Cas9 protein, gene editing system containing Cas9 protein and application thereof

Abstract

The present invention belongs to the field of gene editing technology, and specifically relates to a CRISPR / Cas9 gene editing system and its application. The gene editing system of the present invention is a complex formed by a specific Cas9 protein and sgRNA, which can accurately locate the targeted DNA sequence and produce cutting, so that the target sequence undergoes double-strand break damage; the gene editing is gene editing in cells or in vitro. The PAM sequences recognized by each specific Cas9 protein are diverse, suitable for gene editing in different scenarios, broadening the targetable range, and the specific Hsp1-Hsp3Cas9-Y446A protein and Hsp1-Hsp3Cas9-K390A-Y446A protein have high editing activity and specificity. The present invention has broad application prospects in the field of gene editing.

Description

Technical Field

[0001] The present application belongs to the field of gene editing technology, and specifically relates to Cas9 protein, a gene editing system containing the Cas9 protein, and related applications thereof. Background Art

[0002] The CRISPR / Cas system is an acquired immune system evolved by bacteria and archaea to resist invasion by exogenous viruses or plasmids. In the CRISPR / Cas9 system, after crRNA (CRISPR-derived RNA), tracrRNA (trans-activating RNA) and Cas9 protein form a complex, they recognize the PAM (Protospacer Adjacent Motif) sequence of the target site, and crRNA forms a complementary structure with the targeted DNA sequence. The Cas9 protein performs the function of cutting DNA, causing DNA breakage and damage. Among them, tracrRNA and crRNA can be fused into single-stranded guide RNA (sgRNA) through the connection sequence. When DNA is broken and damaged, the two main DNA damage repair mechanisms in the cell are responsible for repair: non-homologous end-joining (NHEJ) and homologous recombination (HR). The result of NHEJ repair will cause the deletion or insertion of bases, which can be used for gene knockout; when a homologous template is provided, HR repair can be used for site-specific insertion of genes and precise replacement of bases.

[0003] In addition to basic scientific research, the CRISPR / Cas9 gene editing system also has broad prospects for clinical application. When using the CRISPR / Cas9 gene editing system for gene therapy, Cas and single-stranded guide RNA need to be introduced into the body. At present, the most effective expression vector for gene therapy is adeno-associated virus (AAV). However, the DNA packaged by the AAV virus generally does not exceed 4.5kb. SpCas9 is widely used because of its simple PAM sequence (recognizing NGG) and high activity. However, the SpCas9 protein has 1368 amino acids, plus sgRNA and promoter, and cannot be effectively packaged into the AAV virus, limiting its clinical application. To overcome this problem, several small molecular weight Cas9s were invented, including SaCas9 (PAM sequence is NNGRRT); St1Cas9 (PAM sequence is NNAGAW); NmCas9 (PAM sequence is NNNNGATT); Nme2Cas9 (PAM sequence is NNNNCC); CjCas9 (PAM sequence is NNNNRYAC). However, these Cas9s are either prone to off-target effects (i.e., cutting at non-target sites), have complex PAM sequences, or have low editing activity, making them difficult to use widely.

[0004] Therefore, finding a small CRISPR / Cas system with high editing activity, high specificity and simple PAM sequence is the hope for solving the above problems. Summary of the invention

[0005] In response to the above problems, the present inventors conducted repeated studies and found a series of Cas9 proteins and corresponding single-stranded guide RNAs, which can constitute a CRISPA / Cas9 gene editing system for effective gene editing, thereby completing the present invention.

[0006] Therefore, in a first aspect, the present invention provides a Cas9 protein, wherein the Cas9 protein is:

[0007] a) having the amino acid sequence shown in SEQ ID NO: 12 Hsp1-CcuCas9 protein,

[0008] A Hsp1-Hap2Cas9 protein having an amino acid sequence shown in SEQ ID NO: 13,

[0009] A Hsp1-HgaCas9 protein having an amino acid sequence shown in SEQ ID NO: 14,

[0010] A Hsp1-HtyCas9 protein having an amino acid sequence shown in SEQ ID NO: 15,

[0011] A Hsp1-Hsp2Cas9 protein having an amino acid sequence shown in SEQ ID NO: 16,

[0012] A Hsp1-Hsp3Cas9 protein having an amino acid sequence shown in SEQ ID NO: 17,

[0013] A Hsp1-Hsp3Cas9-Y446A protein having an amino acid sequence as shown in SEQ ID NO: 18,

[0014] A Hsp1-Hsp3Cas9-K390A-Y446A protein having an amino acid sequence as shown in SEQ ID NO: 19,

[0015] Hsp1-Hsp4Cas9 protein having the amino acid sequence shown in SEQ ID NO: 20, or

[0016] b) an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, at least 99.95%, at least 99.99%, at least 99.999%, at least 100%, or any percentage between 80% and 100% sequence identity to the amino acid sequence shown in any one of SEQ ID NO:12 to SEQ ID NO:20 and retaining its biological activity.

[0017] In a second aspect, the present invention provides a conjugate comprising:

[0018] a) Cas9 protein, wherein the Cas9 protein is a Cco2Cas9 protein, a CcuCas9 protein, a CspCas9 protein, a Hap1Cas9 protein, a Hap2Cas9 protein, a HgaCas9 protein, a HtyCas9 protein, a Hsp1Cas9 protein, a Hsp2Cas9 protein, a Hsp3Cas9 protein, a Hsp4Cas9 protein, a Hsp1-CcuCas9 protein, a Hsp1-Hap2Cas9 protein, a Hsp1-HgaCas9 protein, a Hsp1-HtyCas9 protein, a Hsp1-Hsp2Cas9 protein, a Hsp1-Hsp3Cas9 protein, a Hsp1-Hsp3Cas9-Y446A protein, a Hsp1-Hsp3Cas9-K390A-Y446A protein, a Hsp1-Hsp4Cas9 protein or a Nsp2Cas9 protein having an amino acid sequence as shown in SEQ ID NO: 1 to SEQ ID NO: 21, respectively, or a protein having an amino acid sequence as shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: an amino acid sequence that has at least 80% sequence identity to the amino acid sequence set forth in any one of SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, and SEQ ID NO:21 and that retains its biological activity;

[0019] b) a modified portion; and

[0020] c) an optional linker for connecting the Cas9 protein to the modification portion.

[0021] In a third aspect, the present invention provides a fusion protein comprising:

[0022] a) Cas9 protein, wherein the Cas9 protein is a Cco2Cas9 protein, a CcuCas9 protein, a CspCas9 protein, a Hap1Cas9 protein, a Hap2Cas9 protein, a HgaCas9 protein, a HtyCas9 protein, a Hsp1Cas9 protein, a Hsp2Cas9 protein, a Hsp3Cas9 protein, a Hsp4Cas9 protein, a Hsp1-CcuCas9 protein, a Hsp1-Hap2Cas9 protein, a Hsp1-HgaCas9 protein, a Hsp1-HtyCas9 protein, a Hsp1-Hsp2Cas9 protein, a Hsp1-Hsp3Cas9 protein, a Hsp1-Hsp3Cas9-Y446A protein, a Hsp1-Hsp3Cas9-K390A-Y446A protein, a Hsp1-Hsp4Cas9 protein or a Nsp2Cas9 protein having an amino acid sequence as shown in SEQ ID NO: 1 to SEQ ID NO: 21, respectively, or a protein having an amino acid sequence as shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: an amino acid sequence that has at least 80% sequence identity to the amino acid sequence set forth in any one of SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, and SEQ ID NO:21 and that retains its biological activity;

[0023] b) another protein or polypeptide; and

[0024] c) an optional linker for connecting the Cas9 protein or a homologue thereof to the additional protein or polypeptide.

[0025] In a fourth aspect, the present invention provides a single-stranded guide RNA, comprising a scaffold sequence, wherein the scaffold sequence has a nucleic acid sequence as shown in any one of SEQ ID NO: 43 and SEQ ID NO: 44, or a nucleic acid sequence that has at least 90% sequence identity with the nucleic acid sequence as shown in any one of SEQ ID NO: 43 and SEQ ID NO: 44 and retains its biological activity, or a nucleic acid sequence that retains its biological activity obtained by modifying the nucleic acid sequence as shown in any one of SEQ ID NO: 43 and SEQ ID NO: 44.

[0026] In a fifth aspect, the present invention provides an isolated nucleic acid molecule comprising a nucleic acid sequence encoding:

[0027] a) Cas9 protein, wherein the Cas9 protein is a Cco2Cas9 protein, a CcuCas9 protein, a CspCas9 protein, a Hap1Cas9 protein, a Hap2Cas9 protein, a HgaCas9 protein, a HtyCas9 protein, a Hsp1Cas9 protein, a Hsp2Cas9 protein, a Hsp3Cas9 protein, a Hsp4Cas9 protein, a Hsp1-CcuCas9 protein, a Hsp1-Hap2Cas9 protein, a Hsp1-HgaCas9 protein, a Hsp1-HtyCas9 protein, a Hsp1-Hsp2Cas9 protein, a Hsp1-Hsp3Cas9 protein, a Hsp1-Hsp3Cas9-Y446A protein, a Hsp1-Hsp3Cas9-K390A-Y446A protein, a Hsp1-Hsp4Cas9 protein or a Nsp2Cas9 protein having an amino acid sequence as shown in SEQ ID NO: 1 to SEQ ID NO: 21, respectively, or a protein having an amino acid sequence as shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: an amino acid sequence that has at least 80% sequence identity to the amino acid sequence set forth in any one of SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, and SEQ ID NO:21 and that retains its biological activity;

[0028] b) the conjugate of the second aspect of the invention; or

[0029] c) The fusion protein of the third aspect of the present invention.

[0030] In a sixth aspect, the present invention provides an isolated nucleic acid molecule comprising a nucleic acid sequence encoding the single-stranded guide RNA of the fourth aspect of the present invention.

[0031] In a seventh aspect, the present invention provides a vector comprising a nucleic acid sequence encoding:

[0032] a) Cas9 protein, wherein the Cas9 protein is a Cco2Cas9 protein, CcuCas9 protein, CspCas9 protein, Hap1Cas9 protein, Hap2Cas9 protein, HgaCas9 protein, HtyCas9 protein, Hsp1 Cas9 protein, Hsp2Cas9 protein, Hsp3Cas9 protein, Hsp4Cas9 protein, Hsp1-CcuCas9 protein, Hsp1-Hap2Cas9 protein, Hsp1-HgaCas9 protein, Hsp1-HtyCas9 protein, Hsp1-Hsp2Cas9 protein, Hsp1-Hsp3Cas9 protein, Hsp1-Hsp3Cas9-Y446A protein, Hsp1-Hsp3Cas9-K390A-Y446A protein, Hsp1-Hsp4Cas9 protein or Nsp2Cas9 protein having the amino acid sequences shown in SEQ ID NO: 1 to SEQ ID NO: 21, respectively, or a protein having the amino acid sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 an amino acid sequence that has at least 80% sequence identity to the amino acid sequence set forth in any one of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, and SEQ ID NO:21 and that retains its biological activity;

[0033] b) the conjugate of the second aspect of the invention; or

[0034] The fusion protein of the third aspect of the present invention.

[0035] In an eighth aspect, the present invention provides a vector comprising a nucleic acid sequence encoding the single-stranded guide RNA of the fourth aspect of the present invention.

[0036] In a ninth aspect, the present invention provides a CRISPR / Cas9 gene editing system comprising:

[0037] a) a protein component comprising:

[0038] 1) Cas9 protein, wherein the Cas9 protein is a Cco2Cas9 protein, a CcuCas9 protein, a CspCas9 protein, a Hap1Cas9 protein, a Hap2Cas9 protein, a HgaCas9 protein, a HtyCas9 protein, a Hsp1Cas9 protein, a Hsp2Cas9 protein, a Hsp3Cas9 protein, a Hsp4Cas9 protein, a Hsp1-CcuCas9 protein, a Hsp1-Hap2Cas9 protein, a Hsp1-HgaCas9 protein, a Hsp1-HtyCas9 protein, a Hsp1-Hsp2Cas9 protein, a Hsp1-Hsp3Cas9 protein, a Hsp1-Hsp3Cas9-Y446A protein, a Hsp1-Hsp3Cas9-K390A-Y446A protein, a Hsp1-Hsp4Cas9 protein or a Nsp2Cas9 protein having an amino acid sequence as shown in SEQ ID NO: 1 to SEQ ID NO: 21, respectively, or a protein having an amino acid sequence as shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 an amino acid sequence that has at least 80% sequence identity to the amino acid sequence set forth in any one of SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, and SEQ ID NO:21 and that retains its biological activity;

[0039] 2) the conjugate of the second aspect of the invention; or

[0040] 3) The fusion protein of the third aspect of the present invention;

[0041] b) a nucleic acid component comprising:

[0042] The single-stranded guide RNA of the fourth aspect of the present invention.

[0043] In a tenth aspect, the present invention provides a cell, comprising: the isolated nucleic acid molecule of the seventh aspect of the present invention, or the vector of the eighth aspect of the present invention.

[0044] In an eleventh aspect, the present invention provides a method for gene editing a target sequence in a cell or in vitro environment, the method comprising: contacting a Cas9 protein, a conjugate of the second aspect of the present invention, or a fusion protein of the third aspect of the present invention with a single-stranded guide RNA of the fourth aspect of the present invention, the vectors of the seventh aspect and the eighth aspect of the present invention, or the CRISPR / Cas9 gene editing system of the ninth aspect of the present invention with a target sequence in a cell or in vitro environment, wherein the Cas9 protein is a Cco2Cas9 protein, a CcuCas9 protein, a CspCas9 protein, a Hap1Cas9 protein, or a CspCas9 protein having amino acid sequences shown in SEQ ID NO: 1 to SEQ ID NO: 21, respectively. Cas9 protein, Hap2Cas9 protein, HgaCas9 protein, HtyCas9 protein, Hsp1Cas9 protein, Hsp2Cas9 protein, Hsp3Cas9 protein, Hsp4Cas9 protein, Hsp1-CcuCas9 protein, Hsp1-Hap2Cas9 protein, Hsp1-HgaCas9 protein, Hsp1-HtyCas9 protein, Hsp1-Hsp2Cas9 protein, Hsp1-Hsp3Cas9 protein, Hsp1-Hsp3Cas9-Y446A protein, Hsp1-Hsp3Cas9-K390A-Y446A protein, Hsp1-Hsp4Cas9 protein or Nsp2Cas9 protein, or a protein having the same sequence as SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: An amino acid sequence having at least 80% sequence identity to the amino acid sequence shown in any one of SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20 and SEQ ID NO: 21 and retaining its biological activity, wherein the target sequence is located at the 5' end of the protospacer adjacent sequence (PAM), andFor the Cco2Cas9 protein, the CcuCas9 protein, the CspCas9 protein, the Hap1 Cas9 protein, the Hap2Cas9 protein, the HgaCas9 protein, the HtyCas9 protein, the Hsp1Cas9 protein, the Hsp2Cas9 protein, the Hsp3Cas9 protein, the Hsp4Cas9 protein, the Hsp1-CcuCas9 protein, the Hsp1-Hap2Cas9 protein, the Hsp1-HgaCas9 protein, the Hsp1-HtyCas9 protein, the Hsp1-Hsp2Cas9 protein, the Hsp1-Hsp3Cas9 protein, the Hsp1-Hsp3Cas9-Y446A protein, the Hsp1-Hsp3Cas9-K390A-Y446A protein, the Hsp1-Hsp4Cas9 protein White, and the Nsp2Cas9 protein, or their homologs, conjugates or fusion proteins, the PAM has the sequence 5'-NNNNCY, 5'-NNNNCNA, 5'-NNNNCYWT, 5'-NNNGCCKS, 5'-NNNGG, 5'-NNNNCC, 5'-NNNNRTTA, 5'-NNNNRAA, 5'-NNNNRYAT, 5'-NNNTCC, 5'-NNNNRT, 5'-NNNNCNA, 5'-NNNGG, 5'-NNNNCCAW, 5'-NNNNRTYR, 5'-NNNNRYAT, 5'-NNNNCY, 5'-NNNNCY, 5'-NNNNCY, 5'-NNNNRT and 5'-NNNNCC, respectively. ,

[0045] In the twelfth aspect, the present invention provides a kit, comprising: Cas9 protein, the conjugate of the second aspect of the present invention or the fusion protein of the third aspect of the present invention and the single-stranded guide RNA of the fourth aspect of the present invention, the isolated nucleic acid molecule of the fifth aspect and the sixth aspect of the present invention, the vector of the seventh aspect and the eighth aspect of the present invention, or the CRISPR / Cas9 gene editing system of the ninth aspect of the present invention; and instructions on how to perform gene editing on a target sequence in a cell or in vitro environment; wherein the Cas9 protein is a protein having SEQ ID NO: 1 to SEQ ID NO: NO: 21, or a Cco2Cas9 protein, CcuCas9 protein, CspCas9 protein, Hap1Cas9 protein, Hap2Cas9 protein, HgaCas9 protein, HtyCas9 protein, Hsp1Cas9 protein, Hsp2Cas9 protein, Hsp3Cas9 protein, Hsp4Cas9 protein, Hsp1-CcuCas9 protein, Hsp1-Hap2Cas9 protein, Hsp1-HgaCas9 protein, Hsp1-HtyCas9 protein, Hsp1-Hsp2Cas9 protein, Hsp1-Hsp3Cas9 protein, Hsp1-Hsp3Cas9-Y446A protein, Hsp1-Hsp3Cas9-K390A-Y446A protein, Hsp1-Hsp4Cas9 protein or Nsp2Cas9 protein having the amino acid sequence shown in SEQ ID NO: 21, or a protein having the amino acid sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20 and SEQ ID NO:21 have at least 80% sequence identity and retain their biological activity.

[0046] Our research group has developed Cas9 editing tools that can efficiently perform gene editing in a eukaryotic cell environment. These Cas9 proteins have a small number of amino acids and can be effectively packaged into expression vectors such as adeno-associated virus vectors, making them very suitable for later development as gene therapy tools. These Cas9s recognize a variety of PAM sequence types, broadening the scope of targetability and can be used for gene editing under different conditions. Moreover, the Cco2Cas9 protein, CcuCas9 protein, CspCas9 protein, Hap1Cas9 protein, Hap2Cas9 protein, HgaCas9 protein, HtyCas9 protein, Hsp1Cas9 protein, Hsp2Cas9 protein, Hsp3Cas9 protein, Hsp4Cas9 protein, Hsp1-CcuCas9 protein, Hsp1-Hap2Cas9 protein, Hsp1-HgaCas9 protein, Hsp1-HtyCas9 protein, Hsp1-Hsp2Cas9 protein, Hsp1-Hsp3Cas9 protein, Hsp1-Hsp3Cas9-Y446A protein, Hsp1-Hsp3Cas9-K390A-Y446A protein and Hsp1-Hsp4Cas9 protein of the present invention can all be gene edited under the guidance of the same single-stranded guide RNA scaffold sequence.

[0047] In addition, the PAM sequences recognized by Cco2Cas9 protein, CcuCas9 protein, Hap2Cas9 protein, HgaCas9 protein, Hsp4Cas9 protein, Hsp1-CcuCas9 protein, Hsp1-Hap2Cas9 protein, Hsp1-Hsp3Cas9 protein, Hsp1-Hsp3Cas9-Y446A protein, Hsp1-Hsp3Cas9-K390A-Y446A protein, Hsp1-Hsp4Cas9 protein and Nsp2Cas9 protein are relatively simple and have a wide editing range. Among them, Hsp1-Hsp3Cas9-Y446A protein and Hsp1-Hsp3Cas9-K390A-Y446A protein have higher editing activity and specificity. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 A schematic diagram showing the use of a GFP reporter cell line library to detect editing of a target sequence by the CRISPR / Cas9 system;

[0049] Figure 2 The cell images after the GFP reporter cell line is treated by the CRISPR / Cas9 gene editing system of the present invention are shown, wherein the upper image is a GFP fluorescence image, and the lower image is a normal white light image;

[0050] Figure 3A schematic diagram showing the editing efficiency results after gene editing of two target sites by the CRISPR / Cco2Cas9 gene editing system;

[0051] Figure 4 A schematic diagram showing the editing efficiency results after gene editing of two target sites by the CRISPR / CcuCas9 gene editing system;

[0052] Figure 5 A schematic diagram showing the editing efficiency results after gene editing of two target sites by the CRISPR / CspCas9 gene editing system;

[0053] Figure 6 A schematic diagram showing the editing efficiency results after gene editing of two target sites by the CRISPR / Hap1Cas9 gene editing system;

[0054] Figure 7 A schematic diagram showing the editing efficiency results after gene editing of two target sites by the CRISPR / Hsp1Cas9 gene editing system;

[0055] Figure 8 A schematic diagram showing the editing efficiency results after gene editing of two target sites by the CRISPR / Hsp3Cas9 gene editing system;

[0056] Fig. 9 A schematic diagram showing the editing efficiency results after gene editing of two target sites by the CRISPR / Hsp1-Hsp3Cas9 gene editing system;

[0057] Fig.10 A schematic diagram showing the editing efficiency results after gene editing of two target sites by the CRISPR / Hsp1-Hsp3Cas9-Y446A gene editing system;

[0058] Fig.11 A schematic diagram showing the editing efficiency results after gene editing of two target sites by the CRISPR / Hsp1-Hsp3Cas9-K390A-Y446A gene editing system;

[0059] Fig.12 A schematic diagram showing the editing efficiency results after gene editing of two target sites by the CRISPR / Nsp2Cas9 gene editing system;

[0060] Fig.13 Schematic diagram showing the specific detection results of the CRISPR / Cco2Cas9 gene editing system in the GFP reporter system HEK293T cell line;

[0061] Fig.14Schematic diagram showing the specific detection results of the CRISPR / CcuCas9 gene editing system in the GFP reporter system HEK293T cell line;

[0062] Fig.15 Schematic diagram showing the specific detection results of the CRISPR / Hsp1Cas9 gene editing system in the GFP reporter system HEK293T cell line;

[0063] Fig.16 Schematic diagram showing the specific detection results of the CRISPR / Hsp1-Hsp3Cas9 gene editing system in the GFP reporter system HEK293T cell line;

[0064] Fig.17 Schematic diagram showing the specific detection results of the CRISPR / Hsp1-Hsp3Cas9-Y446A gene editing system in the GFP reporter system HEK293T cell line;

[0065] Fig.18 Schematic diagram showing the specific detection results of the CRISPR / Hsp1-Hsp3Cas9-K390A-Y446A gene editing system in the GFP reporter system HEK293T cell line;

[0066] Fig.19 Schematic diagram showing the specific detection results of the CRISPR / Nsp2Cas9 gene editing system in the GFP reporter system HEK293T cell line. DETAILED DESCRIPTION

[0067] The present invention will be further described in detail below. It should be understood that the above summary of the invention and the detailed description below are only for the purpose of specifically illustrating the present invention and are not intended to limit the present invention in any way. The scope of protection of the present invention is determined by the appended claims. Without departing from the spirit and purpose of the present invention, those skilled in the art may make changes to each specific embodiment.

[0068] definition

[0069] Unless otherwise specified, the scientific and technical terms used in this application have the meanings commonly understood by those skilled in the art. In order to better understand the present invention, the definitions and explanations of relevant terms are provided below.

[0070] The terms "Cas9 protein", "Cas9" and "Cas" used herein are used interchangeably in this application and refer to RNA-guided nucleases including Cas9 protein or functionally active fragments thereof. Cas9 protein is a protein component of the CRISPR / Cas9 genome editing system, which can target and cut DNA target sequences under the guidance of single-stranded guide RNA (sgRNA) to form DNA double-strand breaks (DSBs). DNA double-strand breaks can activate the intrinsic repair mechanisms in cells, non-homologous end joining (NHEJ) and homologous recombination (HR), thereby repairing DNA damage in cells. During the repair process, the specific DNA sequence is edited at the site.

[0071] The terms "single-stranded guide RNA", "sgRNA (single guided RNA)" used herein are used interchangeably in this application and have the meanings generally understood by those skilled in the art. In general, a single-stranded guide RNA or sgRNA may comprise a scaffold sequence and a guide sequence, which is also referred to herein as a guide RNA (guide RNA or gRNA). In the context of an endogenous CRISPR system, a guide sequence is also referred to as a spacer. In some cases, a guide sequence is any polynucleotide sequence that has sufficient similarity to a target sequence to hybridize with the target sequence and guide the specific binding of a CRISPR / Cas9 complex to the target sequence. In certain embodiments, when optimally aligned, the degree of complementarity between a guide sequence and its corresponding target sequence is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%. It is within the capabilities of a person of ordinary skill in the art to determine the optimal alignment. For example, there are publicly and commercially available alignment algorithms and programs such as, but not limited to, ClustalW, Smith-Waterman in matlab, Bowtie, Geneious, Biopython, and SeqMan.

[0072] The term "CRISPR / Cas9 complex" as used herein refers to a complex formed by the combination of a single-stranded guide RNA (single guide RNA) or a mature crRNA:tracrRNA hybrid and a Cas9 protein, which contains a guide sequence that hybridizes with a target sequence and thereby binds the Cas9 protein to the target sequence. The complex is capable of recognizing and cleaving a polynucleotide that can hybridize with the single-stranded guide RNA or mature crRNA.

[0073] Therefore, in the case of forming a CRISPR / Cas9 complex, a "target sequence" refers to a polynucleotide targeted by a guide sequence designed to be targeted, such as a sequence complementary to the guide sequence, wherein the hybridization between the target sequence and the guide sequence will promote Cas9 to exert its activity, such as the activity of cutting the target sequence. Complete complementarity is not required, as long as there is enough complementarity to cause hybridization and promote Cas9 to exert its activity. In some cases, the target sequence is located in the nucleus or cytoplasm of the cell. In some cases, the target sequence may be located in an organelle of a eukaryotic cell, such as a mitochondria or chloroplast.

[0074] The term "target sequence" or "target polynucleotide" as used herein can be any endogenous or exogenous polynucleotide for a cell (e.g., a eukaryotic cell). For example, the target polynucleotide can be a polynucleotide present in the nucleus of a eukaryotic cell. The target polynucleotide can be a sequence encoding a gene product (e.g., a protein) or a non-coding sequence (e.g., a regulatory polynucleotide or a useless DNA). In some cases, the target sequence should be related to a protospacer adjacent motif (PAM). The precise sequence and length requirements for PAM vary depending on the Cas protein used, but PAM is typically a 2-8 base sequence adjacent to the protospacer (target sequence). Those skilled in the art can identify the PAM sequence used with a given Cas protein.

[0075] As used herein, the terms "polynucleotide," "nucleic acid sequence," "nucleotide sequence," or "nucleic acid fragment" are used interchangeably and are single-stranded or double-stranded RNA or DNA polymers that may optionally contain synthetic, non-natural, or altered nucleotide bases. Nucleotides are referred to by their single-letter names as follows: "A" is adenosine or deoxyadenosine (RNA or DNA, respectively), "C" represents cytidine or deoxycytidine, "G" represents guanosine or deoxyguanosine, "U" represents uridine, "T" represents deoxythymidine, "R" represents purine (A or G), "Y" represents pyrimidine (C or T), "K" represents G or T, "W" represents A or T, "S" represents C or G, "I" represents inosine, and "N" represents any nucleotide.

[0076] As used herein, the terms "polypeptide", "peptide", and "protein" are used interchangeably in this application to refer to polymers of amino acid residues. The term is applicable to amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids, and to naturally occurring amino acid polymers. The terms "polypeptide", "peptide", "amino acid sequence" and "protein" may also include modified forms, including but not limited to glycosylation, lipid attachment, sulfation, gamma carboxylation of glutamic acid residues, hydroxylation and ADP-ribosylation.

[0077] As used herein, the terms sequence "identity" or "homology" have art-recognized meanings, and the percentage of sequence identity between two nucleic acid or polypeptide molecules or regions can be calculated using published techniques. Sequence identity can be measured along the entire length of a polynucleotide or polypeptide or along a region of the molecule. (See, e.g., Computational Molecular Biology, Lesk, AM, ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, DW, ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, AM, and Griffin, HG, eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991). Although there are many methods for measuring the identity between two polynucleotides or polypeptides, the term "identity" is well known to the skilled person to be suitable for conservative amino acid substitutions in peptides or proteins, and generally can be performed without changing the biological activity of the resulting molecule. Generally, those skilled in the art recognize that single amino acid substitutions in non-essential regions of a polypeptide do not substantially change the biological activity (see, e.g., Watson et al., Molecular Biology of the Gene, 4th Edition, 1987, The Benjamin / Cummings Pub.co., p. 224).

[0078] The term "vector" as used herein refers to a nucleic acid delivery vehicle into which a polynucleotide can be inserted. When the vector can express the protein encoded by the inserted polynucleotide, or when the vector can transcribe the inserted polynucleotide (for example, transcribe to generate mRNA or functional RNA), the vector is called an expression vector. The vector can be introduced into a host cell by transformation, transduction or transfection, so that the genetic material elements it carries are expressed in the host cell. Vectors are well known to those skilled in the art, including but not limited to plasmid vectors, viral vectors, etc. The vector can also contain a variety of regulatory sequences for regulating expression. "Regulatory sequence" and "regulatory element" are used interchangeably herein and refer to nucleotide sequences located upstream (5' non-coding sequence), in the middle or downstream (3' non-coding sequence) of a coding sequence and affecting the transcription, RNA processing or stability or translation of the relevant coding sequence. Regulatory sequences can include but are not limited to promoter sequences, transcription start sequences, enhancer sequences, selection elements and reporter genes, etc. The regulatory sequences can be from different sources, or from the same source but arranged in a manner different from that usually occurring in nature. In addition, the vector can also contain a replication initiation site.

[0079] The term "promoter" as used herein refers to a nucleic acid fragment that can control the transcription of another nucleic acid fragment. In some embodiments of the present invention, a promoter is a promoter that can control the transcription of a gene in a cell, whether or not it is derived from the cell. A promoter can be a constitutive promoter or a tissue-specific promoter or a developmentally regulated promoter or an inducible promoter.

[0080] As used herein, the term "constitutive promoter" refers to a promoter that will generally cause a gene to be expressed in most cell types under most circumstances. "Tissue-specific promoter" and "tissue-preferred promoter" are used interchangeably and refer to a promoter that is primarily, but not necessarily exclusively, expressed in one tissue or organ, and may also be expressed in one specific cell or cell type. "Developmentally regulated promoter" refers to a promoter whose activity is determined by developmental events. "Inducible promoter" selectively expresses an operably linked DNA sequence in response to endogenous or exogenous stimuli (environmental, hormones, chemical signals, etc.).

[0081] "Introducing" a nucleic acid molecule (e.g., a plasmid, a linear nucleic acid fragment, RNA, etc.) or a protein into an organism refers to transforming an organism cell with the nucleic acid or protein so that the nucleic acid or protein can function in the cell. "Transformation" as used in the present invention includes stable transformation and transient transformation.

[0082] The term "stable transformation" used herein refers to the introduction of an exogenous nucleotide sequence into a genome, resulting in stable inheritance of the exogenous gene. Once stably transformed, the exogenous nucleic acid sequence is stably integrated into the genome of the organism and any successive generations thereof.

[0083] The term "transient transformation" as used herein refers to the introduction of a nucleic acid molecule or protein into a cell to perform a function without the exogenous gene being stably inherited. In transient transformation, the exogenous nucleic acid sequence is not integrated into the genome.

[0084] The term "complementarity" as used herein refers to the ability of a nucleic acid sequence to form one or more hydrogen bonds with another nucleic acid sequence by means of traditional Watson-Crick or other non-traditional types. The percentage of complementarity represents the percentage of residues in a nucleic acid molecule that can form hydrogen bonds (e.g., Watson-Crick base pairing) with another nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 are complementary, then the percentage of complementarity is 50%, 60%, 70%, 80%, 90% and 100%). "Complete complementarity" means that all consecutive residues of a nucleic acid sequence form hydrogen bonds with the same number of consecutive residues in another nucleic acid sequence. As used herein, "substantially complementary" refers to a degree of complementarity of at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50 or more nucleotides, or to two nucleic acids that hybridize under stringent conditions.

[0085] The term "stringent conditions" related to hybridization used herein refers to a nucleic acid with complementarity to a target sequence that primarily hybridizes with the target sequence and does not hybridize to a non-target sequence substantially. Stringent conditions are generally sequence-dependent and depend on many factors. Generally speaking, the longer the sequence, the higher the temperature at which the sequence specifically hybridizes to its target sequence. Non-limiting examples of stringent conditions are described in Tijssen (1993) "Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization With Nucleic Acid Probes", Part I, Chapter II, "Overview of principles of hybridization and the strategy of nucleic acid probe assay", Elsevier, New York.

[0086] The term "hybridization" as used herein refers to a reaction in which one or more polynucleotide reactions form a complex that is stabilized via hydrogen bonding of bases between the nucleotide residues. Hydrogen bonding can occur by means of Watson-Crick base pairing, Hoogstein binding or in any other sequence-specific manner. The complex may include two chains forming a duplex, three or more chains forming a multi-chain complex, a single self-hybridizing chain, or any combination of these. Hybridization reactions can constitute a step in a more extensive process (such as the beginning of PCR or the cutting of polynucleotides via an enzyme). A sequence that can hybridize with a given sequence is referred to as the "complement" of the given sequence.

[0087] Cas9 protein

[0088] Therefore, in a first aspect, the present invention provides A Cas9 protein, wherein the Cas9 protein is:

[0089] a) having the amino acid sequence shown in SEQ ID NO: 12 Hsp1-CcuCas9 protein,

[0090] A Hsp1-Hap2Cas9 protein having an amino acid sequence shown in SEQ ID NO: 13,

[0091] A Hsp1-HgaCas9 protein having an amino acid sequence shown in SEQ ID NO: 14,

[0092] A Hsp1-HtyCas9 protein having an amino acid sequence shown in SEQ ID NO: 15,

[0093] A Hsp1-Hsp2Cas9 protein having an amino acid sequence shown in SEQ ID NO: 16,

[0094] A Hsp1-Hsp3Cas9 protein having an amino acid sequence shown in SEQ ID NO: 17,

[0095] A Hsp1-Hsp3Cas9-Y446A protein having an amino acid sequence as shown in SEQ ID NO: 18,

[0096] A Hsp1-Hsp3Cas9-K390A-Y446A protein having an amino acid sequence as shown in SEQ ID NO: 19,

[0097] Hsp1-Hsp4Cas9 protein having the amino acid sequence shown in SEQ ID NO: 20, or

[0098] b) an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, at least 99.95%, at least 99.99%, at least 99.999%, at least 100%, or any percentage between 80% and 100% sequence identity to the amino acid sequence shown in any one of SEQ ID NO:12 to SEQ ID NO:20 and retaining its biological activity.

[0099] In the present invention, the so-called "biological activity" of Cas9 protein refers to the activity of the protein binding to single-stranded guide RNA, endonuclease activity (including single-stranded cleavage activity and double-stranded cleavage activity), and / or the activity of binding to and cleaving a specific site of the target sequence under the guidance of guide RNA (gRNA), but is not limited thereto.

[0100] Our research group has developed Cas9 editing tools that can efficiently perform gene editing in a eukaryotic cell environment. These Cas9 proteins have a small number of amino acids and can be effectively packaged into expression vectors such as adeno-associated virus vectors, making them very suitable for later development as gene therapy tools. These Cas9s recognize a variety of PAM sequence types, broadening the scope of targetability and can be used for gene editing under different conditions. Moreover, the Cco2Cas9 protein, CcuCas9 protein, CspCas9 protein, Hap1Cas9 protein, Hap2Cas9 protein, HgaCas9 protein, HtyCas9 protein, Hsp1Cas9 protein, Hsp2Cas9 protein, Hsp3Cas9 protein, Hsp4Cas9 protein, Hsp1-CcuCas9 protein, Hsp1-Hap2Cas9 protein, Hsp1-HgaCas9 protein, Hsp1-HtyCas9 protein, Hsp1-Hsp2Cas9 protein, Hsp1-Hsp3Cas9 protein, Hsp1-Hsp3Cas9-Y446A protein, Hsp1-Hsp3Cas9-K390A-Y446A protein and Hsp1-Hsp4Cas9 protein of the present invention can all be gene edited under the guidance of the same single-stranded guide RNA scaffold sequence.

[0101] In addition, the PAM sequences recognized by Cco2Cas9 protein, CcuCas9 protein, Hap2Cas9 protein, HgaCas9 protein, Hsp4Cas9 protein, Hsp1-CcuCas9 protein, Hsp1-Hap2Cas9 protein, Hsp1-Hsp3Cas9 protein, Hsp1-Hsp3Cas9-Y446A protein, Hsp1-Hsp3Cas9-K390A-Y446A protein, Hsp1-Hsp4Cas9 protein and Nsp2Cas9 protein are relatively simple and have a wide editing range. Among them, Hsp1-Hsp3Cas9-Y446A protein, Hsp1-Hsp3Cas9-K390A-Y446A protein and Nsp2Cas9 protein have higher editing activity and specificity.

[0102] Derivatized Protein

[0103] The Cas9 protein can be derivatized, for example, by linking it to another molecule (e.g., another protein or polypeptide). Typically, the derivatization (e.g., labeling) of the protein will not adversely affect the desired activity of the protein (e.g., activity binding to a single-stranded guide RNA, endonuclease activity, activity binding to and cutting a specific site of a target sequence under the guidance of a guide RNA). Therefore, in the present invention, the Cas9 protein can be functionally linked (by chemical coupling, gene fusion, non-covalent linkage or other means) to one or more other molecular parts, such as another protein or polypeptide, a detectable marker, a pharmaceutical agent, etc.

[0104] In particular, the Cas9 protein can be connected to other functional units. For example, it can be connected to a nuclear localization signal (NLS) sequence to improve the ability of the protein of the present invention to enter the nucleus. For example, it can be connected to a targeting moiety so that the Cas9 protein has targeting. For example, it can be connected to a detectable marker to facilitate detection of the Cas9 protein. For example, it can be connected to an epitope tag to facilitate expression, detection, tracing and / or purification of the Cas9 protein.

[0105] Therefore, in a second aspect, the present invention provides a conjugate comprising:

[0106] a) Cas9 protein, wherein the Cas9 protein is:

[0107] 1) a Cco2Cas9 protein having an amino acid sequence as shown in SEQ ID NO: 1,

[0108] A CcuCas9 protein having an amino acid sequence shown in SEQ ID NO: 2,

[0109] A CspCas9 protein having an amino acid sequence shown in SEQ ID NO: 3,

[0110] A Hap1Cas9 protein having an amino acid sequence shown in SEQ ID NO: 4,

[0111] A Hap2Cas9 protein having an amino acid sequence shown in SEQ ID NO: 5,

[0112] A HgaCas9 protein having an amino acid sequence shown in SEQ ID NO: 6,

[0113] A HtyCas9 protein having an amino acid sequence shown in SEQ ID NO: 7,

[0114] A Hsp1Cas9 protein having an amino acid sequence shown in SEQ ID NO: 8,

[0115] An Hsp2Cas9 protein having an amino acid sequence shown in SEQ ID NO: 9,

[0116] A Hsp3Cas9 protein having an amino acid sequence shown in SEQ ID NO: 10,

[0117] A Hsp4Cas9 protein having an amino acid sequence shown in SEQ ID NO: 11,

[0118] A Hsp1-CcuCas9 protein having an amino acid sequence shown in SEQ ID NO: 12,

[0119] A Hsp1-Hap2Cas9 protein having an amino acid sequence shown in SEQ ID NO: 13,

[0120] A Hsp1-HgaCas9 protein having an amino acid sequence shown in SEQ ID NO: 14,

[0121] A Hsp1-HtyCas9 protein having an amino acid sequence shown in SEQ ID NO: 15,

[0122] A Hsp1-Hsp2Cas9 protein having an amino acid sequence shown in SEQ ID NO: 16,

[0123] A Hsp1-Hsp3Cas9 protein having an amino acid sequence shown in SEQ ID NO: 17,

[0124] A Hsp1-Hsp3Cas9-Y446A protein having an amino acid sequence as shown in SEQ ID NO: 18,

[0125] A Hsp1-Hsp3Cas9-K390A-Y446A protein having an amino acid sequence as shown in SEQ ID NO: 19,

[0126] Hsp1-Hsp4Cas9 protein having the amino acid sequence shown in SEQ ID NO: 20, or

[0127] A Nsp2Cas9 protein having an amino acid sequence as shown in SEQ ID NO: 21,

[0128] or

[0129] 2) Having SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20 and SEQ ID NO:21 has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, at least 99.95%, at least 99.99%, at least 99.999%, at least 100%, or any percentage between 80% and 100% sequence identity to the amino acid sequence set forth in any one of the preceding claims and retains its biological activity;

[0130] b) a modified portion; and

[0131] c) an optional linker for connecting the Cas9 protein to the modification portion.

[0132] Here, the above description of Cas9 protein is applicable to this aspect of the present invention, and will not be repeated here.

[0133] It is understood that in addition to the Cas9 protein itself, the Cas9 protein can also be combined with other substances such as other proteins or labelable tags to impart other functionalities.

[0134] Thus, in one embodiment, the modifying moiety may be another protein or polypeptide, a detectable label, or a combination thereof.

[0135] In a further embodiment, the additional protein or polypeptide is selected from one or more of an epitope tag, a reporter protein or a nuclear localization signal (NLS) sequence, a cytosine deaminase (CBE), adenine deaminase (ABE), a cytosine methylase DNMT3A and MQ1, a cytosine demethylase Tet1, a transcriptional activator protein VP64, p65 and RTA, a transcriptional repressor protein KRAB, a histone acetylase p300, a histone deacetylase LSD1, and an endonuclease FokI.

[0136] Epitope tags are well known to those skilled in the art, examples of which include but are not limited to His, V5, FLAG, HA, Myc, VSV-G, Trx, etc., and those skilled in the art know how to select a suitable epitope tag according to the desired purpose (e.g., purification, detection or tracing).

[0137] Reporter proteins are well known to those skilled in the art, and examples thereof include but are not limited to GST, HRP, CAT, GFP, HcRed, DsRed, CFP, YFP, BFP, etc.

[0138] Detectable labels are well known to those skilled in the art, and examples include fluorescent dyes such as fluorescein isothiocyanate (FITC) or DAPI.

[0139] The Cas9 protein of the present invention may be coupled, conjugated or fused to the modified portion via a linker, or may be directly connected to the modified portion without a linker. Linkers are well known in the art, and examples thereof may include, but are not limited to, linkers comprising 1-50 amino acids (such as Glu or Ser) or amino acid derivatives (such as Ahx, β-Ala, GABA or Ava), or PEG, etc.

[0140] In a third aspect, the present invention provides a fusion protein comprising:

[0141] a) Cas9 protein, wherein the Cas9 protein is:

[0142] 1) a Cco2Cas9 protein having an amino acid sequence as shown in SEQ ID NO: 1,

[0143] A CcuCas9 protein having an amino acid sequence shown in SEQ ID NO: 2,

[0144] A CspCas9 protein having an amino acid sequence shown in SEQ ID NO: 3,

[0145] A Hap1Cas9 protein having an amino acid sequence shown in SEQ ID NO: 4,

[0146] A Hap2Cas9 protein having an amino acid sequence shown in SEQ ID NO: 5,

[0147] A HgaCas9 protein having an amino acid sequence shown in SEQ ID NO: 6,

[0148] A HtyCas9 protein having an amino acid sequence shown in SEQ ID NO: 7,

[0149] An Hsp1 Cas9 protein having an amino acid sequence shown in SEQ ID NO: 8,

[0150] An Hsp2Cas9 protein having an amino acid sequence shown in SEQ ID NO: 9,

[0151] A Hsp3Cas9 protein having an amino acid sequence shown in SEQ ID NO: 10,

[0152] A Hsp4Cas9 protein having an amino acid sequence shown in SEQ ID NO: 11,

[0153] A Hsp1-CcuCas9 protein having an amino acid sequence shown in SEQ ID NO: 12,

[0154] A Hsp1-Hap2Cas9 protein having an amino acid sequence shown in SEQ ID NO: 13,

[0155] A Hsp1-HgaCas9 protein having an amino acid sequence shown in SEQ ID NO: 14,

[0156] A Hsp1-HtyCas9 protein having an amino acid sequence shown in SEQ ID NO: 15,

[0157] A Hsp1-Hsp2Cas9 protein having an amino acid sequence shown in SEQ ID NO: 16,

[0158] A Hsp1-Hsp3Cas9 protein having an amino acid sequence shown in SEQ ID NO: 17,

[0159] A Hsp1-Hsp3Cas9-Y446A protein having an amino acid sequence as shown in SEQ ID NO: 18,

[0160] A Hsp1-Hsp3Cas9-K390A-Y446A protein having an amino acid sequence as shown in SEQ ID NO: 19,

[0161] Hsp1-Hsp4Cas9 protein having the amino acid sequence shown in SEQ ID NO: 20, or

[0162] A Nsp2Cas9 protein having an amino acid sequence as shown in SEQ ID NO: 21,

[0163] or

[0164] 2) Having the same properties as SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20 and SEQ ID NO:21 has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, at least 99.95%, at least 99.99%, at least 99.999%, at least 100%, or any percentage between 80% and 100% sequence identity to the amino acid sequence set forth in any one of the preceding claims and retains its biological activity;

[0165] b) another protein or polypeptide; and

[0166] c) an optional linker for connecting the Cas9 protein to the additional protein or polypeptide.

