <213> Artificial Sequence <220> <223> Artificial <400> 37 gacatccagc tgacccagtc cccctcctcc gtgtctgctt ctgtgggcga cagagtgaca 60 attacctgcc gggcctcctc ctccatctcc tccaattccc tgcactggta tcagcagaag 120 cccggcaagg cccccaagct gctgatctac cggacctcca acctgcagtc cggcgtgccc 180 tctagattct ccggctctgg ctctggcacc gactataccc tgaccatctc cagcctgcag 240 cccgaggact tcgccaccta ctactgtcag cagggctcct ccttcccccg gatgctgaca 300 tttggccagg gcaccaagct ggaaatcaag cgg 333 <210> 38 <211> 333 <212> DNA <213> Artificial Sequence <220> <223> Artificial <400> 38 gacatccaga tgacccagag ccctggcacc ctgtctctgt ctcccggcga gagagctacc 60 ctgtcctgca gagcctcctc ctccatctcc tccaattccc tgcactggta tcagcagaag 120 cccggccagg cccccagact gctgatctac cggacctcca atcgggccac cggcatccct 180 gccagattct ccggctctgg ctctggcacc gactataccc tgaccatctc cagcctggaa 240 cccgaggact tcgccgtgta ctactgtcag cagggctcct ccttcccccg gatgctgaca 300 tttggcggag gcaccaaggt ggaaatcaag cgg 333 <210> 39 <211> 351 <212> DNA <213> Artificial Sequence <220> <223> Artificial <400> 39 caggtccagc tgcaggagtc tggggcagag cttgtgaggt caggggcctc agtcaagttg 60 caggtccagc tgcaggagtc tggggcagag cttgtgaggt caggggcctc agtcaagttg 60 tcctgcacag cttctggctt caacattaga gactactatt tgcactggat aaaacagagg 120 tcctgcacag cttctggctt caacattaga gactactatt tgcactggat aaaacagagg 120 cctgaacagg gcctggagtg gattggatgg attgatcctg agaatggtga tactgaatat 180 cctgaacagg gcctggagtg gattggatgg attgatcctg agaatggtga tactgaatat 180 gccccgaagt tccaggacaa ggccactgtg actgcagaca catcctccaa cacagcctac 240 gccccgaagt tccaggacaa ggccactgtg actgcagaca catcctccaa cacagcctac 240 ctgcagctca acagcctgac atctgaggac actgccgtct attactgtaa tgtatatggc 300 ctgcagctca acagcctgac atctgaggac actgccgtct attactgtaa tgtatatggc 300 atctatttta tggactattg gggccaaggg accacggtca ccgtctcctc a 351 atctatttta tggactattg gggccaaggg accacggtca ccgtctcctc a 351 <210> 40 <211> 351 <212> DNA <213> Artificial Sequence <220> <223> Artificial <400> 40 caggtgcagc tggtgcagtc tggcgccgaa gtgaagaaac ctggcgctac cgtgaagatc 60 caggtgcagc tggtgcagtc tggcgccgaa gtgaagaaac ctggcgctac cgtgaagatc 60 tcctgcaagg tgtccggctt caacatccgg gactactacc tgcactgggt gcagcaggcc 120 tcctgcaagg tgtccggctt caacatccgg gactactacc tgcactgggt gcagcaggcc 120 cctggcaagg gactggaatg gatgggctgg atcgaccccg agaacggcga taccgagtac 180 cctggcaagg gactggaatg gatgggctgg atcgaccccg agaacggcga taccgagtac 180 gcccctaagt tccagggcag agtgaccatc accgccgaca cctctaccga caccgcctac 240 gcccctaagt tccagggcag agtgaccatc accgccgaca cctctaccga caccgcctac 240 atggaactgt cctccctgcg