[0167] As in the second aspect of the present invention, the additional protein or polypeptide may be selected from one or more of an epitope tag, a reporter protein or a nuclear localization signal (NLS) sequence, cytosine deaminase (CBE), adenine deaminase (ABE), cytosine methylase DNMT3A and MQ1, cytosine demethylase Tet1, transcription activator proteins VP64, p65 and RTA, transcription repressor protein KRAB, histone acetylase p300, histone deacetylase LSD1, and endonuclease FokI.

[0168] Epitope tags are well known to those skilled in the art, and examples thereof include, but are not limited to, His, V5, FLAG, HA, Myc, VSV-G, Trx, etc., and those skilled in the art know how to select appropriate epitope tags according to the desired purpose (e.g., purification, detection, or tracing). Reporter proteins are well known to those skilled in the art, and examples thereof include, but are not limited to, GST, HRP, CAT, GFP, HcRed, DsRed, CFP, YFP, BFP, etc.

[0169] Reporter proteins are well known to those skilled in the art, and examples thereof include but are not limited to GST, HRP, CAT, GFP, HcRed, DsRed, CFP, YFP, BFP, etc.

[0170] Detectable labels are well known to those skilled in the art, and examples include fluorescent dyes such as fluorescein isothiocyanate (FITC) or DAPI.

[0171] The Cas9 protein of the present invention can be coupled, conjugated or fused to the other protein or polypeptide through a linker, or can be directly connected to the other protein or polypeptide without a linker. Linkers are well known in the art, and examples thereof include but are not limited to linkers comprising 1-50 amino acids (such as Glu or Ser) or amino acid derivatives (such as Ahx, β-Ala, GABA or Ava), or PEG, etc.

[0172] Single-stranded guide RNA

[0173] In a fourth aspect, the present invention provides a single-stranded guide RNA, wherein the single-stranded guide RNA comprises a scaffold sequence, wherein the scaffold sequence has:

[0174] a) a nucleic acid sequence as shown in SEQ ID NO: 43 for Cco2Cas9 protein, CcuCas9 protein, CspCas9 protein, Hap1Cas9 protein, Hap2Cas9 protein, HgaCas9 protein, HtyCas9 protein, Hsp1Cas9 protein, Hsp2Cas9 protein, Hsp3Cas9 protein, Hsp4Cas9 protein, Hsp1-CcuCas9 protein, Hsp1-Hap2Cas9 protein, Hsp1-HgaCas9 protein, Hsp1-HtyCas9 protein, Hsp1-Hsp2Cas9 protein, Hsp1-Hsp3Cas9 protein, Hsp 1-Hsp3Cas9-Y446A protein, Hsp1-Hsp3Cas9-K390A-Y446A protein and Hsp1-Hsp4Cas9 protein, a homologue, a conjugate or a fusion protein thereof, or

[0175] The nucleic acid sequence shown in SEQ ID NO: 44 for Nsp2Cas9 protein, its homologue, conjugate or fusion protein;

[0176] or

[0177] b) a nucleic acid sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.9% or at least 100% identical to the nucleic acid sequence shown in any one of SEQ ID NO:43 and SEQ ID NO:44 and retains its biological activity; or

[0178] c) A nucleic acid sequence modified based on the nucleic acid sequence of any one of SEQ ID NO: 43 and SEQ ID NO: 44 and retaining its biological activity.

[0179] In one embodiment, the modification may be one or more of base phosphorylation, base sulfurization, base methylation, base hydroxylation, sequence shortening and sequence lengthening.

[0180] In a further embodiment, the shortening of the sequence and the lengthening of the sequence comprise the deletion or addition of one, two, three, four, five, six, seven, eight, nine or ten bases relative to the base sequence.

[0181] In another embodiment, the single-stranded guide RNA may further include a CRISPR spacer sequence at the 5' end of the scaffold sequence, wherein the CRISPR spacer sequence is a sequence with a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides (preferably 22 nucleotides) and capable of complementary pairing with the target sequence.

[0182] In a preferred embodiment, the CRISPR spacer sequence is a sequence with a length of 22 nucleotides and capable of complementary pairing with the target sequence.

[0183] In a further embodiment, the single-stranded guide RNA further comprises a terminator at the 3' end of the scaffold sequence. As an example, the terminator can be a terminator consisting of multiple, such as at least six (eg, seven or eight) Us.

[0184] The single-stranded guide RNA can bind to the above-mentioned Cas9 protein, conjugate or fusion protein to form a complex, which can recognize the corresponding PAM and thereby bind to the target sequence, thereby achieving shearing of the target sequence or gene editing.

[0185] Encoding nucleic acid and vector

[0186] In a fifth aspect, the present invention provides an isolated nucleic acid molecule comprising a nucleic acid sequence encoding:

[0187] a) Cas9 protein, wherein the Cas9 protein is:

[0188] 1) a Cco2Cas9 protein having an amino acid sequence as shown in SEQ ID NO: 1,

[0189] A CcuCas9 protein having an amino acid sequence shown in SEQ ID NO: 2,

[0190] A CspCas9 protein having an amino acid sequence shown in SEQ ID NO: 3,

[0191] A Hap1Cas9 protein having an amino acid sequence shown in SEQ ID NO: 4,

[0192] A Hap2Cas9 protein having an amino acid sequence shown in SEQ ID NO: 5,

[0193] A HgaCas9 protein having an amino acid sequence shown in SEQ ID NO: 6,

[0194] A HtyCas9 protein having an amino acid sequence shown in SEQ ID NO: 7,

[0195] A Hsp1Cas9 protein having an amino acid sequence shown in SEQ ID NO: 8,

[0196] An Hsp2Cas9 protein having an amino acid sequence shown in SEQ ID NO: 9,

[0197] A Hsp3Cas9 protein having an amino acid sequence shown in SEQ ID NO: 10,

[0198] A Hsp4Cas9 protein having an amino acid sequence shown in SEQ ID NO: 11,

[0199] A Hsp1-CcuCas9 protein having an amino acid sequence shown in SEQ ID NO: 12,

[0200] A Hsp1-Hap2Cas9 protein having an amino acid sequence shown in SEQ ID NO: 13,

[0201] Hsp1-HgaCas9 protein having the amino acid sequence shown in SEQ ID NO: 14.

[0202] Hsp1-HtyCas9 protein having the amino acid sequence shown in SEQ ID NO: 15.

[0203] A Hsp1-Hsp2Cas9 protein having an amino acid sequence shown in SEQ ID NO: 16,

[0204] A Hsp1-Hsp3Cas9 protein having an amino acid sequence shown in SEQ ID NO: 17,

[0205] A Hsp1-Hsp3Cas9-Y446A protein having an amino acid sequence as shown in SEQ ID NO: 18,

[0206] A Hsp1-Hsp3Cas9-K390A-Y446A protein having an amino acid sequence as shown in SEQ ID NO: 19,

[0207] Hsp1-Hsp4Cas9 protein having the amino acid sequence shown in SEQ ID NO: 20, or

[0208] A Nsp2Cas9 protein having an amino acid sequence as shown in SEQ ID NO: 21,

[0209] or

[0210] 2) Having the same properties as SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20 and SEQ ID NO:21 has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, at least 99.95%, at least 99.99%, at least 99.999%, at least 100%, or any percentage between 80% and 100% sequence identity to the amino acid sequence set forth in any one of the preceding claims and retains its biological activity;

[0211] b) the conjugate of the second aspect of the invention; or

[0212] c) The fusion protein of the third aspect of the present invention.

[0213] In one embodiment, the isolated nucleic acid molecule comprises the nucleic acid sequence shown in any one of SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41 and SEQ ID NO:42, or a degenerate sequence thereof.

[0214] In a further embodiment, the isolated nucleic acid molecule also encodes the single-stranded guide RNA corresponding to the Cas9 protein of the fourth aspect of the invention.

[0215] As an example, the isolated nucleic acid molecule comprises a nucleic acid sequence encoding a Cas9 protein having an amino acid sequence as shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19 or SEQ ID NO: 20, a homologue, a conjugate or a fusion protein thereof, such as SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35 NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40 or SEQ ID NO:41, and comprises a nucleic acid sequence encoding a single-stranded guide RNA for the Cas9 protein, its homolog, conjugate or fusion protein comprising the scaffold sequence shown in SEQ ID NO:43, comprising a homologous sequence having at least 90% sequence identity with SEQ ID NO:43 and retaining its biological activity, or comprising a modified sequence based on SEQ ID NO:43 and retaining its biological activity, such as the nucleic acid sequence shown in SEQ ID NO:45.

[0216] As an example, the isolated nucleic acid molecule comprises a nucleic acid sequence encoding an Nsp2Cas9 protein having an amino acid sequence shown in SEQ ID NO: 21, a homolog thereof, a conjugate thereof or a fusion protein thereof, such as a nucleic acid sequence shown in SEQ ID NO: 42, and comprises a nucleic acid sequence encoding a single-stranded guide RNA for the Nsp2Cas9 protein, its homolog, conjugate or fusion protein comprising a scaffold sequence shown in SEQ ID NO: 44, a homologous sequence having at least 90% sequence identity with SEQ ID NO: 44 and retaining its biological activity, or a modified sequence modified based on SEQ ID NO: 44 and retaining its biological activity, such as a nucleic acid sequence shown in SEQ ID NO: 46.

[0217] In a sixth aspect, the present invention provides an isolated nucleic acid molecule comprising a nucleic acid sequence encoding the single-stranded guide RNA of the fourth aspect of the present invention.

[0218] In one embodiment, the isolated nucleic acid molecule comprises the nucleic acid sequence shown in any one of SEQ ID NO: 45 and SEQ ID NO: 46 or a degenerate sequence thereof.

[0219] In a preferred embodiment, the isolated nucleic acid molecule further comprises a nucleic acid sequence encoding a CRISPR spacer sequence.

[0220] After the isolated nucleic acid molecule of the present invention is transfected into the corresponding cells using certain tools known in the art, such as expression vectors, the isolated nucleic acid molecule of the present invention can express the Cas9 protein described above, its conjugate or fusion protein, and / or the single-stranded guide RNA described above, and perform corresponding functions therein, such as gene editing.

[0221] In addition, the isolated nucleic acid molecule of the present invention can express Cas9 protein, its conjugate or fusion protein, and single-stranded guide RNA individually / separately, or can express the expression products as a whole. The expression method selected depends on the specific situation.

[0222] Furthermore, the expression product has the corresponding effects and / or functions described above, which will not be repeated here for the sake of brevity.

[0223] In a seventh aspect, the present invention provides a vector comprising a nucleic acid sequence encoding:

[0224] a) Cas9 protein, wherein the Cas9 protein is:

[0225] 1) a Cco2Cas9 protein having an amino acid sequence as shown in SEQ ID NO: 1,

[0226] A CcuCas9 protein having an amino acid sequence shown in SEQ ID NO: 2,

[0227] A CspCas9 protein having an amino acid sequence shown in SEQ ID NO: 3,

[0228] A Hap1Cas9 protein having an amino acid sequence shown in SEQ ID NO: 4,

[0229] A Hap2Cas9 protein having an amino acid sequence shown in SEQ ID NO: 5,

[0230] A HgaCas9 protein having an amino acid sequence shown in SEQ ID NO: 6,

[0231] A HtyCas9 protein having an amino acid sequence shown in SEQ ID NO: 7,

[0232] An Hsp1 Cas9 protein having an amino acid sequence shown in SEQ ID NO: 8,

[0233] An Hsp2Cas9 protein having an amino acid sequence shown in SEQ ID NO: 9,

[0234] A Hsp3Cas9 protein having an amino acid sequence shown in SEQ ID NO: 10,

[0235] A Hsp4Cas9 protein having an amino acid sequence shown in SEQ ID NO: 11,

[0236] A Hsp1-CcuCas9 protein having an amino acid sequence shown in SEQ ID NO: 12,

[0237] A Hsp1-Hap2Cas9 protein having an amino acid sequence shown in SEQ ID NO: 13,

[0238] A Hsp1-HgaCas9 protein having an amino acid sequence shown in SEQ ID NO: 14,

[0239] A Hsp1-HtyCas9 protein having an amino acid sequence shown in SEQ ID NO: 15,

[0240] A Hsp1-Hsp2Cas9 protein having an amino acid sequence shown in SEQ ID NO: 16,

[0241] A Hsp1-Hsp3Cas9 protein having an amino acid sequence shown in SEQ ID NO: 17,

[0242] A Hsp1-Hsp3Cas9-Y446A protein having an amino acid sequence as shown in SEQ ID NO: 18,

[0243] A Hsp1-Hsp3Cas9-K390A-Y446A protein having an amino acid sequence as shown in SEQ ID NO: 19,

[0244] Hsp1-Hsp4Cas9 protein having the amino acid sequence shown in SEQ ID NO: 20, or

[0245] A Nsp2Cas9 protein having an amino acid sequence as shown in SEQ ID NO: 21,

[0246] or

[0247] 2) Having the same properties as SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20 and SEQ ID NO:21 has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, at least 99.95%, at least 99.99%, at least 99.999%, at least 100%, or any percentage between 80% and 100% sequence identity to the amino acid sequence set forth in any one of the preceding claims and retains its biological activity;

[0248] b) the conjugate of the second aspect of the invention; or

[0249] c) The fusion protein of the third aspect of the present invention.

[0250] In one embodiment, the vector comprises the nucleic acid sequence shown in any one of SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, and SEQ ID NO:42, or a degenerate sequence thereof.

[0251] The vector can be an expression vector, such as a plasmid vector such as a pUC19 vector, an episome vector, a pAAV2_ITR vector, a retroviral vector, a lentiviral vector, an adenoviral vector or an adeno-associated viral vector.

[0252] In yet another embodiment, the vector further comprises a nucleic acid sequence encoding a single-stranded guide RNA corresponding to the Cas9 protein of the fourth aspect of the present invention.

[0253] As an example, the vector comprises a nucleic acid sequence encoding a Cas9 protein having an amino acid sequence as shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19 or SEQ ID NO: 20, a homologue, a conjugate or a fusion protein thereof, such as SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35 NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40 or SEQ ID NO:41, and comprises a nucleic acid sequence encoding a single-stranded guide RNA for the Cas9 protein, its homolog, conjugate or fusion protein comprising the scaffold sequence shown in SEQ ID NO:43, comprising a homologous sequence having at least 90% sequence identity with SEQ ID NO:43 and retaining its biological activity, or comprising a modified sequence based on SEQ ID NO:43 and retaining its biological activity, such as the nucleic acid sequence shown in SEQ ID NO:45.

[0254] As an example, the vector contains a nucleic acid sequence encoding an Nsp2Cas9 protein having an amino acid sequence shown in SEQ ID NO: 21, a homolog thereof, a conjugate thereof or a fusion protein thereof, such as the nucleic acid sequence shown in SEQ ID NO: 42, and contains a nucleic acid sequence encoding a single-stranded guide RNA targeting the Nsp2Cas9 protein, its homolog, conjugate or fusion protein, comprising a CRISPR repeat sequence shown in SEQ ID NO: 44, comprising a homologous sequence having at least 90% sequence identity with SEQ ID NO: 44 and retaining its biological activity, or comprising a modified sequence based on SEQ ID NO: 44 and retaining its biological activity, such as the nucleic acid sequence shown in SEQ ID NO: 46.

[0255] In an eighth aspect, the present invention provides a vector comprising a nucleic acid sequence encoding the single-stranded guide RNA of the fourth aspect of the present invention.

[0256] In one embodiment, the vector comprises the nucleic acid sequence shown in any one of SEQ ID NO: 45 and SEQ ID NO: 46 or a degenerate sequence thereof.

[0257] In a preferred embodiment, the vector further comprises a nucleic acid sequence encoding a CRISPR spacer sequence.

[0258] According to the above description, after the vector of the present invention is transfected into cells, the nucleic acid sequence cloned in the vector can be expressed as Cas9 protein, its conjugate or fusion protein, and / or the single-stranded guide RNA described above, and perform corresponding functions therein, such as gene editing.

[0259] In addition, multiple vectors, such as two vectors, can be transfected into cells, wherein one vector expresses the Cas9 protein, its conjugate or fusion protein, and the other vector expresses the single-stranded guide RNA. Subsequently, the expressed Cas9 protein, its conjugate or fusion protein is complexed with the expressed single-stranded guide RNA to form a complex, and the corresponding function is performed therein, such as gene editing.

[0260] Of course, the nucleic acid sequence encoding the Cas9 protein, its conjugate or fusion protein and the nucleic acid sequence encoding the single-stranded guide RNA can also be cloned into a vector, so that after the vector is transfected into the cell, both the Cas9 protein, its conjugate or fusion protein and the single-stranded guide RNA are expressed and perform corresponding functions, such as gene editing.

[0261] CRISPR / Cas9 gene editing system

[0262] In a ninth aspect, the present invention provides a CRISPR / Cas9 gene editing system comprising:

[0263] a) a protein component comprising:

[0264] 1) Cas9 protein, wherein the Cas9 protein is:

[0265] 1.1) a Cco2Cas9 protein having an amino acid sequence as shown in SEQ ID NO: 1,

[0266] A CcuCas9 protein having an amino acid sequence shown in SEQ ID NO: 2,

[0267] A CspCas9 protein having an amino acid sequence shown in SEQ ID NO: 3,

[0268] A Hap1 Cas9 protein having an amino acid sequence shown in SEQ ID NO: 4,

[0269] A Hap2Cas9 protein having an amino acid sequence shown in SEQ ID NO: 5,

[0270] A HgaCas9 protein having an amino acid sequence shown in SEQ ID NO: 6,

[0271] A HtyCas9 protein having an amino acid sequence shown in SEQ ID NO: 7,

[0272] A Hsp1Cas9 protein having an amino acid sequence shown in SEQ ID NO: 8,

[0273] An Hsp2Cas9 protein having an amino acid sequence shown in SEQ ID NO: 9,

[0274] A Hsp3Cas9 protein having an amino acid sequence shown in SEQ ID NO: 10,

[0275] A Hsp4Cas9 protein having an amino acid sequence shown in SEQ ID NO: 11,

[0276] A Hsp1-CcuCas9 protein having an amino acid sequence shown in SEQ ID NO: 12,

[0277] A Hsp1-Hap2Cas9 protein having an amino acid sequence shown in SEQ ID NO: 13,

[0278] A Hsp1-HgaCas9 protein having an amino acid sequence shown in SEQ ID NO: 14,

[0279] A Hsp1-HtyCas9 protein having an amino acid sequence shown in SEQ ID NO: 15,

[0280] A Hsp1-Hsp2Cas9 protein having an amino acid sequence shown in SEQ ID NO: 16,

[0281] A Hsp1-Hsp3Cas9 protein having an amino acid sequence shown in SEQ ID NO: 17,

[0282] A Hsp1-Hsp3Cas9-Y446A protein having an amino acid sequence as shown in SEQ ID NO: 18,

[0283] A Hsp1-Hsp3Cas9-K390A-Y446A protein having an amino acid sequence as shown in SEQ ID NO: 19,

[0284] Hsp1-Hsp4Cas9 protein having the amino acid sequence shown in SEQ ID NO: 20, or

[0285] A Nsp2Cas9 protein having an amino acid sequence as shown in SEQ ID NO: 21,

[0286] or

[0287] 1.2) Having the same properties as SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20 and SEQ ID NO:21 has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, at least 99.95%, at least 99.99%, at least 99.999%, at least 100%, or any percentage between 80% and 100% sequence identity to the amino acid sequence set forth in any one of the preceding claims and retains its biological activity;

[0288] 2) the conjugate of the second aspect of the invention; or

[0289] 3) The fusion protein of the third aspect of the present invention; and

[0290] b) a nucleic acid component, which comprises: a single-stranded guide RNA corresponding to the protein component in a) according to the fourth aspect of the present invention;

[0291] Furthermore, the protein component and the nucleic acid component are combined with each other to form a complex.

[0292] As an example, the protein component comprises a Cas9 protein having an amino acid sequence as shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19 or SEQ ID NO: 20, a homologue, a conjugate or a fusion protein thereof, and the nucleic acid component comprises a single-stranded guide RNA, which is a single-stranded guide RNA comprising a scaffold sequence as shown in SEQ ID NO: 43, a single-stranded guide RNA comprising a homologous sequence having at least 90% sequence identity with SEQ ID NO: 43 and retaining its biological activity, or a single-stranded guide RNA comprising a modified sequence based on SEQ ID NO: 43 and retaining its biological activity.

[0293] As an example, the protein component comprises an Nsp2Cas9 protein having an amino acid sequence shown in SEQ ID NO: 21, a homolog, a conjugate or a fusion protein thereof, and the nucleic acid component comprises a single-stranded guide RNA, which is a single-stranded guide RNA comprising a scaffold sequence shown in SEQ ID NO: 44, a single-stranded guide RNA comprising a homologous sequence having at least 90% sequence identity with SEQ ID NO: 44 and retaining its biological activity, or a single-stranded guide RNA comprising a modified sequence based on SEQ ID NO: 44 and retaining its biological activity.

[0294] In the above, the expression "at least 90% sequence identity" mentioned for the single-stranded guide RNA can be, for example, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.9% or at least 100% sequence identity.

[0295] The CRISPR / Cas9 gene editing system of the present invention can be directly composed of the Cas9 protein described herein, its homologs, or their conjugates or fusion proteins and the single-stranded guide RNA described herein, or can be composed of the expression product obtained by expressing the vector described herein.

[0296] The CRISPR / Cas9 gene editing system of the present invention realizes the recognition, positioning, cutting and gene editing of the target sequence through the joint action of the Cas9 protein and the single-stranded guide RNA contained therein.

[0297] The CRISPR / Cas9 gene editing system of the present invention can accurately locate the target sequence. The so-called "accurate positioning" has two meanings: the first meaning is that the CRISPR / Cas9 gene editing system of the present invention itself can recognize and bind to the target sequence, and the second meaning is that the CRISPR / Cas9 gene editing system of the present invention can bring other proteins fused with the Cas9 protein or proteins that specifically recognize the sgRNA to the location of the target sequence.

[0298] Some CRISPR / Cas9 gene editing systems of the present invention have low tolerance for non-target sequences. In this article, the so-called "low tolerance" means that the CRISPR / Cas9 gene editing system of the present invention is basically unable or completely unable to recognize and bind to non-target sequences, or is basically unable or completely unable to bring other proteins fused to the Cas9 protein or proteins that specifically recognize the sgRNA to the location of non-target sequences.

[0299] cell

[0300] In a tenth aspect, the present invention provides a cell, comprising: the isolated nucleic acid molecule of the fifth and sixth aspects of the present invention, or the vector of the seventh and eighth aspects of the present invention.

[0301] As an example, the cell may be a prokaryotic cell or a eukaryotic cell. For the eukaryotic cell, as an example, it may be a plant cell or an animal cell. For the animal cell, as an example, it may be a mammalian cell such as a human cell.

[0302] method

[0303] In an eleventh aspect, the present invention provides a method for gene editing a target sequence in a cell or in vitro environment, the method comprising contacting any one of the following (1) to (4) with the target sequence in a cell or in vitro environment:

[0304] (1) Cas9 protein, the conjugate of the second aspect of the present invention or the fusion protein of the third aspect of the present invention, and the single-stranded guide RNA corresponding to the Cas9 protein of the fourth aspect of the present invention,

[0305] Wherein, the Cas9 protein is:

[0306] 1) a Cco2Cas9 protein having an amino acid sequence as shown in SEQ ID NO: 1,

[0307] A CcuCas9 protein having an amino acid sequence shown in SEQ ID NO: 2,

[0308] A CspCas9 protein having an amino acid sequence shown in SEQ ID NO: 3,

[0309] A Hap1Cas9 protein having an amino acid sequence shown in SEQ ID NO: 4,

[0310] A Hap2Cas9 protein having an amino acid sequence shown in SEQ ID NO: 5,

[0311] A HgaCas9 protein having an amino acid sequence shown in SEQ ID NO: 6,

[0312] A HtyCas9 protein having an amino acid sequence shown in SEQ ID NO: 7,

[0313] A Hsp1Cas9 protein having an amino acid sequence shown in SEQ ID NO: 8,

[0314] An Hsp2Cas9 protein having an amino acid sequence shown in SEQ ID NO: 9,

[0315] A Hsp3Cas9 protein having an amino acid sequence shown in SEQ ID NO: 10,

[0316] A Hsp4Cas9 protein having an amino acid sequence shown in SEQ ID NO: 11,

[0317] A Hsp1-CcuCas9 protein having an amino acid sequence shown in SEQ ID NO: 12,

[0318] A Hsp1-Hap2Cas9 protein having an amino acid sequence shown in SEQ ID NO: 13,

[0319] A Hsp1-HgaCas9 protein having an amino acid sequence shown in SEQ ID NO: 14,

[0320] A Hsp1-HtyCas9 protein having an amino acid sequence shown in SEQ ID NO: 15,

[0321] A Hsp1-Hsp2Cas9 protein having an amino acid sequence shown in SEQ ID NO: 16,

[0322] A Hsp1-Hsp3Cas9 protein having an amino acid sequence shown in SEQ ID NO: 17,

[0323] A Hsp1-Hsp3Cas9-Y446A protein having an amino acid sequence as shown in SEQ ID NO: 18,

[0324] A Hsp1-Hsp3Cas9-K390A-Y446A protein having an amino acid sequence as shown in SEQ ID NO: 19,

[0325] Hsp1-Hsp4Cas9 protein having the amino acid sequence shown in SEQ ID NO: 20, or

[0326] A Nsp2Cas9 protein having an amino acid sequence as shown in SEQ ID NO: 21,

[0327] or

[0328] 2) Having the same properties as SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20 and SEQ ID NO:21 has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, at least 99.95%, at least 99.99%, at least 99.999%, at least 100%, or any percentage between 80% and 100% sequence identity to the amino acid sequence set forth in any one of the preceding claims and retains its biological activity;

[0329] (2) The vectors of the seventh and eighth aspects of the present invention;

[0330] (3) The vector according to the seventh aspect of the present invention; and

[0331] (4) The CRISPR / Cas9 gene editing system of the ninth aspect of the present invention;

[0332] wherein, after contacting with the target sequence, the Cas9 protein, its homolog, conjugate or fusion protein recognizes the respective protospacer adjacent sequence (PAM), wherein the PAM is located at the 3' end of the target sequence, and, for the Cco2Cas9 protein, the CcuCas9 protein, the CspCas9 protein, the Hap1Cas9 protein, the Hap2Cas9 protein, the HgaCas9 protein, the HtyCas9 protein, the Hsp1Cas9 protein, the Hsp2Cas9 protein, the Hsp3Cas9 protein, the Hsp4Cas9 protein, the Hsp1-CcuCas9 protein, the Hsp1-Hap2Cas9 protein, the Hsp1-HgaCas9 protein, the Hsp1-HtyCas9 protein, the Hsp1-Hsp2Cas9 protein, the Hsp1-Hsp3Cas9 protein, the Hsp1-Hsp3Cas9-Y446A protein, the Hsp1-Hsp3Cas9-K390A-Y446A protein, the Hsp 1-Hsp4Cas9 protein, and the Nsp2Cas9 protein, or their respective homologs, conjugates or fusion proteins, and the PAM is 5'-NNNNCY, 5'-NNNNCNA, 5'-NNNNCYWT, 5'-NNNGCCKS, 5'-NNNGG, 5'-NNNNCC, 5'-NNNNRTTA, 5'-NNNNRAA, 5'-NNNNRYAT, 5'-NNNTCC, 5'-NNNNRT, 5'-NNNNCNA, 5'-NNNGG, 5'-NNNNCCAW, 5'-NNNNRTYR, 5'-NNNNRYAT, 5'-NNNNCY, 5'-NNNNCY, 5'-NNNNCY, 5'-NNNNRT and 5'-NNNNCC, respectively.

[0333] With respect to item (1) above:

[0334] As an example, a Cas9 protein having an amino acid sequence as shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19 or SEQ ID NO: 20, a homologue, a conjugate or a fusion protein thereof, and a single-stranded guide RNA comprising a scaffold sequence as shown in SEQ ID NO: 43, comprising a homologous sequence having at least 90% sequence identity with SEQ ID NO: 43 and retaining its biological activity, or comprising a modified sequence modified based on SEQ ID NO: 43 and retaining its biological activity;

[0335] As an example, a nucleic acid sequence of an Nsp2Cas9 protein having an amino acid sequence as shown in SEQ ID NO: 21, a homolog thereof, a conjugate thereof or a fusion protein thereof, and a single-stranded guide RNA comprising a scaffold sequence as shown in SEQ ID NO: 44, a homologous sequence having at least 90% sequence identity with SEQ ID NO: 44 and retaining its biological activity, or a modified sequence modified based on SEQ ID NO: 44 and retaining its biological activity.

[0336] For item (2) above:

[0337] As an example, the nucleic acid sequence encoding the Cas9 protein having the amino acid sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19 or SEQ ID NO: 20, its homologue, conjugate or fusion protein (e.g., SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35 NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40 or SEQ ID NO:41), and a vector comprising a nucleic acid sequence (e.g., a nucleic acid sequence as shown in SEQ ID NO:45) encoding a single-stranded guide RNA targeting the Cas9 protein, a homolog, conjugate or fusion protein thereof, comprising a scaffold sequence as shown in SEQ ID NO:43, comprising a homologous sequence having at least 90% sequence identity with SEQ ID NO:43 and retaining its biological activity, or comprising a modified sequence based on SEQ ID NO:43 and retaining its biological activity;

[0338] As an example, a vector comprising a nucleic acid sequence encoding an Nsp2Cas9 protein having an amino acid sequence as shown in SEQ ID NO: 21, a homolog thereof, a conjugate or a fusion protein thereof (e.g., a nucleic acid sequence as shown in SEQ ID NO: 42), and a vector comprising a nucleic acid sequence encoding a single-stranded guide RNA targeting the Nsp2Cas9 protein, its homolog, conjugate or fusion protein comprising a scaffold sequence as shown in SEQ ID NO: 44, a homologous sequence having at least 90% sequence identity with SEQ ID NO: 44 and retaining its biological activity, or a modified sequence modified based on SEQ ID NO: 44 and retaining its biological activity (e.g., a nucleic acid sequence as shown in SEQ ID NO: 46).

[0339] In one embodiment, the cell is a prokaryotic cell or a eukaryotic cell, the eukaryotic cell is, for example, a plant cell or an animal cell, for example, a mammalian cell such as a human cell.

[0340] In one embodiment, the gene editing includes one or more of gene knockout of the target sequence, site-specific base changes, site-specific insertions, regulation of gene transcription levels, DNA methylation regulation, DNA acetylation modification, histone acetylation modification, single base conversion, and chromatin imaging tracking.

[0341] Further, in one embodiment, the single base conversion includes conversion of the base adenine to guanine, conversion of cytosine to thymine, or conversion of cytosine to uracil.

[0342] In one embodiment, in the method, the CRISPR spacer sequence of the single-stranded guide RNA forms a perfect base complementary pairing structure with the target sequence, and forms an incomplete base complementary pairing structure with a non-target sequence.

[0343] Herein, the incomplete base complementary pairing structure refers to a structure including a portion of base complementary pairing and a portion of non-base complementary pairing, wherein the non-base complementary pairing includes, for example, base mismatch and / or base bulge.

[0344] In one embodiment, the incomplete base complementary pairing structure includes one or more, for example, two or more base mismatches.

[0345] Thus, the Cas9 protein of the present invention can cut the target site on the target sequence, and under the cutting action of the Cas9 protein, the target sequence undergoes a double-strand break. Furthermore, when the method is performed in a cell, the cut target sequence can be repaired by non-homologous end joining repair or homologous recombination repair pathways in the cell, thereby achieving gene editing of the target sequence.

[0346] The CRISPR / Cas9 gene editing system of the present invention and the gene editing method using the gene editing system have been found to have an editing efficiency of 6%-83% through experiments. In addition, for the CRISPR / Hsp1-Hsp3Cas9-K390A-Y446A gene editing system, the double base mismatch of the guide RNA has a tolerance rate close to 0%. Therefore, the gene editing system can edit the target gene with high specificity, has the characteristics of high editing efficiency and low off-target rate, and can be widely used in gene editing in cells or in vitro environments.

[0347] Reagent test kit

[0348] In a twelfth aspect, the present invention provides a kit for performing gene editing on a target sequence in a cell or in vitro environment, comprising:

[0349] a) selected from any one of the following 1) to 6):

[0350] 1) Cas9 protein or its homologue, the conjugate of the second aspect of the present invention, or the fusion protein of the third aspect of the present invention, and the single-stranded guide RNA corresponding to the Cas9 protein of the fourth aspect of the present invention,

[0351] Wherein, the Cas9 protein is:

[0352] 1.1) a Cco2Cas9 protein having an amino acid sequence as shown in SEQ ID NO: 1,

[0353] A CcuCas9 protein having an amino acid sequence shown in SEQ ID NO: 2,

[0354] A CspCas9 protein having an amino acid sequence shown in SEQ ID NO: 3,

[0355] A Hap1Cas9 protein having an amino acid sequence shown in SEQ ID NO: 4,

[0356] A Hap2Cas9 protein having an amino acid sequence shown in SEQ ID NO: 5,

[0357] A HgaCas9 protein having an amino acid sequence shown in SEQ ID NO: 6,

[0358] A HtyCas9 protein having an amino acid sequence shown in SEQ ID NO: 7,

[0359] A Hsp1Cas9 protein having an amino acid sequence shown in SEQ ID NO: 8,

[0360] An Hsp2Cas9 protein having an amino acid sequence shown in SEQ ID NO: 9,

[0361] A Hsp3Cas9 protein having an amino acid sequence shown in SEQ ID NO: 10,

[0362] A Hsp4Cas9 protein having an amino acid sequence shown in SEQ ID NO: 11,

[0363] A Hsp1-CcuCas9 protein having an amino acid sequence shown in SEQ ID NO: 12,

[0364] A Hsp1-Hap2Cas9 protein having an amino acid sequence shown in SEQ ID NO: 13,

[0365] A Hsp1-HgaCas9 protein having an amino acid sequence shown in SEQ ID NO: 14,

[0366] A Hsp1-HtyCas9 protein having an amino acid sequence shown in SEQ ID NO: 15,

[0367] A Hsp1-Hsp2Cas9 protein having an amino acid sequence shown in SEQ ID NO: 16,

[0368] A Hsp1-Hsp3Cas9 protein having an amino acid sequence shown in SEQ ID NO: 17,

[0369] A Hsp1-Hsp3Cas9-Y446A protein having an amino acid sequence as shown in SEQ ID NO: 18,

[0370] A Hsp1-Hsp3Cas9-K390A-Y446A protein having an amino acid sequence as shown in SEQ ID NO: 19,

[0371] Hsp1-Hsp4Cas9 protein having the amino acid sequence shown in SEQ ID NO: 20, or

[0372] A Nsp2Cas9 protein having an amino acid sequence as shown in SEQ ID NO: 21,

[0373] or

[0374] 1.2) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20 and SEQ ID NO:21 has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, at least 99.95%, at least 99.99%, at least 99.999%, at least 100%, or any percentage between 80% and 100% sequence identity to the amino acid sequence set forth in any one of the preceding claims and retains its biological activity;

[0375] 2) The isolated nucleic acid molecules of the fifth and sixth aspects of the invention;

[0376] 3) The isolated nucleic acid molecule of the seventh aspect of the present invention;

[0377] 4) The vectors of the seventh and eighth aspects of the present invention;

[0378] 5) The vector of the seventh aspect of the present invention; or

[0379] 6) The CRISPR / Cas9 gene editing system of the ninth aspect of the present invention;

[0380] as well as

[0381] b) Instructions for how to perform gene editing on the target sequence in a cell or in vitro environment.

[0382] For item 1) above:

[0383] As an example, a Cas9 protein having an amino acid sequence as shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19 or SEQ ID NO: 20, a homologue, a conjugate or a fusion protein thereof, or a Cas9 protein having an amino acid sequence as shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19 or SEQ ID NO: 20 NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19 or SEQ ID NO: 20 having at least 80% sequence identity, a conjugate or fusion protein thereof, and a single-stranded guide RNA comprising the scaffold sequence of SEQ ID NO: 43, a single-stranded guide RNA comprising a homologous sequence having at least 90% sequence identity to SEQ ID NO: 43 and retaining its biological activity, or a single-stranded guide RNA comprising a modified sequence based on SEQ ID NO: 43 and retaining its biological activity;

[0384] As an example, an Nsp2Cas9 protein having an amino acid sequence as shown in SEQ ID NO: 21, a homolog thereof having an amino acid sequence having at least 80% sequence identity with SEQ ID NO: 21, a conjugate or fusion protein thereof, and a single-stranded guide RNA comprising a scaffold sequence as shown in SEO ID NO: 44, a single-stranded guide RNA comprising a homologous sequence having at least 90% sequence identity with SEQ ID NO: 44 and retaining its biological activity, or a single-stranded guide RNA comprising a modified sequence based on SEQ ID NO: 44 and retaining its biological activity.

[0385] For item 2) above:

[0386] As an example, the nucleic acid sequence encoding the Cas9 protein having the amino acid sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19 or SEQ ID NO: 20, its homologue, conjugate or fusion protein (e.g., SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35 NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40 or SEQ ID NO:41), and an isolated nucleic acid molecule comprising a nucleic acid sequence comprising a scaffold sequence as shown in SEQ ID NO:43, a homologous sequence having at least 90% sequence identity with SEQ ID NO:43 and retaining its biological activity, or a modified sequence based on SEQ ID NO:43 and retaining its biological activity (e.g., the nucleic acid sequence as shown in SEQ ID NO:45) encoding a single-stranded guide RNA for the Cas9 protein, its homolog, conjugate or fusion protein;

[0387] As an example, an isolated nucleic acid molecule comprising a nucleic acid sequence encoding an Nsp2Cas9 protein having an amino acid sequence as shown in SEQ ID NO: 21, a homolog thereof, a conjugate or a fusion protein thereof (e.g., a nucleic acid sequence as shown in SEQ ID NO: 42), and an isolated nucleic acid molecule comprising a nucleic acid sequence encoding a single-stranded guide RNA targeting the Nsp2Cas9 protein, its homolog, conjugate or fusion protein comprising a scaffold sequence as shown in SEQ ID NO: 44, a homologous sequence having at least 90% sequence identity with SEQ ID NO: 44 and retaining its biological activity, or a modified sequence modified based on SEQ ID NO: 44 and retaining its biological activity (e.g., a nucleic acid sequence as shown in SEQ ID NO: 46).

[0388] For item 4) above:

[0389] As an example, the nucleic acid sequence encoding the Cas9 protein having the amino acid sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19 or SEQ ID NO: 20, its homologue, conjugate or fusion protein (e.g., SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35 NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40 or SEQ ID NO:41), and a vector comprising a nucleic acid sequence (e.g., a nucleic acid sequence as shown in SEQ ID NO:45) encoding a single-stranded guide RNA targeting the Cas9 protein, a homolog, conjugate or fusion protein thereof, comprising a scaffold sequence as shown in SEQ ID NO:43, comprising a homologous sequence having at least 90% sequence identity with SEQ ID NO:43 and retaining its biological activity, or comprising a modified sequence based on SEQ ID NO:43 and retaining its biological activity;

[0390] As an example, a vector comprising a nucleic acid sequence encoding an Nsp2Cas9 protein having an amino acid sequence as shown in SEQ ID NO: 21, a homolog thereof, a conjugate or a fusion protein thereof (e.g., a nucleic acid sequence as shown in SEQ ID NO: 42), and a vector comprising a nucleic acid sequence encoding a single-stranded guide RNA targeting the Nsp2Cas9 protein, its homolog, conjugate or fusion protein comprising a scaffold sequence as shown in SEQ ID NO: 44, a homologous sequence having at least 90% sequence identity with SEQ ID NO: 44 and retaining its biological activity, or a modified sequence modified based on SEQ ID NO: 44 and retaining its biological activity (e.g., a nucleic acid sequence as shown in SEQ ID NO: 46).

[0391] Of course, those skilled in the art will appreciate that the kit of the present invention may also include other reagents that are helpful for gene editing.

[0392] Brief description of the sequence involved in the present invention

[0393] SEQ ID NO: 1: Cco2Cas9 protein sequence

[0394] SEQ ID NO: 2: CcuCas9 protein sequence

[0395] SEQ ID NO: 3: CspCas9 protein sequence

[0396] SEQ ID NO: 4: Hap1 Cas9 protein sequence

[0397] SEQ ID NO: 5: Hap2Cas9 protein sequence

[0398] SEQ ID NO: 6: HgaCas9 protein sequence

[0399] SEQ ID NO: 7: HtyCas9 protein sequence

[0400] SEQ ID NO: 8: Hsp1Cas9 protein sequence

[0401] SEQ ID NO: 9: Hsp2Cas9 protein sequence

[0402] SEQ ID NO: 10: Hsp3Cas9 protein sequence

[0403] SEQ ID NO: 11: Hsp4Cas9 protein sequence

[0404] SEQ ID NO: 12: Hsp1-CcuCas9 protein sequence

[0405] SEQ ID NO: 13: Hsp1-Hap2Cas9 protein sequence

[0406] SEQ ID NO: 14: Hsp1-HgaCas9 protein sequence

[0407] SEQ ID NO: 15: Hsp1-HtyCas9 protein sequence

[0408] SEQ ID NO: 16: Hsp1-Hsp2Cas9 protein sequence

[0409] SEQ ID NO: 17: Hsp1-Hsp3Cas9 protein sequence

[0410] SEQ ID NO: 18: Hsp1-Hsp3Cas9-Y446A protein sequence

[0411] SEQ ID NO: 19: Hsp1-Hsp3Cas9-K390A-Y446A protein sequence

[0412] SEQ ID NO: 20: Hsp1-Hsp4Cas9 protein sequence

[0413] SEQ ID NO: 21: Nsp2Cas9 protein sequence

[0414] SEQ ID NO: 22: Coding sequence of Cco2Cas9 protein

[0415] SEQ ID NO: 23: Coding sequence of CcuCas9 protein

[0416] SEQ ID NO: 24: Coding sequence of CspCas9 protein

[0417] SEQ ID NO: 25: Coding sequence of Hap1Cas9 protein

[0418] SEQ ID NO: 26: Coding sequence of Hap2Cas9 protein

[0419] SEQ ID NO: 27: Coding sequence of HgaCas9 protein

[0420] SEQ ID NO: 28: Coding sequence of HtyCas9 protein

[0421] SEQ ID NO: 29: Coding sequence of Hsp1Cas9 protein

[0422] SEQ ID NO: 30: Coding sequence of Hsp2Cas9 protein

[0423] SEQ ID NO: 31: Coding sequence of Hsp3Cas9 protein

[0424] SEQ ID NO: 32: Coding sequence of Hsp4Cas9 protein

[0425] SEQ ID NO: 33: Coding sequence of Hsp1-CcuCas9 protein

[0426] SEQ ID NO: 34: Coding sequence of Hsp1-Hap2Cas9 protein

[0427] SEQ ID NO: 35: Coding sequence of Hsp1-HgaCas9 protein

[0428] SEQ ID NO: 36: Coding sequence of Hsp1-HtyCas9 protein

[0429] SEQ ID NO: 37: Coding sequence of Hsp1-Hsp2Cas9 protein

[0430] SEQ ID NO: 38: Coding sequence of Hsp1-Hsp3Cas9 protein

[0431] SEQ ID NO: 39: Coding sequence of Hsp1-Hsp3Cas9-Y446A protein

[0432] SEQ ID NO: 40: Coding sequence of Hsp1-Hsp3Cas9-K390A-Y446A protein

[0433] SEQ ID NO: 41: Coding sequence of Hsp1-Hsp4Cas9 protein

[0434] SEQ ID NO: 42: Coding sequence of Nsp2Cas9 protein

[0435] SEQ ID NO: 43: Scaffold sequence for use with Cco2Cas9 protein, CcuCas9 protein, CspCas9 protein, Hap1Cas9 protein, Hap2Cas9 protein, HgaCas9 protein, HtyCas9 protein, Hsp 1Cas9 protein, Hsp2Cas9 protein, Hsp3Cas9 protein, Hsp4Cas9 protein, Hsp1-CcuCas9 protein, Hsp1-Hap2Cas9 protein, Hsp1-HgaCas9 protein, Hsp1-HtyCas9 protein, Hsp1-Hsp2Cas9 protein, Hsp1-Hsp3Cas9 protein, Hsp1-Hsp3Cas9-Y446A protein, Hsp1-Hsp3Cas9-K390A-Y446A protein, and Hsp1-Hsp4Cas9 protein

[0436] SEQ ID NO: 44: Scaffold sequence for use with Nsp2Cas9 protein

[0437] SEQ ID NO: 45: DNA sequence of a scaffold sequence of a single-stranded guide RNA associated with a Cco2Cas9 protein, a CcuCas9 protein, a CspCas9 protein, a Hap 1Cas9 protein, a Hap2Cas9 protein, a HgaCas9 protein, a HtyCas9 protein, a Hsp1Cas9 protein, a Hsp2Cas9 protein, a Hsp3Cas9 protein, a Hsp4Cas9 protein, a Hsp1-CcuCas9 protein, a Hsp1-Hap2Cas9 protein, a Hsp1-HgaCas9 protein, a Hsp1-HtyCas9 protein, a Hsp1-Hsp2Cas9 protein, a Hsp1-Hsp3Cas9 protein, a Hsp1-Hsp3Cas9-Y446A protein, a Hsp1-Hsp3Cas9-K390A-Y446A protein, and a Hsp1-Hsp4Cas9 protein

[0438] SEQ ID NO: 46: DNA sequence of the scaffold sequence of the single-stranded guide RNA associated with the Nsp2Cas9 protein

[0439] Example

[0440] The present invention is now described with reference to the following examples which are intended to illustrate but not to limit the present invention. It is understood by those skilled in the art that the examples are provided here only for the purpose of describing the present invention in detail and are not intended to limit the scope of the present invention.

[0441] Unless otherwise specified, the experiments and methods described in the examples were performed in accordance with conventional methods well known in the art and described in the references. In addition, for those examples where specific conditions are not specified, conventional conditions or conditions recommended by the manufacturer were used. The reagents or instruments used where the manufacturer is not specified are all conventional products that can be obtained commercially.

[0442] Example 1

[0443] (1) Construction of plasmid pAAV2_Cas9_ITR

[0444] According to the gene retrieval number of each Cas9 protein listed in Table 1, the amino acid sequence information was downloaded, wherein the amino acid sequences of Cco2Cas9 protein, CcuCas9 protein, CspCas9 protein, Hap1Cas9 protein, Hap2Cas9 protein, HgaCas9 protein, HtyCas9 protein, Hsp1Cas9 protein, Hsp2Cas9 protein, Hsp3Cas9 protein, Hsp4Cas9 protein, Hsp1-CcuCas9 protein, Hsp1-Hap2Cas9 protein, Hsp1-HgaCas9 protein, Hsp1-HtyCas9 protein, Hsp1-Hsp2Cas9 protein, Hsp1-Hsp3Cas9 protein, Hsp1-Hsp3Cas9-Y446A protein, Hsp1-Hsp3Cas9-K390A-Y446A protein, Hsp1-Hsp4Cas9 protein and Nsp2Cas9 protein are shown in SEQ ID NO: 1 to SEQ ID NO: 21, respectively.

[0445] Table 1. Cas9 proteins and their NCBI protein search IDs and sequence numbers

[0446]

[0447]

[0448] The coding nucleic acid sequence of the Cas9 protein obtained above was codon optimized to obtain a gene sequence of the Cas protein highly expressed in human cells. The optimized gene sequences of Cco2Cas9 protein, CcuCas9 protein, CspCas9 protein, Hap1Cas9 protein, Hap2Cas9 protein, HgaCas9 protein, HtyCas9 protein, Hsp1Cas9 protein, Hsp2Cas9 protein, Hsp3Cas9 protein, Hsp4Cas9 protein, Hsp1-CcuCas9 protein, Hsp1-Hap2Cas9 protein, Hsp1-HgaCas9 protein, Hsp1-HtyCas9 protein, Hsp1-Hsp2Cas9 protein, Hsp1-Hsp3Cas9 protein, Hsp1-Hsp3Cas9 protein, Hsp1-Hsp3Cas9-Y446A protein, Hsp1-Hsp3Cas9-K390A-Y446A protein, Hsp1-Hsp4Cas9 protein and Nsp2Cas9 protein are shown in SEQ ID NO: 22 to SEQ ID NO: 42, respectively.

[0449] The gene sequences of the highly expressed Cas proteins shown in SEQ ID NO: 22 to SEQ ID NO: 42 obtained above were synthesized and constructed onto the slugCas9 backbone plasmid (Addgene platform, catalog #163793) to obtain the plasmid pAAV2_Cas9_ITR.

[0450] (2-1) Construction of plasmid pSK-U6-Cj-tracr

[0451] The pSKB- plasmid (Addgene platform, catalog #62540) was digested with ClaI and XhoI restriction enzymes, and the digestion system was: 1 μg plasmid pSKB-, 5 μL 10× CutSmart buffer (purchased from NEB), 1 μL ClaI and 1 μL XhoI restriction enzymes (purchased from NEB), and water was added to 50 μL. The digestion system was reacted at 37°C overnight.

[0452] Then, the digested products were electrophoresed on 1% agarose gel at 120 V for 30 min.

[0453] A 2945 bp DNA fragment was cut out from the agarose gel, recovered using a gel recovery kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., DP209) according to the instructions provided by the manufacturer, and finally eluted with ultrapure water.

[0454] The scaffold sequence (DNA sequence of which is SEQ ID NO: 45) in the single-stranded guide RNA for Cco2Cas9 protein, CcuCas9 protein, CspCas9 protein, Hap1Cas9 protein, Hap2Cas9 protein, HgaCas9 protein, HtyCas9 protein, Hsp1Cas9 protein, Hsp2Cas9 protein, Hsp3Cas9 protein, Hsp4Cas9 protein, Hsp1-CcuCas9 protein, Hsp1-Hap2Cas9 protein, Hsp1-HgaCas9 protein, Hsp1-HtyCas9 protein, Hsp1-Hsp2Cas9 protein, Hsp1-Hsp3Cas9 protein, Hsp1-Hsp3Cas9-Y446A protein, Hsp1-Hsp3Cas9-K390A-Y446A protein and Hsp1-Hsp4Cas9 protein was gene synthesized and constructed on the linearized pSKB-backbone to obtain the plasmid pSK-U6-Cj-tracr.

[0455] (2-2) Construction of plasmid pU6-Nme2-tracr

[0456] The sequence of Nme2Cas9_AAV plasmid (Addgene platform, catalog #119924) contains the scaffold sequence in the single-stranded guide RNA for Nsp2Cas9 protein (its DNA sequence is SEQ ID NO: 46). The Nme2Cas9_AAV plasmid (Addgene platform, catalog #119924) was linearized by PCR method, and the primer sequences were GGCGGTACTATGTAGATGAGGGCCGCAGGAACCCCTAG and CTCATCTACATAGTACCGCCTCCA.

[0457] The reaction system is as follows:

[0458]

[0459] The PCR run procedure is as follows:

[0460]

[0461]

[0462] The PCR product was electrophoresed on a 1% agarose gel at 120 V for 30 min, and a 3368 bp DNA fragment was cut from the agarose gel and recovered using a gel recovery kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., DP209) according to the manufacturer's instructions, and finally eluted with ultrapure water. TMThe DNA concentration was measured by Lite spectrophotometer (Thermo Scientific) and kept for later use or at -20°C for long-term storage.

[0463] The linearized Nme2Cas9_AAV fragments were homologously recombined according to the ratio required by the instructions, and the homologous recombinase used was High-fidelity DNA assembly master mix (NEB), the reaction system is as follows:

[0464]

[0465] The reaction conditions are as follows:

[0466]

[0467] The recombinant product was added to Escherichia coli DH5α competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.), incubated on ice for 30 min, heat shocked at 42°C for 1 min, incubated on ice for 2 min, added with 900 μL LB medium, and cultured at 37°C for 1 hour to activate and resuscitate the Escherichia coli DH5α competent cells.

[0468] The revived E. coli DH5α competent cells were spread on LB solid plates containing ampicillin resistance and cultured upside down in a 37° C. incubator. The obtained E. coli DH5α single clone was verified by Sanger sequencing.

[0469] The E. coli DH5α clones with correct connection verified by sequencing were shaken to extract the plasmid, that is, the plasmid pU6-Nme2-tracr was obtained and set aside.

[0470] (3-1) Preparation of linearized plasmid pSK-U6-Cj-tracr

[0471] The plasmid pSK-U6-Cj-tracr was digested with BbsI restriction enzyme, and the digestion system was: 1 μg of plasmid pSK-U6-Cj-tracr, 5 μL of 10×CutSmart buffer (purchased from NEB), 1 μL of BbsI restriction enzyme (purchased from NEB), and water was added to 50 μL. The digestion system was reacted at 37° C. for 2 hours.

[0472] Then, the digested products were electrophoresed on 1% agarose gel at 120 V for 30 min.

[0473] The DNA fragment was cut from the agarose gel and recovered using a gel recovery kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., DP209) according to the instructions provided by the manufacturer, and finally eluted with ultrapure water. The DNA fragment is the linearized plasmid pSK-U6-Cj-tracr, which is 3380 bp in size.

[0474] The recovered linearized plasmid pSK-U6-Cj-tracr was purified by NanoDrop TM The DNA concentration was measured by Lite spectrophotometer (ThermoScientific) and kept for later use or at -20°C for long-term storage.

[0475] (3-2) Preparation of linearized plasmid pU6-Nme2-tracr

[0476] The plasmid pU6-Nme2-tracr was digested with BspQI restriction endonuclease, and the digestion system was: 1 μg of plasmid pU6-Nme2-tracr, 5 μL of 10×Buffer 3.1 buffer (purchased from NEB), 1 μL of BspQI restriction endonuclease (purchased from NEB), and water was added to 50 μL. The digestion system was reacted at 50° C. for 2 hours.

[0477] Then, the digested products were electrophoresed on 1% agarose gel at 120 V for 30 min.

[0478] The DNA fragment was cut from the agarose gel, recovered using a gel recovery kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., DP209) according to the instructions provided by the manufacturer, and finally eluted with ultrapure water. The DNA fragment is the linearized plasmid pU6-Nme2-tracr, which is 3326 bp in size.

[0479] The recovered linearized plasmid pU6-Nme2-tracr was transferred to TM The DNA concentration was measured by Lite spectrophotometer (ThermoScientific) and kept for later use or at -20°C for long-term storage.

[0480] (4-1) Preparation of plasmid pSK-U6-Cj-sgRNA

[0481] Design gRNA (GAGUAGAGGCGGCCACGACCUG), and add the corresponding sticky end sequences on both sides of the linearized plasmid pSK-U6-Cj-tracr to the sense and antisense strands of the designed gRNA sequence, and synthesize two oligonucleotide single-stranded DNAs. The specific sequences of these two oligonucleotide single-stranded DNAs are as follows (the lowercase letters represent the sticky end sequences):

[0482] Oligo-F:tttgAGTAGAGGCGGCCACGACCTGGT

[0483] Oligo-R: taaaACCAGGTCGTGGCCGCCTCTACT

[0484] The oligonucleotide single-stranded DNA was annealed to obtain double-stranded DNA. The annealing reaction system was: 1 μL 100 μM oligo-F, 1 μL 100 μM oligo-R, and 28 μL water. After the annealing system was shaken and mixed, it was placed in a PCR instrument to run the annealing program. The annealing program was: 95°C_5min, 85°C_1min, 75°C_1min, 65°C_1min, 55°C_1min, 45°C_1min, 35°C_1min, 25°C_1min, stored at 4°C, and the cooling rate was 0.3°C / s. After annealing, the obtained product was connected to the linearized pSK-U6-Cj-tracr plasmid obtained in step (3-1) by DNA ligase (purchased from NEB).

[0485] The ligation product was added to Escherichia coli DH5α competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.), incubated on ice for 30 min, heat shocked at 42°C for 1 min, incubated on ice for 2 min, 900 μL LB medium was added, and cultured at 37°C for 1 hour to activate and recover the Escherichia coli DH5α competent cells.

[0486] The revived E. coli DH5α competent cells were spread on LB solid plates containing corresponding resistance and cultured inverted in a 37°C incubator. The obtained E. coli DH5α single clone was verified by Sanger sequencing.

[0487] The E. coli DH5α clones with correct connection verified by sequencing were shaken and the plasmid was extracted to obtain the plasmid pSK-U6-Cj-sgRNA containing the target sgRNA sequence for expression, which was set aside.

[0488] (4-2) Preparation of plasmid pU6-Nme2-sgRNA

[0489] Design gRNA (GAGUAGAGGCGGCCACGACCUG), and add the corresponding sticky end sequences on both sides of the linearized plasmid pU6-Nme2-tracr to the sense and antisense strands of the designed gRNA sequence, and synthesize two oligonucleotide single-stranded DNAs. The specific sequences of these two oligonucleotide single-stranded DNAs are as follows (the lowercase letters represent the sticky end sequences):

[0490] Oligo-F: accGAGTAGAGGCGGCCACGACCTG

[0491] Oligo-R:aacCAGGTCGTGGCCGCCTCTACTC

[0492] The oligonucleotide single-stranded DNA was annealed to obtain double-stranded DNA. The annealing reaction system was: 1 μL 100 μM oligo-F, 1 μL 100 μM oligo-R, and 28 μL water. After the annealing system was shaken and mixed, it was placed in a PCR instrument to run the annealing program. The annealing program was: 95°C_5min, 85°C_1min, 75°C_1min, 65°C_1min, 55°C_1min, 45°C_1min, 35°C_1min, 25°C_1min, stored at 4°C, and the cooling rate was 0.3°C / s. After annealing, the obtained product was connected to the linearized pU6-Nme2-tracr plasmid obtained in step (3-2) by DNA ligase (purchased from NEB).

[0493] The ligation product was added to Escherichia coli DH5α competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.), incubated on ice for 30 min, heat shocked at 42°C for 1 min, incubated on ice for 2 min, 900 μL LB medium was added, and cultured at 37°C for 1 hour to activate and recover the Escherichia coli DH5α competent cells.

[0494] The revived E. coli DH5α competent cells were spread on LB solid plates containing corresponding resistance and cultured inverted in a 37°C incubator. The obtained E. coli DH5α single clone was verified by Sanger sequencing.

[0495] The E. coli DH5α clones with correct connection verified by sequencing were shaken and the plasmid was extracted to obtain the plasmid pU6-Nme2-sgRNA containing the target sgRNA sequence for expression, which was set aside.

[0496] (5) The obtained plasmid pSK-U6-Cj-sgRNA or pU6-Nme2-sgRNA expressing sgRNA and the plasmid pAAV2_Cas9_ITR expressing Cas9 were transfected into the GFP reporter system HEK293T cell line library containing the target sequence (GAGTAGAGGCGGCCACGACCTG) by liposome.

[0497] The GFP reporter system HEK293T cell line library containing the target sequence is obtained by inserting a 24bp protospacer (as a target sequence) and an 8bp random sequence (as a PAM sequence) between the start codon ATG and the GFP coding sequence, causing a GFP frameshift mutation without expression. The GFP gene containing the inserted fragment is started with a CMV promoter and constructed on a lentiviral expression vector. This sequence is randomly inserted into the genome of the HEK293T cells by lentivirus mediation to make it a stable GFP reporter cell line library. After the target sequence is cut using the gene editing system, the cells will restore the GFP reading frame to some cells through their own repair system, producing green fluorescence, indicating that the gene editing system can be used for gene editing in mammalian cells.

[0498] The above transfection process includes the following steps:

[0499] On day 0, the GFP reporter system HEK293T cell line library containing the target sequence was plated in a 10 cm dish according to the transfection requirements, and the cell density was controlled at 30%.

[0500] The GFP reporter system HEK293T cell line library containing the target sequence contains the nucleotide sequence of CMV-ATG-target site-PAM-GFP, wherein the PAM sequence is an 8 bp random sequence, and the sequence of the target site is GAGTAGAGGCGGCCACGACCTG ( Figure 1 ).

[0501] On day 1, transfection was performed. The transfection process was as follows:

[0502] Take 10 μg of the plasmid pAAV2_Cas9_ITR expressing Cas9 and 5 μg of the plasmid pSK-U6-Cj-sgRNA or pU6-Nme2-sgRNA expressing sgRNA respectively, add them into 500 μL Opti-MEM culture medium (purchased from Gibco), and mix them by gently pipetting.

[0503] Will 2000 (purchased from Invitrogen) or PEI (purchased from Polysciences) was flicked to mix well, and 30 μL was drawn. 2000 or 15 μL PEI (100 μM) was added to 500 μL Opti-MEM medium, mixed gently, and allowed to stand at room temperature for 5 min.

[0504] The diluted plasmid and the diluted transfection reagent were mixed and gently pipetted to mix. The resulting mixture was allowed to stand at room temperature for 20 min, then added to the culture medium of the GFP reporter system HEK293T cell line library containing the target sequence and placed at 37°C and 5% CO. 2 Continue culturing in the incubator.

[0505] Then, in CO 2 After 5 days of culture in the incubator, the editing of the target sequence in the HEK293T cell line library by each CRISPR / Cas9 system was observed under a fluorescence microscope. The results are shown in Figure 2 From this figure, we can see that CRISPR / Cco2Cas9 system, CRISPR / CcuCas9 system, CRISPR / CspCas9 system, CRISPR / Hap1Cas9 system, CRISPR / Hap2Cas9 system, CRISPR / HgaCas9 system, CRISPR / HtyCas9 system, CRISPR / Hsp1Cas9 system, CRISPR / Hsp2Cas9 system, CRISPR / Hsp3Cas9 system, CRISPR / Hsp4Cas9 system, CRISPR / Hsp1-CcuCas9 system, CRISPR / Hsp1-Hap The cells in the libraries of the CRISPR / Hsp1-2Cas9 system, CRISPR / Hsp1-HgaCas9 system, CRISPR / Hsp1-HtyCas9 system, CRISPR / Hsp1-Hsp2Cas9 system, CRISPR / Hsp1-Hsp3Cas9 system, CRISPR / Hsp1-Hsp3Cas9-Y446A system, CRISPR / Hsp1-Hsp3Cas9-K390A-Y446A system, CRISPR / Hsp1-Hsp4Cas9 system and CRISPR / Nsp2Cas9 system groups all showed green fluorescence, indicating that these systems successfully edited the target sequences in the cells.

[0506] Example 2

[0507] (1) Construction of plasmid pAAV2_Cas9_ITR

[0508] According to the gene accession number of each Cas9 protein listed in Table 1 above, its amino acid sequence was downloaded, wherein the amino acid sequences of Cco2Cas9 protein, CcuCas9 protein, CspCas9 protein, Hap1Cas9 protein, Hsp1Cas9 protein, Hsp3Cas9 protein, Hsp1-Hsp3Cas9 protein, Hsp1-Hsp3Cas9-Y446A protein, Hsp1-Hsp3Cas9-K390A-Y446A protein and Nsp2Cas9 protein are shown in SEQ ID NO: 1 to SEQ ID NO: 4, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 17 to SEQ ID NO: 19 and SEQ ID NO: 21, respectively.

[0509] The coding nucleic acid sequences of the above-mentioned Cas9 proteins are codon optimized to obtain gene sequences of the Cas9 proteins highly expressed in human cells. The optimized gene sequences of Cco2Cas9 protein, CcuCas9 protein, CspCas9 protein, Hap1Cas9 protein, Hsp1Cas9 protein, Hsp3Cas9 protein, Hsp1-Hsp3Cas9 protein, Hsp1-Hsp3Cas9-Y446A protein, Hsp1-Hsp3Cas9-K390A-Y446A protein and Nsp2Cas9 protein are shown in SEQ ID NO: 22 to SEQ ID NO: 25, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 38 to SEQ ID NO: 40 and SEQ ID NO: 42, respectively.

[0510] The gene sequences for highly expressed Cas9 proteins shown in SEQ ID NO: 22 to SEQ ID NO: 25, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 38 to SEQ ID NO: 40 and SEQ ID NO: 42 were synthesized and constructed onto the slugCas9 backbone plasmid (Addgene platform, catalog #163793) to obtain the plasmid pAAV2_Cas9_ITR.

[0511] (2-1) Construction of plasmid pSK-U6-Cj-tracr

[0512] The pSKB- plasmid (Addgene platform, catalog #62540) was digested with ClaI and XhoI restriction enzymes, and the digestion system was: 1 μg plasmid pSKB-, 5 μL 10× CutSmart buffer (purchased from NEB), 1 μL ClaI and 1 μL XhoI restriction enzymes (purchased from NEB), and water was added to 50 μL. The digestion system was reacted at 37°C overnight.

[0513] Then, the digested products were electrophoresed on 1% agarose gel at 120 V for 30 min.

[0514] A 2945 bp DNA fragment was cut out from the agarose gel, recovered using a gel recovery kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., DP209) according to the instructions provided by the manufacturer, and finally eluted with ultrapure water.

[0515] The scaffold sequence (DNA sequence of which is SEQ ID NO: 45) in the single-stranded guide RNA for Cco2Cas9 protein, CcuCas9 protein, CspCas9 protein, Hap1Cas9 protein, Hsp1Cas9 protein, Hsp3Cas9 protein, Hsp1-Hsp3Cas9 protein, Hsp1-Hsp3Cas9-Y446A protein and Hsp1-Hsp3Cas9-K390A-Y446A protein was gene synthesized and constructed on the linearized pSKB-backbone to obtain the plasmid pSK-U6-Cj-tracr.

[0516] (2-2) Construction of plasmid pU6-Nme2-tracr

[0517] The sequence of Nme2Cas9_AAV plasmid (Addgene platform, catalog #119924) contains a scaffold sequence in a single-stranded guide RNA for Nsp2Cas9 protein (its DNA sequence is SEQ ID NO: 46). The Nme2Cas9_AAV plasmid (Addgene platform, catalog #119924) was linearized by PCR, and the primer sequences were GGCGGTACTATGTAGATGAGGGCCGCAGGAACCCCTAG; and CTCATCTACATAGTACCGCCTCCA.

[0518] The reaction system is as follows:

[0519]

[0520] The PCR run procedure is as follows:

[0521]

[0522] The PCR product was electrophoresed on a 1% agarose gel at 120 V for 30 min, and a 3368 bp DNA fragment was cut from the agarose gel and recovered using a gel recovery kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., DP209) according to the manufacturer's instructions, and finally eluted with ultrapure water. TM The DNA concentration was measured by Lite spectrophotometer (Thermo Scientific) and kept for later use or at -20°C for long-term storage.

[0523] The linearized Nme2Cas9_AAV fragments were homologously recombined according to the ratio required by the instructions, and the homologous recombinase used was High-fidelity DNA assembly master mix (NEB), the reaction system is as follows:

[0524]

[0525] The reaction conditions are as follows:

[0526]

[0527] The recombinant product was added to Escherichia coli DH5α competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.), incubated on ice for 30 min, heat shocked at 42°C for 1 min, incubated on ice for 2 min, added with 900 μL LB medium, and cultured at 37°C for 1 hour to activate and resuscitate the Escherichia coli DH5α competent cells.

[0528] The revived E. coli DH5α competent cells were spread on LB solid plates containing ampicillin resistance and cultured upside down in a 37° C. incubator. The obtained E. coli DH5α single clone was verified by Sanger sequencing.

[0529] The E. coli DH5α clones with correct connection verified by sequencing were shaken to extract the plasmid, that is, the plasmid pU6-Nme2-tracr was obtained and set aside.

[0530] (3-1) Preparation of linearized plasmid pSK-U6-Cj-tracr

[0531] The plasmid pSK-U6-Cj-tracr was digested with BbsI restriction enzyme, and the digestion system was: 1 μg of plasmid pSK-U6-Cj-tracr, 5 μL of 10×CutSmart buffer (purchased from NEB), 1 μL of BbsI restriction enzyme (purchased from NEB), and water was added to 50 μL. The digestion system was reacted at 37° C. for 2 hours.

[0532] Then, the digested products were electrophoresed on 1% agarose gel at 120 V for 30 min.

[0533] The DNA fragment was cut from the agarose gel and recovered using a gel recovery kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., DP209) according to the instructions provided by the manufacturer, and finally eluted with ultrapure water. The DNA fragment is the linearized plasmid pSK-U6-Cj-tracr, which is 3380 bp in size.

[0534] The recovered linearized plasmid pSK-U6-Cj-tracr was purified by NanoDrop TM The DNA concentration was measured by Lite spectrophotometer (ThermoScientific) and kept for later use or at -20°C for long-term storage.

[0535] (3-2) Preparation of linearized plasmid pU6-Nme2-tracr

[0536] The plasmid pU6-Nme2-tracr was digested with BspQI restriction endonuclease, and the digestion system was: 1 μg plasmid pU6-Nme2-tracr, 5 μL 10×Buffer 3.1 buffer (purchased from NEB), 1 μL BspQI restriction endonuclease (purchased from NEB), and water was added to 50 μL. The digestion system was reacted at 50°C for 2 hours.

[0537] Then, the digested product was electrophoresed on a 1% agarose gel at 120 V for 30 min. The DNA fragment was cut from the agarose gel and recovered using a gel recovery kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., DP209) according to the instructions provided by the manufacturer, and finally eluted with ultrapure water. The DNA fragment was the linearized plasmid pU6-Nme2-tracr, which was 3326 bp in size.

[0538] The recovered linearized plasmid pU6-Nme2-tracr was transferred to TM The DNA concentration was measured by Lite spectrophotometer (ThermoScientific) and kept for later use or at -20°C for long-term storage.

[0539] (4-1) Preparation of plasmid pSK-U6-Cj-sgRNA

[0540] Each gRNA was designed, and its sequence is shown in Table 2. The corresponding sticky end sequences on both sides of the linearized plasmid pSK-U6-Cj-tracr were added to the sense strand and antisense strand corresponding to each designed gRNA sequence, and two oligonucleotide single-stranded DNAs were synthesized. The specific sequences of the two oligonucleotide single-stranded DNAs are also shown in the table below.

[0541]

[0542] The oligonucleotide single-stranded DNA was annealed to obtain double-stranded DNA. The annealing reaction system was: 1 μL 100 μM oligo-F, 1 μL 100 μM oligo-R, and 28 μL water. After the annealing system was shaken and mixed, it was placed in a PCR instrument to run the annealing program. The annealing program was: 95°C_5min, 85°C_1min, 75°C_1min, 65°C_1min, 55°C_1min, 45°C_1min, 35°C_1min, 25°C_1min, stored at 4°C, and the cooling rate was 0.3°C / s. After annealing, the obtained product was connected to the linearized pSK-U6-Cj-tracr plasmid obtained in step (3-1) by DNA ligase (purchased from NEB).

[0543] The ligation product was added to Escherichia coli DH5α competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.), incubated on ice for 30 min, heat shocked at 42°C for 1 min, incubated on ice for 2 min, 900 μL LB medium was added, and cultured at 37°C for 1 hour to activate and recover the Escherichia coli DH5α competent cells.

[0544] The revived E. coli DH5α competent cells were spread on LB solid plates containing corresponding resistance and cultured inverted in a 37°C incubator. The obtained E. coli DH5α single clone was verified by Sanger sequencing.

[0545] The E. coli DH5α clones with correct connection verified by sequencing were shaken and the plasmid was extracted to obtain the plasmid pSK-U6-Cj-sgRNA containing the target sgRNA sequence for expression, which was set aside.

[0546] (4-2) Preparation of plasmid pU6-Nme2-sgRNA

[0547] Each gRNA was designed, and its sequence is shown in Table 2 above. The corresponding sticky end sequences on both sides of the linearized plasmid pU6-Nme2-tracr were added to the sense strand and antisense strand corresponding to each designed gRNA sequence, and two oligonucleotide single-stranded DNAs were synthesized. The specific sequences of the two oligonucleotide single-stranded DNAs are also shown in Table 2 above.

[0548] The oligonucleotide single-stranded DNA was annealed to obtain double-stranded DNA. The annealing reaction system was: 1 μL 100 μM oligo-F, 1 μL 100 μM oligo-R, and 28 μL water. After the annealing system was shaken and mixed, it was placed in a PCR instrument to run the annealing program. The annealing program was: 95°C_5min, 85°C_1min, 75°C_1min, 65°C_1min, 55°C_1min, 45°C_1min, 35°C_1min, 25°C_1min, stored at 4°C, and the cooling rate was 0.3°C / s. After annealing, the obtained product was connected to the linearized pU6-Nme2-tracr plasmid obtained in step (3-2) by DNA ligase (purchased from NEB).

[0549] The ligation product was added to Escherichia coli DH5α competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.), incubated on ice for 30 min, heat shocked at 42°C for 1 min, incubated on ice for 2 min, 900 μL LB medium was added, and cultured at 37°C for 1 hour to activate and recover the Escherichia coli DH5α competent cells.

[0550] The revived E. coli DH5α competent cells were spread on LB solid plates containing corresponding resistance and cultured inverted in a 37°C incubator. The obtained E. coli DH5α single clone was verified by Sanger sequencing.

[0551] The E. coli DH5α clones with correct connection verified by sequencing were shaken and the plasmid was extracted to obtain the plasmid pU6-Nme2-sgRNA containing the target sgRNA sequence for expression, which was set aside.

[0552] (5-1) Transfection of HEK293T cell line with plasmid pAAV2_Cas9_ITR expressing Cas protein and plasmid pSK-U6-Cj-sgRNA expressing sgRNA

[0553] On day 0, HEK293T cells containing the target sequence were plated in 24-well plates according to the transfection requirements, with a cell density of about 30%.

[0554] On day 1, transfection was performed. The transfection process was as follows:

[0555] Take 500 ng of plasmid pAAV2_Cas9_ITR and 300 ng of plasmid pSK-U6-Cj-sgRNA and add them to 25 μL Opti-MEM culture medium (purchased from Gibco), and gently pipette to mix.

[0556] Lipofectamine 2000 (purchased from Invitrogen) or polyethyleneimine (hereinafter referred to as PEI) (purchased from Polysciences) was flicked to mix well, and 1.6 μL was drawn. 2000 or 0.8 μL PEI (100 μM) was added to 25 μL Opti-MEM medium (purchased from Gibco), mixed gently, and allowed to stand at room temperature for 5 min.

[0557] The diluted transfection reagent and the diluted plasmid were mixed, gently pipetted to mix, and allowed to stand at room temperature for 20 min. Then, they were added to the culture medium containing the HEK293T cells to be transfected, and the cells were placed at 37°C and 5% CO. 2 The cells were cultured in the incubator for 5 days.

[0558] (5-2) Transfection of HEK293T cell line with plasmid pAAV2_Cas9_ITR expressing Cas protein and plasmid pU6-Nme2-sgRNA expressing sgRNA

[0559] On day 0, HEK293T cells containing the target sequence were plated in 24-well plates according to the transfection requirements, with a cell density of about 30%.

[0560] On day 1, transfection was performed. The transfection process was as follows:

[0561] Take 500 ng of plasmid pAAV2_Cas9_ITR and 300 ng of plasmid pU6-Nme2-sgRNA and add them to 25 μL Opti-MEM culture medium (purchased from Gibco), and gently pipette to mix.

[0562] Lipofectamine 2000 (purchased from Invitrogen) or polyethyleneimine (hereinafter referred to as PEI) (purchased from Polysciences) was flicked to mix well, and 1.6 μL was drawn. 2000 or 0.8 μL PEI (100 μM) was added to 25 μL Opti-MEM medium (purchased from Gibco), mixed gently, and allowed to stand at room temperature for 5 min.

[0563] The diluted transfection reagent and the diluted plasmid were mixed, gently pipetted to mix, and allowed to stand at room temperature for 20 min. Then, they were added to the culture medium containing the HEK293T cells to be transfected, and the cells were placed at 37°C and 5% CO. 2 The cells were cultured in the incubator for 5 days.

[0564] (6) Preparation of Next-Generation Sequencing Library

[0565] HEK293T cells were collected 5 days after editing, and genomic DNA was extracted using a DNA kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., DP304) according to the instructions provided by the DNA kit.

[0566] The first round of PCR was performed using 2×Q5 Mastermix. The PCR primers are shown in Table 3 below:

[0567]

[0568] The reaction system is as follows:

[0569]

[0570] The PCR run procedure is as follows:

[0571]

[0572] The second round of PCR for sequencing library construction was performed using 2xQ5 Mastermix. The PCR primers are as follows:

[0573] F2 Primer:

[0574]

[0575] R2 Primer:

[0576]

[0577] The reaction system is as follows:

[0578]

[0579]

[0580] The PCR run procedure is as follows:

[0581]

[0582] The second round of PCR products were purified using a gel recovery kit according to the manufacturer's steps to purify DNA fragments of 418 bp, 421 bp, 358 bp, 381 bp, 378 bp, 417 bp, 415 bp, 419 bp, 375 bp, 355 bp, 400 bp, 397 bp, 390 bp and 390 bp, which are the sizes of A46, V60, A28, A30, A45, A51, A18, A19, V26, V28, A59, V21, A10 and V54, respectively. Thus, the preparation of the second generation sequencing library was completed.

[0583] (8) Analysis of Next-Generation Sequencing Results

[0584] The prepared second-generation sequencing library was subjected to double-end sequencing on a high-throughput sequencer HiseqXTen (Illumina).

[0585] The editing efficiency of the two target sites calculated by the second generation sequencing is as follows Figures 3 to 12 As shown, the X-axis represents the target site and the Y-axis represents the editing efficiency (Indels%). It can be seen from the figure that the gene editing systems containing Cco2Cas9, CcuCas9, CspCas9, Hap1Cas9, Hsp1Cas9, Hsp3Cas9, Hsp1-Hsp3Cas9, Hsp1-Hsp3Cas9-Y446A, Hsp1-Hsp3Cas9-K390A-Y446A and Nsp2Cas9 proteins can all be used for cell gene editing.

[0586] Example 3

[0587] (1) Construction of plasmid pAAV2_Cas9_ITR

[0588] According to the gene retrieval number of each Cas9 protein listed in Table 1 above, the amino acid sequence information was downloaded, where the amino acid sequences of Cco2Cas9 protein, CcuCas9 protein, Hsp1Cas9 protein, Hsp1-Hsp3Cas9 protein, Hsp1-Hsp3Cas9-Y446A protein, Hsp1-Hsp3Cas9-K390A-Y446A protein and Nsp2Cas9 protein are shown in SEQ ID NO: 1 to SEQ ID NO: 2, SEQ ID NO: 8, SEQ ID NO: 17 to SEQ ID NO: 19 and SEQ ID NO: 21, respectively.

[0589] The coding nucleic acid sequence of the Cas9 protein obtained above was codon optimized to obtain a gene sequence of the Cas protein highly expressed in human cells. The optimized gene sequences of Cco2Cas9 protein, CcuCas9 protein, Hsp1Cas9 protein, Hsp1-Hsp3Cas9 protein, Hsp1-Hsp3Cas9-Y446A protein, Hsp1-Hsp3Cas9-K390A-Y446A protein and Nsp2Cas9 protein are shown in SEQ ID NO: 22 to SEQ ID NO: 23, SEQ ID NO: 29, SEQ ID NO: 38 to SEQ ID NO: 40 and SEQ ID NO: 42, respectively.

[0590] The gene sequences of each Cas protein highly expressed as shown in SEQ ID NO: 22 to SEQ ID NO: 23, SEQ ID NO: 29, SEQ ID NO: 38 to SEQ ID NO: 40 and SEQ ID NO: 42 obtained above were synthesized and constructed into the slugCas9 backbone plasmid (Addgene platform, catalog #163793) to obtain the plasmid pAAV2_Cas9_ITR.

[0591] (2-1) Construction of plasmid pSK-U6-Cj-tracr

[0592] The pSKB- plasmid (Addgene platform, catalog #62540) was digested with ClaI and XhoI restriction enzymes, and the digestion system was: 1 μg plasmid pSKB-, 5 μL 10× CutSmart buffer (purchased from NEB), 1 μL ClaI and 1 μL XhoI restriction enzymes (purchased from NEB), and water was added to 50 μL. The digestion system was reacted at 37°C overnight.

[0593] Then, the digested products were electrophoresed on 1% agarose gel at 120 V for 30 min.

[0594] A 2945 bp DNA fragment was cut out from the agarose gel, recovered using a gel recovery kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., DP209) according to the instructions provided by the manufacturer, and finally eluted with ultrapure water.

[0595] The scaffold sequence (DNA sequence of which is SEQ ID NO: 45) in the single-stranded guide RNA for Cco2Cas9 protein, CcuCas9 protein, Hsp1Cas9 protein, Hsp1-Hsp3Cas9 protein, Hsp1-Hsp3Cas9-Y446A protein and Hsp1-Hsp3Cas9-K390A-Y446A was gene synthesized and constructed on the linearized pSKB-backbone to obtain the plasmid pSK-U6-Cj-tracr.

[0596] (2-2) Construction of plasmid pU6-Nme2-tracr

[0597] The sequence of Nme2Cas9_AAV plasmid (Addgene platform, catalog #119924) contains a scaffold sequence in a single-stranded guide RNA for Nsp2Cas9 protein (its DNA sequence is SEQ ID NO: 46). The Nme2Cas9_AAV plasmid (Addgene platform, catalog #119924) was linearized by PCR, and the primer sequences were GGCGGTACTATGTAGATGAGGGCCGCAGGAACCCCTAG; and CTCATCTACATAGTACCGCCTCCA.

[0598] The reaction system is as follows:

[0599]

[0600] The PCR run procedure is as follows:

[0601]

[0602] The PCR product was electrophoresed on a 1% agarose gel at 120 V for 30 min, and a 3368 bp DNA fragment was cut from the agarose gel and recovered using a gel recovery kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., DP209) according to the manufacturer's instructions, and finally eluted with ultrapure water. TM The DNA concentration was measured by Lite spectrophotometer (Thermo Scientific) and kept for later use or at -20°C for long-term storage.

[0603] The linearized Nme2Cas9_AAV fragments were homologously recombined according to the ratio required by the instructions, and the homologous recombinase used was High-fidelity DNA assembly master mix (NEB), the reaction system is as follows:

[0604]

[0605] The reaction conditions are as follows:

[0606]

[0607] The recombinant product was added to Escherichia coli DH5α competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.), incubated on ice for 30 min, heat shocked at 42°C for 1 min, incubated on ice for 2 min, added with 900 μL LB medium, and cultured at 37°C for 1 hour to activate and resuscitate the Escherichia coli DH5α competent cells.

[0608] The revived E. coli DH5α competent cells were spread on LB solid plates containing ampicillin resistance and cultured upside down in a 37° C. incubator. The obtained E. coli DH5α single clone was verified by Sanger sequencing.

[0609] The E. coli DH5α clones with correct connection verified by sequencing were shaken to extract the plasmid, that is, the plasmid pU6-Nme2-tracr was obtained and set aside.

[0610] (3-1) Preparation of linearized plasmid pSK-U6-Cj-tracr

[0611] The plasmid pSK-U6-Cj-tracr was digested with BbsI restriction enzyme, and the digestion system was: 1 μg of plasmid pSK-U6-Cj-tracr, 5 μL of 10×CutSmart buffer (purchased from NEB), 1 μL of BbsI restriction enzyme (purchased from NEB), and water was added to 50 μL. The digestion system was reacted at 37° C. for 2 hours.

[0612] Then, the digested products were electrophoresed on 1% agarose gel at 120 V for 30 min.

[0613] The DNA fragment was cut from the agarose gel and recovered using a gel recovery kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., DP209) according to the instructions provided by the manufacturer, and finally eluted with ultrapure water. The DNA fragment is the linearized plasmid pSK-U6-Cj-tracr, which is 3380 bp in size.

[0614] The recovered linearized plasmid pSK-U6-Cj-tracr was purified by NanoDrop TM The DNA concentration was measured by Lite spectrophotometer (ThermoScientific) and kept for later use or at -20°C for long-term storage.

[0615] (3-2) Preparation of linearized plasmid pU6-Nme2-tract

[0616] The plasmid pU6-Nme2-tracr was digested with BspQI restriction endonuclease, and the digestion system was: 1 μg of plasmid pU6-Nme2-tracr, 5 μL of 10×Buffer 3.1 buffer (purchased from NEB), 1 μL of BspQI restriction endonuclease (purchased from NEB), and water was added to 50 μL. The digestion system was reacted at 50° C. for 2 hours.

[0617] Then, the digested products were electrophoresed on 1% agarose gel at 120 V for 30 min.

[0618] The DNA fragment was cut from the agarose gel, recovered using a gel recovery kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., DP209) according to the instructions provided by the manufacturer, and finally eluted with ultrapure water. The DNA fragment is the linearized plasmid pU6-Nme2-tracr, which is 3326 bp in size.

[0619] The recovered linearized plasmid pU6-Nme2-tracr was transferred to TM The DNA concentration was measured by Lite spectrophotometer (ThermoScientific) and kept for later use or at -20°C for long-term storage.

[0620] (4-1) Preparation of plasmid pSK-U6-Cj-on target sgRNA or pSK-U6-Cj-mismatch sgRNA

[0621] The sequences of each on target gRNA and mismatch gRNA were designed, and the corresponding oligonucleotide single-stranded DNAs are shown in Table 4 below, where the mismatch bases are shown as underlined bold bases in the sequence table.

[0622] The oligonucleotide single-stranded DNA corresponding to the on target gRNA and the oligonucleotide single-stranded DNA corresponding to different mismatch gRNAs were annealed separately. The annealing reaction system was: 1μL 100μM oligo-F, 1μL 100μM oligo-R, and 28μL water. After the annealing system was shaken and mixed, it was placed in a PCR instrument to run the annealing program; the annealing program was as follows: 95℃_5min, 85℃_1min, 75℃_1min, 65℃_1min, 55℃_1min, 45℃_1min, 35℃_1min, 25℃_1min, 4℃ storage, cooling rate 0.3℃ / s. After annealing, the obtained products were connected to the obtained linearized pSK-U6-Cj-tracr plasmid by DNA ligase (purchased from NEB).

[0623] The ligation product was added to Escherichia coli DH5α competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.), incubated on ice for 30 min, heat shocked at 42°C for 1 min, incubated on ice for 2 min, added with 900 μL LB medium, and cultured at 37°C for 1 h to activate and recover the Escherichia coli DH5α competent cells.

[0624] The revived E. coli DH5α competent cells were spread on LB solid plates containing corresponding resistance and cultured inverted in a 37°C incubator. The obtained E. coli DH5α single clone was verified by Sanger sequencing.

[0625] The E. coli DH5α clones with correct connection verified by sequencing were shaken and plasmids were extracted, namely, the plasmid pSK-U6-Cj-on target sgRNA expressing the above-mentioned on target gRNA sequence and the plasmid pSK-U6-Cj-mismatch sgRNA expressing the above-mentioned different mismatch gRNA sequences were obtained for use.

[0626] (4-2) Preparation of plasmid pU6-Nme2-on target sgRNA or pU6-Nme2-mismatch sgRNA

[0627] The sequences of each on target gRNA and mismatch gRNA were designed, and the corresponding oligonucleotide single-stranded DNAs were shown in Table 4 below, where the mismatch bases were shown as underlined bold bases in the sequence table. The obtained oligonucleotide single-stranded DNAs corresponding to the ontarget gRNA and the oligonucleotide single-stranded DNAs corresponding to different mismatch gRNAs were annealed separately. The annealing reaction system was: 1μL 100μM oligo-F, 1μL 100μM oligo-R, and 28μL water. After the annealing system was shaken and mixed, it was placed in a PCR instrument to run the annealing program; the annealing program was as follows: 95℃_5min, 85℃_1min, 75℃_1min, 65℃_1min, 55℃_1min, 45℃_1min, 35℃_1min, 25℃_1min, stored at 4℃, and the cooling rate was 0.3℃ / s. After annealing, the obtained products were ligated to the obtained linearized pU6-Nme2-tracr plasmid using DNA ligase (purchased from NEB).

[0628] The ligation product was added to Escherichia coli DH5α competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.), incubated on ice for 30 min, heat shocked at 42°C for 1 min, incubated on ice for 2 min, added with 900 μL LB medium, and cultured at 37°C for 1 h to activate and recover the Escherichia coli DH5α competent cells.

[0629] The revived E. coli DH5α competent cells were spread on LB solid plates containing corresponding resistance and cultured inverted in a 37°C incubator. The obtained E. coli DH5α single clone was verified by Sanger sequencing.

[0630] The E. coli DH5a clones with correct connection verified by sequencing were shaken and plasmids were extracted, namely, plasmid pU6-Nme2-on target sgRNA expressing the above-mentioned on target gRNA sequence and plasmid pU6-Nme2-mismatch sgRNA expressing the above-mentioned different mismatch gRNA sequences were obtained for use.

[0631]

[0632]

[0633]

[0634]

[0635] (5-1) The obtained plasmid pSK-U6-Cj-on target sgRNA expressing the on target gRNA sequence and the plasmid pSK-U6-Cj-mismatch sgRNA expressing the mismatch gRNA sequence were respectively transfected with the plasmid pAAV2_Cas9_ITR expressing Cas9 into the GFP reporter system HEK293T cell line containing the target sequence by liposome transfection.

[0636] The above transfection process includes the following steps:

[0637] On day 0, according to the transfection requirements, HEK293T cells containing the target sequence of GFP reporter system were plated in 24-well plates, and the cell density was controlled at 30%.

[0638] The GFP reporter system HEK293T cell line containing the target sequence contains the nucleotide sequence of CMV-ATG-target site-PAM-GFP, where the PAM sequence is shown in Figures 13 to 18 The sequence of the target site corresponding to the Cco2Cas9 protein is CCGGGACCCTCCACTCCTCCTG, the sequence of the target site corresponding to the CcuCas9 protein is TCCTTGGGCAGCAACACAGCAG, the sequence of the target site corresponding to the Hsp1Cas9 protein is GGTGACAGGGGCTTCTCTCCAG, and the sequence of the target site corresponding to the Hsp1-Hsp3Cas9 protein, Hsp1-Hsp3Cas9-Y446A protein and Hsp1-Hsp3Cas9-K390A-Y446A protein is AGCGCAATGATGATCTCCGAGC.