gagcgaggac accgccgtgt actactgcaa cgtgtacggc 300 atctacttca tggactactg gggccagggc acaatggtca ccgtgtcctc t 351 <210> 41 <211> 351 <212> DNA <213> Artificial Sequence <220> <223> Artificial <400> 41 caggtgcagc tggtgcagtc tggcgccgaa gtgaagaaac ctggcgctac cgtgaagatc 60 tcctgcaagg cctccggctt caacatccgg gactactacc tgcactgggt gcagcaggcc 120 cctggcaagg gactggaatg gatgggctgg atcgaccccg agaacggcga taccgagtac 180 gcccctaagt tccagggcag agtgaccatc accgccgaca cctctaccaa caccgcctac 240 atggaactgt cctccctgcg gagcgaggac accgccgtgt actactgcaa cgtgtacggc 300 atctacttca tggactactg gggccagggc acaatggtca ccgtgtcctc t 351 <210> 42 <211> 351 <212> DNA <213> Artificial Sequence <220> <223> Artificial <400> 42 caggtgcagc tgcaggaatc tggcgccgaa gtgaagaaac ctggcgcctc cgtgaaggtg 60 tcctgcaagg cctccggctt caacatccgg gactactacc tgcactgggt gcgacaggct 120 ccaggccagg gactggaatg gatgggctgg atcgaccccg agaacggcga taccgagtac 180 gcccctaagt tccagggcag agtgaccacc accgccgaca cctctatctc caccgcctac 240 atggaactgt cccggctgag atccgacgac accgccgtgt actactgcaa cgtgtacggc 300 atctacttca tggactactg gggccagggc acactcgtca ccgtgtcctc t 351 <210> 43 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 43 cagtcgaagc tttgaggaga cggtgaccgt ggtcccttgg ccccag 46 <210> 44 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 44 caactaggat ccaggtsmar ctgcagsagt cwgg 34 <210> 45 <211> 6 <212> DNA <213> Artificial Sequence <220> <223> Primers <400> 45 aagctt 6 <210> 46 <211> 6 <212> DNA <213> Artificial Sequence <220> <223> Primers <400> 46 ggatcc 6 <210> 47 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Primers <400> 47 cagtcgaagc ttgttagatc tccagcttgg tccc 34 <210> 48 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Primers <400> 48 caactaggat ccgacattca gctgacccag tctcca 36 <210> 49 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primers <400> 49 tcacgaattc tcaggtccag ctgcaggagt 30 <210> 50 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Primers <400> 50 ttggtgctag ctgaggagac ggtgaccgt 29 <210> 51 <211> 6 <212> DNA <213> Artificial Sequence <220> <223> Primers <400> 51 gaattc 6 <210> 52 <211> 6 <212> DNA <213> Artificial Sequence <220> <223> Primers <400> 52 gctagc 6 <210> 53 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Primers <400> 53 agccaccgta cgtttgatct ccagcttggt ccca 34 <210> 54 <211> 6 <212> DNA <213> Artificial Sequence <220> <223> Primers <400> 54 cgtacg 6 <210> 55 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primers <400> 55 gtcacgaatt cagacattca gctgacccag 30