[0639] On day 1, transfection was performed. The transfection process was as follows:

[0640] Take 300 ng of plasmid pSK-U6-Cj-on target sgRNA or 300 ng of plasmid pSK-U6-Cj-mismatchsgRNA and 500 ng of plasmid pAAV2_Cas9_ITR and add them into 25 μL Opti-MEM culture medium (purchased from Gibco) respectively, and mix them by gently pipetting.

[0641] Will 2000 (purchased from Invitrogen) or PEI (purchased from Polysciences) was flicked to mix well, and 1.6 μL was drawn. 2000 or 0.8 μL PEI (100 μM) was added to 25 μL Opti-MEM medium, mixed gently, and allowed to stand at room temperature for 5 min.

[0642] The diluted plasmid and the diluted transfection reagent were mixed and gently pipetted to mix. The resulting mixture was allowed to stand at room temperature for 20 min, then added to the culture medium of the GFP reporter system HEK293T cell line containing the target sequence and placed at 37°C and 5% CO. 2 Continue culturing in the incubator.

[0643] Flow cytometry analysis technology was used to analyze the editing efficiency and off-target rate of the CRISPR gene editing system of the present invention on the target sequence.

[0644] Specifically, the CO 2 After culturing the HEK293T cell line in an incubator for 5 days, its specificity was detected by flow cytometry (BD Biosciences FACSCalibur), and the GFP positive ratio was analyzed and plotted using FlowJo analysis software.

[0645] (5-2) The obtained plasmid pU6-Nme2-on target sgRNA expressing the on target gRNA sequence and the plasmid pU6-Nme2-mismatch sgRNA expressing the mismatch gRNA sequence were respectively transfected with the plasmid pAAV2_Cas9_ITR expressing Cas9 into the GFP reporter system HEK293T cell line containing the target sequence (AGCGCAATGATGATCTCCGAGC) by liposome transfection.

[0646] The above transfection process includes the following steps:

[0647] On day 0, according to the transfection requirements, HEK293T cells containing the target sequence of GFP reporter system were plated in 24-well plates, and the cell density was controlled at 30%.

[0648] The GFP reporter system HEK293T cell line containing the target sequence contains the nucleotide sequence of CMV-ATG-target site-PAM-GFP, where the PAM sequence is shown in Fig.19 , the sequence of the target site is AGCGCAATGATGATCTCCGAGC.

[0649] On day 1, transfection was performed. The transfection process was as follows:

[0650] Take 300 ng of plasmid pU6-Nme2-on target sgRNA or 300 ng of plasmid pU6-Nme2-mismatchsgRNA and 500 ng of plasmid pAAV2_Cas9_ITR and add them into 25 μL Opti-MEM culture medium (purchased from Gibco) respectively, and mix them by gently pipetting.

[0651] Will 2000 (purchased from Invitrogen) or PEI (purchased from Polysciences) was flicked to mix well, and 1.6 μL was drawn. 2000 or 0.8 μL PEI (100 μM) was added to 25 μL Opti-MEM medium, mixed gently, and allowed to stand at room temperature for 5 min.

[0652] The diluted plasmid and the diluted transfection reagent were mixed and gently pipetted to mix. The resulting mixture was allowed to stand at room temperature for 20 min, then added to the culture medium of the GFP reporter system HEK293T cell line containing the target sequence and placed at 37°C and 5% CO. 2 Continue culturing in the incubator.

[0653] Flow cytometry analysis technology was used to analyze the editing efficiency and off-target rate of the CRISPR gene editing system of the present invention on the target sequence.

[0654] Specifically, the CO 2 After culturing the HEK293T cell line in an incubator for 5 days, its specificity was detected by flow cytometry (BD Biosciences FACSCalibur), and the GFP positive ratio was analyzed and plotted using FlowJo analysis software.

[0655] The specific detection results of the CRISPR / Cas9 gene editing system of the present invention in the GFP reporter system HEK293T cell line containing the target sequence are shown in Figures 13 to 19, where the upper horizontal bar shows the schematic diagram of the GFP reporter system, with a specific target sequence and PAM sequence inserted between the start codon ATG and the GFP coding sequence, causing a GFP frameshift mutation. Therefore, when the gene editing system cuts the target sequence, the cell's own repair system will restore the GFP reading frame to some cells, producing green fluorescence. Figures 13 to 19 The Y axis in the bar graph at the bottom center represents the percentage of GFP-positive cells (%), and the X axis represents the oligonucleotide single-stranded DNA sequences corresponding to the On-target gRNA and the mismatch gRNA. Figures 13 to 19 It can be seen that the target sites of the CRISPR gene editing system of the present invention in the GFP reporter system HEK293T cell line were all edited, and the gene editing ratio mediated by the mismatch gRNA was significantly lower than the gene editing ratio mediated by the on-target gRNA. In addition, in the research results of the CRISPR / Hsp1-Hsp3Cas9-Y446A gene editing system, no obvious off-target phenomenon was found in the double base mismatch of the last 14bp, while the CRISPR / Hsp1-Hsp3Cas9-K390A-Y446A gene editing system did not find obvious off-target phenomenon in all double base mismatches, indicating that these gene editing systems have extremely high requirements for complete matching between gRNA and target sequence, and have a low fault tolerance rate and high safety in practical application.

[0656] Sequence Listing

[0657] SEQ ID NO: 1: Cco2Cas9 protein sequence (Campylobacter coli)

[0658]

[0659] SEQ ID NO: 2: CcuCas9 protein sequence (Campylobacter cuniculorum)

[0660]

[0661] SEQ ID NO: 3: CspCas9 protein sequence (Campylobacter sp. 113)

[0662]

[0663]

[0664] SEQ ID NO: 4: Hap1Cas9 protein sequence (Helicobacter apodemus)

[0665]

[0666] SEQ ID NO: 5: Hap2Cas9 protein sequence (Helicobacter apodemus)

[0667]

[0668] SEQ ID NO: 6: HgaCas9 protein sequence (Helicobacter ganmani)

[0669]

[0670]

[0671] SEQ ID NO: 7: HtyCas9 protein sequence (Helicobacter typhlonius)

[0672]

[0673] SEQ ID NO: 8: Hsp1Cas9 protein sequence (Helicobacter sp. MIT11-5569)

[0674]

[0675] SEQ ID NO: 9: Hsp2Cas9 protein sequence (Helicobacter sp. MIT 03-1614)

[0676]

[0677]

[0678] SEQ ID NO: 10: Hsp3Cas9 protein sequence (Helicobacter sp. MIT14-3879)

[0679]

[0680] SEQ ID NO: 11: Hsp4Cas9 protein sequence (Helicobacter sp. 10-6591)

[0681]

[0682] SEQ ID NO: 12: Hsp1-CcuCas9 protein sequence

[0683]

[0684]

[0685] SEQ ID NO: 13: Hsp1-Hap2Cas9 protein sequence

[0686]

[0687] SEQ ID No: 14: Hsp1-HgaCas9 protein sequence

[0688]

[0689] SEQ ID NO: 15: Hsp1-HtyCas9 protein sequence

[0690]

[0691]

[0692] sEQ ID No: 16: Hsp1-Hsp2Cas9 protein sequence

[0693]

[0694] SEQ ID NO: 17: Hsp1-Hsp3Cas9 protein sequence

[0695]

[0696] sEQ ID NO: 18: Hsp1-Hsp3Cas9-Y446A protein sequence

[0697]

[0698]

[0699] sEQ ID NO: 19: Hsp1-Hsp3Cas9-K390A-Y446A protein sequence

[0700]

[0701] SEQ ID No: 20: Hsp1-Hsp4Cas9 protein sequence

[0702]

[0703] SEQ ID NO: 21: Nsp2Cas9 protein sequence (Neisseria sp. WF04)

[0704]

[0705] SEQ ID NO: 22: Coding sequence of Cco2Cas9 protein

[0706]

[0707]

[0708] SEQ ID NO: 23: Coding sequence of CcuCas9 protein

[0709]

[0710]

[0711] SEQ ID No: 24: Coding sequence of CspCas9 protein

[0712]

[0713]

[0714] SEQ ID NO: 25: Coding sequence of Hap1Cas9 protein

[0715]

[0716]

[0717] sEQ ID No: 26: Coding sequence of Hap2Cas9 protein

[0718]

[0719]

[0720] SEQ ID No: 27: Coding sequence of HgaCas9 protein

[0721]

[0722]

[0723] SEQ ID NO: 28: Coding sequence of HtyCas9 protein

[0724]

[0725]

[0726] SEQ ID No: 29: Coding sequence of Hsp1Cas9 protein

[0727]

[0728]

[0729] SEQ ID No: 30: Coding sequence of Hsp2Cas9 protein

[0730]

[0731]

[0732] SEQ ID No: 31: Coding sequence of Hsp3Cas9 protein

[0733]

[0734]

[0735] SEQ ID NO: 32: Coding sequence of Hsp4Cas9 protein

[0736]

[0737]

[0738] SEQ ID NO: 33: Coding sequence of Hsp1-CcuCas9 protein

[0739]

[0740]

[0741] SEQ ID NO: 34: Coding sequence of Hsp1-Hap2Cas9 protein

[0742]

[0743]

[0744] SEQ ID NO: 35: Coding sequence of Hsp1-HgaCas9 protein

[0745]

[0746]

[0747] SEQ ID NO: 36: Coding sequence of Hsp1-HtyCas9 protein

[0748]

[0749]

[0750] SEQ ID NO: 37: Coding sequence of Hsp1-Hsp2Cas9 protein

[0751]

[0752]

[0753] SEQ ID NO: 38: Coding sequence of Hsp1-Hsp3Cas9 protein

[0754]

[0755]

[0756] SEQ ID No: 39: Coding sequence of Hsp1-Hsp3Cas9-Y446A protein

[0757]

[0758]

[0759] sEQ ID NO: 40: Coding sequence of Hsp1-Hsp3Cas9-K390A-Y446A protein

[0760]

[0761]

[0762] SEQ ID NO: 41: Coding sequence of Hsp1-Hsp4Cas9 protein

[0763]

[0764]

[0765] SEQ ID NO: 42: Coding sequence of Nsp2Cas9 protein

[0766]

[0767]

[0768] SEQ ID No: 43: Scaffold sequence of single-stranded guide RNA associated with Cco2Cas9 protein, CcuCas9 protein, CspCas9 protein, Hap1Cas9 protein, Hap2Cas9 protein, HgaCas9 protein, HtyCas9 protein, Hsp1Cas9 protein, Hsp2Cas9 protein, Hsp3Cas9 protein, Hsp4Cas9 protein, Hsp1-CcuCas9 protein, Hsp1-Hap2Cas9 protein, Hsp1-HgaCas9 protein, Hsp1-HtyCas9 protein, Hsp1-Hsp2Cas9 protein, Hsp1-Hsp3Cas9 protein, Hsp1-Hsp3Cas9-Y446A protein, Hsp1-Hsp3Cas9-K390A-Y446A protein, and Hsp1-Hsp4Cas9 protein

[0769]

[0770] SEQ ID No: 44: Scaffold sequence of single-stranded guide RNA associated with Nsp2Cas9 protein

[0771]

[0772] SEQ ID NO: 45: DNA sequence of a scaffold sequence of a single-stranded guide RNA associated with a Cco2Cas9 protein, a CcuCas9 protein, a CspCas9 protein, a Hap1Cas9 protein, a Hap2Cas9 protein, a HgaCas9 protein, a HtyCas9 protein, a Hsp1Cas9 protein, a Hsp2Cas9 protein, a Hsp3Cas9 protein, a Hsp4Cas9 protein, a Hsp1-CcuCas9 protein, a Hsp1-Hap2Cas9 protein, a Hsp1-HgaCas9 protein, a Hsp1-HtyCas9 protein, a Hsp1-Hsp2Cas9 protein, a Hsp1-Hsp3Cas9 protein, a Hsp1-Hsp3Cas9-Y446A protein, a Hsp1-Hsp3Cas9-K390A-Y446A protein, and a Hsp1-Hsp4Cas9 protein

[0773]

[0774] SEQ ID NO: 46: DNA sequence of the scaffold sequence of the single-stranded guide RNA associated with the Nsp2Cas9 protein

[0775] Sequence Listing <110> Fudan University <120> Cas9 protein, gene editing system containing Cas9 protein and application thereof <130> CF210247S <160> 46 <170> SIPOSequenceListing 1.0 <210> 1 <211> 1000 <212> PRT <213> Campylobacter coli <400> 1 Met Lys Ile Leu Gly Phe Asp Ile Gly Ile Asn Ser Ile Gly Trp Ala 1 5 10 15 Phe Val Glu Asp Asn Gln Leu Gln Asp Cys Gly Val Arg Leu Phe Thr 20 25 30 Lys Ala Glu Asp Pro Lys Thr Lys Glu Ser Leu Ala Leu Pro Arg Arg 35 40 45 Asn Ala Arg Ser Asn Arg Arg Arg Leu Gly Arg Arg Arg Ser Arg Leu 50 55 60 Ile Ala Leu Lys His Ile Ile Ser Lys Glu Leu Lys Leu Asn Tyr Gln 65 70 75 80 Asp Tyr Ile Ala Asn Asp Gly Glu Leu Pro Lys Ala Tyr Glu Gly Arg 85 90 95 Leu Val Ser Pro Tyr Glu Leu Arg Tyr Lys Ala Leu Asn Glu Lys Ile 100 105 110 Glu Pro Lys Asp Leu Ala Arg Val Ile Leu His Ile Ala Lys His Arg 115 120 125 Gly Tyr Met Asn Lys Asn Glu Lys Ser Ser Asp Asn Glu Lys Gly 130 135 140 Lys is the name of Lys Thr Asn and Lys is the name of Lys Glu Lys Tyr 145 150 155 160 Gln Ser Val Gly Glu Tyr Phe Tyr Lys Glu Phe Phe Gln Lys Tyr Lys 165 170 175 Glu Asn Thr Lys Asp Phe Ile Asn Ile Arg Asn Lys Gly Ser Tyr 180 185 190 Glu Asn Cys Val Leu Ser Asp Leu Glu Lys Glu Lys Leu Ile 195 200 205 Leu Glu Lys Gln Lys Glu Trp Gly Tyr Ser Tyr Asn Asp Asn Phe Ile 210 215 220 Lys Glu Ile Leu Lys Val Ala Phe Phe Gln Arg Pro Leu Lys Asp Phe 225 230 235 240 Ser Tyr Leu Val Gly Ala Cys Thr Phe Phe Glu Asp Glu Lys Arg Ala 245 250 255 Cys Lys Asn Ser Tyr Ser Ala Trp Glu Phe Val Ala Leu Thr Lys Ile 260 265 270 Ile Asn Glu Leu Lys Ser Leu Glu Lys Glu Ser Gly Glu Leu Val Ser 275 280 285 Ser Gln Ile Ile Asn Glu Ile Leu Asn His Ile Leu Asp Lys Gly Ser 290 295 300 Ile Thr Tyr Lys Lys Phe Arg Glu Tyr Ile Lys Leu His Glu Ser Met 305 310 315 320 Lys Phe Lys Ser Leu Lys Tyr Asp Lys Asp Asn Ala Glu Ser Val Lys 325 330 335 Leu Ile Glu Phe Arg Lys Leu Val Glu Phe Lys Lys Ala Leu Gly Glu 340 345 350 His Ser Leu Thr Arg Glu Glu Leu Asp Gln Ile Ala Thr Tyr Ile Thr 355 360 365 Leu Ile Lys Asp Asn Glu Lys Leu Lys Ile Thr Leu Glu Lys Tyr Ser 370 375 380 Leu Asn Asn Glu Gln Ile Lys Asn Leu Ile Glu Ile Asp Phe Asn Asp 385 390 395 400 His Ile Asn Leu Ser Phe Lys Ala Leu Asn Leu Ile Leu Pro Leu Met 405 410 415 Lys Glu Gly Lys Arg Tyr Asp Glu Ala Cys Lys Leu Leu Asn Leu Lys 420 425 430 Thr Lys Ser Asn Asn Gln Lys Phe Asp Phe Leu Pro Ala Phe Cys Asp 435 440 445 Serving Gln Glu Leu Thr Asn Pro Ile Val Asn Arg Ala Ile 450 455 460 Ser Glu Tyr Arg Lys Val Leu Asn Ala Leu Leu Lys Tyr Gly Lys 465 470 475 480 Met His Lys Ile His Ile Glu Leu Ala Arg Asp Ile Gly Leu Ser Lys 485,490,495 Lys Leu Arg Thr Lys Ile Glu Lys Glu Gln Lys Glu Asn Tyr Glu Asn 500 505 510 Asn Ile Trp Ala Leu Asn Glu Cys Glu Asn Phe Gly Leu Lys Ala Asn 515,520,525 Only Lys Asn With Leu Lys Leu Lys Leu Trp Lys Glu Gln Lys Glu Phe 530 535 540 Cys Ile Tyr Ser Gly Lys Lys Ile Ser Ile Glu His Leu Arg Asp Glu 545 550 555 560 Lys Ala Leu Glu Val Asp His Ile Tyr Pro Tyr Ser Arg Ser Phe Asp 565,570,575 Asp Ser Phe Leu Asn Lys Val Leu Val Phe Thr Lys Glu Asn Gln Glu 580 585 590 Lys Leu Asn Lys Thr Pro Phe Glu Ala Phe Gly Ala Asn Glu Glu Arg 595 600 605 Trp Ser Lys Ile Gln Ala Leu Ala Gln Asn Leu Pro Tyr Lys Lys Lys 610 615 620 Asn Lys Ile Leu Asp Glu Ala Phe Lys Gly Lys Gln Gln Gln Asp Phe 625 630 635 640 Ile Ser Arg Asn Leu Asn Asp Thr Arg Tyr Ile Ser Thr Leu Ile Val 645 650 655 Lys Tyr Thr Lys Glu Tyr Leu Asp Phe Leu Pro Leu Asp Glu Lys Glu 660 665 670 Asp Ile Asn Leu Lys Ser Gly Glu Lys Gly Ser Lys Ile His Val Gln 675 680 685 Thr Ile Asn Gly Met Leu Thr Ser Val Leu Arg His Thr Trp Gly Phe 690 695 700 Ala Gln Lys Asp Arg Asn Asn His Leu His His Ala Leu Asp Ala Thr 705 710 715 720 Ile Val Ala Tyr Ser Thr Asn Ala Ile Ile Lys Ala Phe Ser Asp Phe 725 730 735 Lys Glu Gln Glu Leu Lys Ala Lys Leu Tyr Ala Lys Glu Leu 740,745,750 Thr Asn Asp Ser Tyr Lys His Gln Ala Lys Phe Phe Glu Pro Phe Glu 755,760,765 Gly Phe Arg Glu Gln Ile Leu Asn Gln Ile Asn Lys Leu Phe Val Ser 770,775,780 Lys Pro Pro Arg Lys Arg Ala Arg Gly Ala Leu His Lys Glu Thr Phe 785,790,795,800 Tyr Pro Lys Asp Glu Met Ile Lys Lys Tyr Asn Ser Gln Glu Gly Val 805 810 815 Glu Ile Ala Leu Asn Cys Gly Lys Ile Arg Lys Ile Gly Thr Lys Tyr 820 825 830 Val Glu Asn Asp Thr Met Val Arg Ile Asp Ile Phe Lys Lys Gln Asn 835 840 845 Lys Phe Tyr Ala Ile Pro Ile Tyr Thr Met Asp Phe Ala Leu Gly Val 850 855 860 Leu Pro Asn Lys Ile Val Ile Gly Lys Asp Lys Lys Gly Asn Pro 865 870 875 880 Lys Gln Trp Gln Glu Ile Asp Glu Ser Tyr Glu Phe Cys Phe Ser Leu 885,890,895 His Lys Asp Asp Leu Val Leu Ile Gln Lys Lys Asp Met Gln Glu Pro 900 905 910 Glu Phe Ala Tyr Tyr Asn Gly Phe Asp Ile Ser Asn Ser Ser Ile Cys 915 920 925 Val Glu Lys His Asp Asn Lys Phe Glu Asn Leu Thr Asp Asn Gln Lys 930 935 940 Leu Leu Phe Thr Asn Ala Glu Glu Gly Asn Val Lys Ala Lys Lys Ile 945 950 955 960 Gly Ile Gln Gly Leu Arg Ile Phe Glu Lys Tyr Ile Ile Thr Pro Leu 965 970 975 Gly Glu Lys Ile Lys Ala Asp Phe Lys Pro Arg Glu Asp Ile Ala Leu 980 985 990 Lys Thr Ser Lys Lys His Gly Leu 995 1000 <210> 2 <211> 1032 <212> PRT <213> Campylobacter cuniculorum <400> 2 Met Lys Ile Leu Gly Phe Asp Ile Gly Ile Ser Ser Ile Gly Trp Ala 1 5 10 15 Phe Val Glu Asn Glu Glu Leu Arg Asp Cys Gly Val Arg Ile Phe Thr 20 25 30 Lys Ala Glu Asn Pro Glu Asn Gly Glu Ser Leu Ala Leu Pro Arg Arg 35 40 45 Glu Ala Arg Gly Val Arg Arg Arg Leu Ala Arg Arg Lys Ala Arg Leu 50 55 60 Asn Gly Val Lys Leu Cys Gln Glu Phe Gly Lys Leu Asn 65 70 75 80 Asp Tyr Phe Ser Asn Asp Gly Glu Leu Pro Lys Ala Tyr Gln Met Ser 85 90 95 Lys Asn Thr Lys Ser Val Tyr Glu Leu Arg Thr Leu Ala Leu Ser Cys 100 105 110 Lys Leu Glu Phe Lys Asp Leu Ala Arg Val Phe Leu His Ile Ala Lys 115 120 125 His Arg Gly Tyr Gly Asn Lys His Ala Lys Ile Ser Gln Asp Ser Lys 130 135 140 Asp Ile Gly Gln Ile Lys Lys Ala Leu Lys His Asn Glu Glu Glu Leu 145 150 155 160 Lys Asn Tyr Arg Ser Val Gly Glu Tyr Leu Tyr Lys Asn Phe Tyr Gln 165 170 175 Lys Val Arg Asn Phe Glu Glu Ile Lys Thr Lys Asn Lys Asn Gln 180 185 190 Ser Thr Phe Glu Phe Lys Asn Val Arg Asn Lys Ser Gly Asn Tyr Lys 195 200 205 Gln Cys Will Be Gln Glu Trp Lys Asn Lys Glu Ile Phe 210 215 220 Glu Lys Gln Arg Ser Phe Gly Val Lys Leu Ser Lys Asp Phe Glu Asn 225 230 235 240 Glu Leu Leu Asp Lys Ile Phe Phe Gln Arg Glu Leu Lys Asp Phe Ser 245 250 255 Asp Lys Ile Gly Phe Cys Ile Tyr Phe Glu Gly Lys Arg Ala Ser 260 265 270 Lys Glu Ser Leu Ser Ala Lys Glu Phe Ile Ala Leu Thr Arg Met Ile 275 280 285 Thr Phe Lys Asn Leu Glu Gln Asn Arg Lys Asn Gln Ser Gly 290,295,300 Tyr Glue Isle Ser Gln Glu Isle Ile Lys Glu Isle Asn Glu Isle 305 310 315 320 Asp Lys Gly Met Met Lys Tyr Lys Glu Leu Arg Thr Lys Gly Leu 325 330 335 Asp Lys Ser Ile Gln Phe Lys Asp Lys Leu Ser I Tyr Glu Lys Gly 340 345 350 To Glu Lys Ala Glu Glu Thr Lys Phe To Asp Phe Lys Glu Leu Arg 355 360 365 Asn Phe Lys Lys Ala Leu Gly Gly Ser Phe Glu Gly Leu Glu Arg Lys 370 375 380 His Ile Asp Glu Ile Ala His Lys Ile Thr Leu Ile Lys Ser Lys Glu 385 390 395 400 Lys Leu Lys Ile Ala Leu Glu Asn Tyr Ile Lys Glu His Lys Leu Glu 405 410 415 Gln Arg Leu Asn Glu Cys Leu Gly Asn Leu Ser Glu Leu Asp Phe Ser 420 425 430 Gly His Ile Asp Leu Ser Leu Glu Ala Leu Glu Gln Ile Leu Pro Phe 435 440 445 Met Arg Glu Gly Phe Arg Tyr Asp Glu Ala Val Lys Lys Ala Gly Leu 450 455 460 Arg Glu Ile Arg Lys Asp Tyr Leu Lys Lys Asp Phe Leu Pro Pro Leu 465 470 475 480 Lys Asp Phe Glu Asn Leu Path Asn Pro Val Val Val Arg Path Leu Path 485 490 495 Glu Tyr Arg Lys Val Leu Asn Ala Leu Leu Lys Lys Tyr Gly Lys Met 500 505 510 His Lys Ile His Ile Glu Leu Thr Arg Glu Ile Gly Leu Asn His Lys 515 520 525 Glu Arg Gln Asn Tyr Ile Glu Glu Gln Lys Asn Asn Phe Asn Phe Asn 530 535 540 Glu Glu Ala Arg Lys Lys Cys Glu Glu Ile Gly Leu Asp Ala Glu Lys 545 550 555 560 Tyr Leu Leu Lys Met Lys Leu Phe Leu Glu Gln Asp Glu Phe Cys Ile 565 570 575 Tyr Ser Gly Glu Lys Ile Lys Ile Glu His Leu Arg Asp Ala Lys Met 580 585 590 Leu Glu Ile Asp His Ile Tyr Pro Tyr Ser Arg Ser Phe Asp Asp Ser 595 600 605 Tyr Leu Asn Lys Val Leu Val Phe Ser Lys Glu Asn Gln Asn Lys Gly 610 615 620 Asn Lys Thr Pro Phe Glu Ala Phe Gly Asn Asp Lys Glu Lys Trp Asp 625 630 635 640 Lys Ile Lys Gly Leu Thr Gln Gly Leu Lys Lys Leu Pro Ser Lys Lys 645 650 655 Lys Arg with Leu Asn Leu Tyr Phe Asn Asp Lys Glu Ala Gly Phe 660,665,670 Ile Ser Arg Asn Leu Asn Asp Thr Ala Tyr Ile Ala Arg Phe Ser Ala 675,680,685 Asn Tyr Thr Lys Tyr Phe Leu Asp Phe Leu Pro Leu Ser Glu Asn Glu 690,695,700 Will Ser Ile Ser Gly Glu Lys Gly Ser Lys Val His Val Glu Ala Ile 705 710 715 720 Gly Arg Leu Thr Ala Met Leu Arg is Tyr Trp Gly Leu Gly Gln 725 730 735 Lys Asp Arg Asn Asn His Leu His Ala Val Asp Ala Val Ile Val 740,745,750 Only Tyr Thr Asn Only Lys Ile Only Lys Asn Phe Only Asp Phe Lys Lys 755,760,765 Phe Arg Glu Gln Asn Lys Ala Lys Ile Tyr Ala Lys Glu Phe Ala Gln 770,775,780 Thr Thr Asp Lys Lys Ile Phe Lys Pro Cys Glu Asn Phe Arg Asn Lys 785,790,795,800 I Leu Met Lys I Asp Glu Ile Phe Val Ser Lys Pro Pro Arg Lys 805 810 815 Arg Ala Arg Gly Ala Leu His Lys Glu Ser Phe Met Ser Phe Asp Asp 820 825 830 Lys Lys Leu Lys Ser Tyr Gly Gly Arg Glu Gly Val Lys Lys Ala 835 840 845 Leu Ser Leu Gly Lys Ile Arg Lys Ile Gly Thr Lys Ile Val Glu Asn 850 855 860 Lys Asn Met Val Arg Val Asp Ile Phe Lys Asp Lys Lys Gly Lys Phe 865 870 875 880 Tyr Gly Val Pro Ile Tyr Thr Met Asp Phe Ala Leu Gly Ile Leu Pro 885,890,895 Asn Lys Ala Val Val Ser Gly Glu Asp Lys Thr Arg Glu Ile Lys 900 905 910 Asp Trp Lys Glu Met Asp Glu Lys Tyr Glu Phe Cys Phe Ser Leu Phe 915,920,925 Lys Asp Asp Leu Ile Lys Ile Gln Lys Lys Asp Met Lys Glu Pro Lys 930,935,940 Phe Cys Tyr Tyr Lys Asn Phe Asp Val Ser Asn Ala Ser Ile Cys Ile 945 950 955 960 Ala Lys His Asp Asn Lys Phe Glu Asn Arg Asp Glu Asp Glu Lys Ile 965 970 975 Leu Tyr Ser Lys Ala Thr Tyr Lys Lys Val Glu Ala Arg Gly Ile Gly 980 985 990 Ile Gln Asn Leu Lys Ile Leu Glu Lys Trp Gln Val Ser Pro Leu Gly 995 1000 1005 Glu Lys Arg Glu Phe Glu Phe Glu Pro Arg Lys Asn Ile Ser Leu Lys 1010 1015 1020 Thr Thr Asn Arg Lys Asn Val Phe 1025 1030 <210> 3 <211> 987 <212> PRT <213> Campylobacter sp. 113 <400> 3 Met Ala Arg Ile Leu Ala Phe Asp Ile Gly Ile Ser Ser Ile Gly Trp 1 5 10 15 Ala Phe Ser Glu Asn Asp Glu Leu Lys Asp Cys Gly Val Arg Ile Phe 20 25 30 Thr Lys Ala Glu Asn Pro Lys Thr Gly Glu Ser Leu Ala Leu Pro Arg 35 40 45 Arg Leu Ala Arg Ser Ala Arg Lys Arg Leu Ala Arg Arg Lys Ala Arg 50 55 60 Leu Asn His Leu Lys His Leu Ile Ala Asn Glu Phe Lys Leu Asn Tyr 65 70 75 80 Glu Asp Tyr Gln Ser Phe Asp Glu Ser Leu Ala Lys Ala Tyr Lys Gly 85 90 95 Ser Leu Ile Ser Pro Tyr Glu Leu Arg Phe Arg Ala Leu Asn Glu Leu 100 105 110 Lys Gln Asp Phe Ala Arg Val Ile Leu His Ile Ala Lys Arg 115 120 125 Arg Gly Tyr Asp Asp Ile Lys Asn Asn Gly Asp Glu Glu Lys Gly Glu 130 135 140 Lys Island Only Lys Island Gln Asn Glu Glu Lys Will Be Tyr Gln 145 150 155 160 Ser Val Gly Glu Tyr Leu Tyr Lys Glu Tyr Phe Gln Lys Phe Lys Glu 165 170 175 Asn Ser Lys Glu Phe Ile Asn Val Arg Asn Lys Glu Ser Tyr Glu 180 185 190 Arg Cys contains Gln Ser with Lys Asp and Glu with Lys 195 200 205 Gln Lys Gln Arg Lys Phe Gly Phe Ser Phe Ser Lys Phe Glu Glu 210 215 220 Glu Val Leu Ser Val Ala Phe Tyr Lys Arg Ala Leu Lys Asp Phe Ser 225 230 235 240 His Leu Val Gly Asn Cys Ser Phe Phe Thr Asp Glu Lys Arg Ala Pro 245 250 255 Lys Asn Ser Pro Leu Ala Phe Met Phe Val Ala Leu Thr Arg Ile Ile 260 265 270 Asn Leu Leu Asn Asn Leu Lys Asn Thr Glu Gly Ile Leu Tyr Thr Lys 275 280 285 Asp Asp Leu Asn Thr Leu Leu Asn Glu Val Leu Lys Asn Gly Thr Leu 290 295 300 Thr Tyr Lys Gln Thr Lys Lys Leu Leu Gly Leu Ser Asn Asp Tyr Glu 305 310 315 320 Phe Lys Gly Glu Lys Gly Thr Tyr Phe Ile Glu Phe Gln Lys Tyr Lys 325 330 335 Glu Phe Val Lys Ala Leu Gly Glu His Asn Leu Ser Gln Asp Asp Leu 340 345 350 Asn Glu Ile Ala Lys Asp Ile Thr Leu Ile Lys Asp Glu Ile Lys Leu 355 360 365 Lys Lys Ala Leu Ala Lys Tyr Asp Leu Asn Gln Asn Gln Ile Asp Ser 370 375 380 Leu Ser Lys Leu Glu Phe Lys Asp His Leu Asn Ile Ser Phe Lys Ala 385 390 395 400 Leu Lys Ile Thr Pro Leu Met Leu Glu Gly Lys Tyr Asp Glu 405 410 415 Only Cys Asn Glue To Asn Leu Lys And Only Ile Asn To Glu Asp Lys Lys 420 425 430 Asp Phe Leu Pro Ala Phe Asn Glu Thr Tyr Tyr Lys Asp Glu Val Thr 435 440 445 Asn Pro Asn Val Val Leu Arg Ala Ile Lys Glu Tyr Arg Lys Val Val Leu Donkey 450 455 460 Ala Leu Lys Lys Tyr Ser Lys Val His Lys Ile Asn Ile Glu Leu 465 470 475 480 Only Arg Glu Will Gly Lys Asn His Being Gln Arg Ala Lys With Glu Lys 485,490,495 Glu Gln Asn Glu Asn Tyr Lys Ala Lys Asp Ala Glu Leu Glu Cys 500 505 510 Glu Lys Gly Leu Lys Ile Asn Served Lys Asn Ile Leu Lys Arg 515,520,525 Leu Phe Lys Glu Gln Lys Glu Phe Cys Val Tyr Ser Gly Glu Lys Ile 530 535 540 Lys Ile Ser Asp Leu Gln Asp Glu Lys Met Leu Glu Ile Asp His Ile 545 550 555 560 Tyr Pro Tyr Ser Arg Ser Phe Asp Asp Ser Tyr Met Asn Lys Val Leu 565 570 575 Val Phe Thr Lys Gln Asn Gln Glu Lys Leu Asn Lys Thr Pro Phe Glu 580 585 590 Thr Phe Gly Asn Asp Arg Val Lys Trp Gln Lys Ile Glu Val Leu Ala 595 600 605 Lys Asn Leu Pro Thr Lys Lys Gln Lys Arg Ile Leu Asp Lys Asn Tyr 610 615 620 Lys Asp Lys Glu Gln Lys Asp Phe Lys Asp Arg Asn Leu Asn Asp Thr 625 630 635 640 Arg Tyr Ile Ala Arg Leu Val Leu Asn Tyr Thr Lys Asp Tyr Leu Asp 645 650 655 Phe Leu Pro Leu Ser Asp Asp Glu Asn Thr Lys Leu Asn Asp Thr Gln 660 665 670 Lys Gly Ser Lys Val His Val Glu Ala Lys Ser Gly Met Leu Thr Ser 675 680 685 Thr Leu Arg His Thr Trp Gly Phe Ser Thr Lys Asp Arg Asn Asn His 690 695 700 Leu His His Only Asp Only Only Only Only Tyr Only Asn Asn Ser 705 710 715 720 Ile Val Lys Ala Phe Ser Asp Phe Lys Lys Glu Gln Glu Ser Asn Thr 725 730 735 Glu Leu Tyr Ala Lys Lys Ser Glu Leu Asp Tyr Lys Asn Lys 740,745,750 Arg Lys Phe Phe Glu Pro Phe Ser Gly Phe Arg Gln Lys Leu Leu Asp 755,760,765 Lys Ile Asp Glu Ile Phe Val Ser Lys Pro Glu Arg Lys Lys Pro Ser 770,775,780 Gly Ala Leu His Glu Glu Thr Phe Arg Lys Glu Glu Glu Phe Tyr Gln 785,790,795,800 Ser Tyr Gly Gly Lys Glu Gly Val Leu Lys Ala Leu Glu Leu Gly Lys 805 810 815 Ile Arg Lys Val Asn Gly Lys Ile Val Ser Asn Gly Asp Met Phe Arg 820 825 830 Val Asp Ile Phe Lys His Lys Lys Thr Asn Lys Phe Tyr Ala Val Pro 835 840 845 Ile Tr Thr Met Asp Phe Ala Leu Lys Val Leu Pro Asn Lys Ala Val 850 855 860 Val Gln Gly Lys Asp Lys Lys Ser Gly Leu Ile Lys Asp Trp Ile Leu 865,870,875,880 Met Asp Glu Asn Tyr Glu Phe Cys Phe Ser Leu Tyr Lys Asp Ser Leu 885 890 895 Ile Leu Ile Gln Thr Lys Asp Met Gln Glu Pro Glu Leu Val Tyr Tyr 900 905 910 Glu Arg Leu Asp Ser Ser Asn Ala Ser Leu Thr Val Ser Lys His Asp 915 920 925 Asn Lys Phe Glu Thr Leu Ser Lys Asn Gln Lys Ile Leu Phe Lys Asn 930 935 940 Ala Asn Glu Lys Glu Val Ile Ala Lys Ser Ile Gly Ile Gln Asn Leu 945,950,955,960 Lys Val Phe Glu Lys Tyr Ile Val Ser Ala Leu Gly Glu Val Thr Lys 965,970,975 Ala Glu Phe Arg Gln Arg Glu Asp Phe Lys Lys 980 985 <210> 4 <211> 1110 <212> PRT <213> Helicobacter apodemus <400> 4 Met Arg Ile Leu Gly Phe Asp Ile Gly Ile Thr Ser Ile Gly Trp Ala 1 5 10 15 Tyr Val Glu Gly Glu Glu Leu Lys Asp Cys Gly Val Arg Ile Phe Thr 20 25 30 Lys Ala Glu Asn Pro Gln Asn Gly Asp Ser Leu Ala Ala Pro Arg Arg 35 40 45 Glu Ala Arg Gly Val Arg Arg Arg Leu Ala Arg Arg Lys Val Arg Leu 50 55 60 Asn Val Ile Lys Arg Leu Leu Cys Lys Glu Phe Gly Leu Asn Leu Ser 65 70 75 80 Asp Tyr Phe Ala Asn Asp Gly Glu Leu Pro Lys Ala Tyr Glu Thr Thr 85 90 95 Lys Asp Thr Lys Ser Pro Tyr Glu Leu Arg Ser Leu Ala Leu Glu Gln 100 105 110 Lys Leu Glu Pro Lys Glu Leu Ala Arg Val Ile Leu His Ile Ala Lys 115 120 125 His Arg Gly Tyr Gly Asn Lys His Ala Lys Arg Asp Leu Glu Ala Glu 130 135 140 Glu Lys Ala Lys Lys Ala Ala Glu Lys Ala Pro Gln Glu Lys Glu Ser 145 150 155 160 Thr Thr Thr Asn Gly Asp Ser Lys Lys Glu Gln Glu Lys Val Leu Lys 165 170 175 Ala Leu Tyr Gln Asn Glu Thr Leu Leu Lys Lys Tyr Gln Thr Asn Tyr 180 185 190 Gln Thr Asn Asn Lys Thr Asn Asp Glu Thr Asn Asn Lys Thr Ile Phe 195 200 205 Leu Val Gly Lys Tyr Leu Tyr Lys Glu Phe Gln Asp Lys Gly Gln Arg 210 215 220 Ile Arg Asn Thr Thr Asn Asn Tyr Gln His Thr Met Arg Gln Glu Trp 225 230 235 240 Leu Lys Asp Glu Leu Glu Phe Ile Phe Lys Lys Gln Lys Asp Phe Gly 245 250 255 Ala Thr Phe Ser Glu Asn Phe Glu Ser Gln Ile Leu Glu Thr Ala Phe 260 265 270 Tyr Gln Arg Asp Leu Lys Ser Phe Glu Asp Lys Val Gly Lys Cys Val 275 280 285 Phe Tyr Glu Asn Glu Asn Arg Ala Pro Lys Asp Ser Leu Ser Ala Met 290 295 300 Glu Phe Val Ala Leu Thr Arg Ile Ile Asn Thr Leu Lys Asn Leu Glu 305 310 315 320 Lys Lys Ser Lys Asn Leu Gly Ile Gly Glu Thr Tyr Gly Lys Asp Lys 325 330 335 Ile Gln Glu Ile Leu Lys Ile Val Leu Asp Lys Gly Glu Met Ser Tyr 340 345 350 Lys Glu Leu Arg Lys Ile Leu Lys Leu Asn Glu Ser Ile Leu Phe Ala 355 360 365 Lys Asp Ser Lys Leu Asp Tyr Thr Lys Gly Met Gln Glu Ala Glu Lys 370 375 380 Ala Lys Phe Ile Glu Leu Lys Asn Leu Lys Ala Phe Lys Lys Ala Met 385 390 395 400 Gly Gly Asp Phe Ser Lys Phe Pro Arg Glu Glu Leu Asp Lys Ile Ala 405 410 415 Thr Asp Ile Val Leu Ile Lys Ser Lys Glu Asn Leu Ala Lys Lys Leu 420 425 430 Gln Asn Tyr Ser Ala Leu Ser Lys Glu Gln Val Glu Ala Leu Ser Asn 435 440 445 Leu Asn Phe Ala Lys His Ile Asp Leu Ser Leu Lys Ala Leu Asp Lys 450 455 460 Ile Leu Pro Phe Met Arg Glu Gly Leu Ser Tyr Asp Glu Val Val Lys 465 470 475 480 Lys Val Gly Leu Gln Glu His Arg Tyr Lys Gln Lys Gly Glu Phe 485,490,495 Leu Ile Pro Leu Lys Glu Tyr Glu Pro Tyr Leu Ala Asn Pro Val Val 500 505 510 Arg Fluent Served as Glu Tyr Arg Lys Val Fluent Asn Fluent 515,520,525 Lys Tyr Gly Asn Val His Lys Ile His Leu Glu Phe Thr Arg Glu Ala 530 535 540 Gly Lys Asn Tyr Asp Glu Arg Lys Ile Glu Lys Glu Gln Arg Glu 545 550 555 560 His Phe Glu Ala Asn Gln Lys Ala Ile Lys Gln Arg Glu Ile Leu Gly 565,570,575 Pro-Asn-Gly Only Asn-Asn-Lys Met-Lys On Trp Glu 580,585,590 Gln Gly Glu Cys Cys Val Tyr Ser Gly Glu Lys Ile Thr Ser Lys His 595,600,605 Phe Phe Asp Ser Asn Ala Leu Gln Val Asp His Ile Tyr Pro Tyr Ser 610 615 620 Arg Ser Phe Asp Asp Ser Tyr Met Asn Lys Val Leu Val Phe Ala Lys 625 630 635 640 Glu Asn Gln Asn Lys Leu Asn Lys Thr Pro Phe Glu Ala Phe Gly Ser 645 650 655 Asp Lys Glu Lys Trp Asp Arg Ile Leu Ser Leu Ser Ala Lys Leu Pro 660 665 670 Lys Gln Lys Gln Arg Arg Ile Ser Asn Lys Asp Phe Lys Asp Lys Glu 675 680 685 Leu Gly Phe Ile Ala Arg Asn Ile Asn Asp Thr Gly Tyr Ile Ala Arg 690 695 700 Leu Ala Ser Gln Trp Thr Asn Asn Cys Leu Lys Phe Glu Asp Leu Arg 705 710 715 720 Glu Asn Glu Val Thr Ile Ala Gly Glu Lys Gly Ser Lys Asn His Leu 725 730 735 Glu Val Ile Ser Gly Gln Leu Thr Ser Met Leu Arg His Tyr Trp Gly 740 745 750 Leu Gly Asp Lys Asp Arg Asn Asn His Leu His His Ala Val Asp Ala 755 760 765 Val Ile Ile Ala Tyr Thr Asn Ala Lys Thr Ile Lys Ala Phe Ala Asp 770 775 780 Phe Lys Lys Asn Gln Glu Gln Asn Arg Ala Lys Phe Tyr Ala Lys Gln 785,790,795,800 It contains Ser Glu Gln Glu Tyr Lys Arg Gln Arg Asn Pro Phe Glu Pro Cys 805 810 815 Only Asn Phe Arg Gln Arg Val Glu Glu Lys Ile Asn Lys Ile Phe Val 820 825 830 Ser Lys Pro Pro Arg Lys Arg Ala Arg Gly Ala Leu His Lys Glu Thr 835 840 845 Phe Gly Ser Ile Cys Leu Asp Gly Asn Asn Asn Trp Val Ala Arg Phe 850 855 860 Lys Ile Lys Serving Lys Glu Gln Glu Asp Ile Thr Lys Glu Lys Ala 865 870 875 880 Thr Lys Ala Lys Tyr Lys Asp Glu Phe Lys Gly Glu Glu Asn Ile Arg 885,890,895 Lys Ala Leu Lys Leu Gly Lys Ile Arg Ile Asn Asn Thr Gln Lys 900 905 910 Asp Ile Ala Ile Gly Asp Lys Ile Val Lys Asn Glu Thr Met Val Arg 915,920,925 Val Asp Ile Phe Lys Asp Lys Gly Lys Phe Tyr Ala Val Pro Ile 930,935,940 Tyr Thr Met Asp Phe Ala Leu Gly Ile Leu Pro Asn Lys Ala Val Ala 945 950 955 960 Thr Gly Glu Asp Glu Asp Gly Val Ile Lys Asp Trp Ile Glu Met Asp 965 970 975 Lys Thr Lys Tyr Glu Phe Cys Phe Ser Leu Phe Lys Asp Asp Leu Ile 980 985 990 Lys Val Arg Lys Lys Lys Met Lys Glu Ala Glu Leu Cys Tyr Phe Val 995 1000 1005 Gly Phe Asp Thr Asp Gly Ser Arg Ile Ile Val Ala Lys His Asn Asn 1010 1015 1020 Asp Tyr Gln Thr Met Thr Glu Asn Glu Cys Lys Leu Phe Thr Leu Lys 1025 1030 1035 1040 Glu Lys Lys Lys Lys Gln Lys Thr Leu Asn Asp Glu Glu Asp Asn Gln 1045 1050 1055 Glu Arg Ile Glu Thr Glu Tyr Lys Ile Ile Gly Gly Arg Thr Gly Ile 1060 1065 1070 Gln Asn Leu Glu Thr Phe Glu Lys His Gln Val Ser Pro Leu Gly Glu 1075 1080 1085 Val Gln Lys Ala Glu Phe Glu Asp Arg Gln Glu Ile Lys Leu Lys Ser 1090 1095 1100 Ser Pro Lys Gly Lys Asp 1105 1110 <210> 5 <211> 1082 <212> PRT <213> Helicobacter apodemus <400> 5 Met Lys Ile Leu Ser Phe Asp Ile Gly Val Thr Ser Ile Gly Trp Ala 1 5 10 15 Tyr Val Glu Gly Glu Lys Leu Lys Asp Cys Gly Val Arg Ile Phe Thr 20 25 30 Lys Ala Glu Asn Pro Glu Asn Gly Asp Ser Leu Ala Ala Pro Arg Arg 35 40 45 Glu Ala Arg Gly Val Arg Arg Arg Leu Ala Arg Arg Lys Val Arg Leu 50 55 60 Asn Val Ile Lys Arg Leu Leu Cys Lys Glu Phe Gly Leu Asn Leu Ser 65 70 75 80 Asp Tyr Phe Ala Asn Asp Gly Glu Leu Pro Lys Ala Tyr Glu Thr Thr 85 90 95 Lys Asp Thr Lys Ser Pro Tyr Glu Leu Arg Ser Leu Ala Leu Glu Gln 100 105 110 Lys Leu Glu Pro Lys Asp Leu Ala Arg Val Ile Leu His Ile Ala Lys 115 120 125 His Arg Gly Tyr Gly Asn Lys His Ala Lys Arg Asp Leu Glu Ala Glu 130 135 140 Glu Lys Ala Lys Lys Ala Ala Glu Lys Val Pro Gln Glu Lys Glu Ser 145 150 155 160 Thr Thr Thr Asn Gly Asp Ser Lys Lys Glu Gln Glu Lys Val Leu Lys 165 170 175 Ala Leu Tyr Gln Asn Glu Thr Leu Leu Lys Asn Tyr Gln Ile Asn Tyr 180 185 190 Gln Thr Asn Asp Glu Thr Asn Asn Lys Thr Ile Phe Leu Val Gly Lys 195 200 205 Tyr Leu Tyr Lys Glu Phe Gln Asp Lys Gly Gln Arg Ile Arg Asn Thr 210 215 220 Thr Asn Asn Tyr Gln His Thr Met Arg Gln Glu Trp Leu Lys Asp Glu 225 230 235 240 Leu Glu Phe Ile Phe Ala Lys Gln Arg Glu Phe Gly Phe Pro Phe Ser 245 250 255 Glu Lys Leu Tyr Lys Val Ala Thr Glu Asn Asn Lys Thr Lys Glu Leu 260 265 270 Asp Phe Ala Ser Ala Ile Met Glu Thr Ala Phe Tyr Gln Arg Asp Leu 275 280 285 Lys Ser Phe Glu Asp Lys Val Gly Lys Cys Val Phe Tyr Glu Asn Glu 290 295 300 Asn Arg Ala Pro Lys Asp Ser Leu Ser Val Met Glu Phe Val Ala Leu 305 310 315 320 Thr Arg Ile Ile Asn Thr Leu Lys Asn Leu Glu Glu Lys Ser Lys Asn 325 330 335 Leu Gly Ile Gly Glu Thr Tyr Gly Lys Asp Lys Ile Gln Glu Ile Leu 340 345 350 Lys Ile Val Leu Asp Lys Gly Glu Met Ser Tyr Lys Glu Leu Arg Lys 355 360 365 Ile Leu Lys Leu Asn Glu Ser Ile Leu Phe Ala Lys Asp Pro Lys Leu 370 375 380 Asp Tyr Thr Lys Gly Val Gln Glu Ala Glu Lys Ala Lys Phe Ile Glu 385 390 395 400 Leu Lys Asn Leu Lys Ala Phe Lys Lys Ala Met Gly Gly Glu Thr Glu 405 410 415 Gln Lys Ala Asn Lys Lys Thr Lys Lys Thr Ile Glu Val Ser Leu Glu 420 425 430 Ser Phe Asp Arg Lys Glu Leu Asp Leu In Path Thr His In Path Leu 435 440 445 Ile Lys Ser Lys Glu Asn Leu Ala Glu Arg Leu Arg Asn Tyr Pro Ala 450 455 460 Leu Ser Lys Glu Gln Val Glu Ala Leu Ser Asn Leu Asn Phe Ala Lys 465 470 475 480 His Ile Asp Leu Ser Leu Lys Ala Leu Asp Lys Ile Leu Pro Leu Met 485 490 495 Arg Glu Gly Leu Arg Tyr Asp Glu Ala Val Lys Lys Ala Gly Leu Gln 500 505 510 Glu His Arg Lys His Lys Gln Lys Gly Glu Phe Leu Ile Pro Leu Lys 515 520 525 Glu Tyr Glu Pro Tyr Leu Path Asn Pro Val Val Path Arg Path Leu Ser 530 535 540 Glu Tyr Arg Lys Val Leu Asn Ala Leu Leu Lys Lys Tyr Gly Lys Val 545 550 555 560 His Lys Ile His Leu Glu Phe Thr Arg Glu Ala Lys Leu Ser Ala Lys 565 570 575 Glu Arg Gln Lys Tyr Glu Lys Glu Gln Arg Glu His Phe Glu Path Asn 580 585 590 Gln Asn Ala Ile Lys Gln Cys Glu Lys Leu Asp Leu Arg Leu Asn Gly 595 600 605 Ala Asn Ile Leu Lys Met Lys Leu Trp Ile Glu Gln Gly Glu Tyr Cys 610 615 620 Ala Tyr Ser Val Lys Lys Ile Thr Thr Glu Asp Leu Lys Asp Ser Asn 625 630 635 640 Lys Leu Gln Ile Asp His Ile Tyr Pro Tyr Ser Arg Ser Phe Asp Asp 645 650 655 Ser Tyr Met Asn Lys Val Leu Val Phe Ser Lys Glu Asn Gln Asn Lys 660 665 670 Leu Asn Lys Thr Pro Phe Glu Ala Phe Gly Ser Asp Lys Glu Lys Trp 675 680 685 Asp Arg Ile Leu Ser Leu Ser Ala Lys Leu Pro Lys Gln Lys Gln Arg 690 695 700 Arg Ile Ser Asn Thr Asn Phe Lys Asp Lys Glu Gly Gly Phe Leu Ala 705 710 715 720 Arg Asn Ile Val Asp Thr Gly Tyr Ile Ala Arg Leu Ala Ser Gln Trp 725 730 735 Thr Asn His Cys Leu Lys Phe Glu Asp Leu Arg Glu Asn Glu Val Thr 740 745 750 Ile Thr Gly Glu Lys Gly Ser Ser Val His Ile Glu Val Val Ser Gly 755 760 765 Ser Leu Thr Ala Thr Leu Arg His Tyr Trp Gly Leu Gly Asp Lys Asp 770 775 780 Arg Asn Asn His Leu His His Ala Val Asp Ala Ile Ile Leu Ala Tyr 785 790 795 800 Val Asn Asp Thr Met Ile Gln Ala Phe Ala Asn Phe Arg Lys Asn Gln 805 810 815 Glu Gln Asn Lys Ala Lys Phe Tyr Ala Lys Gln Ile Ala Glu Ser Glu 820 825 830 Tyr Lys Ala Lys Lys Ala Phe Phe Glu Pro Cys Glu Asn Phe Arg Asp 835 840 845 Lys Val Leu Lys Lys Leu Asp Ser Ile Phe Val Ser Lys Pro Pro Arg 850 855 860 Lys Arg Ala Arg Gly Ala Leu His Lys Glu Thr Phe Tyr Ser Phe Glu 865 870 875 880 Asp Glu Lys Leu Leu Lys Ser Tyr Gly Gly Lys Gln Gly Val Gln Arg 885 890 895 Ala Ile Asp Leu Gly Lys Ile Arg Arg Ile Gly Thr Lys Ile Val Ser 900 905 910 Asn Gly Ala Met Val Arg Val Asp Ile Phe Lys His Lys Glu Gly Lys 915 920 925 Phe Tyr Ala Val Pro Ile Tyr Thr Met Asp Phe Ala Phe Gly Glu Trp 930 935 940 Pro Asn Lys Ala Val Ala Thr Gly Lys Asp Glu Asp Gly Val Ile Lys 945 950 955 960 Asp Trp Ile Glu Met Asp Ser Asp Tyr Asp Phe Cys Phe Ser Leu Phe 965 970 975 Lys Asp Asp Leu Ile Lys Val Lys Lys Lys Lys Met Lys Glu Ala Glu 980 985 990 Phe Cys Tyr Phe Lys Arg Phe Lys Thr Ser Gly Ala Ser Ile Glu Ile 995 1000 1005 Val Lys His Asp Asn Arg Ala Asp Asn Leu Asn Gly Asn Gln Glu Lys 1010 1015 1020 Ile Phe Lys Val Lys Leu Glu Asn Asn Gln Lys Ile Leu Asp Lys Ser 1025 1030 1035 1040 Leu Ile Ser Ile Gln Asn Leu Glu Ile Phe Glu Lys Trp Gln Val Ser 1045 1050 1055 Pro Leu Gly Lys Val Gln Lys Ala Val Pro Glu Ser Arg Gln Gly Ile 1060 1065 1070 Lys Leu Lys Ser Ser Leu Lys Arg Lys Gly 1075 1080 <210> 6 <211> 1030 <212> PRT <213> Helicobacter ganmani <400> 6 Met Lys Ile Leu Gly Phe Asp Ile Gly Ile Thr Ser Ile Gly Trp Ala 1 5 10 15 Tyr Val Glu Gly Glu Glu Leu Lys Asp Cys Gly Val Arg Ile Phe Thr 20 25 30 Lys Ala Glu Asn Pro Lys Asn Gly Asp Ser Leu Ala Ala Pro Arg Arg 35 40 45 Glu Ala Arg Gly Val Arg Arg Arg Leu Ala Arg Arg Lys Ala Arg Leu 50 55 60 Asn Ala Ile Lys Arg Leu Leu Cys Lys Glu Phe Gly Leu Asn Leu Ser 65 70 75 80 Asp Tyr Leu Ala Asn Asp Gly Glu Leu Pro Lys Ala Tyr Gln Thr Ser 85 90 95 Lys Glu His Lys Ser Pro Tyr Glu Leu Arg Thr Leu Ala Leu Ser Gln 100 105 110 Lys Leu Asp Ser Lys Asp Leu Ala Arg Val Ile Leu His Ile Ala Lys 115 120 125 His Arg Gly Tyr Gly Asn Lys His Ala Lys Thr Gly Ser Asp Lys Asp 130 135 140 The Gly Lys Server Will Leu Serve Ala Ile Lys Val Asn Gly Thr Ala Met Lys 145 150 155 160 Asp Lys Tyr Gln Ser Val Gly Glu Tyr Leu Tyr Lys Glu Phe Tyr Gln 165 170 175 Lys Gly Ser Glu Lys Gly Asn Asn Ile Thr Lys Glu 180 185 190 Phe Lys Asn Val Arg Asn Lys Glu Ser Tyr Glu His Cys Val Ala 195 200 205 Gln Glu Gln Val Arg Ala Glu Leu Glu Leu Ile Phe Ala Lys Gln Lys 210 215 220 Glu Phe Gly Ile Thr Phe Ser Glu Asn Phe Glu Ser Gln Ile Glu 225 230 235 240 Thr Ala Phe Tyr Gln Lys Asp Leu Lys Ser Phe Glu Asn Lys Val Gly 245 250 255 Lys Cys Val Phe Tyr Asp Glu Pro Arg Ala Pro Lys Asp Ser Leu Ser 260 265 270 Ala Ile Glu Phe Val Ala Leu Thr Arg Ile Ile Asn Thr Leu Lys Asn 275 280 285 Leu Glu Glu Lys Ser Lys Asn Leu Gly Ile Gly Glu Ala Tyr Gly Lys 290 295 300 Asp Lys Ile Gln Glu Ile Leu Lys Ile Val Leu Asp Lys Gly Glu Ile 305 310 315 320 Ser Tyr Lys Lys Leu Arg Glu Ile Leu His Leu Asp Glu Cys Ile Leu 325 330 335 Phe Ala Lys Asp Ser Lys Leu Asp Tyr Thr Lys Gly Met Gln Glu Ala 340 345 350 Glu Lys Ala Lys Leu Ile Glu Phe Lys Asn Leu Lys Ala Phe Lys Lys 355 360 365 Path Met Gly Glu Asp Phe Gly Lys Phe Ser Arg Glu Glu Leu Asp Ser 370 375 380 By Way Met Asp By Way Leu By Lys Ser Lys Glu Asn Leu Way Lys 385 390 395 400 Lys Leu Gln Asn Tyr Ser Ala Leu Ser Lys Glu Gln Val Glu Ala Leu 405 410 415 Ser Asn Leu Asn Phe Ala Lys His Ile Asp Leu Ser Phe Lys Ala Leu 420 425 430 Asp Lys Ile Leu Pro Phe Met Arg Glu Gly Leu Arg Tyr Asp Glu Ala 435 440 445 Val Lys Lys Ala Gly Leu Gln Glu His Arg Lys His Lys Gln Lys Gly 450 455 460 Glu Phe Leu Ile Pro Leu Lys Asp Tyr Glu Pro Tyr Leu Ala Asn Pro 465 470 475 480 Val Val Ala Arg Ala Leu Ser Glu Tyr Arg Lys Val Leu Asn Ala Leu 485 490 495 Leu Arg Lys Tyr Gly Asn Val His Lys Ile His Leu Glu Phe Thr Arg 500 505 510 Glu Ala Gly Lys Asn Tyr Asp Glu Arg Lys Lys Ile Glu Lys Glu Gln 515 520 525 Arg Glu His Phe Glu Ala Asn Gln Lys Ala Ile Gln Gln Cys Glu Ile 530 535 540 Leu Gly Leu Pro Ile Asn Gly Ala Asn Ile Leu Lys Met Lys Leu Trp 545 550 555 560 Ile Glu Gln Lys Glu Leu Cys Val Tyr Ser Asp Arg Lys Ile Thr Arg 565 570 575 Glu His Leu Leu Asp Ser Lys Val Leu Glu Val Asp His Ile Tyr Pro 580 585 590 Tyr Ser Arg Ser Phe Asp Asp Ser Tyr Met Asn Lys Val Leu Val Phe 595 600 605 Ala Lys Glu Asn Gln Gly Lys Gly Asn Lys Thr Pro Phe Glu Ala Phe 610 615 620 Gly Asn Asp Lys Glu Lys Trp Asp Arg Ile Leu Ser Leu Ser Ala Asn 625 630 635 640 Leu Pro Lys Gln Lys Gln Arg Arg Ile Ser Asn Lys Asp Phe Lys Asp 645 650 655 Lys Glu Leu Gly Phe Ile Ala Arg Asn Ile Asn Asp Thr Gly Tyr Ile 660 665 670 Ala Arg Leu Ala Ser Gln Trp Thr Asn His Cys Leu Lys Phe Glu Asn 675 680 685 Leu Ser Glu Asn Glu Val Ser Ile Ala Gly Glu Lys Gly Ser Lys Asn 690 695 700 His Leu Glu Val Ile Ser Gly Gln Leu Thr Ser Met Leu Arg His Tyr 705 710 715 720 Trp Gly Leu Gly Asn Lys Asp Arg Asn Asn His Leu His His Ala Val 725 730 735 Asp With Val And Leu With Tyr Thr Asn Asn With Met With Lys With Phe 740,745,750 Ala Asn Phe Arg Lys Asn Gln Glu Glu Asn Lys Lys Phe Tyr Ala 755,760,765 Lys Gln Ile Ala Glu Ser Glu Tyr Lys Ala Lys Lys Ala Phe Phe Glu 770,775,780 Pro Cys Lys Asn Phe Arg Gln Met Val Leu Asp Lys Val Asp Ser Ile 785,790,795,800 Phe Val Ser Lys Pro Pro Arg Lys Arg Ala Arg Gly Ala Leu His Lys 805 810 815 Glu Thr Phe Tyr Ser Phe Glu Lys Leu Cys Asn Asp Lys Glu Tyr Ser 820 825 830 Lys Asp Asn Lys Met Asp Tyr Gly Gly Gln Lys Gly Ile Glu Arg Ala 835 840 845 Leu Glu Leu Gly Lys Ile Arg Gln Will Gly Thr Lys Ile Will Ser Asn 850 855 860 Gly Ala Met Val Arg Val Asp Ile Phe Lys Asp Lys Lys Gly Lys Phe 865 870 875 880 Tyr Ala Val Pro Ile Tyr Thr Met Asp Phe Ala Leu Gly Ile Leu Pro 885,890,895 Asn Lys Ala Val Ala Ile Gly Lys Asp Lys Asp Gly Val Ile Lys Asp 900 905 910 Trp Ile Glu Met Asp Ser Asn Tyr Thr Phe Cys Phe Ser Leu Phe Lys 915 920 925 Asp Asp Leu Ile Leu Val Lys Lys Lys Glu Met Glu Lys Ala Glu Leu 930 935 940 Cys Tyr Phe Val Ser Phe Asp Thr Ser Thr Ala Ser Ile Gln Val Glu 945 950 955 960 Lys His Asn Asn Lys Phe Glu Gly Leu Ser Glu Asn Glu Lys Ile Leu 965 970 975 Tyr Ser Asn Ala Thr Gln Lys Glu Val Val Gly Lys Ser Ile Gly Ile 980 985 990 Gln Asn Leu Lys Thr Phe Glu Lys Tyr Gln Val Ser Pro Leu Gly Glu 995 1000 1005 Met Gln Lys Ala Glu Phe Glu Pro Cys Gln Asp Ile Ala Leu Lys Ser 1010 1015 1020 Ser Pro Lys Arg Lys Asn 1025 1030 <210> 7 <211> 1036 <212> PRT <213> Helicobacter typhlonius <400> 7 Met Arg Ile Phe Gly Phe Asp Ile Gly Ile Thr Ser Ile Gly Trp Ala 1 5 10 15 Tyr Val Glu Ser Asn Glu Leu Lys Asp Cys Gly Val Arg Ile Phe Thr 20 25 30 Lys Ala Glu Asn Pro Lys Asn Gly Lys Ser Leu Ala Leu Pro Arg Arg 35 40 45 Glu Ala Arg Gly Ala Arg Arg Arg Leu Ala Arg Arg Lys Ala Arg Leu 50 55 60 Asn Ala Ile Lys Arg Leu Leu Cys Lys Glu Phe Gly Leu Asn Val Ser 65 70 75 80 Asp Tyr Phe Ala Asn Asp Gly Glu Leu Pro Lys Ala Tyr Glu Thr Thr 85 90 95 Lys Asp Thr Lys Ser Pro Tyr Glu Leu Arg Ser Leu Ala Leu Glu Gln 100 105 110 Lys Leu Glu Pro Lys Glu Leu Ala Arg Val Ile Leu His Ile Ala Lys 115 120 125 His Arg Gly Tyr Gly Asn Lys His Ala Lys Thr Gly Ser Asp Lys Asp 130 135 140 Ser Gly Lys Val Leu Ser Ala Ile Lys Val Asn Glu Thr Ala Met Lys 145 150 155 160 Asp Lys Tyr Gln Ser Val Gly Glu Tyr Leu Tyr Lys Glu Phe Tyr Gln 165 170 175 Lys Leu Arg Leu Glu Ser Glu Lys Lys Gly Asn Asn Ile Thr Lys Glu 180 185 190 Phe Lys Asn Val Arg Asn Lys Gly Glu Asn Tyr Glu His Cys Val Ala 195 200 205 Gln Glu Gln Val Arg Ala Glu Leu Glu Leu Ile Phe Ala Lys Gln Lys 210 215 220 Asp Phe Gly Ala Thr Phe Ser Glu Asn Phe Glu Ser Gln Ile Ile Glu 225 230 235 240 Thr Ala Phe Tyr Gln Arg Asp Leu Lys Ser Phe Glu Asp Lys Val Gly 245 250 255 Lys Cys Val Phe Tyr Glu Asn Glu Asn Arg Ala Pro Lys Asp Ser Leu 260 265 270 Ser Ala Met Glu Phe Val Ala Leu Thr Arg Ile Ile Asn Thr Leu Lys 275 280 285 Asn Leu Glu Glu Lys Ser Lys Asn Leu Gly Ile Gly Glu