Claims

1. Use of a monoclonal antibody that binds to the gastric inhibitory peptide GIP in the preparation of a medicament for the treatment of obesity. The antibody described therein includes a light chain variable domain and a heavy chain variable domain; The light chain variable domain has at least 90% identity with SEQ ID NO: 18 and has a first CDR that has 100% sequence identity with the amino acid sequence of SEQ ID NO: 20; a second CDR that has 100% sequence identity with the amino acid sequence of SEQ ID NO: 21; and a third CDR that has 100% sequence identity with the amino acid sequence of SEQ ID NO: 22; and The heavy chain variable domain has at least 95% identity with the amino acid sequence selected from the group consisting of SEQ ID NO: 28, SEQ ID NO: 29 and SEQ ID NO: 30, and has a first CDR that has 100% sequence identity with the amino acid sequence of SEQ ID NO: 31; a second CDR that has 100% sequence identity with the amino acid sequence of SEQ ID NO: 32; and a third CDR that has 100% sequence identity with the amino acid sequence of SEQ ID NO:

33.

2. Use of a monoclonal antibody that binds to the gastric inhibitory peptide GIP in the preparation of a medicament for the treatment of type II diabetes. The antibody described therein includes a light chain variable domain and a heavy chain variable domain; The light chain variable domain has at least 90% identity with SEQ ID NO: 18 and has a first CDR that has 100% sequence identity with the amino acid sequence of SEQ ID NO: 20; a second CDR that has 100% sequence identity with the amino acid sequence of SEQ ID NO: 21; and a third CDR that has 100% sequence identity with the amino acid sequence of SEQ ID NO: 22; and The heavy chain variable domain has at least 95% identity with the amino acid sequence selected from the group consisting of SEQ ID NO: 28, SEQ ID NO: 29 and SEQ ID NO: 30, and has a first CDR that has 100% sequence identity with the amino acid sequence of SEQ ID NO: 31; a second CDR that has 100% sequence identity with the amino acid sequence of SEQ ID NO: 32; and a third CDR that has 100% sequence identity with the amino acid sequence of SEQ ID NO:

33.

3. Use of a monoclonal antibody that binds to the gastric inhibitory peptide GIP in the preparation of a medicament for the treatment of food-induced Cushing's syndrome. The antibody described therein includes a light chain variable domain and a heavy chain variable domain; The light chain variable domain has at least 90% identity with SEQ ID NO: 18 and has a first CDR that has 100% sequence identity with the amino acid sequence of SEQ ID NO: 20; a second CDR that has 100% sequence identity with the amino acid sequence of SEQ ID NO: 21; and a third CDR that has 100% sequence identity with the amino acid sequence of SEQ ID NO: 22; and The heavy chain variable domain has at least 95% identity with the amino acid sequence selected from the group consisting of SEQ ID NO: 28, SEQ ID NO: 29 and SEQ ID NO: 30, and has a first CDR that has 100% sequence identity with the amino acid sequence of SEQ ID NO: 31; a second CDR that has 100% sequence identity with the amino acid sequence of SEQ ID NO: 32; and a third CDR that has 100% sequence identity with the amino acid sequence of SEQ ID NO:

33.

4. Use of a monoclonal antibody that binds to the gastric inhibitory peptide GIP in the preparation of a medicament for the treatment of metabolic syndrome. The antibody described therein includes a light chain variable domain and a heavy chain variable domain; The light chain variable domain has at least 90% identity with SEQ ID NO: 18 and has a first CDR that has 100% sequence identity with the amino acid sequence of SEQ ID NO: 20; a second CDR that has 100% sequence identity with the amino acid sequence of SEQ ID NO: 21; and a third CDR that has 100% sequence identity with the amino acid sequence of SEQ ID NO: 22; and The heavy chain variable domain has at least 95% identity with the amino acid sequence selected from the group consisting of SEQ ID NO: 28, SEQ ID NO: 29 and SEQ ID NO: 30, and has a first CDR that has 100% sequence identity with the amino acid sequence of SEQ ID NO: 31; a second CDR that has 100% sequence identity with the amino acid sequence of SEQ ID NO: 32; and a third CDR that has 100% sequence identity with the amino acid sequence of SEQ ID NO:

33.

5. The use according to any one of claims 1 to 4, wherein the light chain variable domain has at least 95% identity with SEQ ID NO:

18.

6. The use according to any one of claims 1 to 4, wherein the light chain variable domain is 100% identical to SEQ ID NO: 18, and the heavy chain variable domain is 100% identical to SEQ ID NO: 28, SEQ ID NO: 29 or SEQ ID NO:

30.

7. The use according to any one of claims 1 to 4, wherein the light chain variable domain has at least 90% identity with SEQ ID NO: 18, and the heavy chain variable domain has at least 95% identity with SEQ ID NO:

29.

8. The use according to any one of claims 1 to 4, wherein the light chain variable domain has at least 95% identity with SEQ ID NO: 18, and the heavy chain variable domain has at least 95% identity with SEQ ID NO:

29.