Val Tyr Gly 290 295 300 Lys Asp Lys Ile Gln Glu Ile Leu Lys Ile Val Leu Asp Lys Gly Glu 305 310 315 320 Met Ser Tyr Lys Lys Leu Arg Glue Ile Leu His Leu Asp Glu His Ile 325 330 335 Leu Phe Ala Lys Asp Ser Lys Leu Asp Tyr Thr Gln Gly Val Gln Glu 340 345 350 Glu Lys Ala Lys Phe Ile Glu Leu Lys Asn Leu Lys Ala Phe Lys 355 360 365 Lys Ala Met Gly Gly Asp Phe Ser Asn Phe Ala Arg Glu Glu Leu Asp 370 375 380 Lys Ile Ala Thr Asp Ile Thr Leu Val Lys Served Lys Glu Asn Leu Ala 385 390 395 400 Lys Gln Asn Tyr Ser Ala Leu Ser Glu Gln Val Glu Ala 405 410 415 Leu Ser Asn Leu Ser Phe Ala Lys His Ile Asp Leu Ser Leu Lys Ala 420 425 430 Leu Glu Gln Ile Leu Pro Phe Met Arg Gly Asp Lys Thr Gly Lys Cys 435 440 445 Leu Arg Tyr Asp Glu Ala Val Lys Ala Glu Leu Gln Glu His Arg 450 455 460 Lys His Lys Gln Lys Gly Glu Phe Leu Ile Pro Leu Lys Asp Tyr Glu 465 470 475 480 Pro Tyr Leu Ala Asn Pro Val Val Ala Arg Ala Leu Ser Glu Tyr Arg 485 490 495 Lys Val Leu Asn Ala Leu Leu Arg Lys Tyr Gly Lys Val His Lys Ile 500 505 510 His Leu Glu Phe Thr Arg Glu Ala Lys Leu Ser Ala Lys Glu Arg Gln 515 520 525 Lys Tyr Glu Lys Glu Gln Lys Glu His Phe Glu Ala Asn Gln Arg Ala 530 535 540 Ile Gln Gln Cys Glu Ile Leu Gly Leu Pro Ile Asn Gly Thr Asn Ile 545 550 555 560 Leu Lys Met Lys Leu Trp Leu Glu Gln Gly Glu Cys Cys Ala Tyr Ser 565 570 575 Gly Glu Lys Ile Thr Arg Glu His Leu Leu Asp Ser Asn Ala Leu Gln 580 585 590 Val Asp His Ile Tyr Pro Tyr Ser Arg Ser Phe Asp Asp Ser Tyr Met 595 600 605 Asn Lys Val Leu Val Phe Ala Lys Glu Asn Gln Asp Lys Gly Asn Lys 610 615 620 Thr Pro Phe Glu Ala Phe Gly Gly Asp Lys Glu Lys Trp Asp Arg Ile 625 630 635 640 Leu Ser Leu Ser Ala Lys Leu Pro Lys Gln Lys Gln Arg Arg Ile Ser 645 650 655 Asn Thr Asn Phe Lys Asp Lys Glu Gly Gly Phe Leu Ala Arg Asn Leu 660 665 670 Asn Asp Thr Gly Tyr Ile Ala Lys Leu Ala Ser Gln Trp Thr Lys Asp 675 680 685 Cys Leu Glu Phe Glu Asp Leu Arg Glu Asn Glu Val Thr Ile Ala Gly 690 695 700 Glu Lys Gly Ser Ser Val His Ile Glu Val Val Ser Gly Gln Leu Thr 705 710 715 720 Ser Met Leu Arg His Tyr Trp Gly Leu Gly Asn Lys Asp Arg Asn Asn 725 730 735 His Leu His His Ala Val Asp Ala Val Ile Leu Ala Tyr Thr Asn Asn 740 745 750 Ala Met Ile Lys Ala Phe Ala Asn Phe Arg Lys Asn Gln Glu Glu Asn 755 760 765 Lys Lys Lys Phe Tyr Ala Lys Gln Ile Ala Glu Ser Glu Tyr Lys Ala 770 775 780 Lys Lys Ala Phe Phe Glu Pro Cys Lys Asn Phe Arg Gln Arg Val Glu 785,790,795,800 Glu Lys Ile Lys Glu Ile Phe Val Ser Lys Pro Arg Lys Arg Val 805 810 815 Arg Gly Ala Leu His Gln Glu Thr Phe Tyr Pro Phe Glu Lys Leu Cys 820 825 830 Asn Asp Lys Glu Tyr Ser Glu Leu Lys Met Asp Tyr Gly Gly Glu 835 840 845 Lys Gly Met Gln Lys Ala Ile Ala Leu Gly Lys Ile Arg Gln Ile Gly 850 855 860 Thr Lys Ile Val Ser Asn Gly Ala Met Val Arg Val Asp Ile Phe Lys 865 870 875 880 Asp Lys Lys Gly Lys Phe Tyr Ala Val Pro Ile Tyr Thr Met Asp Phe 885,890,895 Ala Leu Gly Ile Leu Pro Asn Lys Ala Val Ala Ile Gly Lys Asp Lys 900 905 910 Asp Gly Val Contains Asp Trp Contains Glu Met Asp Ser Asn Tyr Asp Phe 915,920,925 How To Perform Lys Asp Asp And Leu Val Gln Lys Glu 930,935,940 Met Glu Arg Ala Glu Leu Cys Tyr Phe Val Ser Phe Gly Ser Thr Asn 945 950 955 960 Ala Gln Ile Asn Val Glu Lys His Asn Asn Lys Phe Glu Gly Leu Ser 965 970 975 Glu Asn Glu Lys Ile Leu Tyr Ser Asn Ala Thr Gln Lys Glu Val Ala 980 985 990 Gly Lys Ser Ile Gly Ile Gln Asn Leu Lys Thr Phe Glu Lys Tyr Gln 995 1000 1005 Val Ser Pro Leu Gly Glu Val Gln Lys Ala Glu Phe Glu Pro His Gln 1010 1015 1020 Glu Ile Lys Leu Lys Ser Ser Pro Lys Arg Lys Asp 1025 1030 1035 <210> 8 <211> 1057 <212> PRT <213> Helicobacter sp. MIT 11-5569 <400> 8 Met Ser Asp Lys Ser Lys Ile Leu Gly Phe Asp Ile Gly Ile Thr Ser 1 5 10 15 Ile Gly Trp Ala Tyr Val Glu Gly Glu Glu Leu Ile Asp Cys Gly Val 20 25 30 Arg Ile Phe Thr Lys Ala Glu Asn Pro Lys Thr Lys Glu Ser Leu Ala 35 40 45 Leu Pro Arg Arg Glu Ala Arg Gly Val Arg Arg Arg Leu Ala Arg Arg 50 55 60 Lys Gly Arg Leu Asn Ala Ile Lys Gln Leu Ile Cys Lys Glu Phe Gly 65 70 75 80 Leu Asn Tyr Gln Asp Tyr Ile Ala Gln Asp Gly Glu Leu Pro Lys Ala 85 90 95 Tyr Ala Gly Lys Leu Ile Asn Pro Tyr Glu Leu Arg Ser Lys Ala Leu 100 105 110 Arg Glu Lys Leu Glu Lys Glu Glu Leu Ala Arg Val Ile Leu His Ile 115 120 125 Ala Lys His Arg Gly Tyr Gly Asn Lys His Ala Lys Glu Thr Asp Asp 130 135 140 Ala Glu Ser Gly Lys Ile Lys Lys Ala Ile Ser Asn Asn Glu Lys Ile 145 150 155 160 Leu Asn Glu Lys Gly Tyr Gln Ser Ala Gly Glu Tyr Leu Tyr Gln Glu 165 170 175 Phe Phe Gln Lys Glu Arg Leu Gln Glu Glu Lys Lys Gly Asn Asn Thr 180 185 190 Thr Lys Glu Phe Lys Asn Val Arg Asn Lys Ala Gly Asp Tyr Glu His 195 200 205 Cys Ile Ala Gln Thr Gln Met Gln Asn Glu Leu Arg Leu Ile Phe Glu 210 215 220 Lys Gln Arg Glu Phe Gly Leu Asn Phe Ser Glu Glu Phe Lys Lys Lys 225 230 235 240 Val Leu Glu Thr Ala Phe Phe Gln Arg Pro Leu Lys Asp Phe Ser Asp 245 250 255 Lys Ile Gly Asp Cys Thr Phe Ile Glu Gly Ala Lys Arg Ala Pro Lys 260 265 270 Asp Ser Leu Ser Ala Ile Glu Phe Val Ala Leu Gly Arg Ile Ile Asn 275 280 285 Thr Leu Lys Asn Leu Gln Asn Thr Ser Gly Glu Val Tyr Ser Arg Asp 290 295 300 Lys Ile Asn Glu Ile Leu Gln Ile Val Leu Asp Lys Gly Glu Ile Ser 305 310 315 320 Tyr Lys Lys Leu Arg Glu Ile Leu Asp Ile Glu Ser Ser Val Arg Phe 325 330 335 Lys Asp Ser Lys Leu Asp Tyr Thr Lys Glu Leu Lys Glu Ala Glu Lys 340 345 350 Thr Lys Leu Phe Glu Ser Lys Asn Leu Gln Lys Phe Lys Lys Ala Leu 355 360 365 Gly Ser Phe Glu Gly Ile Ser Arg Glu Ile Leu Asp Ser Ile Ala Lys 370 375 380 Glu Ile Met Ile Thr Lys Asp Lys Glu Lys Leu Ala Lys Glu Leu Lys 385 390 395 400 Lys Phe Pro Leu Asp Glu Thr Gln Ile Gln Asn Leu Ser Asn Leu Ser 405 410 415 Phe Ser Gln Thr Ile Asn Leu Ser Leu Glu Ala Leu Ser Gln Ile Leu 420 425 430 Pro Phe Met Arg Gly Glu Arg Glu Asp Lys Cys Leu Arg Tyr Asp Glu 435 440 445 Ala Val Glu Lys Ala Gly Leu Lys Glu Val Ala Lys Asn Lys Ser Lys 450 455 460 Asp Asp Phe Leu Pro Pro Leu Glu Asn Tyr Glu Pro Tyr Leu Ala Asn 465 470 475 480 Pro Val Val Ala Arg Ala Leu Ser Glu Tyr Arg Lys Val Leu Asn Ala 485 490 495 Leu Leu Arg Lys Tyr Gly Lys Met His Lys Ile His Ile Glu Phe Thr 500 505 510 Arg Glu Val Gly Lys Ser Lys Glu Glu Arg Asn Lys Ile Glu Lys Glu 515 520 525 Gln Lys Glu Asn Phe Ala Lys Asn Gln Glu Ala Gln Lys Gln Cys Glu 530 535 540 Ile Leu Gly Leu Pro Ile Asn Gly Ala Asn Ile Leu Lys Met Lys Leu 545 550 555 560 Trp Arg Glu Gln Gln Glu Ser Cys Val Tyr Ser Gly Lys Glu Ile Ala 565 570 575 Ile Asp Asp Leu Lys Asn Pro Ala Ile Leu Gln Val Asp His Ile Tyr 580 585 590 Pro Tyr Ser Arg Ser Phe Asp Asp Ser Tyr Asn Asn Lys Val Leu Val 595 600 605 Phe Ser Lys Glu Asn Gln Asn Lys Leu Asn Lys Thr Pro Phe Glu Ala 610 615 620 Phe Gly Glu Asn Lys Asp Lys Trp Glu Lys Ile Leu Ser Leu Ala Ser 625 630 635 640 Lys Leu Pro Lys Pro Lys Arg Gln Arg Ile Tyr Asn Met Gln Phe Lys 645 650 655 Asp Lys Glu Gln Gly Phe Leu Thr Arg Asn Ile Asn Asp Thr Gly Tyr 660,665,670 Arg-only cells can be Gln but Thr Lys Asn Cys can be Phe Glu 675,680,685 Lys Leu Ser Glu Asp Glu Val Ser Ile Ala Gly Glu Lys Gly Ser Lys 690,695,700 Val His Val Glu Val Ile Ser Gly Ser Leu Thr Ala Met Leu Arg His 705 710 715 720 Tyr Trp Gly Leu Gly Asp Lys Asn Arg Asp Asn His Leu His Ala 725 730 735 Val Asp Only Ile Ile Only Tyr Ser Asn Glu Lys Val Isle Lys Only 740,745,750 Phe Ser Asp Tyr Lys His Arg Glu Gln Asn Ala Lys Phe Tyr 755,760,765 Ala Lys Glu Ile Ala Glu Ser Glu Tyr Lys Gln Lys Val Phe Phe 770,775,780 Glu Pro Thr Asn His Phenotype of Gln Lys Val Leu Glu Lys With Asp Ser 785,790,795,800 Ile Phe Val Ser Lys Pro Arg Lys Arg Ala Arg Gly Ala Leu His 805 810 815 Glu Glu Thr Phe Tyr Ser Phe Glu Arg Leu Cys Asn Asp Lys Glu Tyr 820 825 830 Ala Lys Lys Glu Lys Met Asp Tyr Gly Gly Lys Ala Gly Ile Gln Lys 835 840 845 Ala Ile Ala Leu Gly Lys Ile Arg Gln Val Gly Thr Lys Ile Val Ser 850 855 860 Asn Gly Thr Met Val Arg Val Asp Ile Phe Gln His Lys Ser Asn Gly 865 870 875 880 Lys Phe Tyr Gly Val Pro Ile Tyr Thr Met Asp Phe Ala Leu Gly Val 885 890 895 Leu Pro Asn Lys Ala Val Val Ser Gly Lys Asp Lys Gln Gly Val Ile 900 905 910 Lys Asp Trp Leu Glu Met Asp Ser Asn Tyr Glu Phe Cys Phe Ser Leu 915 920 925 Phe Lys Asp Asp Leu Ile Leu Val Gln Lys Lys Glu Met Glu Lys Ala 930 935 940 Glu Leu Cys Tyr Tyr Thr Asp Phe Asn Ser Asn Thr Ala Gly Ile Lys 945 950 955 960 Phe Glu Lys His Asn Asn Leu Tyr Val Asn Leu Asn Glu Asn Glu Arg 965 970 975 Lys Leu Phe Thr Ser Lys Glu Val Val Lys Gly Gly Lys Lys Asn Val 980 985 990 Trp Lys Asp Lys Thr Pro Lys Glu Ile Glu Gln Leu Glu Lys Asn Arg 995 1000 1005 Lys Ile Ile Gly Gly Phe Val Thr Ile Glu Asp Leu Lys Thr Phe Glu 1010 1015 1020 Lys Tyr Gln Val Ser Pro Leu Gly Glu Val Gln Lys Ala Asp Phe Ala 1025 1030 1035 1040 Pro Arg Gln Ala Ile Thr Leu Lys Ser Ser Pro Lys His Arg Ile Asn 1045 1050 1055 Lys <210> 9 <211> 1039 <212> PRT <213> Helicobacter sp. MIT 03-1614 <400> 9 Met Lys Ile Leu Ser Phe Asp Ile Gly Ile Thr Ser Ile Gly Trp Ala 1 5 10 15 Phe Val Glu Gly Glu Glu Leu Lys Asp Cys Gly Val Arg Ile Phe Thr 20 25 30 Lys Ala Glu Asn Pro Lys Asn Gly Asp Ser Leu Ala Ala Pro Arg Arg 35 40 45 Glu Ala Arg Gly Val Arg Arg Arg Leu Ala Arg Arg Lys Ala Arg Leu 50 55 60 Asn Val Ile Lys Arg Leu Cys Glu Phe Gly Leu Asn Leu Ser 65 70 75 80 Asp Tyr Phe Ala Asn Asp Gly Glu Leu Pro Lys Ala Tyr Glu Thr Thr 85 90 95 Lys Asp Thr Lys Pro Tyr Glu Serving Leu Arg Thr Leu Ala Leu Serving Gln 100 105 110 Lys Leu Asp Ser Lys Asp Leu Ala Arg Val Ile Leu His Ile Ala Lys 115 120 125 His Arg Gly Tyr Gly Asn Lys His Ala Lys Thr Gly Ser Asp Lys Asp 130 135 140 The Gly Lys Server Will Leu Serve Ala Ile Lys Val Asn Gly Thr Ala Met Lys 145 150 155 160 Asp Lys Tyr Gln Ser Val Gly Glu Tyr Leu Tyr Lys Glu Phe Tyr Gln 165 170 175 Lys Glu Arg Leu Glu Ser Glu Lys Ser Asn Asn Thr Thr Lys Glu 180 185 190 Phe Lys Asn Val Arg Asn Lys Gly Glu Asn Tyr Glu His Cys Val Ala 195 200 205 Gln Glu Gln Val Arg Ala Glu Leu Glu Leu With Phe Thr Lys Gln Lys 210 215 220 Glu Phe Gly Phe Pro Phe Ser Ala Lys Thr Tyr Lys Ile Ser Tyr Glu 225 230 235 240 Asn Gly Glu Ala Lys Glu Leu Asp Phe Thr Ser Ala Ile Ile Glu Thr 245 250 255 Only Phe Tyr Gln Arg Asp Leu Lys Served as Phe Glu Asp Lys Val Gly Lys 260 265 270 Cys Val Phe Tyr Glu Asn Glu Asn Arg Ala Pro Lys Asp Ser Leu Ser 275 280 285 Only Glu Phe Val Only With Thr Arg And Ile With Asn Thr With Lys Asn 290,295,300 Leu Glu Glu Lys Ser Lys Asn Leu Gly Ile Gly Glu Thr Tyr Gly Lys 305 310 315 320 Asp Lys Ile Gln Glu Ile Leu Lys Asn Val Phe Asp Lys Gly Glu Met 325 330 335 Leu Glu Ser Tyr Lys Arg Lys Ile Leu Lys Leu Asn Glu Leu Ser 340 345 350 Phe Ala Lys Asp Ser Lys Leu Asp Tyr Thr Lys Gly Met Gln Glu Ala 355 360 365 Glu Lys Ala Lys Phe Ile Glu Leu Lys Asn Leu Lys Ala Phe Lys Lys 370 375 380 Ala Met Gly Gly Asp Phe Ser Lys Phe Pro Arg Glu Glu Leu Asp Lys 385 390 395 400 Thr Asp Ile Leu Ile Ile Lys Ser Glu Asn Leu Ala Lys 405 410 415 Leu Gln Asn Tyr Ser Ala Leu Ser Glu Gln Val Glu Ala Leu 420 425 430 Ser Asn Leu Ser Phe Ala Lys Ala Leu 435 440 445 His Lys Ile Leu Pro Leu Met Cys Glu Gly Leu Cys Tyr Asp Glu Ala 450 455 460 Val Lys Ala Gly Leu Gln Glu His Arg Lys Lys Gln Lys Gly 465 470 475 480 Glu Phe Leu Ile Pro Leu Lys Asp Tyr Glu Pro Tyr Leu Ala Asn Pro 485,490,495 Ile Val Ala Arg Ala Leu Ser Glu Tyr Arg Lys Val Leu Asn Thr Leu 500 505 510 Leu Arg Lys Tyr Gly Lys Val His Lys Ile His Leu Glu Phe Thr Arg 515 520 525 Glu Ala Lys Leu Ser Ala Lys Glu Arg Gln Lys Tyr Glu Lys Glu Gln 530 535 540 Lys Glu His Phe Glu Val Asn Gln Lys Ala Ile Gln Gln Cys Glu Ile 545 550 555 560 Leu Glu Leu Pro Ile Asn Gly Thr Asn Ile Leu Lys Met Lys Leu Trp 565 570 575 Leu Glu Gln Gly Glu Cys Cys Ile Tyr Ser Gly Gln Lys Ile Thr Arg 580 585 590 Glu His Leu Leu Ala Ser Asn Ala Leu Gln Ile Asp His Ile Tyr Pro 595 600 605 Tyr Ser Arg Ser Phe Asp Asp Ser Tyr Met Asn Lys Val Leu Val Phe 610 615 620 Asn Lys Glu Asn Gln Asn Lys Leu Asp Lys Thr Pro Phe Glu Ala Phe 625 630 635 640 Gly Ser Asp Lys Glu Lys Trp Asp Arg Ile Leu Ser Phe Ser Ala Asn 645 650 655 Leu Pro Lys Gln Lys Gln Arg Arg Ile Ser Asn Lys Asp Phe Lys Asp 660 665 670 Lys Glu Arg Gly Phe Ile Ala Arg Asn Leu Asn Asp Thr Gly Tyr Ile 675 680 685 Ala Arg Leu Ala Ser Gln Trp Ser Lys Asp Cys Leu Glu Phe Leu Pro 690 695 700 Leu Ser Glu Asn Glu Cys Thr Ile Ser Gly Glu Lys Asn Ser Lys Val 705 710 715 720 His Ile Glu Val Val Ser Gly Gln Leu Thr Ala Thr Leu Arg His Tyr 725 730 735 Trp Gly Leu Gly Asp Lys Asp Arg Asn Asn His Leu His His Ala Val 740 745 750 Asp Ala Ile Ile Leu Ala Tyr Thr Asn Ala Lys Thr Lys Asn Val Phe 755 760 765 Ala Asn Phe Lys Lys Thr Gln Glu Gln Asn Lys Ala Lys Phe Tyr Ala 770 775 780 Lys Gln Ile Ser Glu Gln Glu Tyr Lys Lys Gln Lys Ala Phe Phe Glu 785 790 795 800 Pro Cys Ala Asn Phe Arg Gln Arg Val Glu Glu Lys Ile Asn Glu Ile 805 810 815 Phe Val Ser Lys Pro Pro Arg Lys Arg Ala Arg Gly Ala Leu His Glu 820 825 830 Glu Thr Phe Tyr Ser Phe Glu Asp Glu Lys Leu Leu Lys Ser Tyr Gly 835 840 845 Gly Lys Gln Gly Ile Glu Lys Ala Ile Ser Leu Gly Lys Ile Arg Gln 850 855 860 Val Gly Thr Lys Ile Val Ser Asn Gly Ala Met Val Arg Val Asp Ile 865 870 875 880 Phe Lys Asp Lys Lys Gly Lys Phe Tyr Ala Val Pro Ile Tyr Thr Met 885 890 895 Asp Phe Ala Leu Gly Ile Leu Pro Asn Lys Ala Val Val Gln Gly Lys 900 905 910 Ser Lys Glu Asp Gly Val Ile Lys Asp Trp Ile Glu Met Asp Ser Asn 915 920 925 Tyr Thr Phe Cys Phe Ser Leu Phe Lys Asp Asp Leu Ile Leu Val Gln 930 935 940 Lys Lys Glu Met Glu Lys Ala Glu Leu Cys Tyr Phe Val Gly Phe Gly 945 950 955 960 Val Ser Thr Ala Ser Ile Gln Val Glu Lys His Asn Asn Lys Phe Glu 965 970 975 Gly Leu Ser Glu Asn Glu Lys Ile Leu Tyr Ser Asn Ala Thr Gln Lys 980 985 990 Glu Val Val Gly Lys Ser Ile Gly Ile Gln Asn Leu Lys Thr Phe Glu 995 1000 1005 Lys His Gln Val Ser Pro Leu Gly Lys Val Gln Lys Val Glu Phe Glu 1010 1015 1020 Ser Arg Gln Glu Ile Lys Leu Lys Ser Ser Ser Lys Arg Lys Gly 1025 1030 1035 <210> 10 <211> 1067 <212> PRT <213> Helicobacter sp. MIT 14-3879 <400> 10 Met Lys Ile Leu Gly Phe Asp Ile Gly Ile Ala Ser Val Gly Trp Ala 1 5 10 15 Tyr Val Glu Glu Asn Glu Leu Arg Asp Cys Gly Val Arg Ile Phe Thr 20 25 30 Lys Ala Glu Asn Ser Thr Gly Glu Ser Leu Ala Leu Pro Arg Arg Glu 35 40 45 Ala Arg Gly Thr Arg Arg Arg Leu Lys Arg Arg Lys Gln Arg Leu Asn 50 55 60 Glu Leu Lys Arg Leu Leu Cys Lys Gln Phe Asn Phe Asn Leu Asn Asp 65 70 75 80 Tyr Cys Ser Asn Asp Gly Glu Leu Ala Lys Ala Tyr Gln Thr Thr Lys 85 90 95 Asp Thr Lys Ser Pro Tyr Glu Leu Arg Ala Leu Ala Leu Glu Gln Lys 100 105 110 Leu Asp Ser Lys Asp Leu Val Arg Val Ile Leu His Ile Ala Lys His 115 120 125 Arg Gly Tyr Gly Asn Lys His Ala Lys Arg Asp Leu Glu Ala Glu Glu 130 135 140 Lys Ile Lys Ala Lys Ile Glu Lys Glu Asp Gln Glu Ile Thr Gln Lys 145 150 155 160 Ala Thr Gln Glu Lys Gln Ser Thr Thr Thr Lys Gly Asp Ser Lys Lys 165 170 175 Glu Gln Glu Gln Val Leu Lys Ala Leu Tyr Arg Asn Glu Thr Ala Leu 180 185 190 Lys His Tyr Gln Thr Val Gly Gln Tyr Phe Tyr Lys Glu Phe Lys Glu 195 200 205 Lys Gly Gln Arg Ile Arg Asn Thr Thr Asn Asn Tyr Gln His Thr Met 210 215 220 Arg Gln Asp Trp Leu Lys Lys Glu Leu Glu Leu Ile Phe Glu Lys Gln 225 230 235 240 Lys Glu Phe Gly Ala Lys Phe Ser Glu Gly Phe Glu Asn Lys Ile Ile 245 250 255 Glu Ile Ala Phe Phe Gln Arg Asp Leu Lys Ser Phe Glu Asp Lys Val 260 265 270 Gly Gln Cys Thr Phe Tyr Pro Asn Glu Pro Arg Ala Pro Lys Asp Ser 275 280 285 Leu Ser Ala Ile Glu Phe Val Thr Leu Thr Arg Ile Ile Asn Thr Leu 290 295 300 Lys Asn Leu Glu Glu Lys Ser Lys Asn Leu Gly Ile Gly Glu Val Tyr 305 310 315 320 Gly Lys Asp Lys Ile Lys Glu Ile Leu Asn Ile Val Leu Asp Lys Gly 325 330 335 Glu Ile Ser Tyr Lys Lys Leu Arg Glu Ile Leu Gly Leu Asn Glu Gln 340 345 350 Ile Thr Phe Lys Asp Asn Lys Leu Asp Tyr Ala Lys Asp Met Lys Glu 355 360 365 Glu Gln Lys Val Lys Leu Ile Glu Phe Lys Asn Leu Lys Asp Phe Lys 370 375 380 Lys Ala Ile Gly Gly Ser Phe Gln Ala Phe Gly Ser Phe Glu Thr Phe 385 390 395 400 Asp Arg Lys Glu Leu Asp Leu Ile Ala Thr Asp Ile Ala Val Ile Lys 405 410 415 Ser Arg Glu Asn Leu Ala Lys Lys Leu Glu Asn Tyr Pro Ser Leu Thr 420 425 430 Gln Glu Gln Arg Glu Ser Leu Ser Glu Leu Asn Phe Ser Lys His Ile 435 440 445 Asn Leu Ser Leu Arg Ala Leu Glu Lys Ile Leu Pro Phe Met Arg Glu 450 455 460 Gly Leu Arg Tyr Asn Glu Ala Val Glu Lys Ala Gly Leu Gln Glu His 465 470 475 480 Arg Lys His Lys Gln Lys Ser Asp Phe Leu Pro Pro Leu Gln Asp Tyr 485 490 495 Glu Pro Tyr Leu Ala Asn Pro Val Val Glu Arg Ala Leu Ser Glu Tyr 500 505 510 Arg Lys Val Leu Asn Ala Leu Leu Arg Lys Tyr Gly Gln Val His Lys 515 520 525 Ile His Leu Glu Phe Thr Arg Glu Ala Lys Leu Ser Ser Lys Glu Arg 530 535 540 Gln Lys Tyr Glu Lys Glu Gln Arg Glu Asn Phe Ala Arg Asn Gln Glu 545 550 555 560 Ala Glu Lys Gln Cys Glu Ala Ile Gly Leu Pro Leu Asn Asp Ala Lys 565 570 575 Asn Ile Leu Lys Met Lys Leu Trp Ile Glu Gln Arg Gln Leu Cys Ala 580 585 590 Tyr Ser Gly Glu Lys Ile Thr Ile Glu His Leu Lys Asp Ser Thr Met 595 600 605 Leu Glu Ile Asp His Ile Tyr Pro Tyr Ser Arg Ser Tyr Asp Asp Ser 610 615 620 Tyr Asn Asn Lys Val Leu Cys Leu Ala Arg Glu Asn Gln Asn Lys Gly 625 630 635 640 Asn His Thr Pro Phe Glu Ala Phe Gly Lys Asp Thr Glu Lys Trp Asp 645 650 655 Arg Ile Leu Ser Leu Ala Ser Lys Leu Pro Lys Pro Lys Tyr Arg Arg 660 665 670 Ile Ser Asn Lys Gln Phe Lys Asp Lys Glu Ala Gly Phe Leu Ala Arg 675 680 685 Asn Ile Val Asp Thr Ser Tyr Ile Ala Arg Leu Ala Ser Glu Tyr Thr 690 695 700 Lys His Ser Leu Asn Phe Leu Pro Leu Ser Glu Asp Glu Val Met Ile 705 710 715 720 Thr Gly Glu Lys Asp Ser Lys Lys His Val Glu Val Val Ser Gly Ser 725 730 735 Leu Thr Ala Thr Leu Arg His Tyr Trp Gly Leu Gly Gly Lys Asn Gly 740 745 750 Asp Lys Asp Arg Asp Asn His Leu His His Val Val Asp Ala Ile Ile 755 760 765 Ile Ala Tyr Thr Asn Ala Lys Val Ile Lys Ala Phe Ser Asp Phe Arg 770 775 780 Lys Leu Gln Glu Gln Asn Arg Ala Lys Phe Tyr Ala Lys Glu Ile Ala 785 790 795 800 Gln Ser Lys Asp Lys Thr Lys Lys Gly Phe Glu Pro Pro Cys Glu Asn 805 810 815 Phe Arg Asn Lys Ile Gln Glu Lys Val Asp Ser Ile Phe Val Ser Lys 820 825 830 Pro Pro Arg Lys Arg Ala Arg Gly Ala Leu His Glu Glu Thr Phe Tyr 835 840 845 Ser Leu Asn Asp Ala Ser Leu Leu Lys Ser Tyr Gly Gly Gln Glu Gly 850 855 860 Val Gln Arg Ala Leu Glu Leu Gly Lys Ile Arg Arg Ile Gly Thr Lys 865 870 875 880 Val Val Ser Asn Gly Glu Met Lys Arg Val Asp Ile Phe Lys Asp Lys 885 890 895 Lys Gly Lys Phe Tyr Gly Val Pro Ile Tyr Thr Met Asp Phe Ala Leu 900 905 910 Gly Ile Leu Pro Asn Lys Ala Val Ile Ser Gly Lys Lys Asp Gly Val 915 920 925 Ile Lys Asp Trp Leu Glu Met Asp Ser Asn Tyr Glu Phe Cys Phe Ser 930 935 940 Leu Phe Lys Asp Asp Leu Ile Leu Val Gln Lys Ser Glu Met Glu Glu 945 950 955 960 Pro Glu Leu Cys Tyr Tyr Val Gly Phe Asp Ser Cys Ser Pro Arg Ile 965 970 975 Ile Val Asp Lys His Asn Lys Cys Tyr Lys Asn Met Ser Asp Asn Glu 980 985 990 Lys Lys Leu Phe Thr Leu Lys Glu Arg Glu Arg Asn Asn Lys Lys Glu 995 1000 1005 Glu Gln Lys Gln Asp Asp Glu Asn Lys Glu Gln Lys Ile Ile Gly Gly 1010 1015 1020 Arg Leu Gly Ile Gln Asn Leu Lys Thr Phe Lys Lys Tyr Gln Val Ser 1025 1030 1035 1040 Pro Leu Gly Glu Val Lys Glu Val Gly Lys Glu Thr Arg Gln Ala Ile 1045 1050 1055 Ala Leu Lys Ser Thr Lys His Ile Lys Gln Asp 1060 1065 <210> 11 <211> 1024 <212> PRT <213> Helicobacter 10-6591 (Helicobacter sp. 10-6591) <400> 11 Met Lys Ile Ile Gly Phe Asp Ile Gly Ile Ala Ser Ile Gly Trp Ala 1 5 10 15 Tyr Met Glu Asp Asn Glu Leu Lys Asp Cys Gly Val Arg Ile Phe Thr 20 25 30 Lys Ala Glu Asn Pro Lys Thr Lys Ala Ser Leu Ala Leu Pro Arg Arg 35 40 45 Lys Ala Arg Ser Ala Arg Arg Arg Leu Ala Arg Arg Arg Gly Arg Leu 50 55 60 Tyr Ala Leu Lys Gln Leu Ile Cys Lys Glu Phe Gly Phe Tyr Leu Gly 65 70 75 80 Asp Tyr Val Ser Asp Asp Gly Asp Leu Pro Lys Ala Tyr Ile His Thr 85 90 95 Lys Asp Thr Lys Ser Pro Tyr Glu Leu Arg Thr Leu Ala Leu Thr Gln 100 105 110 Lys Leu Glu His Lys Asp Leu Ala Arg Ala Ile Leu His Ile Ala Lys 115 120 125 His Arg Gly Tyr Gly Asn Lys His Ala Arg Glu Ala Glu Asp Thr Glu 130 135 140 Glu Gln Asn Glu Thr Gly Lys Ile Lys Ala Ala Ile Lys Glu Asn Glu 145 150 155 160 Lys Ile Leu Gln Glu Lys Gly Tyr Lys Thr Ile Gly Glu Tyr Leu Tyr 165 170 175 Lys Thr Phe Tyr Gln Gln Glu Arg Ser Asp Ser Glu Lys Lys Gly Asn 180 185 190 Lys Asn Ser Lys Glu Phe Gln Asn Val Arg Asn Lys Ala Gly Asn Tyr 195 200 205 Glu His Cys Met Ala Gln Asp Lys Leu Lys Ala Glu Leu Glu Leu Ile 210 215 220 Leu Gln Val Gln Asn Lys Leu Gly Ala Asn Leu Lys Asp Ser Phe Cys 225 230 235 240 Gln Lys Val Ile Asp Ile Ala Phe Tyr Gln Arg Glu Leu Lys Asp Phe 245 250 255 Ser Asp Lys Val Gly Lys Cys Ile Tyr Asp Glu Asn Ser Pro Arg Ala 260 265 270 Lys Asp Ser Leu Ser Ala Met Glu Phe Ile Ala Leu Thr Arg Ile 275 280 285 Leu Asn Only Leu Gln Ser Ile Ser Gln Ser Gly Glu Val Tyr Gly 290,295,300 Lys Asp Met Ile Ala Gln Ile Served His Ile Val Leu Glu Lys Gly Glu 305 310 315 320 Ile Asn Tyr Lys Ala Mine Arg Glu Ile Mine Arg Mine Pro Glu Ser Ile 325 330 335 Arg Phe Pro Lys Asp Ser Lys Leu Asp Tyr Thr Lys Glu Gln Lys Val 340 345 350 Ala Glu Lys Ala Ala Phe Ile Glu Phe Lys Asn Leu Lys Ala Phe Lys 355 360 365 Lys Ala Leu Gly Gly Ser Phe Ala Gly Leu Ser Arg Lys Glu Leu Asp 370 375 380 Ala Ile Ala Thr His Ile Thr Leu Thr Lys Asp Lys Ile His Phe Gln 385 390 395 400 Gln Lys Leu Glu Ser Tyr Ala Leu Asp Asp Asn Gln Lys Glu Ala Leu 405 410 415 Ser Lys Leu Ser Phe Ser His His Ile His Leu Gly Phe Glu Ala Leu 420 425 430 Asn Gln Ile Leu Pro Phe Met Arg Glu Gly Leu Arg Tyr Asp Glu Ala 435 440 445 Val Gln Gln Ala Gly Leu Lys Glu Trp Arg Lys Ile Thr Gln Lys Glu 450 455 460 Asn Leu Leu Ser Pro Leu His Lys Tyr Glu Pro Tyr Leu Ala Asn Pro 465 470 475 480 Val Val Ala Arg Ala Met Ser Glu Tyr Arg Lys Val Leu Asn Ser Leu 485 490 495 Leu Lys Thr Tyr Gly Gln Val His Lys Ile His Ile Glu Phe Thr Arg 500 505 510 Glu Val Gly Arg Asn Ala Lys Asp Arg Ser Lys Ile Glu Lys Glu Gln 515 520 525 Arg Asp Lys Leu Ala Lys Asn Glu Ala Ala Lys Lys Gln Cys Glu Asn 530 535 540 Leu Arg Leu Pro Leu Ser Asp Ser Asn Ile Leu Lys Met Lys Leu Trp 545 550 555 560 Ile Glu Gln Gly Glu Phe Cys Ile Tyr Ser Gly Lys Lys Ile Thr Cys 565 570 575 Asp Asp Leu Gln Asn Pro Gln Lys Leu Gln Ile Asp His Ile Tyr Pro 580 585 590 Tyr Ser Arg Ser Phe Asp Asp Ser Tyr Ala Asn Lys Val Leu Val Phe 595 600 605 Thr Lys Glu Asn Gln Asn Lys Arg Asn Lys Thr Pro Phe Glu Ala Phe 610 615 620 Gly Glu Asp Thr Lys Lys Trp Glu Lys Ile Leu Ser Arg Ala Ser Thr 625 630 635 640 Leu Pro Lys Ala Lys Tyr Arg Arg Ile Ser Asn Ile Lys Phe Glu Asp 645 650 655 Lys Glu Ala Gly Phe Ile Pro Arg Asn Ile Asn Asp Thr Ser Tyr Ile 660 665 670 Ala Arg Leu Cys Ala Asn Trp Thr Lys Asp Cys Leu Ser Phe Leu Pro 675 680 685 Leu Ser Glu Asn Glu Val Thr Ile Ser Gly Glu Lys Gly Ser Lys Val 690 695 700 His Val Glu Thr Ile Ser Gly Asn Leu Thr Ala Thr Leu Arg His Tyr 705 710 715 720 Trp Gly Leu Gly Glu Lys Asn Arg Asn Asn His Leu His His Ala Ile 725 730 735 Asp Ala Ile Ile Ile Val Phe Ser Asn Ala Lys Thr Ile Lys Ala Phe 740 745 750 Ser Asp Phe Lys Lys Gln Arg Glu Leu Asn Lys Ala Arg Phe Tyr Ala 755 760 765 Lys Glu Leu Ala Glu Ala Asp Tyr Lys Gln Gln Lys Val Phe Phe Glu 770 775 780 Pro Met Glu Asp Phe Arg Gln Lys Ile Leu Ala Lys Val Asp Ser Ile 785 790 795 800 Phe Val Ser Lys Pro Pro Arg Lys Arg Ala Arg Gly Ala Leu His Glu 805 810 815 Glu Thr Phe Tyr Ala Phe Asp Asp Lys Asp Leu Met Lys Lys Tyr Gly 820 825 830 Gly Gln Glu Gly Val Glu Lys Ala Val Ala Leu Gly Lys Ile Arg Arg 835 840 845 Ile Gly Thr Lys Ile Val Asn Asn Gly Ala Met Val Arg Val Asp Ile 850 855 860 Phe Gln His Lys Gln Ser Gly Lys Phe Tyr Gly Val Pro Ile Tyr Thr 865 870 875 880 Met Asp Phe Ala Leu Gly Ile Leu Pro Asn Lys Ala Val Ile Ala Gly 885,890,895 Lys Asp Lys Gln Gly Val Ile Lys Asp Trp Leu Glu Met Asp Ser Ser 900 905 910 Tyr Glu Phe Cys Phe Ser Leu Phe Lys Asp Asp Leu Ile Leu Leu Gln 915,920,925 Lys Lys Asp Met Glu Lys Ala Glu Leu Cys Tyr Phe Val Ser Phe Gly 930,935,940 Ile Ala Thr Ala Thr Ile Gln Val Glu Lys His Asn Asn Lys Phe Glu 945 950 955 960 Asp Contains Glu Ser Asn Glu Lys Contains Tyr Thr Asn Ala Thr Ala Lys 965,970,975 Glu Val Val Ala Lys Ser Ile Gly Ile Gln Asn Leu Lys Ile Phe Glu 980,985,990 Lys Tyr His Val Ser Pro Leu Gly Glu Val Lys Lys Ala Glu Phe Ala 995 1000 1005 Glu Arg Gln Asn Ile Wing Leu Pro Ser Ser Pro Lys Lys Wing 1010 1015 1020 <210> 12 <211> 1033 <212> PRT <213> Artificial Sequence <400> 12 Met Ser Asp Lys Ser Lys Ile Leu Gly Phe Asp Ile Gly Ile Thr Ser 1 5 10 15 To Gly Trp Ala Tyr Val Glu Gly Glu Glu Leu To Asp Cys Gly Val 20 25 30 Arg Ile Phe Thr Lys Path Glu Asn Pro Lys Thr Lys Glu Ser Leu Path 35 40 45 Leu Pro Arg Arg Glu Ala Arg Gly Val Arg Arg Arg Leu Ala Arg Arg 50 55 60 Lys Gly Arg Leu Asn Ala Ile Lys Gln Leu Ile Cys Lys Glu Phe Gly 65 70 75 80 Leu Asn Tyr Gln Asp Tyr Ile Ala Gln Asp Gly Glu Leu Pro Lys Ala 85 90 95 Tyr Ala Gly Lys Leu Ile Asn Pro Tyr Glu Leu Arg Ser Lys Ala Leu 100 105 110 Arg Glu Lys Leu Glu Lys Glu Glu Leu Ala Arg Val Ile Leu His Ile 115 120 125 Ala Lys His Arg Gly Tyr Gly Asn Lys His Ala Lys Glu Thr Asp Asp 130 135 140 Ala Glu Ser Gly Lys Ile Lys Lys Ala Ile Ser Asn Asn Glu Lys Ile 145 150 155 160 Leu Asn Glu Lys Gly Tyr Gln Ser Ala Gly Glu Tyr Leu Tyr Gln Glu 165 170 175 Phe Phe Gln Lys Glu Arg Leu Gln Glu Glu Lys Lys Gly Asn Asn Thr 180 185 190 Thr Lys Glu Phe Lys Asn Val Arg Asn Lys Ala Gly Asp Tyr Glu His 195 200 205 Cys Ile Ala Gln Thr Gln Met Gln Asn Glu Leu Arg Leu Ile Phe Glu 210 215 220 Lys Gln Arg Glu Phe Gly Leu Asn Phe Ser Glu Glu Phe Lys Lys Lys 225 230 235 240 Val Leu Glu Thr Ala Phe Phe Gln Arg Pro Leu Lys Asp Phe Ser Asp 245 250 255 Lys Ile Gly Asp Cys Thr Phe Ile Glu Gly Ala Lys Arg Ala Pro Lys 260 265 270 Asp Ser Leu Ser Ala Ile Glu Phe Val Ala Leu Gly Arg Ile Ile Asn 275 280 285 Thr Leu Lys Asn Leu Gln Asn Thr Ser Gly Glu Val Tyr Ser Arg Asp 290 295 300 Lys Ile Asn Glu Ile Leu Gln Ile Val Leu Asp Lys Gly Glu Ile Ser 305 310 315 320 Tyr Lys Lys Leu Arg Glu Ile Leu Asp Ile Glu Ser Ser Val Arg Phe 325 330 335 Lys Asp Ser Lys Leu Asp Tyr Thr Lys Glu Leu Lys Glu Ala Glu Lys 340 345 350 Thr Lys Leu Phe Glu Ser Lys Asn Leu Gln Lys Phe Lys Lys Ala Leu 355 360 365 Gly Ser Phe Glu Gly Ile Ser Arg Glu Ile Leu Asp Ser Ile Ala Lys 370 375 380 Glu Ile Met Ile Thr Lys Asp Lys Glu Lys Leu Ala Lys Glu Leu Lys 385 390 395 400 Lys Phe Pro Leu Asp Glu Thr Gln Ile Gln Asn Leu Ser Asn Leu Ser 405 410 415 Phe Ser Gln Thr Ile Asn Leu Ser Leu Glu Ala Leu Ser Gln Ile Leu 420 425 430 Pro Phe Met Arg Gly Glu Arg Glu Asp Lys Cys Leu Arg Tyr Asp Glu 435 440 445 Ala Val Glu Lys Ala Gly Leu Lys Glu Val Ala Lys Asn Lys Ser Lys 450 455 460 Asp Asp Phe Leu Pro Pro Leu Glu Asn Tyr Glu Pro Tyr Leu Ala Asn 465 470 475 480 Pro Val Val Ala Arg Ala Leu Ser Glu Tyr Arg Lys Val Leu Asn Ala 485 490 495 Leu Leu Arg Lys Tyr Gly Lys Met His Lys Ile His Ile Glu Phe Thr 500 505 510 Arg Glu Val Gly Lys Ser Lys Glu Glu Arg Asn Lys Ile Glu Lys Glu 515 520 525 Gln Lys Glu Asn Phe Ala Lys Asn Gln Glu Ala Gln Lys Gln Cys Glu 530 535 540 Ile Leu Gly Leu Pro Ile Asn Gly Ala Asn Ile Leu Lys Met Lys Leu 545 550 555 560 Trp Arg Glu Gln Gln Glu Ser Cys Val Tyr Ser Gly Lys Glu Ile Ala 565 570 575 Ile Asp Asp Leu Lys Asn Pro Ala Ile Leu Gln Val Asp His Ile Tyr 580 585 590 Pro Tyr Ser Arg Ser Phe Asp Asp Ser Tyr Asn Asn Lys Val Leu Val 595 600 605 Phe Ser Lys Glu Asn Gln Asn Lys Leu Asn Lys Thr Pro Phe Glu Ala 610 615 620 Phe Gly Glu Asn Lys Asp Lys Trp Glu Lys Ile Leu Ser Leu Ala Ser 625 630 635 640 Lys Leu Pro Lys Pro Lys Arg Gln Arg Ile Tyr Asn Met Gln Phe Lys 645 650 655 Asp Lys Glu Gln Gly Phe Leu Thr Arg Asn Ile Asn Asp Thr Gly Tyr 660 665 670 Ile Ala Arg Leu Val Ser Gln Trp Thr Lys Asn Cys Leu Ser Phe Glu 675 680 685 Lys Leu Ser Glu Asp Glu Val Ser Ile Ala Gly Glu Lys Gly Ser Lys 690 695 700 Val His Val Glu Val Ile Ser Gly Ser Leu Thr Ala Met Leu Arg His 705 710 715 720 Tyr Trp Gly Leu Gly Asp Lys Asn Arg Asp Asn His Leu His His Ala 725 730 735 Val Asp Ala Ile Ile Ile Ala Tyr Ser Asn Glu Lys Val Ile Lys Ala 740 745 750 Phe Ser Asp Tyr Lys His Arg Glu Gln Asn Ala Lys Phe Tyr 755,760,765 Ala Lys Glu Ile Ala Glu Ser Glu Tyr Lys Gln Lys Val Phe Phe 770,775,780 Glu Pro Thr Asn His Phenotype of Gln Lys Val Leu Glu Lys With Asp Ser 785,790,795,800 Ile Phe Val Ser Lys Pro Arg Lys Arg Ala Arg Gly Ala Leu His 805 810 815 Glu Glu Thr Phe Tyr Ser Phe Glu Arg Leu Cys Asn Asp Lys Glu Tyr 820 825 830 Ala Lys Glu Lys Met Asp Tyr Gly Gly Lys Ala Gly Ile Gln Lys 835 840 845 Ala Ile Ala Leu Gly Lys Ile Arg Gln Val Gly Thr Lys Ile Val Ser 850 855 860 Asn Gly Thr Met Val Arg Val Asp Ile Phe Lys Asp Lys Lys Gly Lys 865 870 875 880 Phe Tyr Gly Val Pro Ile Tyr Thr Met Asp Phe Ala Leu Gly Ile Leu 885,890,895 Pro Asn Lys Ala Val Val Ser Gly Glu Asp Lys Lys Thr Arg Glu Ile 900 905 910 Lys Asp Trp Lys Glu Met Asp Glu Lys Tyr Glu Phe Cys Phe Ser Leu 915 920 925 Phe Lys Asp Asp Leu Ile Lys Ile Gln Lys Lys Asp Met Lys Glu Pro 930 935 940 Lys Phe Cys Tyr Tyr Lys Asn Phe Asp Val Ser Asn Ala Ser Ile Cys 945 950 955 960 Ile Ala Lys His Asp Asn Lys Phe Glu Asn Arg Asp Glu Asp Glu Lys 965 970 975 Ile Leu Tyr Ser Lys Ala Thr Tyr Lys Lys Val Glu Ala Arg Gly Ile 980 985 990 Gly Ile Gln Asn Leu Lys Ile Leu Glu Lys Trp Gln Val Ser Pro Leu 995 1000 1005 Gly Glu Lys Arg Glu Phe Glu Phe Glu Pro Arg Lys Asn Ile Ser Leu 1010 1015 1020 Lys Thr Thr Asn Arg Lys Asn Val Phe 1025 1030 <210> 13 <211> 1034 <212> PRT <213> Artificial Sequence <400> 13 Met Ser Asp Lys Ser Lys Ile Leu Gly Phe Asp Ile Gly Ile Thr Ser 1 5 10 15 Ile Gly Trp Ala Tyr Val Glu Gly Glu Glu Leu Ile Asp Cys Gly Val 20 25 30 Arg Ile Phe Thr Lys Ala Glu Asn Pro Lys Thr Lys Glu Ser Leu Ala 35 40 45 Leu Pro Arg Arg Glu Ala Arg Gly Val Arg Arg Arg Leu Ala Arg Arg 50 55 60 Lys Gly Arg Leu Asn Ala Ile Lys Gln Leu Ile Cys Lys Glu Phe Gly 65 70 75 80 Leu Asn Tyr Gln Asp Tyr Ile Ala Gln Asp Gly Glu Leu Pro Lys Ala 85 90 95 Tyr Ala Gly Lys Leu Ile Asn Pro Tyr Glu Leu Arg Ser Lys Ala Leu 100 105 110 Arg Glu Lys Leu Glu Lys Glu Glu Leu Ala Arg Val Ile Leu His Ile 115 120 125 Ala Lys His Arg Gly Tyr Gly Asn Lys His Ala Lys Glu Thr Asp Asp 130 135 140 Ala Glu Ser Gly Lys Ile Lys Lys Ala Ile Ser Asn Asn Glu Lys Ile 145 150 155 160 Leu Asn Glu Lys Gly Tyr Gln Ser Ala Gly Glu Tyr Leu Tyr Gln Glu 165 170 175 Phe Phe Gln Lys Glu Arg Leu Gln Glu Glu Lys Lys Gly Asn Asn Thr 180 185 190 Thr Lys Glu Phe Lys Asn Val Arg Asn Lys Ala Gly Asp Tyr Glu His 195 200 205 Cys Ile Ala Gln Thr Gln Met Gln Asn Glu Leu Arg Leu Ile Phe Glu 210 215 220 Lys Gln Arg Glu Phe Gly Leu Asn Phe Ser Glu Glu Phe Lys Lys Lys 225 230 235 240 Val Leu Glu Thr Ala Phe Phe Gln Arg Pro Leu Lys Asp Phe Ser Asp 245 250 255 Lys Ile Gly Asp Cys Thr Phe Ile Glu Gly Ala Lys Arg Ala Pro Lys 260 265 270 Asp Ser Leu Ser Ala Ile Glu Phe Val Ala Leu Gly Arg Ile Ile Asn 275 280 285 Thr Leu Lys Asn Leu Gln Asn Thr Ser Gly Glu Val Tyr Ser Arg Asp 290 295 300 Lys Ile Asn Glu Ile Leu Gln Ile Val Leu Asp Lys Gly Glu Ile Ser 305 310 315 320 Tyr Lys Lys Leu Arg Glu Ile Leu Asp Ile Glu Ser Ser Val Arg Phe 325 330 335 Lys Asp Ser Lys Leu Asp Tyr Thr Lys Glu Leu Lys Glu Ala Glu Lys 340 345 350 Thr Lys Leu Phe Glu Ser Lys Asn Leu Gln Lys Phe Lys Lys Ala Leu 355 360 365 Gly Ser Phe Glu Gly Ile Ser Arg Glu Ile Leu Asp Ser Ile Ala Lys 370 375 380 Glu Ile Met Ile Thr Lys Asp Lys Glu Lys Leu Ala Lys Glu Leu Lys 385 390 395 400 Lys Phe Pro Leu Asp Glu Thr Gln Ile Gln Asn Leu Ser Asn Leu Ser 405 410 415 Phe Ser Gln Thr Ile Asn Leu Ser Leu Glu Ala Leu Ser Gln Ile Leu 420 425 430 Pro Phe Met Arg Gly Glu Arg Glu Asp Lys Cys Leu Arg Tyr Asp Glu 435 440 445 Ala Val Glu Lys Ala Gly Leu Lys Glu Val Ala Lys Asn Lys Ser Lys 450 455 460 Asp Asp Phe Leu Pro Pro Leu Glu Asn Tyr Glu Pro Tyr Leu Ala Asn 465 470 475 480 Pro Val Val Ala Arg Ala Leu Ser Glu Tyr Arg Lys Val Leu Asn Ala 485 490 495 Leu Leu Arg Lys Tyr Gly Lys Met His Lys Ile His Ile Glu Phe Thr 500 505 510 Arg Glu Val Gly Lys Ser Lys Glu Glu Arg Asn Lys Ile Glu Lys Glu 515 520 525 Gln Lys Glu Asn Phe Ala Lys Asn Gln Glu Ala Gln Lys Gln Cys Glu 530 535 540 Ile Leu Gly Leu Pro Ile Asn Gly Ala Asn Ile Leu Lys Met Lys Leu 545 550 555 560 Trp Arg Glu Gln Gln Glu Ser Cys Val Tyr Ser Gly Lys Glu Ile Ala 565 570 575 Ile Asp Asp Leu Lys Asn Pro Ala Ile Leu Gln Val Asp His Ile Tyr 580 585 590 Pro Tyr Ser Arg Ser Phe Asp Asp Ser Tyr Asn Asn Lys Val Leu Val 595 600 605 Phe Ser Lys Glu Asn Gln Asn Lys Leu Asn Lys Thr Pro Phe Glu Ala 610 615 620 Phe Gly Glu Asn Lys Asp Lys Trp Glu Lys Ile Leu Ser Leu Ala Ser 625 630 635 640 Lys Leu Pro Lys Pro Lys Arg Gln Arg Ile Tyr Asn Met Gln Phe Lys 645 650 655 Asp Lys Glu Gln Gly Phe Leu Thr Arg Asn Ile Asn Asp Thr Gly Tyr 660 665 670 Ile Ala Arg Leu Val Ser Gln Trp Thr Lys Asn Cys Leu Ser Phe Glu 675 680 685 Lys Leu Ser Glu Asp Glu Val Ser Ile Ala Gly Glu Lys Gly Ser Lys 690 695 700 Val His Val Glu Val Ile Ser Gly Ser Leu Thr Ala Met Leu Arg His 705 710 715 720 Tyr Trp Gly Leu Gly Asp Lys Asn Arg Asp Asn His Leu His His Ala 725 730 735 Val Asp Ala Ile Ile Ile Ala Tyr Ser Asn Glu Lys Val Ile Lys Ala 740 745 750 Phe Ser Asp Tyr Lys Lys His Arg Glu Gln Asn Lys Ala Lys Phe Tyr 755 760 765 Ala Lys Glu Ile Ala Glu Ser Glu Tyr Lys Lys Gln Lys Val Phe Phe 770 775 780 Glu Pro Thr Asn His Phe Arg Gln Lys Val Leu Glu Lys Ile Asp Ser 785 790 795 800 Ile Phe Val Ser Lys Pro Arg Lys Arg Ala Arg Gly Ala Leu His 805 810 815 Glu Glu Thr Phe Tyr Ser Phe Glu Arg Leu Cys Asn Asp Lys Glu Tyr 820 825 830 Ala Lys Glu Lys Met Asp Tyr Gly Gly Lys Ala Gly Ile Gln Lys 835 840 845 Ala Ile Ala Leu Gly Lys Ile Arg Gln Val Gly Thr Lys Ile Val Ser 850 855 860 Asn Gly Thr Met Val Arg Val Asp Ile Phe Lys His Lys Glu Gly Lys 865 870 875 880 Phe Tyr Ala Val Pro Ile Tyr Thr Met Asp Phe Ala Phe Gly Glu Trp 885,890,895 Pro Asn Lys Ala Val Ala Thr Gly Lys Asp Glu Asp Gly Val Ile Lys 900 905 910 Asp Trp Ile Glu Met Asp Ser Asp Tyr Asp Phe Cys Phe Ser Leu Phe 915,920,925 Lys Asp Asp Leu Ile Lys Val Lys Lys Lys Met Lys Glu Ala Glu 930,935,940 Phe Cys Tyr Phe Lys Arg Phe Lys Thr Ser Gly Ala Ser Ile Glu Ile 945 950 955 960 Val Lys His Asp Asn Arg Ala Asp Asn Leu Asn Gly Asn Gln Glu Lys 965 970 975 Ile Phe Lys Val Lys Leu Glu Asn Asn Gln Lys Ile Leu Asp Lys Ser 980 985 990 Leu Ile Ser Ile Gln Asn Leu Glu Ile Phe Glu Lys Trp Gln Val Ser 995 1000 1005 Pro Leu Gly Lys Val Gln Lys Ala Val Pro Glu Ser Arg Gln Gly Ile 1010 1015 1020 Lys Leu Lys Ser Ser Leu Lys Arg Lys Gly 1025 1030 <210> 14 <211> 1031 <212> PRT <213> Artificial Sequence <400> 14 Met Ser Asp Lys Ser Lys Ile Leu Gly Phe Asp Ile Gly Ile Thr Ser 1 5 10 15 Ile Gly Trp Ala Tyr Val Glu Gly Glu Glu Leu Ile Asp Cys Gly Val 20 25 30 Arg Ile Phe Thr Lys Ala Glu Asn Pro Lys Thr Lys Glu Ser Leu Ala 35 40 45 Leu Pro Arg Arg Glu Ala Arg Gly Val Arg Arg Arg Leu Ala Arg Arg 50 55 60 Lys Gly Arg Leu Asn Ala Ile Lys Gln Leu Ile Cys Lys Glu Phe Gly 65 70 75 80 Leu Asn Tyr Gln Asp Tyr Ile Ala Gln Asp Gly Glu Leu Pro Lys Ala 85 90 95 Tyr Ala Gly Lys Leu Ile Asn Pro Tyr Glu Leu Arg Ser Lys Ala Leu 100 105 110 Arg Glu Lys Leu Glu Lys Glu Glu Leu Ala Arg Val Ile Leu His Ile 115 120 125 Ala Lys His Arg Gly Tyr Gly Asn Lys His Ala Lys Glu Thr Asp Asp 130 135 140 Ala Glu Ser Gly Lys Ile Lys Lys Ala Ile Ser Asn Asn Glu Lys Ile 145 150 155 160 Leu Asn Glu Lys Gly Tyr Gln Ser Ala Gly Glu Tyr Leu Tyr Gln Glu 165 170 175 Phe Phe Gln Lys Glu Arg Leu Gln Glu Glu Lys Lys Gly Asn Asn Thr 180 185 190 Thr Lys Glu Phe Lys Asn Val Arg Asn Lys Ala Gly Asp Tyr Glu His 195 200 205 Cys Ile Ala Gln Thr Gln Met Gln Asn Glu Leu Arg Leu Ile Phe Glu 210 215 220 Lys Gln Arg Glu Phe Gly Leu Asn Phe Served as Glu Glu Phe Lys Lys Lys 225 230 235 240 Val Leu Glu Thr Ala Phe Phe Gln Arg Pro Leu Lys Asp Phe Ser Asp 245 250 255 Lys Ile Gly Asp Cys Thr Phe Ile Glu Gly Ala Lys Arg Ala Pro Lys 260 265 270 Asp Ser Leu Ser Ala Ile Glu Phe Val Ala Leu Gly Arg Ile Ile Asn 275 280 285 Thr Lys Asn Leu Gln Asn Thr Ser Gly Glu Val Tyr Ser Arg Asp 290,295,300 Lys Gly Glu Ser Ile Gln Ile Val Leu Asp 305 310 315 320 Tyr Lys Lys Leu Arg Glu Ile Leu Asp Ile Glu Ser Ser Val Arg Phe 325 330 335 Lys Asp Ser Lys Leu Asp Tyr Thr Lys Glu Leu Lys Glu Ala Glu Lys 340 345 350 Thr Lys Leu Phe Glu Ser Lys Asn Leu Gln Lys Phe Lys Ala Leu 355 360 365 Gly Ser Phe Glu Gly Ile Ser Arg Glu Ile Leu Asp Ser Ile Ala Lys 370 375 380 Glu Ile Met Ile Thr Lys Asp Lys Glu Lys Leu Ala Lys Glu Leu Lys 385 390 395 400 Lys Phe Pro Leu Asp Glu Thr Gln Ile Gln Asn Leu Ser Asn Leu Ser 405 410 415 Phe Ser Gln Thr Ile Asn Leu Ser Leu Glu Ala Leu Ser Gln Ile Leu 420 425 430 Pro Phe Met Arg Gly Glu Arg Glu Asp Lys Cys Leu Arg Tyr Asp Glu 435 440 445 Ala Val Glu Lys Ala Gly Leu Lys Glu Val Ala Lys Asn Lys Ser Lys 450 455 460 Asp Asp Phe Leu Pro Pro Leu Glu Asn Tyr Glu Pro Tyr Leu Ala Asn 465 470 475 480 Pro Val Val Ala Arg Ala Leu Ser Glu Tyr Arg Lys Val Leu Asn Ala 485 490 495 Leu Leu Arg Lys Tyr Gly Lys Met His Lys Ile His Ile Glu Phe Thr 500 505 510 Arg Glu Val Gly Lys Ser Lys Glu Glu Arg Asn Lys Ile Glu Lys Glu 515 520 525 Gln Lys Glu Asn Phe Ala Lys Asn Gln Glu Ala Gln Lys Gln Cys Glu 530 535 540 Ile Leu Gly Leu Pro Ile Asn Gly Ala Asn Ile Leu Lys Met Lys Leu 545 550 555 560 Trp Arg Glu Gln Gln Glu Ser Cys Val Tyr Ser Gly Lys Glu Ile Ala 565 570 575 Ile Asp Asp Leu Lys Asn Pro Ala Ile Leu Gln Val Asp His Ile Tyr 580 585 590 Pro Tyr Ser Arg Ser Phe Asp Asp Ser Tyr Asn Asn Lys Val Leu Val 595 600 605 Phe Ser Lys Glu Asn Gln Asn Lys Leu Asn Lys Thr Pro Phe Glu Ala 610 615 620 Phe Gly Glu Asn Lys Asp Lys Trp Glu Lys Ile Leu Ser Leu Ala Ser 625 630 635 640 Lys Leu Pro Lys Pro Lys Arg Gln Arg Ile Tyr Asn Met Gln Phe Lys 645 650 655 Asp Lys Glu Gln Gly Phe Leu Thr Arg Asn Ile Asn Asp Thr Gly Tyr 660 665 670 Ile Ala Arg Leu Val Ser Gln Trp Thr Lys Asn Cys Leu Ser Phe Glu 675,680,685 Lys Leu Ser Glu Asp Glu Val Ser Ile Ala Gly Glu Lys Gly Ser Lys 690,695,700 Val His Val Glu Val Ile Ser Gly Ser Leu Thr Ala Met Leu Arg His 705 710 715 720 Tyr Trp Gly Leu Gly Asp Lys Asn Arg Asp Asn His Leu His Ala 725 730 735 Val Asp Only Ile Ile Only Tyr Ser Asn Glu Lys Val Isle Lys Only 740,745,750 Phe Ser Asp Tyr Lys His Arg Glu Gln Asn Ala Lys Phe Tyr 755,760,765 Ala Lys Glu Ile Ala Glu Ser Glu Tyr Lys Gln Lys Val Phe Phe 770,775,780 Glu Pro Thr Asn His Phenotype of Gln Lys Val Leu Glu Lys With Asp Ser 785,790,795,800 Ile Phe Val Ser Lys Pro Arg Lys Arg Ala Arg Gly Ala Leu His 805 810 815 Glu Glu Thr Phe Tyr Ser Phe Glu Arg Leu Cys Asn Asp Lys Glu Tyr 820 825 830 Ala Lys Glu Lys Met Asp Tyr Gly Gly Lys Ala Gly Ile Gln Lys 835 840 845 Ala Ile Ala Leu Gly Lys Ile Arg Gln Val Gly Thr Lys Ile Val Ser 850 855 860 Asn Gly Thr Met Val Arg Val Asp Ile Phe Lys Asp Lys Lys Gly Lys 865 870 875 880 Phe Tyr Ala Val Pro Ile Tyr Thr Met Asp Phe Ala Leu Gly Ile Leu 885 890 895 Pro Asn Lys Ala Val Ala Ile Gly Lys Asp Lys Asp Gly Val Ile Lys 900 905 910 Asp Trp Ile Glu Met Asp Ser Asn Tyr Thr Phe Cys Phe Ser Leu Phe 915 920 925 Lys Asp Asp Leu Ile Leu Val Lys Lys Lys Glu Met Glu Lys Ala Glu 930 935 940 Leu Cys Tyr Phe Val Ser Phe Asp Thr Ser Thr Ala Ser Ile Gln Val 945 950 955 960 Glu Lys His Asn Asn Lys Phe Glu Gly Leu Ser Glu Asn Glu Lys Ile 965 970 975 Leu Tyr Ser Asn Ala Thr Gln Lys Glu Val Val Gly Lys Ser Ile Gly 980 985 990 Ile Gln Asn Leu Lys Thr Phe Glu Lys Tyr Gln Val Ser Pro Leu Gly 995 1000 1005 Glu Met Gln Lys Ala Glu Phe Glu Pro Cys Gln Asp Ile Ala Leu Lys 1010 1015 1020 Ser Ser Pro Lys Arg Lys Asn 1025 1030 <210> 15 <211> 1031 <212> PRT <213> Artificial Sequence <400> 15 Met Ser Asp Lys Ser Lys Ile Leu Gly Phe Asp Ile Gly Ile Thr Ser 1 5 10 15 Ile Gly Trp Ala Tyr Val Glu Gly Glu Glu Leu Ile Asp Cys Gly Val 20 25 30 Arg Ile Phe Thr Lys Ala Glu Asn Pro Lys Thr Lys Glu Ser Leu Ala 35 40 45 Leu Pro Arg Arg Glu Ala Arg Gly Val Arg Arg Arg Leu Ala Arg Arg 50 55 60 Lys Gly Arg Leu Asn Ala Ile Lys Gln Leu Ile Cys Lys Glu Phe Gly 65 70 75 80 Leu Asn Tyr Gln Asp Tyr Ile Ala Gln Asp Gly Glu Leu Pro Lys Ala 85 90 95 Tyr Ala Gly Lys Leu Ile Asn Pro Tyr Glu Leu Arg Ser Lys Ala Leu 100 105 110 Arg Glu Lys Leu Glu Lys Glu Glu Leu Ala Arg Val Ile Leu His Ile 115 120 125 Ala Lys His Arg Gly Tyr Gly Asn Lys His Ala Lys Glu Thr Asp Asp 130 135 140 Ala Glu Ser Gly Lys Ile Lys Lys Ala Ile Ser Asn Asn Glu Lys Ile 145 150 155 160 Leu Asn Glu Lys Gly Tyr Gln Ser Ala Gly Glu Tyr Leu Tyr Gln Glu 165 170 175 Phe Phe Gln Lys Glu Arg Leu Gln Glu Glu Lys Lys Gly Asn Asn Thr 180 185 190 Thr Lys Glu Phe Lys Asn Val Arg Asn Lys Ala Gly Asp Tyr Glu His 195 200 205 Cys Ile Ala Gln Thr Gln Met Gln Asn Glu Leu Arg Leu Ile Phe Glu 210 215 220 Lys Gln Arg Glu Phe Gly Leu Asn Phe Ser Glu Glu Phe Lys Lys Lys 225 230 235 240 Val Leu Glu Thr Ala Phe Phe Gln Arg Pro Leu Lys Asp Phe Ser Asp 245 250 255 Lys Ile Gly Asp Cys Thr Phe Ile Glu Gly Ala Lys Arg Ala Pro Lys 260 265 270 Asp Ser Leu Ser Ala Ile Glu Phe Val Ala Leu Gly Arg Ile Ile Asn 275 280 285 Thr Leu Lys Asn Leu Gln Asn Thr Ser Gly Glu Val Tyr Ser Arg Asp 290 295 300 Lys Ile Asn Glu Ile Leu Gln Ile Val Leu Asp Lys Gly Glu Ile Ser 305 310 315 320 Tyr Lys Lys Leu Arg Glu Ile Leu Asp Ile Glu Ser Ser Val Arg Phe 325 330 335 Lys Asp Ser Lys Leu Asp Tyr Thr Lys Glu Leu Lys Glu Ala Glu Lys 340 345 350 Thr Lys Leu Phe Glu Ser Lys Asn Leu Gln Lys Phe Lys Lys Ala Leu 355 360 365 Gly Ser Phe Glu Gly Ile Ser Arg Glu Ile Leu Asp Ser Ile Ala Lys 370 375 380 Glu Ile Met Ile Thr Lys Asp Lys Glu Lys Leu Ala Lys Glu Leu Lys 385 390 395 400 Lys Phe Pro Leu Asp Glu Thr Gln Ile Gln Asn Leu Ser Asn Leu Ser 405 410 415 Phe Ser Gln Thr Ile Asn Leu Ser Leu Glu Ala Leu Ser Gln Ile Leu 420 425 430 Pro Phe Met Arg Gly Glu Arg Glu Asp Lys Cys Leu Arg Tyr Asp Glu 435 440 445 Ala Val Glu Lys Ala Gly Leu Lys Glu Val Ala Lys Asn Lys Ser Lys 450 455 460 Asp Asp Phe Leu Pro Pro Leu Glu Asn Tyr Glu Pro Tyr Leu Ala Asn 465 470 475 480 Pro Val Val Ala Arg Ala Leu Ser Glu Tyr Arg Lys Val Leu Asn Ala 485 490 495 Leu Leu Arg Lys Tyr Gly Lys Met His Lys Ile His Ile Glu Phe Thr 500 505 510 Arg Glu Val Gly Lys Ser Lys Glu Glu Arg Asn Lys Ile Glu Lys Glu 515 520 525 Gln Lys Glu Asn Phe Ala Lys Asn Gln Glu Ala Gln Lys Gln Cys Glu 530 535 540 Ile Leu Gly Leu Pro Ile Asn Gly Ala Asn Ile Leu Lys Met Lys Leu 545 550 555 560 Trp Arg Glu Gln Gln Glu Ser Cys Val Tyr Ser Gly Lys Glu Ile Ala 565 570 575 Ile Asp Asp Leu Lys Asn Pro Ala Ile Leu Gln Val Asp His Ile Tyr 580 585 590 Pro Tyr Ser Arg Ser Phe Asp Asp Ser Tyr Asn Asn Lys Val Leu Val 595 600 605 Phe Ser Lys Glu Asn Gln Asn Lys Leu Asn Lys Thr Pro Phe Glu Ala 610 615 620 Phe Gly Glu Asn Lys Asp Lys Trp Glu Lys Ile Leu Ser Leu Ala Ser 625 630 635 640 Lys Leu Pro Lys Pro Lys Arg Gln Arg Ile Tyr Asn Met Gln Phe Lys 645 650 655 Asp Lys Glu Gln Gly Phe Leu Thr Arg Asn Ile Asn Asp Thr Gly Tyr 660 665 670 Ile Ala Arg Leu Val Ser Gln Trp Thr Lys Asn Cys Leu Ser Phe Glu 675 680 685 Lys Leu Ser Glu Asp Glu Val Ser Ile Ala Gly Glu Lys Gly Ser Lys 690 695 700 Val His Val Glu Val Ile Ser Gly Ser Leu Thr Ala Met Leu Arg His 705 710 715 720 Tyr Trp Gly Leu Gly Asp Lys Asn Arg Asp Asn His Leu His Ala 725 730 735 Val Asp Only Ile Ile Only Tyr Ser Asn Glu Lys Val Isle Lys Only 740,745,750 Phe Ser Asp Tyr Lys His Arg Glu Gln Asn Ala Lys Phe Tyr 755,760,765 Ala Lys Glu Ile Ala Glu Ser Glu Tyr Lys Gln Lys Val Phe Phe 770,775,780 Glu Pro Thr Asn His Phenotype of Gln Lys Val Leu Glu Lys With Asp Ser 785,790,795,800 Ile Phe Val Ser Lys Pro Arg Lys Arg Ala Arg Gly Ala Leu His 805 810 815 Glu Glu Thr Phe Tyr Ser Phe Glu Arg Leu Cys Asn Asp Lys Glu Tyr 820 825 830 Ala Lys Glu Lys Met Asp Tyr Gly Gly Lys Ala Gly Ile Gln Lys 835 840 845 Ala Ile Ala Leu Gly Lys Ile Arg Gln Val Gly Thr Lys Ile Val Ser 850 855 860 Asn Gly Thr Met Val Arg Val Asp Ile Phe Lys Asp Lys Lys Gly Lys 865 870 875 880 Phe Tyr Ala Val Pro Ile Tyr Thr Met Asp Phe Ala Leu Gly Ile Leu 885 890 895 Pro Asn Lys Ala Val Ala Ile Gly Lys Asp Lys Asp Gly Val Ile Lys 900 905 910 Asp Trp Ile Glu Met Asp Ser Asn Tyr Asp Phe Cys Phe Ser Leu Phe 915 920 925 Lys Asp Asp Leu Ile Leu Val Gln Lys Lys Glu Met Glu Arg Ala Glu 930 935 940 Leu Cys Tyr Phe Val Ser Phe Gly Ser Thr Asn Ala Gln Ile Asn Val 945 950 955 960 Glu Lys His Asn Asn Lys Phe Glu Gly Leu Ser Glu Asn Glu Lys Ile 965 970 975 Leu Tyr Ser Asn Ala Thr Gln Lys Glu Val Ala Gly Lys Ser Ile Gly 980 985 990 Ile Gln Asn Leu Lys Thr Phe Glu Lys Tyr Gln Val Ser Pro Leu Gly 995 1000 1005 Glu Val Gln Lys Ala Glu Phe Glu Pro His Gln Glu Ile Lys Leu Lys 1010 1015 1020 Ser Ser Pro Lys Arg Lys Asp 1025 1030 <210> 16 <211> 1032 <212> PRT <213> Artificial Sequence <400> 16 Met Ser Asp Lys Ser Lys Ile Leu Gly Phe Asp Ile Gly Ile Thr Ser 1 5 10 15 Ile Gly Trp Ala Tyr Val Glu Gly Glu Glu Leu Ile Asp Cys Gly Val 20 25 30 Arg Ile Phe Thr Lys Ala Glu Asn Pro Lys Thr Lys Glu Ser Leu Ala 35 40 45 Leu Pro Arg Arg Glu Ala Arg Gly Val Arg Arg Arg Leu Ala Arg Arg 50 55 60 Lys Gly Arg Leu Asn Ala Ile Lys Gln Leu Ile Cys Lys Glu Phe Gly 65 70 75 80 Leu Asn Tyr Gln Asp Tyr Ile Ala Gln Asp Gly Glu Leu Pro Lys Ala 85 90 95 Tyr Ala Gly Lys Leu Ile Asn Pro Tyr Glu Leu Arg Ser Lys Ala Leu 100 105 110 Arg Glu Lys Leu Glu Lys Glu Glu Leu Ala Arg Val Ile Leu His Ile 115 120 125 Ala Lys His Arg Gly Tyr Gly Asn Lys His Ala Lys Glu Thr Asp Asp 130 135 140 Ala Glu Ser Gly Lys Ile Lys Lys Ala Ile Ser Asn Asn Glu Lys Ile 145 150 155 160 Leu Asn Glu Lys Gly Tyr Gln Ser Ala Gly Glu Tyr Leu Tyr Gln Glu 165 170 175 Phe Phe Gln Lys Glu Arg Leu Gln Glu Glu Lys Lys Gly Asn Asn Thr 180 185 190 Thr Lys Glu Phe Lys Asn Val Arg Asn Lys Ala Gly Asp Tyr Glu His 195 200 205 Cys Ile Ala Gln Thr Gln Met Gln Asn Glu Leu Arg Leu Ile Phe Glu 210 215 220 Lys Gln Arg Glu Phe Gly Leu Asn Phe Ser Glu Glu Phe Lys Lys Lys 225 230 235 240 Val Leu Glu Thr Ala Phe Phe Gln Arg Pro Leu Lys Asp Phe Ser Asp 245 250 255 Lys Ile Gly Asp Cys Thr Phe Ile Glu Gly Ala Lys Arg Ala Pro Lys 260 265 270 Asp Ser Leu Ser Ala Ile Glu Phe Val Ala Leu Gly Arg Ile Ile Asn 275 280 285 Thr Leu Lys Asn Leu Gln Asn Thr Ser Gly Glu Val Tyr Ser Arg Asp 290 295 300 Lys Ile Asn Glu Ile Leu Gln Ile Val Leu Asp Lys Gly Glu Ile Ser 305 310 315 320 Tyr Lys Lys Leu Arg Glu Ile Leu Asp Ile Glu Ser Ser Val Arg Phe 325 330 335 Lys Asp Ser Lys Leu Asp Tyr Thr Lys Glu Leu Lys Glu Ala Glu Lys 340 345 350 Thr Lys Leu Phe Glu Ser Lys Asn Leu Gln Lys Phe Lys Lys Ala Leu 355 360 365 Gly Ser Phe Glu Gly Ile Ser Arg Glu Ile Leu Asp Ser Ile Ala Lys 370 375 380 Glu Ile Met Ile Thr Lys Asp Lys Glu Lys Leu Ala Lys Glu Leu Lys 385 390 395 400 Lys Phe Pro Leu Asp Glu Thr Gln Ile Gln Asn Leu Ser Asn Leu Ser 405 410 415 Phe Ser Gln Thr Ile Asn Leu Ser Leu Glu Ala Leu Ser Gln Ile Leu 420 425 430 Pro Phe Met Arg Gly Glu Arg Glu Asp Lys Cys Leu Arg Tyr Asp Glu 435 440 445 Ala Val Glu Lys Ala Gly Leu Lys Glu Val Ala Lys Asn Lys Ser Lys 450 455 460 Asp Asp Phe Leu Pro Pro Leu Glu Asn Tyr Glu Pro Tyr Leu Ala Asn 465 470 475 480 Pro Val Val Ala Arg Ala Leu Ser Glu Tyr Arg Lys Val Leu Asn Ala 485 490 495 Leu Leu Arg Lys Tyr Gly Lys Met His Lys Ile His Ile Glu Phe Thr 500 505 510 Arg Glu Val Gly Lys Ser Lys Glu Glu Arg Asn Lys Ile Glu Lys Glu 515 520 525 Gln Lys Glu Asn Phe Ala Lys Asn Gln Glu Ala Gln Lys Gln Cys Glu 530 535 540 Ile Leu Gly Leu Pro Ile Asn Gly Ala Asn Ile Leu Lys Met Lys Leu 545 550 555 560 Trp Arg Glu Gln Gln Glu Ser Cys Val Tyr Ser Gly Lys Glu Ile Ala 565 570 575 Ile Asp Asp Leu Lys Asn Pro Ala Ile Leu Gln Val Asp His Ile Tyr 580 585 590 Pro Tyr Ser Arg Ser Phe Asp Asp Ser Tyr Asn Asn Lys Val Leu Val 595 600 605 Phe Ser Lys Glu Asn Gln Asn Lys Leu Asn Lys Thr Pro Phe Glu Ala 610 615 620 Phe Gly Glu Asn Lys Asp Lys Trp Glu Lys Ile Leu Ser Leu Ala Ser 625 630 635 640 Lys Leu Pro Lys Pro Lys Arg Gln Arg Ile Tyr Asn Met Gln Phe Lys 645 650 655 Asp Lys Glu Gln Gly Phe Leu Thr Arg Asn Ile Asn Asp Thr Gly Tyr 660 665 670 Ile Ala Arg Leu Val Ser Gln Trp Thr Lys Asn Cys Leu Ser Phe Glu 675 680 685 Lys Leu Ser Glu Asp Glu Val Ser Ile Ala Gly Glu Lys Gly Ser Lys 690 695 700 Val His Val Glu Val Ile Ser Gly Ser Leu Thr Ala Met Leu Arg His 705 710 715 720 Tyr Trp Gly Leu Gly Asp Lys Asn Arg Asp Asn His Leu His His Ala 725 730 735 Val Asp Ala Ile Ile Ile Ala Tyr Ser Asn Glu Lys Val Ile Lys Ala 740 745 750 Phe Ser Asp Tyr Lys Lys His Arg Glu Gln Asn Lys Ala Lys Phe Tyr 755 760 765 Ala Lys Glu Ile Ala Glu Ser Glu Tyr Lys Gln Lys Val Phe Phe 770,775,780 Glu Pro Thr Asn His Phenotype of Gln Lys Val Leu Glu Lys With Asp Ser 785,790,795,800 Ile Phe Val Ser Lys Pro Arg Lys Arg Ala Arg Gly Ala Leu His 805 810 815 Glu Glu Thr Phe Tyr Ser Phe Glu Arg Leu Cys Asn Asp Lys Glu Tyr 820 825 830 Ala Lys Glu Lys Met Asp Tyr Gly Gly Lys Ala Gly Ile Gln Lys 835 840 845 Ala Ile Ala Leu Gly Lys Ile Arg Gln Val Gly Thr Lys Ile Val Ser 850 855 860 Asn Gly Thr Met Val Arg Val Asp Ile Phe Lys Asp Lys Lys Gly Lys 865 870 875 880 Phe Tyr Ala Val Pro Ile Tyr Thr Met Asp Phe Ala Leu Gly Ile Leu 885,890,895 Pro Asn Lys Ala Val Val Gln Gly Lys Ser Lys Glu Asp Gly Val Ile 900 905 910 Lys Asp Trp Ile Glu Met Asp Ser Asn Tyr Thr Phe Cys Phe Ser Leu 915,920,925 Phe Lys Asp Asp Leu Ile Leu Val Gln Lys Lys Glu Met Glu Lys Ala 930 935 940 Glu Leu Cys Tyr Phe Val Gly Phe Gly Val Ser Thr Ala Ser Ile Gln 945 950 955 960 Val Glu Lys His Asn Asn Lys Phe Glu Gly Leu Ser Glu Asn Glu Lys 965 970 975 Ile Leu Tyr Ser Asn Ala Thr Gln Lys Glu Val Val Gly Lys Ser Ile 980 985 990 Gly Ile Gln Asn Leu Lys Thr Phe Glu Lys His Gln Val Ser Pro Leu 995 1000 1005 Gly Lys Val Gln Lys Val Glu Phe Glu Ser Arg Gln Glu Ile Lys Leu 1010 1015 1020 Lys Ser Ser Ser Lys Arg Lys Gly 1025 1030 <210> 17 <211> 1048 <212> PRT <213> Artificial Sequence <400> 17 Met Ser Asp Lys Ser Lys Ile Leu Gly Phe Asp Ile Gly Ile Thr Ser 1 5 10 15 Ile Gly Trp Ala Tyr Val Glu Gly Glu Glu Leu Ile Asp Cys Gly Val 20 25 30 Arg Ile Phe Thr Lys Ala Glu Asn Pro Lys Thr Lys Glu Ser Leu Ala 35 40 45 Leu Pro Arg Arg Glu Ala Arg Gly Val Arg Arg Arg Leu Ala Arg Arg 50 55 60 Lys Gly Arg Leu Asn Ala Ile Lys Gln Leu Ile Cys Lys Glu Phe Gly 65 70 75 80 Leu Asn Tyr Gln Asp Tyr Ile Ala Gln Asp Gly Glu Leu Pro Lys Ala 85 90 95 Tyr Ala Gly Lys Leu Ile Asn Pro Tyr Glu Leu Arg Ser Lys Ala Leu 100 105 110 Arg Glu Lys Leu Glu Lys Glu Glu Leu Ala Arg Val Ile Leu His Ile 115 120 125 Ala Lys His Arg Gly Tyr Gly Asn Lys His Ala Lys Glu Thr Asp Asp 130 135 140 Ala Glu Ser Gly Lys Ile Lys Lys Ala Ile Ser Asn Asn Glu Lys Ile 145 150 155 160 Leu Asn Glu Lys Gly Tyr Gln Ser Ala Gly Glu Tyr Leu Tyr Gln Glu 165 170 175 Phe Phe Gln Lys Glu Arg Leu Gln Glu Glu Lys Lys Gly Asn Asn Thr 180 185 190 Thr Lys Glu Phe Lys Asn Val Arg Asn Lys Ala Gly Asp Tyr Glu His 195 200 205 Cys Ile Ala Gln Thr Gln Met Gln Asn Glu Leu Arg Leu Ile Phe Glu 210 215 220 Lys Gln Arg Glu Phe Gly Leu Asn Phe Ser Glu Glu Phe Lys Lys Lys 225 230 235 240 Val Leu Glu Thr Ala Phe Phe Gln Arg Pro Leu Lys Asp Phe Ser Asp 245 250 255 Lys Ile Gly Asp Cys Thr Phe Ile Glu Gly Ala Lys Arg Ala Pro Lys 260 265 270 Asp Ser Leu Ser Ala Ile Glu Phe Val Ala Leu Gly Arg Ile Ile Asn 275 280 285 Thr Leu Lys Asn Leu Gln Asn Thr Ser Gly Glu Val Tyr Ser Arg Asp 290 295 300 Lys Ile Asn Glu Ile Leu Gln Ile Val Leu Asp Lys Gly Glu Ile Ser 305 310 315 320 Tyr Lys Lys Leu Arg Glu Ile Leu Asp Ile Glu Ser Ser Val Arg Phe 325 330 335 Lys Asp Ser Lys Leu Asp Tyr Thr Lys Glu Leu Lys Glu Ala Glu Lys 340 345 350 Thr Lys Leu Phe Glu Ser Lys Asn Leu Gln Lys Phe Lys Lys Ala Leu 355 360 365 Gly Ser Phe Glu Gly Ile Ser Arg Glu Ile Leu Asp Ser Ile Ala Lys 370 375 380 Glu Ile Met Ile Thr Lys Asp Lys Glu Lys Leu Ala Lys Glu Leu Lys 385 390 395 400 Lys Phe Pro Leu Asp Glu Thr Gln Ile Gln Asn Leu Ser Asn Leu Ser 405 410 415 Phe Ser Gln Thr Ile Asn Leu Ser Leu Glu Ala Leu Ser Gln Ile Leu 420 425 430 Pro Phe Met Arg Gly Glu Arg Glu Asp Lys Cys Leu Arg Tyr Asp Glu 435 440 445 Ala Val Glu Lys Ala Gly Leu Lys Glu Val Ala Lys Asn Lys Ser Lys 450 455 460 Asp Asp Phe Leu Pro Pro Leu Glu Asn Tyr Glu Pro Tyr Leu Ala Asn 465 470 475 480 Pro Val Val Ala Arg Ala Leu Ser Glu Tyr Arg Lys Val Leu Asn Ala 485 490 495 Leu Leu Arg Lys Tyr Gly Lys Met His Lys Ile His Ile Glu Phe Thr 500 505 510 Arg Glu Val Gly Lys Ser Lys Glu Glu Arg Asn Lys Ile Glu Lys Glu 515 520 525 Gln Lys Glu Asn Phe Ala Lys Asn Gln Glu Ala Gln Lys Gln Cys Glu 530 535 540 Ile Leu Gly Leu Pro Ile Asn Gly Ala Asn Ile Leu Lys Met Lys Leu 545 550 555 560 Trp Arg Glu Gln Gln Glu Ser Cys Val Tyr Ser Gly Lys Glu Ile Ala 565 570 575 Ile Asp Asp Leu Lys Asn Pro Ala Ile Leu Gln Val Asp His Ile Tyr 580 585 590 Pro Tyr Ser Arg Ser Phe Asp Asp Ser Tyr Asn Asn Lys Val Leu Val 595 600 605 Phe Ser Lys Glu Asn Gln Asn Lys Leu Asn Lys Thr Pro Phe Glu Ala 610 615 620 Phe Gly Glu Asn Lys Asp Lys Trp Glu Lys Ile Leu Ser Leu Ala Ser 625 630 635 640 Lys Leu Pro Lys Pro Lys Arg Gln Arg Ile Tyr Asn Met Gln Phe Lys 645 650 655 Asp Lys Glu Gln Gly Phe Leu Thr Arg Asn Ile Asn Asp Thr Gly Tyr 660 665 670 Ile Ala Arg Leu Val Ser Gln Trp Thr Lys Asn Cys Leu Ser Phe Glu 675 680 685 Lys Leu Ser Glu Asp Glu Val Ser Ile Ala Gly Glu Lys Gly Ser Lys 690 695 700 Val His Val Glu Val Ile Ser Gly Ser Leu Thr Ala Met Leu Arg His 705 710 715 720 Tyr Trp Gly Leu Gly Asp Lys Asn Arg Asp Asn His Leu His His Ala 725 730 735 Val Asp Ala Ile Ile Ile Ala Tyr Ser Asn Glu Lys Val Ile Lys Ala 740 745 750 Phe Ser Asp Tyr Lys Lys His Arg Glu Gln Asn Lys Ala Lys Phe Tyr 755 760 765 Ala Lys Glu Ile Ala Glu Ser Glu Tyr Lys Lys Gln Lys Val Phe Phe 770 775 780 Glu Pro Thr Asn His Phe Arg Gln Lys Val Leu Glu Lys Ile Asp Ser 785 790 795 800 Ile Phe Val Ser Lys Pro Pro Arg Lys Arg Ala Arg Gly Ala Leu His 805 810 815 Glu Glu Thr Phe Tyr Ser Phe Glu Arg Leu Cys Asn Asp Lys Glu Tyr 820 825 830 Ala Lys Lys Glu Lys Met Asp Tyr Gly Gly Lys Ala Gly Ile Gln Lys 835 840 845 Ala Ile Ala Leu Gly Lys Ile Arg Gln Val Gly Thr Lys Ile Val Ser 850 855 860 Asn Gly Thr Met Val Arg Val Asp Ile Phe Lys Asp Lys Lys Gly Lys 865 870 875 880 Phe Tyr Gly Val Pro Ile Tyr Thr Met Asp Phe Ala Leu Gly Ile Leu 885 890 895 Pro Asn Lys Ala Val Ile Ser Gly Lys Lys Asp Gly Val Ile Lys Asp 900 905 910 Trp Leu Glu Met Asp Ser Asn Tyr Glu Phe Cys Phe Ser Leu Phe Lys 915 920 925 Asp Asp Leu Ile Leu Val Gln Lys Ser Glu Met Glu Glu Pro Glu Leu 930 935 940 Cys Tyr Tyr Val Gly Phe Asp Ser Cys Ser Pro Arg Ile Ile Val Asp 945 950 955 960 Lys His Asn Lys Cys Tyr Lys Asn Met Ser Asp Asn Glu Lys Lys Leu 965 970 975 Phe Thr Leu Lys Glu Arg Glu Arg Asn Asn Lys Lys Glu Glu Gln Lys 980 985 990 Gln Asp Asp Glu Asn Lys Glu Gln Lys Ile Ile Gly Gly Arg Leu Gly 995 1000 1005 Ile Gln Asn Leu Lys Thr Phe Lys Lys Tyr Gln Val Ser Pro Leu Gly 1010 1015 1020 Glu Val Lys Glu Val Gly Lys Glu Thr Arg Gln Ala Ile Ala Leu Lys 1025 1030 1035 1040 Ser Thr Lys His Ile Lys Gln Asp 1045 <210> 18 <211> 1048 <212> PRT <213> Artificial Sequence <400> 18 Met Ser Asp Lys Ser Lys Ile Leu Gly Phe Asp Ile Gly Ile Thr Ser 1 5 10 15 Ile Gly Trp Ala Tyr Val Glu Gly Glu Glu Leu Ile Asp Cys Gly Val 20 25 30 Arg Ile Phe Thr Lys Ala Glu Asn Pro Lys Thr Lys Glu Ser Leu Ala 35 40 45 Leu Pro Arg Arg Glu Ala Arg Gly Val Arg Arg Arg Leu Ala Arg Arg 50 55 60 Lys Gly Arg Leu Asn Ala Ile Lys Gln Leu Ile Cys Lys Glu Phe Gly 65 70 75 80 Leu Asn Tyr Gln Asp Tyr Ile Ala Gln Asp Gly Glu Leu Pro Lys Ala 85 90 95 Tyr Ala Gly Lys Leu Ile Asn Pro Tyr Glu Leu Arg Ser Lys Ala Leu 100 105 110 Arg Glu Lys Leu Glu Lys Glu Glu Leu Ala Arg Val Ile Leu His Ile 115 120 125 Ala Lys His Arg Gly Tyr Gly Asn Lys His Ala Lys Glu Thr Asp Asp 130 135 140 Ala Glu Ser Gly Lys Ile Lys Lys Ala Ile Ser Asn Asn Glu Lys Ile 145 150 155 160 Leu Asn Glu Lys Gly Tyr Gln Ser Ala Gly Glu Tyr Leu Tyr Gln Glu 165 170 175 Phe Phe Gln Lys Glu Arg Leu Gln Glu Glu Lys Lys Gly Asn Asn Thr 180 185 190 Thr Lys Glu Phe Lys Asn Val Arg Asn Lys Ala Gly Asp Tyr Glu His 195 200 205 Cys Ile Ala Gln Thr Gln Met Gln Asn Glu Leu Arg Leu Ile Phe Glu 210 215 220 Lys Gln Arg Glu Phe Gly Leu Asn Phe Served as Glu Glu Phe Lys Lys Lys 225 230 235 240 Val Leu Glu Thr Ala Phe Phe Gln Arg Pro Leu Lys Asp Phe Ser Asp 245 250 255 Lys Ile Gly Asp Cys Thr Phe Ile Glu Gly Ala Lys Arg Ala Pro Lys 260 265 270 Asp Ser Leu Ser Ala Ile Glu Phe Val Ala Leu Gly Arg Ile Ile Asn 275 280 285 Thr Lys Asn Leu Gln Asn Thr Ser Gly Glu Val Tyr Ser Arg Asp 290,295,300 Lys Gly Glu Ser Ile Gln Ile Val Leu Asp 305 310 315 320 Tyr Lys Lys Leu Arg Glu Ile Leu Asp Ile Glu Ser Ser Val Arg Phe 325 330 335 Lys Asp Ser Lys Leu Asp Tyr Thr Lys Glu Leu Lys Glu Ala Glu Lys 340 345 350 Thr Lys Leu Phe Glu Ser Lys Asn Leu Gln Lys Phe Lys Ala Leu 355 360 365 Gly Ser Phe Glu Gly Ser Arg Glu Ile Leu Asp Ser I Ala Lys 370 375 380 Glu Ile Met Ile Thr Lys Asp Lys Glu Lys Leu Ala Lys Glu Leu Lys 385 390 395 400 Lys Phe Pro Leu Asp Glu Thr Gln Ile Gln Asn Leu Ser Asn Leu Ser 405 410 415 Phe Ser Gln Thr Ile Asn Leu Ser Leu Glu Ala Leu Ser Gln Ile Leu 420 425 430 Pro Phe Met Arg Gly Glu Arg Glu Asp Lys Cys Leu Arg Ala Asp Glu 435 440 445 Ala Val Glu Lys Ala Gly Leu Lys Glu Val Ala Lys Asn Lys Ser Lys 450 455 460 Asp Asp Phe Leu Pro Pro Leu Glu Asn Tyr Glu Pro Tyr Leu Ala Asn 465 470 475 480 Pro Val Val Ala Arg Ala Leu Ser Glu Tyr Arg Lys Val Leu Asn Ala 485 490 495 Leu Leu Arg Lys Tyr Gly Lys Met His Lys Ile His Ile Glu Phe Thr 500 505 510 Arg Glu Val Gly Lys Ser Lys Glu Glu Arg Asn Lys Ile Glu Lys Glu 515 520 525 Gln Lys Glu Asn Phe Ala Lys Asn Gln Glu Ala Gln Lys Gln Cys Glu 530 535 540 Ile Leu Gly Leu Pro Ile Asn Gly Ala Asn Ile Leu Lys Met Lys Leu 545 550 555 560 Trp Arg Glu Gln Gln Glu Ser Cys Val Tyr Ser Gly Lys Glu Ile Ala 565 570 575 Ile Asp Asp Leu Lys Asn Pro Ala Ile Leu Gln Val Asp His Ile Tyr 580 585 590 Pro Tyr Ser Arg Ser Phe Asp Asp Ser Tyr Asn Asn Lys Val Leu Val 595 600 605 Phe Ser Lys Glu Asn Gln Asn Lys Leu Asn Lys Thr Pro Phe Glu Ala 610 615 620 Phe Gly Glu Asn Lys Asp Lys Trp Glu Lys Ile Leu Ser Leu Ala Ser 625 630 635 640 Lys Leu Pro Lys Pro Lys Arg Gln Arg Ile Tyr Asn Met Gln Phe Lys 645 650 655 Asp Lys Glu Gln Gly Phe Leu Thr Arg Asn Ile Asn Asp Thr Gly Tyr 660 665 670 Ile Ala Arg Leu Val Ser Gln Trp Thr Lys Asn Cys Leu Ser Phe Glu 675 680 685 Lys Leu Ser Glu Asp Glu Val Ser Ile Ala Gly Glu Lys Gly Ser Lys 690,695,700 Val His Val Glu Val Ile Ser Gly Ser Leu Thr Ala Met Leu Arg His 705 710 715 720 Tyr Trp Gly Leu Gly Asp Lys Asn Arg Asp Asn His Leu His Ala 725 730 735 Val Asp Only Ile Ile Only Tyr Ser Asn Glu Lys Val Isle Lys Only 740,745,750 Phe Ser Asp Tyr Lys His Arg Glu Gln Asn Ala Lys Phe Tyr 755,760,765 Ala Lys Glu Ile Ala Glu Ser Glu Tyr Lys Gln Lys Val Phe Phe 770,775,780 Glu Pro Thr Asn His Phenotype of Gln Lys Val Leu Glu Lys With Asp Ser 785,790,795,800 Ile Phe Val Ser Lys Pro Arg Lys Arg Ala Arg Gly Ala Leu His 805 810 815 Glu Glu Thr Phe Tyr Ser Phe Glu Arg Leu Cys Asn Asp Lys Glu Tyr 820 825 830 Ala Lys Glu Lys Met Asp Tyr Gly Gly Lys Ala Gly Ile Gln Lys 835 840 845 Ala Ile Ala Leu Gly Lys Ile Arg Gln Val Gly Thr Lys Ile Val Ser 850 855 860 Asn Gly Thr Met Val Arg Val Asp Ile Phe Lys Asp Lys Lys Gly Lys 865 870 875 880 Phe Tyr Gly Val Pro Ile Tyr Thr Met Asp Phe Ala Leu Gly Ile Leu 885 890 895 Pro Asn Lys Ala Val Ile Ser Gly Lys Lys Asp Gly Val Ile Lys Asp 900 905 910 Trp Leu Glu Met Asp Ser Asn Tyr Glu Phe Cys Phe Ser Leu Phe Lys 915 920 925 Asp Asp Leu Ile Leu Val Gln Lys Ser Glu Met Glu Glu Pro Glu Leu 930 935 940 Cys Tyr Tyr Val Gly Phe Asp Ser Cys Ser Pro Arg Ile Ile Val Asp 945 950 955 960 Lys His Asn Lys Cys Tyr Lys Asn Met Ser Asp Asn Glu Lys Lys Leu 965 970 975 Phe Thr Leu Lys Glu Arg Glu Arg Asn Asn Lys Lys Glu Glu Gln Lys 980 985 990 Gln Asp Asp Glu Asn Lys Glu Gln Lys Ile Ile Gly Gly Arg Leu Gly 995 1000 1005 Ile Gln Asn Leu Lys Thr Phe Lys Lys Tyr Gln Val Ser Pro Leu Gly 1010 1015 1020 Glu Val Lys Glu Val Gly Lys Glu Thr Arg Gln Ala Ile Ala Leu Lys 1025 1030 1035 1040 Ser Thr Lys His Ile Lys Gln Asp 1045 <210> 19 <211> 1048 <212> PRT <213> Artificial Sequence <400> 19 Met Ser Asp Lys Ser Lys Ile Leu Gly Phe Asp Ile Gly Ile Thr Ser 1 5 10 15 Ile Gly Trp Ala Tyr Val Glu Gly Glu Glu Leu Ile Asp Cys Gly Val 20 25 30 Arg Ile Phe Thr Lys Ala Glu Asn Pro Lys Thr Lys Glu Ser Leu Ala 35 40 45 Leu Pro Arg Arg Glu Ala Arg Gly Val Arg Arg Arg Leu Ala Arg Arg 50 55 60 Lys Gly Arg Leu Asn Ala Ile Lys Gln Leu Ile Cys Lys Glu Phe Gly 65 70 75 80 Leu Asn Tyr Gln Asp Tyr Ile Ala Gln Asp Gly Glu Leu Pro Lys Ala 85 90 95 Tyr Ala Gly Lys Leu Ile Asn Pro Tyr Glu Leu Arg Ser Lys Ala Leu 100 105 110 Arg Glu Lys Leu Glu Lys Glu Glu Leu Ala Arg Val Ile Leu His Ile 115 120 125 Ala Lys His Arg Gly Tyr Gly Asn Lys His Ala Lys Glu Thr Asp Asp 130 135 140 Ala Glu Ser Gly Lys Ile Lys Lys Ala Ile Ser Asn Asn Glu Lys Ile 145 150 155 160 Leu Asn Glu Lys Gly Tyr Gln Ser Ala Gly Glu Tyr Leu Tyr Gln Glu 165 170 175 Phe Phe Gln Lys Glu Arg Leu Gln Glu Glu Lys Lys Gly Asn Asn Thr 180 185 190 Thr Lys Glu Phe Lys Asn Val Arg Asn Lys Ala Gly Asp Tyr Glu His 195 200 205 Cys Ile Ala Gln Thr Gln Met Gln Asn Glu Leu Arg Leu Ile Phe Glu 210 215 220 Lys Gln Arg Glu Phe Gly Leu Asn Phe Ser Glu Glu Phe Lys Lys Lys 225 230 235 240 Val Leu Glu Thr Ala Phe Phe Gln Arg Pro Leu Lys Asp Phe Ser Asp 245 250 255 Lys Ile Gly Asp Cys Thr Phe Ile Glu Gly Ala Lys Arg Ala Pro Lys 260 265 270 Asp Ser Leu Ser Ala Ile Glu Phe Val Ala Leu Gly Arg Ile Ile Asn 275 280 285 Thr Leu Lys Asn Leu Gln Asn Thr Ser Gly Glu Val Tyr Ser Arg Asp 290 295 300 Lys Ile Asn Glu Ile Leu Gln Ile Val Leu Asp Lys Gly Glu Ile Ser 305 310 315 320 Tyr Lys Lys Leu Arg Glu Ile Leu Asp Ile Glu Ser Ser Val Arg Phe 325 330 335 Lys Asp Ser Lys Leu Asp Tyr Thr Lys Glu Leu Lys Glu Ala Glu Lys 340 345 350 Thr Lys Leu Phe Glu Ser Lys Asn Leu Gln Lys Phe Lys Lys Ala Leu 355 360 365 Gly Ser Phe Glu Gly Ile Ser Arg Glu Ile Leu Asp Ser Ile Ala Lys 370 375 380 Glu Ile Met Ile Thr Ala Asp Lys Glu Lys Leu Ala Lys Glu Leu Lys 385 390 395 400 Lys Phe Pro Leu Asp Glu Thr Gln Ile Gln Asn Leu Ser Asn Leu Ser 405 410 415 Phe Ser Gln Thr Ile Asn Leu Ser Leu Glu Ala Leu Ser Gln Ile Leu 420 425 430 Pro Phe Met Arg Gly Glu Arg Glu Asp Lys Cys Leu Arg Ala Asp Glu 435 440 445 Ala Val Glu Lys Ala Gly Leu Lys Glu Val Ala Lys Asn Lys Ser Lys 450 455 460 Asp Asp Phe Leu Pro Pro Leu Glu Asn Tyr Glu Pro Tyr Leu Ala Asn 465 470 475 480 Pro Val Val Ala Arg Ala Leu Ser Glu Tyr Arg Lys Val Leu Asn Ala 485 490 495 Leu Leu Arg Lys Tyr Gly Lys Met His Lys Ile His Ile Glu Phe Thr 500 505 510 Arg Glu Val Gly Lys Ser Lys Glu Glu Arg Asn Lys Ile Glu Lys Glu 515 520 525 Gln Lys Glu Asn Phe Ala Lys Asn Gln Glu Ala Gln Lys Gln Cys Glu 530 535 540 Ile Leu Gly Leu Pro Ile Asn Gly Ala Asn Ile Leu Lys Met Lys Leu 545 550 555 560 Trp Arg Glu Gln Gln Glu Ser Cys Val Tyr Ser Gly Lys Glu Ile Ala 565 570 575 Ile Asp Asp Leu Lys Asn Pro Ala Ile Leu Gln Val Asp His Ile Tyr 580 585 590 Pro Tyr Ser Arg Ser Phe Asp Asp Ser Tyr Asn Asn Lys Val Leu Val 595 600 605 Phe Ser Lys Glu Asn Gln Asn Lys Leu Asn Lys Thr Pro Phe Glu Ala 610 615 620 Phe Gly Glu Asn Lys Asp Lys Trp Glu Lys Ile Leu Ser Leu Ala Ser 625 630 635 640 Lys Leu Pro Lys Pro Lys Arg Gln Arg Ile Tyr Asn Met Gln Phe Lys 645 650 655 Asp Lys Glu Gln Gly Phe Leu Thr Arg Asn Ile Asn Asp Thr Gly Tyr 660 665 670 Ile Ala Arg Leu Val Ser Gln Trp Thr Lys Asn Cys Leu Ser Phe Glu 675 680 685 Lys Leu Ser Glu Asp Glu Val Ser Ile Ala Gly Glu Lys Gly Ser Lys 690 695 700 Val His Val Glu Val Ile Ser Gly Ser Leu Thr Ala Met Leu Arg His 705 710 715 720 Tyr Trp Gly Leu Gly Asp Lys Asn Arg Asp Asn His Leu His Ala 725 730 735 Val Asp Only Ile Ile Only Tyr Ser Asn Glu Lys Val Isle Lys Only 740,745,750 Phe Ser Asp Tyr Lys His Arg Glu Gln Asn Ala Lys Phe Tyr 755,760,765 Ala Lys Glu Ile Ala Glu Ser Glu Tyr Lys Gln Lys Val Phe Phe 770,775,780 Glu Pro Thr Asn His Phenotype of Gln Lys Val Leu Glu Lys With Asp Ser 785,790,795,800 Ile Phe Val Ser Lys Pro Arg Lys Arg Ala Arg Gly Ala Leu His 805 810 815 Glu Glu Thr Phe Tyr Ser Phe Glu Arg Leu Cys Asn Asp Lys Glu Tyr 820 825 830 Ala Lys Glu Lys Met Asp Tyr Gly Gly Lys Ala Gly Ile Gln Lys 835 840 845 Ala Ile Ala Leu Gly Lys Ile Arg Gln Val Gly Thr Lys Ile Val Ser 850 855 860 Asn Gly Thr Met Val Arg Val Asp Ile Phe Lys Asp Lys Lys Gly Lys 865 870 875 880 Phe Tyr Gly Val Pro Ile Tyr Thr Met Asp Phe Ala Leu Gly Ile Leu 885 890 895 Pro Asn Lys Ala Val Ile Ser Gly Lys Lys Asp Gly Val Ile Lys Asp 900 905 910 Trp Leu Glu Met Asp Ser Asn Tyr Glu Phe Cys Phe Ser Leu Phe Lys 915 920 925 Asp Asp Leu Ile Leu Val Gln Lys Ser Glu Met Glu Glu Pro Glu Leu 930 935 940 Cys Tyr Tyr Val Gly Phe Asp Ser Cys Ser Pro Arg Ile Ile Val Asp 945 950 955 960 Lys His Asn Lys Cys Tyr Lys Asn Met Ser Asp Asn