9. The use according to any one of claims 1 to 4, wherein the light chain variable domain is 100% identical to SEQ ID NO: 18, and the heavy chain variable domain is 100% identical to SEQ ID NO:

29.

10. The use according to any one of claims 1 to 4, wherein the monoclonal antibody binds to the amino acid sequence of the GIP, wherein the GIP is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO:

4.

11. The use according to any one of claims 1 to 4, wherein the monoclonal antibody comprises a human constant region.

12. The use according to any one of claims 1 to 4, wherein the molecular weight of the monoclonal antibody is from 30 kDa to 500 kDa.

13. The use according to any one of claims 1 to 4, wherein the monoclonal antibody has a binding affinity for GIP, characterized in that IC 50 The range is from 0.1 nM to 7 nM.

14. The use according to any one of claims 1 to 4, wherein the drug is administered intravenously, intraperitoneally or subcutaneously.

15. The use according to any one of claims 1 to 4, wherein the medicament further comprises a pharmaceutical excipient selected from the group consisting of buffers, surfactants, preservatives, fillers, polymers and stabilizers.

16. The use according to any one of claims 1 to 4, wherein the drug is in the form of a powder, injection, solution, suspension or emulsion.

17. The use according to any one of claims 1 to 4, wherein the amount of antibody contained in the drug is from 0.1 mg to 1000 mg per milliliter of the drug.

18. The use according to any one of claims 1 to 4, wherein the drug is lyophilized.

19. A monoclonal antibody that binds to the gastric inhibitory peptide GIP, comprising a light chain variable domain and a heavy chain variable domain; The light chain variable domain has at least 90% identity with SEQ ID NO: 18 and has a first CDR that has 100% sequence identity with the amino acid sequence of SEQ ID NO: 20; a second CDR that has 100% sequence identity with the amino acid sequence of SEQ ID NO: 21; and a third CDR that has 100% sequence identity with the amino acid sequence of SEQ ID NO: 22; and The heavy chain variable domain has at least 95% identity with the amino acid sequence selected from the group consisting of SEQ ID NO: 28, SEQ ID NO: 29 and SEQ ID NO: 30, and has a first CDR that has 100% sequence identity with the amino acid sequence of SEQ ID NO: 31; a second CDR that has 100% sequence identity with the amino acid sequence of SEQ ID NO: 32; and a third CDR that has 100% sequence identity with the amino acid sequence of SEQ ID NO:

33.

20. The monoclonal antibody of claim 19, wherein the light chain variable domain has at least 95% identity with SEQ ID NO:

18.

21. The monoclonal antibody of claim 19, wherein the light chain variable domain is 100% identical to SEQ ID NO: 18, and the heavy chain variable domain is 100% identical to SEQ ID NO: 28, SEQ ID NO: 29 or SEQ ID NO:

30.

22. The monoclonal antibody of claim 19, wherein the light chain variable domain has at least 95% identity with SEQ ID NO: 18, and the heavy chain variable domain has at least 95% identity with SEQ ID NO:

29.

23. The monoclonal antibody according to claim 19, wherein the light chain variable domain is 100% identical to SEQ ID NO: 18, and the heavy chain variable domain is 100% identical to SEQ ID NO:

29.

24. The monoclonal antibody according to any one of claims 19 to 23, wherein the antibody binds to the amino acid sequence of the GIP, wherein the GIP is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO:

4.

25. The monoclonal antibody according to any one of claims 19 to 23, wherein the monoclonal antibody comprises a human constant region.

26. The monoclonal antibody according to any one of claims 19 to 23, wherein the molecular weight of the monoclonal antibody is from 30 kDa to 500 kDa.

27. The monoclonal antibody according to any one of claims 19 to 23, wherein the monoclonal antibody has a binding affinity for GIP, characterized in that IC 50 The range is from 0.1 nM to 7 nM.

28. A nucleotide molecule encoding a monoclonal antibody according to any one of claims 19 to 23.

Images