Glu Lys Lys Leu 965 970 975 Phe Thr Leu Lys Glu Arg Glu Arg Asn Asn Lys Lys Glu Glu Gln Lys 980 985 990 Gln Asp Asp Glu Asn Lys Glu Gln Lys Ile Ile Gly Gly Arg Leu Gly 995 1000 1005 Ile Gln Asn Leu Lys Thr Phe Lys Lys Tyr Gln Val Ser Pro Leu Gly 1010 1015 1020 Glu Val Lys Glu Val Gly Lys Glu Thr Arg Gln Ala Ile Ala Leu Lys 1025 1030 1035 1040 Ser Thr Lys His Ile Lys Gln Asp 1045 <210> 20 <211> 1033 <212> PRT <213> Artificial Sequence <400> 20 Met Ser Asp Lys Ser Lys Ile Leu Gly Phe Asp Ile Gly Ile Thr Ser 1 5 10 15 Ile Gly Trp Ala Tyr Val Glu Gly Glu Glu Leu Ile Asp Cys Gly Val 20 25 30 Arg Ile Phe Thr Lys Ala Glu Asn Pro Lys Thr Lys Glu Ser Leu Ala 35 40 45 Leu Pro Arg Arg Glu Ala Arg Gly Val Arg Arg Arg Leu Ala Arg Arg 50 55 60 Lys Gly Arg Leu Asn Ala Ile Lys Gln Leu Ile Cys Lys Glu Phe Gly 65 70 75 80 Leu Asn Tyr Gln Asp Tyr Ile Ala Gln Asp Gly Glu Leu Pro Lys Ala 85 90 95 Tyr Ala Gly Lys Leu Ile Asn Pro Tyr Glu Leu Arg Ser Lys Ala Leu 100 105 110 Arg Glu Lys Leu Glu Lys Glu Glu Leu Ala Arg Val Ile Leu His Ile 115 120 125 Ala Lys His Arg Gly Tyr Gly Asn Lys His Ala Lys Glu Thr Asp Asp 130 135 140 Ala Glu Ser Gly Lys Ile Lys Lys Ala Ile Ser Asn Asn Glu Lys Ile 145 150 155 160 Leu Asn Glu Lys Gly Tyr Gln Ser Ala Gly Glu Tyr Leu Tyr Gln Glu 165 170 175 Phe Phe Gln Lys Glu Arg Leu Gln Glu Glu Lys Lys Gly Asn Asn Thr 180 185 190 Thr Lys Glu Phe Lys Asn Val Arg Asn Lys Ala Gly Asp Tyr Glu His 195 200 205 Cys Ile Ala Gln Thr Gln Met Gln Asn Glu Leu Arg Leu Ile Phe Glu 210 215 220 Lys Gln Arg Glu Phe Gly Leu Asn Phe Ser Glu Glu Phe Lys Lys Lys 225 230 235 240 Val Leu Glu Thr Ala Phe Phe Gln Arg Pro Leu Lys Asp Phe Ser Asp 245 250 255 Lys Ile Gly Asp Cys Thr Phe Ile Glu Gly Ala Lys Arg Ala Pro Lys 260 265 270 Asp Ser Leu Ser Ala Ile Glu Phe Val Ala Leu Gly Arg Ile Ile Asn 275 280 285 Thr Leu Lys Asn Leu Gln Asn Thr Ser Gly Glu Val Tyr Ser Arg Asp 290 295 300 Lys Ile Asn Glu Ile Leu Gln Ile Val Leu Asp Lys Gly Glu Ile Ser 305 310 315 320 Tyr Lys Lys Leu Arg Glu Ile Leu Asp Ile Glu Ser Ser Val Arg Phe 325 330 335 Lys Asp Ser Lys Leu Asp Tyr Thr Lys Glu Leu Lys Glu Ala Glu Lys 340 345 350 Thr Lys Leu Phe Glu Ser Lys Asn Leu Gln Lys Phe Lys Lys Ala Leu 355 360 365 Gly Ser Phe Glu Gly Ile Ser Arg Glu Ile Leu Asp Ser Ile Ala Lys 370 375 380 Glu Ile Met Ile Thr Lys Asp Lys Glu Lys Leu Ala Lys Glu Leu Lys 385 390 395 400 Lys Phe Pro Leu Asp Glu Thr Gln Ile Gln Asn Leu Ser Asn Leu Ser 405 410 415 Phe Ser Gln Thr Ile Asn Leu Ser Leu Glu Ala Leu Ser Gln Ile Leu 420 425 430 Pro Phe Met Arg Gly Glu Arg Glu Asp Lys Cys Leu Arg Tyr Asp Glu 435 440 445 Ala Val Glu Lys Ala Gly Leu Lys Glu Val Ala Lys Asn Lys Ser Lys 450 455 460 Asp Asp Phe Leu Pro Pro Leu Glu Asn Tyr Glu Pro Tyr Leu Ala Asn 465 470 475 480 Pro Val Val Ala Arg Ala Leu Ser Glu Tyr Arg Lys Val Leu Asn Ala 485 490 495 Leu Leu Arg Lys Tyr Gly Lys Met His Lys Ile His Ile Glu Phe Thr 500 505 510 Arg Glu Val Gly Lys Ser Lys Glu Glu Arg Asn Lys Ile Glu Lys Glu 515 520 525 Gln Lys Glu Asn Phe Ala Lys Asn Gln Glu Ala Gln Lys Gln Cys Glu 530 535 540 Ile Leu Gly Leu Pro Ile Asn Gly Ala Asn Ile Leu Lys Met Lys Leu 545 550 555 560 Trp Arg Glu Gln Gln Glu Ser Cys Val Tyr Ser Gly Lys Glu Ile Ala 565 570 575 Ile Asp Asp Leu Lys Asn Pro Ala Ile Leu Gln Val Asp His Ile Tyr 580 585 590 Pro Tyr Ser Arg Ser Phe Asp Asp Ser Tyr Asn Asn Lys Val Leu Val 595 600 605 Phe Ser Lys Glu Asn Gln Asn Lys Leu Asn Lys Thr Pro Phe Glu Ala 610 615 620 Phe Gly Glu Asn Lys Asp Lys Trp Glu Lys Ile Leu Ser Leu Ala Ser 625 630 635 640 Lys Leu Pro Lys Pro Lys Arg Gln Arg Ile Tyr Asn Met Gln Phe Lys 645 650 655 Asp Lys Glu Gln Gly Phe Leu Thr Arg Asn Ile Asn Asp Thr Gly Tyr 660 665 670 Ile Ala Arg Leu Val Ser Gln Trp Thr Lys Asn Cys Leu Ser Phe Glu 675 680 685 Lys Leu Ser Glu Asp Glu Val Ser Ile Ala Gly Glu Lys Gly Ser Lys 690 695 700 Val His Val Glu Val Ile Ser Gly Ser Leu Thr Ala Met Leu Arg His 705 710 715 720 Tyr Trp Gly Leu Gly Asp Lys Asn Arg Asp Asn His Leu His His Ala 725 730 735 Val Asp Only Ile Ile Only Tyr Ser Asn Glu Lys Val Isle Lys Only 740,745,750 Phe Ser Asp Tyr Lys His Arg Glu Gln Asn Ala Lys Phe Tyr 755,760,765 Ala Lys Glu Ile Ala Glu Ser Glu Tyr Lys Gln Lys Val Phe Phe 770,775,780 Glu Pro Thr Asn His Phenotype of Gln Lys Val Leu Glu Lys With Asp Ser 785,790,795,800 Ile Phe Val Ser Lys Pro Arg Lys Arg Ala Arg Gly Ala Leu His 805 810 815 Glu Glu Thr Phe Tyr Ser Phe Glu Arg Leu Cys Asn Asp Lys Glu Tyr 820 825 830 Ala Lys Glu Lys Met Asp Tyr Gly Gly Lys Ala Gly Ile Gln Lys 835 840 845 Ala Ile Ala Leu Gly Lys Ile Arg Gln Val Gly Thr Lys Ile Val Ser 850 855 860 Asn Gly Thr Met Val Arg Val Asp Ile Phe Gln His Lys Gln Ser Gly 865 870 875 880 Lys Phe Tyr Gly Val Pro Ile Tyr Thr Met Asp Phe Ala Leu Gly Ile 885,890,895 Leu Pro Asn Lys Ala Val Ile Ala Gly Lys Asp Lys Gln Gly Val Ile 900 905 910 Lys Asp Trp Leu Glu Met Asp Ser Ser Tyr Glu Phe Cys Phe Ser Leu 915 920 925 Phe Lys Asp Asp Leu Ile Leu Leu Gln Lys Lys Asp Met Glu Lys Ala 930 935 940 Glu Leu Cys Tyr Phe Val Ser Phe Gly Ile Ala Thr Ala Thr Ile Gln 945 950 955 960 Val Glu Lys His Asn Asn Lys Phe Glu Asp Leu Ser Glu Asn Glu Lys 965 970 975 Leu Leu Tyr Thr Asn Ala Thr Ala Lys Glu Val Val Ala Lys Ser Ile 980 985 990 Gly Ile Gln Asn Leu Lys Ile Phe Glu Lys Tyr His Val Ser Pro Leu 995 1000 1005 Gly Glu Val Lys Lys Ala Glu Phe Ala Glu Arg Gln Asn Ile Ala Leu 1010 1015 1020 Pro Ser Ser Pro Lys His Lys Lys Ala 1025 1030 <210> 21 <211> 1067 <212> PRT <213> Neisseria sp. WF04 <400> 21 Met Lys Thr Pro Ala His Arg Tyr Ile Leu Gly Leu Asp Leu Gly Ile 1 5 10 15 Ala Ser Val Gly Trp Ala Leu Val Leu Ala Asp Glu Asn Glu Tyr Pro 20 25 30 Ile Gly Leu Leu Asp Cys Gly Val Arg Val Phe Glu Arg Ala Glu Met 35 40 45 Pro Lys Asp Gly Lys Ser Leu Ala Ala Thr Arg Arg Gln Ala Arg Ser 50 55 60 Ile Arg Arg Leu Ile Arg Arg Arg Ala His Arg Leu Leu Arg Leu Arg Arg 65 70 75 80 Arg Leu Leu Lys Arg Glu Gly Leu Leu Ser Ala Ala Asp Phe Ala Ala 85 90 95 Asp Gly Leu Pro Ala Ala Met Pro Val Asn Thr Trp Gln Leu Arg Val 100 105 110 Glu Gly Leu Asp Arg Lys Leu Ala Glu Lys Glu Trp Ala Ala Val Leu 115 120 125 Leu His Leu Val Lys His Arg Gly Tyr Leu Ser Gln Arg Lys Asn Glu 130 135 140 Met Gln Thr Glu Asp Lys Glu Leu Gly Lys Leu Leu Ala Gly Val Ala 145 150 155 160 Glu Asn Arg Gln Leu Leu Ala Asp Asn Pro Glu Gln Tyr Arg Thr Pro 165 170 175 Ala Glu Leu Ala Val Lys Arg Phe Ala Val Gln Ser Gly His Leu Arg 180 185 190 Asn Lys Gly Gly Asp Tyr Ala His Thr Phe Asn Arg Leu Asp Leu Gln 195 200 205 Lys Glu Leu His Leu Leu Phe Ala Lys Gln Arg Gly Leu Gly Asn Pro 210 215 220 Phe Ala Ser Ala Glu Leu Glu Asn Lys Val Asp Ser Leu Leu Met Thr 225 230 235 240 Gln Arg Ala Ala Leu Gln Asp Gly Ala Val Leu Lys Met Leu Gly His 245 250 255 Cys Thr Phe Glu Pro Gln Glu Tyr Lys Ala Ala Lys His Thr Tyr Ser 260 265 270 Ala Glu Arg Phe Ile Trp Leu Thr Arg Leu Asn Asn Leu Arg Ile Leu 275 280 285 His Asn Gly Glu Glu Arg Ala Leu Asn Glu His Glu Arg Lys Leu Leu 290 295 300 Leu Asp Glu Pro Tyr Lys Lys Ala Lys Leu Thr Tyr Lys Gln Val Arg 305 310 315 320 Lys Ile Leu Asn Leu Pro Asp Ser Ala Val Phe Lys Gly Leu Arg Tyr 325 330 335 Gly Lys Ser Glu Asp Gly Leu Lys Ala Glu Ser Gly Ala Leu Met Glu 340 345 350 Met Lys Ala Tyr His Lys Ile Arg Thr Val Leu Glu Lys Ala Gly Leu 355 360 365 Lys Gly Glu Trp Glu Asn Arg Ile Arg Asn Pro Glu Val Leu Asp Ala 370 375 380 Ile Gly Thr Ala Phe Ser Leu Tyr Lys Thr Asp Asn Asp Ile Gln Thr 385 390 395 400 Ala Leu Ala Asp Leu Ala Leu Pro Glu Lys Val Leu Glu Ala Leu Leu 405 410 415 Lys Gly Ile Gly Phe Asp Lys Phe Ile Gln Leu Ser Leu Ser Ala Leu 420 425 430 Arg Lys Ile Leu Pro Leu Met Glu Gln Gly Leu Arg Tyr Asp Glu Ala 435 440 445 Cys Thr Lys Val Tyr Gly Asn His Tyr Gly Ala Lys Ile Gln Gln Asn 450 455 460 Ser Leu Val Leu Pro Val Ile Asp Gly Asn Asp Ile Arg Asn Pro Val 465 470 475 480 Val Leu Arg Thr Leu Thr Gln Ala Arg Lys Val Val Asn Ala Val Ile 485 490 495 Arg Arg Tyr Gly Ser Pro Leu Arg Val His Ile Glu Thr Ala Arg Glu 500 505 510 Leu Gly Lys Ser Trp Asp Asp Arg Lys Glu Ile Glu Lys Arg Gln Glu 515 520 525 Glu Asn Arg Lys Glu Arg Glu Arg Ala Ala Asp Glu Phe Lys Glu Tyr 530 535 540 Phe Pro His Phe Ala Gly Glu Pro Lys Gly Arg Asp Ile Leu Lys Met 545 550 555 560 Arg Leu Tyr Asn Gln Gln Gln Gly Lys Cys Leu Tyr Ser Gly Leu Pro 565 570 575 Leu Asp Leu Ser Arg Leu Asn Glu Lys Gly Tyr Val Glu Ile Asp His 580 585 590 Ala Leu Pro Phe Ser Arg Thr Trp Asp Asp Ser Phe Asn Asn Lys Val 595 600 605 Leu Val Leu Gly Ser Glu Asn Gln Lys Lys Arg Ser Gln Thr Pro Tyr 610 615 620 Glu Tyr Leu Asp Gly Ala Ser Asn Ser Glu Arg Trp Arg Glu Phe Gln 625 630 635 640 Ala Arg Val Ala Gly Cys His Phe Pro Tyr Ala Lys Lys Gln Arg Ile 645 650 655 Gln Thr Ala Lys Leu Asn Glu Gln Asp Phe Ile Asp Arg Asn Leu Asn 660 665 670 Asp Thr Arg Tyr Ile Ala Arg Phe Leu Cys Gly Phe Ile Glu Asn Asn 675 680 685 Leu His Leu Glu Gly Lys Asp Lys Arg Arg Val Phe Ala Ser Asn Gly 690 695 700 Gln Ile Thr Ala Leu Leu Arg Gly Leu Trp Gly Leu Arg Lys Val Arg 705 710 715 720 Glu Glu Asn Asp Arg His His Ala Leu Asp Ala Val Val Val Ala Cys 725 730 735 Ser Thr Val Ser Met Gln Gln Lys Ile Thr Glu Ala Met Lys Arg Arg 740 745 750 Glu Ser Leu Glu Thr Val Asn Thr Glu Thr Gly Glu Val Lys Gln Arg 755 760 765 Ile Pro Gln Pro Trp Asp Phe Phe Arg Gln Glu Val Met Ile Arg Val 770 775 780 Phe Ser Asp His Pro Arg Glu Glu Leu Ala Glu Lys Leu Asn Ser Arg 785 790 795 800 Pro Gln Ala Leu His Glu His Val Ala Pro Leu Phe Val Ser Arg Ala 805 810 815 Pro Asn Arg Lys Thr Thr Gly Gln Gly His Leu Glu Thr Ile Lys Ser 820 825 830 Ala Lys Arg Leu Ser Glu Asn Ile Ser Val Val Lys Lys Pro Leu Ala 835 840 845 Ser Leu Lys Thr Lys Asp Ile Glu Asn Ile Ala Gly Tyr Thr Ala Asn 850 855 860 Arg Glu Pro Glu Phe Tyr Gln Ala Leu Lys Lys Arg Leu Ala Glu Phe 865 870 875 880 Asn Asp Asp Pro Lys Lys Ala Phe Ala Glu Pro Phe Tyr Lys Pro Thr 885 890 895 Lys Asn Gly Glu Gln Gly Pro Leu Val Lys Ser Val Arg Val Glu Asp 900 905 910 Asp Arg Val Lys Val Gly Leu Ala Val Arg His Gly Ile Thr Asp Thr 915 920 925 Asn Gly Asp Met Val Arg Ala Asp Val Tyr Gln Lys Ala Asn Lys Ser 930 935 940 Gly Arg Ile Gln Tyr Phe Val Val Pro Val Tyr Ala Trp Gln Ile Ala 945 950 955 960 Lys Gly Val Leu Pro Leu Leu Asp Cys Arg Gly Tyr Lys Ile Asp Glu 965 970 975 Thr Tyr Thr Phe Cys Phe Ser Leu His Lys Tyr Asp Leu Ile Ser Phe 980 985 990 Pro Lys Asp Gly Asn Pro Glu Glu Glu Gln Leu Val Tyr Tyr Ile Thr 995 1000 1005 Cys Asp Ser Ser Asn Gly Arg Phe Trp Ile Ala Ser His Asp Lys Gly 1010 1015 1020 Ala Lys Glu Gln Gln Phe Arg Ile Ser Thr Gln Asn Gln Leu Phe Ile 1025 1030 1035 1040 Lys Lys Tyr Gln Thr Asp Pro Leu Gly Lys Glu Ile Arg Leu Cys Lys 1045 1050 1055 Pro Glu Gln Arg Pro Ala Leu Lys Ile Lys Arg 1060 1065 <210> 22 <211> 3000 <212> DNA <213> Artificial Sequence <400> 22 atgaagatcc tgggcttcga catcggaatc aactccatcg gctgggcctt cgtggaagat 60 aaccagctgc aggactgcgg cgtgcggctg ttcaccaagg cagaagatcc taaaaccaag 120 gaaagcctgg ccctgcctag acggaacgcc cggagcaata gaaaggct gggcagacgg 180 aggtccagac tgattgccct gaagcacatt atcagcaagg agctgaaact gaactaccag 240 gattacatcg ccaacgacgg cgagctgcct aaggcctacg agggcagact ggtgtcccct 300 tacgagctga gatacaaggc actgaacgag aaaattgagc ccaaggacct ggccagagtg 360 atcctgcaca tcgctaagca caggattac atgaacaaga acgagaagaa atccagcgac 420 aacgagaagg gcaagatcct gagcgccctg aaaacaaacg ccctgaaact tgaaagtac 480 cagtctgtgg gcgagtactt ctacaaagag ttcttccaga agtacaagga aaacaccaag 540 gacttcatca atatcagaaa taagaagggg agctacgaaa actgcgtgct ggcatctgac 600 ctggaaaagg aactgaaact gatcctggag aagcagaaag aatggggcta ctcctacaac 660 gacaacttca tcaaggaaat cctgaaggtt gccttcttcc aaagacctct gaaggacttc 720 agctaccttg ttggcgcttg caccttctc gaggacgaga aaagagcctg taaaaacagc 780 tactctgcct gggagttcgt ggccctgacc aagatcatca atgagctgaa gtccctggag 840 aaagaaagcg gagaactggt gtctagccag attatcaacg agatccttaa ccacatcctg 900 gataagggca gcatcacata caagaagttc agagaata tcaactgca cgagtctatg 960 aaattcaaga gcctgaagta cgacaaggac aacgccgaat ccgtgaagct gatcgagttc 1020 aggaagctgg tcgaatttaa gaggccctg ggcgagcaca gcctgaccag agaggactg 1080 gaccagatcg ccacttacat caccctgat aaggataatg aaagctgaa gatcaccctg 1140 gaaaaata gcctgaaca cgagcagatc aagaacctca tcgagatcga ttcaacgat 1200 cacatcacc tttcttta ggcccttaac ctaatcctgc ccctgatgaa agagggaaaa 1260 cggtatgacg aggcttgtaa actgctgaac ctgaaaacca agagcaaca ccagaagttc 1320 gatttcctgc ctgccttttg cgacagcatc tttgcccagg agctgaccaa cccatcgtg 1380 aaccgagcca tcagcgagta cagaaggtg ctgaacgccc tcctgaaaaa gtacggcaaa 1440 atgcacaaga tccacattga gctggccaga gatatcggcc tgtctaaaaa gctgcgaaca 1500 aagatcgaga aagagcagaa ggagaactac gagacaaca tctgggctct gaatgagtgc 1560 gagaatttcg gactgaaagc aaatgccaag aacatcctga aactgaagct gtggaaggaa 1620 cagaaagagt tttgcatcta cagtggcaag aaaattatagca tcgaacacct gagggatgag 1680 aaggccctgg aagtggacca catctacccc tatagccgga gcttcgatga tagcttcctg 1740 aacaaggtgc tggtgttcac caaggaaaac cagggaagc tgaacaagac cccttttgag 1800 gccttcggcg ccaacgagga aagatggagc aagatccagg ccctggccca gaacctgcct 1860 tacaagaaga agacaaaaat cctagatgaa gccttcaagg ccaagcaaca gcagacttc 1920 atcagcagaa acctcaatga cacccggtac atctctacac tgattgtgaa gtacaccaag 1980 gagtacctgg actttctgcc actggacgag aaggagca tcaacctaaa aagcggcgaa 2040 aagggctcta agatccacgt gcagaccatc aacggcatgc tgacatctgt gctccgccac 2100 acctggggtt tcgcccagaa ggatagaaac aatcacctgc accacgccct ggatgctacc 2160 atcgtggcct acagcacaa cgccatcatc aaggctttca gcgactttaa gaaggaacaa 2220 gagctgctga aggctaact ttgccaaa gaactcaca acgacagcta caaccatcag 2280 gccaagtttt tcgaaccttt cgaaggcttc cgggaacaga ttctgaatca aatcacaa 2340 ctgttcgtgt ccaacctcc aagaaagcgg gccagaggcg cccttcataa ggaaaccttc 2400 taccctaag atgagatt caagaagtac aactcccagg agggcgtcga gatcgccctg 2460 aattgcggaa aaatcagaa gatcgggacc aagtacgtgg aaatgacac gatggtgcgg 2520 atcgacatct tcaagaaca aaaacaagttc tacgccatac ccatctatac atggactc 2580 gccttgggcg tgctgcctaa caatcgtg atcatcggca aggacaagaa agggaatcct 2640 aagcagtggc aggagatcga cgagtcctac gagttctgct tctctctgca caggacgac 2700 ctggtgctta tccagaagaa ggacatgcag gagccggaat tcgcatacta caatggattc 2760 gatatcagca atagcagcat ctgcgtgga aaacatgata ataagttcga gaacctgact 2820 gatacaga aactgctgtt taccaaccc gaggaagga atgtgaagc caaaaatc 2880 ggcatccagg gcctgagaat cttcgaaaag tacatcatta cacctctggg cgaaaagatc 2940 aaggccgact tcaagcctag agaggacatc gccctgaaaa caagcaagaa gcacggcctg 3000 <210> 23 <211> 3096 <212> DNA <213> Artificial Sequence <400> 23 atgaagatct tgggctttga tatcggaatc tccagcatcg gatgggcctt cgtggaaaat 60 gaggaactgc gggactgcgg cgtccggatc ttcaccaagg ccgagaaccc cgagaacggc 120 gagagccttg ccctgcctag acgggaagct agaggcgtga gaagaaggct ggctagaaga 180 aaggcccggc tgaacggcgt gaagaaactg ctgtgccagg agttcggcct caagctgaac 240 gactacttca gcaacgacgg cgagctgcct aaggcttatc agatgagcaa gaataccaag 300 agcgtgtacg agctgagaac cctggccctg agctgcaagc tggagttcaa ggacctggct 360 agagtgtttc tgcacatcgc caaacataga ggctacggga acaagcacgc caagatcagc 420 caagacagca aggatatcgg ccaaatcaag aaggccctga aacataatga agaggagctg 480 aagaattacc ggagtgtggg cgagtacctg tacaagaact tctaccagaa ggtgcggaat 540 ttcgaagaaa tcaagacaaa gaacaagaac aaccagagca ccttcgagtt caagaacgtg 600 cgaaacaagt ctggcaacta caagcaatgt gtgagccagg agtggctgaa aaacgagctg 660 aagctgatct tcgagaagca gagatctttc ggcgtgaaac tgtccaagga tttcgagaac 720 gagctgctgg acaagatctt tttccagcgg gagctaaagg attttagcga caaaatcggc 780 ttttgcatat actttgaagg caagaaaga gccagcaagg aaagcctcag cgccaaggaa 840 ttcatcgcgt tgacaagaat gatcaacaca ttcaagaacc ttgaacagca gaaccggaag 900 aaccagtctg gggagatcta ctcccaggag atcatcaagg agattttgaa catcatcctg 960 gacaagggca tgatgaagta caaagaactg aggaccctgc tgaagcttga taaatccatc 1020 cagttcaagg atagcaagct tagttacgag aaggggatcg agaaggccga ggaaaccaaa 1080 ttcattgatt tcaaggaact gcgcaacttc aagaaggctc ttggcggatc tttcgaaggc 1140 ctggagagaa agcatattga cgaaattgcc cacaagataa cactgatcaa gtccaaggag 1200 aagctgaaaa ttgctctgga gaactacatc aaagcaaca agctggaaca gagacttaac 1260 gagtgcctgg gaaacctgtc tgagctggat ttcagcggcc acatcgacct gtctctggag 1320 gccctggagc agatcctgcc tttatgaga gagggcttca gatacgacga ggccgtgaag 1380 aaggccggcc tgagagagat ccggaaagat tacctga aggacttcct gccacctctg 1440 areactttg agaacctggc taatcctgtg gtggtgagag ccctcgctga atacagaaaa 1500 gtgctgaacg ccctgctgaa gagatacgga aaaatgcaca agattcacat tgagctgaca 1560 agagagatcg ggctgaacca caaagaaaga cagaactata tcgaggaaca aagaacaac 1620 1680 tacctgctga agatgaaact gttcctggag caggacgagt tctgtatcta cagcggagag 1740 aagatcaaga tcgagcacct gagagatgcc aagatgctgg aaatcgacca catctacccc 1800 tacagcagaa gcttcgatga cagctacctg aacaaggtgc tggtgttctc caaggaaaac 1860 cagaacaaag gaacaagac ccctttcgag gcttttggca atgacaaaga gaagtgggac 1920 aagatcaag gcctgaccca gggcctgaag aagctgcccca gcaagaaaaa gaaagaatc 1980 ctgaacctct acttcaatga caggaagct ggctcatca gcagaacct gaacgacacc 2040 gcctacatcg ccagattctc cgccactac acaaatact tcctggactt cctgcccctg 2100 agcgagaacg aagtgtccat atccggag aaggctcta agtgcacgt ggaagccatc 2160 agcggcagac tgacagccat gctgagacac tactggggcc tgggccagaa ggacagaacac 2220 aaccacctgc accacgccgt ggacgcagtg atcgtggcct acaccacgc caagatcatc 2280 aagaacttcg ccgactcaa gaagttccgg gagcaaaca agccaagat ctacgccaag 2340 gattcgccc agaccaccga cagaaaatc tttaaaccct gtgaaaattt cagaaacaag 2400 atcctcatga agattgacga gatctttgtg tccaacctc caagaaagcg ggcccggggc 2460 gccctgcaca aggagctt catgagcttc gacgacaga agctgctca aagctacgga 2520 ggaagagagg gcgtcaagaa ggccctgtcc ctggggcaaga tcagaagat cggtacaag 2580 atagttgaga acagaat ggtgcgggtc gatacttca aggacaagaa gggcaagttc 2640 tacggcgtcc ccatctatac aatggatttc gctctgggaa tcctgcctaa caaagccgtg 2700 gtgagtggag aagataagaa aacccgggaa atcaaggact ggaaggaaat ggacgagaag 2760 tacgaattct gcttcagcct gttcaaagac gatctgatta aaattcagaa aaaggatatg 2820 aaggaaccta agttctgcta ctacaagaat ttcgacgtgt ccaacgcttc tatctgcatc 2880 gcaaaacacg acaacaagtt cgagaataga gacgaggacg aaaaaatcct gtacagcaaa 2940 gccacctaca agaaggtgga agccagaggc atcggcatcc agaatctgaa gatcctggag 3000 aagtggcagg tgagtcctct gggcgaaaag cgggaattcg agttcgagcc tcggaagaat 3060 atctcactga aaaccaccaa cagaaagaat gtgttc 3096 <210> 24 <211> 2961 <212> DNA <213> Artificial Sequence <400> 24 atggcccgca tccttgcttt cgacatcggc atcagcagca tcggctgggc cttttctgaa 60 aacgacgagc tgaaagattg cggagtgcgg atctttacaa aagccgaaaa ccccaagaca 120 ggcgaatccc tcgctctgcc tagacggctc gccagaagcg ccagaaagag acttgctagg 180 agaaaggcca gactgaacca ccttaagcac ctgatcgcca acgagttcaa gctgaactac 240 gaggactacc agagcttcga cgagtctctc gcgaaggcat acaagggcag cctgatcagc 300 ccttacgagc ttagattccg ggccctgaat gaactgctga gcaaagaga ctttgccaga 360 gtgatcctgc acatcgccaa gcggagaggc tacgacgaca tcaagataa tggagatgaa 420 gagaagggcg agaatcctgaa ggccatcaaa cagaacgagg aaaagctcgt cagctaccag 480 agcgtgggcg aatacctgta caaggagtac ttccaaaagt ttaaagaa cagcaaggaa 540 600 aaagacgagc tgaagctgat ctttcagaag cagaagaagt tcggcttcag cttcagcaag 660 aaattcgagg aagaggtgct gagcgtggcc ttctacaagc gggcccttaa agacttcagc 720 cacctggtgg gcaactgcag ctttttcacc your hand gagcccctaa gaactctcct 780 ctggccttca tgttcgtggc cctgacccgg attatcaacc tgctgaacaa cctgaagaac 840 accgagggca tcctgtacac caaggacgacgac ctgaacactc tgctcaatga ggtgctgaaa 900 aatggcacac tgacctacaa gcaaacaaa aagctgctgg gcctgtctaa tgactacgag 960 ttcaagggcg agaagggaac atatttcatc gagttccaga agtacaaga attcgtgaag 1020 gccctgggcg agcacacc gtctcaggat gacctgaacg agatagcta agatacacc 1080 ctgattaag acgagatcaa gctgaagaaa gctttggcca atacgacct gaaccagaac 1140 cagatcgact ccctgtcaa gctggagttt aaggaccacc tgaatctc ttcaggcc 1200 ctcaagctga ttacacctct gatgctggaa ggaaagaat acgatgaggc ctgtaatgag 1260 ctgaatctga aggtggctat taacgac aagaaggact tcctgcctgc ctcaacgag 1320 acatactaca aggatgagt gaccaatcct gtggtgctca gagccatca agaatacaga 1380 aaggtgctga acgccctgct gagaaatac agcaggtgc ataagatca catcgagctg 1440 gcccgggaag tggggaaaaaaaaaaaggccag cgcggccaag aactacaagg ctagaagga tgccgagctg gatgtgaa agctgggact gagatcaac 1560 agcaaaaaca tcctgaagct gagactgttc aaagagcaga aagaattctg cgtgtactcc 1620 ggcgaaaaaa tcaagatcag cgacctgcag gacgagaaga tgctggaaat cgatcacatc 1680 taccctaca gcagatcttt tgacgactct tacatgaaca aggtgctggt gttcaccaag 1740 caaaaccagg agaagctaaa caagacccct tttgagacat tcggcaacga cagagtgaag 1800 tggcagaaga tcgaggtgct ggccaagaac ctccctacaa agaaacagaa aagaatcctg 1860 gacaagaact acaaagacaa ggaacagaag gactttaaag atagaaaacct gaacgatacc 1920 agatacatcg cacggctggt gctgaattac accaaggatt acctggactt cctgcctctg 1980 tctgacgatg agaacaccaa gctgaacgac acccagaaag gaagcaaggt ccacgtggaa 2040 gccaagtctg gcatgctgac cagcaccctg cggcacacat ggggcttctc caccaaagat 2100 agaaacaatc acctccacca cgccatcgac gccgccatca tcgcctacgc caacaacagc 2160 atcgttaagg ccttctccga tttcaagaag gagcaggaga gcaacacagc cgagctgtac 2220 gccaagaaga tcagcgagct cgactacaag aacaagcgga agttcttcga gcctttttct 2280 ggctttagac agaagctgct ggataagatc gacgagatct tcgtgtccaa acctgagcgg 2340 aaaaagccca gcggcgccct gcacgaggaa accttcagaa aggaagaaga attctaccag 2400 tcttacggcg gcaaggaagg cgtgctgaag gccctggaac tgggcaagat cagaaaggtg 2460 aacggcaaga tcgtgtccaa cggcgacatg ttccgggtgg acatcttcaa acacaagaaa 2520 accaacaagt tctacgccgt gcctatctac accatggact tcgcccttaa ggtgctccca 2580 aacaaggccg tggtgcaggg caaggacaag aaaagcggcc tgatcaagga ctggatcctg 2640 atggacgaga actacgagtt ttgcttcagt ctgtataagg acagcctgat cctgatccag 2700 accaaggaca tgcaggagcc cgagcttgtc tactacgaga gactggacag cagcaatgcc 2760 agcctgacag tgtccaaaca tgataacaaa ttcgaaaccc tgtctaaaaa tcaaaagatc 2820 ctgttcaaaa acgccaatga aaaagaggtc atcgccaagt ccatcggcat ccagaacctg 2880 aaagtgttcg agaaatatat cgtgtctgcc ctgggagagg tgacaaaagc cgagtttcgg 2940 cagcgggaag atttcaagaa g 2961 <210> 25 <211> 3330 <212> DNA <213> Artificial Sequence <400> 25 atgagaatcc tgggattcga tatcggcatc accagcatcg gatggggccta cgtggaaggc 60 gaagagctga aagactgcgg cgtgcggatc ttcaccagg ccgagaaccc ccagaatggc 120 gabagcctgg cagctcctag aagagaggct agaggagtgc ggagacggct ggccagacgg 180 aaggtgcgac ttaatgtgat caaagactg ctgtgcaagg agttcggcct gatctgagc 240 gattacttcg ccaacgacgg cgagctgcct aaggcatacg agaccaccaa ggaccaccaag 300 agcccctacg agctgagaag cctggccctg gaacagaac tggaacccaa ggaactggct 360 agagtcatcc tgcacatcgc caagcacaga ggtacggca acagcacgc caagcgggac 420 ctggaagccg aggaaaagc caqaagcc gctgaaagg cccctcagga aaggaagt 480 acaaacca atggcgatag haaggaaggaagg tgctgaaggc cctctaccag 540 aatgaaacac tgctgaaaaa gtatcagaca aactaccaaaaaaaaaaaacgat 600 gagaccaca ataagaccat cttcctggtg ggcaagtacc tgtacaagga atttcaggac 660 aaaggccaga gatcagaaa caccacaac aactaccaac acaccatgcg gcaggaatgg 720 ctgaaggacg agctggaattt tatctcaag aagcagaagg acttcggcgc aacattttct 780 gagaactttg aaagccagat ctggagacg gccttttatc agagagatct gaagagcttc 840 gaggacaag tgggcaagtg cgtgttctac gagaacgaga atagagctcc taggatagc 900 ctgtctgcca tggaattcgt ggcattgacc cggattatca ataccctgaa aaatctggaa 960 aaaaaatcta agaacctggg aatcggcgag acatacggca aagacagat tcaggaatc 1020 ctgaaaattg tgctggacaa gggcgaaatg agctacaag agctgcggaa gatcctgaag 1080 ctgaacgaga gcatcctgtt tgccaagat agcaagctgg attacacaa gggcatgcag 1140 gaggccgaga aggctaagtt catcgagctc aaaaacctga aagctttca gaaggctg 1200 ggcggcgact tcagcaatt cccagagaa gaactggaca agatcgccac cgatatcgtg 1260 ctgatcaagt caaggaaa cctggccaag aactgcaga actacagcgc cctgtccaaa 1320 gagcaggtgg aagccctgtc taatctgaac ttcgccaagc acatcgacct gagcctgaag 1380 gctctggata agatcctgcc ttttatgaga gaggcttgt catatgatga ggttgtgaag 1440 aaggtgggcc tgcaggagca ccggaaatac aagcagaaag gcgagttcct gatccccctg 1500 aaagagtacg agccttacct ggccaacccc gtggtggcca gagccctgtc cgagtacaga 1560 aaagtcctga atgccctgct gagaaagtac ggcaacgtgc acaagattca cctggaattc 1620 acaagagagg ctggcaaaaa ctacgacgag agaaagaaaa tcgagaaaga gcagcgggaa 1680 cacttcgagg ccaaccagaa agctatcaag cagcgggaaa tcctgggcct gcctatcaac 1740 ggcgccaata tcctgaagat gaagctgtgg atcgagcagg gcgagtgctg cgtgtacagc 1800 ggcgagaaaa tcactagcaa acatttcttc gactccaacg ccctccaggt ggaccacatc 1860 taccctatt ctagatcttt tgatgattct tacatgaaca aagttcttgt gttcgccaag 1920 gagaaccaga acaagctgaa caagacccct ttcgaagctt ttggaagcga taaggaaaag 1980 tgggaccgga tcctgtccct gagcgccaag ctgccaaagc aaaagcaaag aagaatcagc 2040 aacaaggatt tcaaggacaa ggaactgggc ttcatcgcca ggaatatcaa cgacaccgga 2100 tatatcgcca ggctagcctc tcagtggaca aacaattgcc tgaagttcga ggatctgaga 2160 gaaaacgaag tgaccatcgc cggagaaaaa ggttcgaaga accacctgga ggtgatctcc 2220 ggccagctga ccagcatgct gcggcactac tggggctgg gcgatagga tcggacaac 2280 cacctgcacc acgccgtgga cgccgtcatc atcgcctac ccacgccaa gaccatcaag 2340 gctttcgccg atttcaagaaaaccaggag cagacagag ccaagttcta cgccaagcag 2400 atcagcgagc aggagtacaa aagacagcgc aatccctcg agccctgcgc caatttaga 2460 cagcgggtgg aagagagat caaaaatc ttcgtgtcca aacctccctcg gaagcgggcc 2520 agaggagccc tacatagga aacttttggc tccatctgtc tggacggtaa caacactgg 2580 gtggccagat tcagatca gagcagaaa gacaggagg acatcacca ggaaaaggcc 2640 acgaaggcca atacaaga tgagttcaag ggcgaggaaa acatccggaa agccctgaag 2700 ctgggcaga tcagacgaat cacaacc cagagata tcgccatcgg cgacagatac 2760 gtgaagaacg agacaatggt gcgggtcgat atctttaagg acagaaggg caattctac 2820 gccgtgccca tctacaccat ggacttcgct ttggtatcc tgcccacaa ggccgtggcc 2880 accggcgagg acgaggacgg cgtgatcaag gactggatcg agatggataa gaccaaatac 2940 gaattctgct tctccctgtt caaggacgac ctgatcaagg tgcggaagaa aaagatgaag 3000 gaagccgaac tgtgttactt cgtgggattt gacaccgacg gcagcagaat cattgtggct 3060 aaacataata acgactacca gaccatgacc gagaacgaat gtaaactgtt taccctgaag 3120 gaaaagaaga aaaagcaaaa gaccctgaac gacgaagagg acaaccagga gcggatcgag 3180 accgagtaca agatcattgg cggaagaacc ggcatccaga acctggagac cttcgagaag 3240 caccaggtca gccctctggg agaagtgcag aaagccgaat tcgaggatag acaggaaatc 3300 aaactgaaaa gcagccccaa gggaaaggac 3330 <210> 26 <211> 3246 <212> DNA <213> Artificial Sequence <400> 26 atgaagatcc tgtccttcga tatcggcgtc accagcatcg gctgggccta tgtggaaggc 60 gagaagctga aagattgcgg cgtgcggatc tttaccaagg ccgagaatcc tgagaacgga 120 gatagtctgg ccgctcctcg gagggaagcc agaggcgtgc ggagacggct ggccagaaga 180 aaggtgcggc tgaacgtgat caagagactg ctgtgcaagg aattcggcct gaacctgagc 240 gactactttg ccaacgatgg cgaacttcca aaggcttatg aaaccaaa ggatacaaag 300 agcccctatg agctcagaag cctggcgctc gaagaagagc ttgaacctaa ggacctggcc 360 cgggtgatcc tgcacatcgc caagcacaga ggatacggaa ataaacacgc caagcggac 420 ttagaggccg aggaaaaagc taagaagcc gccgaaaagg tgcctcagga gaagagagc 480 accaccacca atggcgacag caagaaggaa caggaaaagg tcctgaaggc tctgtaccag 540 aacgagaccc tgctgaaaaa ctaccaaatc aactaccaga ccaatgacga gacaacaac 600 aaaactattt tcctggtggg caaatatctg tataagggt ttcaggacaa gggccagaga 660 720 ctggagttca ttttcgccaa acagcgggaa ttcgggtttc cattctctga gaagctgtat 780 aaggtggcga cagagaacaa caagacaaaaa gaactggact tcgcttctgc cataatggaa 840 accgccttct accagcggga cctgaaatcc ttcgaggata aggttggaaa gtgcgtgttc 900 tacgagaacg agaatagagc ccctaaggac tctctgagcg tgatggaatt cgtggcactg 960 accagaatca tcaacacact gaagaacctg gaagagaagt ccaagaacct cggcatcgga 1020 gagacctacg ccaaggataa gatccaggag atactcaaaa tcgtgctgga caaggggaa 1080 atgagctaca aagagctgcg aaaaatcctg aaactgaatg agagcatcct gttcgctaag 1140 gaccccaagc tggactacac aaaggcgtg caggaggccg agaaggcaaa gttcatcgag 1200 ctgaagaatc tgaaggcctt caaaaaggcc atgggcggcg agacagagca aaaggccaac 1260 aagaaaacca agaaaaccat cgaggtgtct ctggaaagct ttgacagaaa agaagctggac 1320 1380 aactaccctg ctctgtccaa ggaacaagtc gaagccctga gcaacctgaa cttcgccaaa 1440 catatcgacc tgagcctgaa ggccctggac aagatcctgc ctctgatgag agaggccctg 1500 agatacgacg aggccgtgaa aaaggctggc ctgcaggaac acagaaagca caaccagaag 1560 ggcgagttcc tgattcctct gaaggagtac gagccttacc tggccaaccc cgtggtggcc 1620 agagccctga gcgaatacag aaggttctg aacgccctgc tgaaaagta cggcaagtg 1680 cacagatcc acctggaatt tacagagaa gccaagctgt ctgccaagga agacagaag 1740 tacgaaaaag aacaacggga acacttcgag gcaaccaga acgccatca gcagtgcgag 1800 aagctggatt tgaggctga cggagctac atcttaaga tgagctgtg gatcgacag 1860 ggcgagtatt gcgcctacag cgtgaagaag atcaccaccg aggacctgaa ggacagcac 1920 aagctgcaga tcgaccacat ctacccctac tccagaagct ttgatgatag ctacatgaac 1980 aaggtgttag tgttcagca ggaaaaccag aacaagctga acagacacc ttcgaggct 2040 tttggatctg ataaagagaa gtgggataga atcctcagcc tgtctgctaa gctgcctaaa 2100 cagaaacaaa gacggatctc taacaccac ttcaaggaca aggaggtgg cttccttgcc 2160 agaaacatcg tggacaccgg ctacatcgcc cgcctggcca gccagtggac caccactgt 2220 ctgaagttcg aagatctgag agagaatgag gtgaccatca caggcgagaa gggttcaagc 2280 gtgcacatcg aggtggtgtc cggcagcctg accgccacac tgcgccacta ctggggcctg 2340 ggagataagg accggaacaa tcacctgcac cacgccgtgg acgccatcat cctggcctac 2400 gtgaacgaca ccatgatcca ggcctttgcc aacttccgga agaaccagga gcaaaacaag 2460 gctaagttct acgccaagca gatcgccgaa tctgaataca aggccaaaaa ggctttcttc 2520 gagccctgcg agaacttcag agataaggtg ctgaagaagc tggatagcat cttcgtgtcc 2580 aagcctccaa gaaagcgggc ccggggcgcc ctgcataagg aaaccttcta cagcttcgag 2640 gatgaaaagc tgctgaagag ctacggcggc aagcagggcg tgcagagagc tatcgacctg 2700 ggcaagatca gacggatcgg caccaagatt gtgtccaacg gcgccatggt cagagtcgat 2760 atcttcaagc acaaggaagg caagttctac gccgtgccca tctacaccat ggacttcgcc 2820 ttcggcgagt ggcctaacaa ggccgtggcc acaggcaaag atgaggacgg cgtgatcaag 2880 gactggatcg agatggacag cgactacgac ttttgtttta gcctgttcaa ggacgacctg 2940 atcaaagtta agaaaaagaa gatgaaggag gctgaattct gttacttcaa aagattcaag 3000 acaagcggcg ccagcattga gatcgtgaag cacgacaata gagctgataa cctaaacggc 3060 aaccaggaaa aaatcttcaa ggtgaagctg gaaaacaatc agaaaatcct ggacaagagc 3120 ctgatcagta tccagaacct ggagatcttc gaaaaatggc aagtgagccc tctcggcaag 3180 gttcagaagg ccgtgcccga gtctagacag ggaataaagc tgaagagcag cctgaagaga 3240 aagggc 3246 <210> 27 <211> 3090 <212> DNA <213> Artificial Sequence <400> 27 atgaaaatcc tgggctttga tattggcata acatctatcg gatgggccta cgtggaagga 60 gaagaactca aagactgcgg cgtgcgcatc ttcaccaagg ctgaaaatcc taagaatggt 120 gactccctgg cagcccctcg gagagaggcc agaggcgtcc ggcggcggct ggcacggaga 180 aaggccagac tgaatgccat caaaagactg ctgtgcaagg aattcggcct gaacctgtct 240 gattacctgg ctaatgatgg cgaactgcct aaggcctacc aaactagcaa ggagcataag 300 agtccttatg aactgagaac cctggccctg agccagaagc tggactctaa agacctggct 360 cgggtgatcc tgcacatcgc gaagcacaga ggctacggca acaagcacgc caaaacaggg 420 tctgacaag acagcggcaa gtgctgtcc gccacaag tcaacgac cgccatgaag 480 ghaagtacc agagcgtgggg cgaatactctg tacaggaat tctaccagaa gctgcggctg 540 gagagcgaaaaaaggcaaaaaaaggcaaaaaaaacktca agaaaaaaaaaaaaaaaaaaaaaaaaaaching 6 being 600 gagtcctacg agcattgtgt ggcccaggag caggtgagag ccgagctgga gctgatcttc 660 gccaagcaga aagagttcgg aatcaccttc agcgagaact tcgagagcca gatcatcgag 720 acagccttct accagaagga ccttaaatct ttcgaaaca aggttggcaa gtgcgtgttc 780 tatgatgagc ccagagcccc taggatagc ctgagcgcca tcgagttcgt tgccctgaca 840 aggataatca acaccctgaa gatctagaa gagagagca agaatctggg cattggcgag 900 gcctacggca aggacagat ccaggagatc ctgagatcg tgctggacaa gggcgagat 960 agctacaaga aactgagaga gatcctgcac ctggatgagt gcatcctgtt cgccaaggat 1020 agcaagctgg actacaccaa gggcatgcag gaggccgaaa agcaagct gatcgagttt 1080 aagaacctga aggccttca gaggccatg gcgagatt tcggcagtt gagagaga 1140 gagctggata gcatcgccat ggacatcgcc cttatcaaga gcaaagaaaa cctggctaag 1200 aaactgcaga actacagcgc cctctctaaa gaacaggtgg aggccctgag caacctgaat 1260 ttcgccaagc acatcgacct gagcttcaag gccctggaca agatcctgcc tttcatgaga 1320 gagggcctga gatacgacga ggctgtgaag aaagctggcc tccaggagca tagaaagcac 1380 aagcagaaag gcgaatttct gatccccctg aaggactacg agccttacct ggccaacccc 1440 gtggtggcca gagctctctc tgagtacaga aaggtgctga acgccctgct gcgcaagtac 1500 ggcaacgtgc acaagataca cctggaattc acccgggagg ccggcaagaa ctacgacgag 1560 agaaagaaga tcgaaaagga acagcgggaa cacttcgagg ctaaccagaa ggccatccag 1620 cagtgtgaaa tcctgggact gcccatcaat ggtgctaaca tcctgaagat gaagctgtgg 1680 atcgagcaga aagaactgtg cgtgtacagc gacagaaaaa ttacaagaga gcaccttctg 1740 gattccaagg tgctggaagt ggaccacatc tatccctatt cccggtcctt cgacgattct 1800 tatatgaaca aggtcctggt gttcgccaag gagaaccagg gcaaaggcaa caagacccct 1860 tttgaggcct ttggaaacga caaggagaag tgggatagaa tcctgagcct gtctgccaat 1920 ctgccaaagc aaaagcaaag aagaatcagt aacaaggact tcaaggataa ggaactgggc 1980 ttcatcgccc ggaacatcaa cgacacaggc tacatcgcca gactcgctag ccaatggacc 2040 aaccactgcc tgaaatttga aaacctgagc gagaacgagg tgagcatcgc cggagaaaag 2100 ggctccaaga accacttgga agtgatctcc ggccagctga ccagcatgct gagacactac 2160 tggggcctgg gaaacaaaga ccggaacaac cacctgcacc acgccgtgga cgccgtgatc 2220 ctggcctaca ccaacaacgc catgatcaag gccttcgcca atttcagaaa gaaccaagag 2280 gaaaacaaga agaagtttta cgccaagcag atcgccgaga gcgagtacaa ggccaagaaa 2340 gcttttttcg aaccttgcaa aaacttccgg cagatggtgc tggacaaggt ggatagcatt 2400 tttgtgagca agccacctag aaagcgggcc agaggcgccc tgcacaaaga gacattctac 2460 agcttcgaga aactgtgcaa cgacaaggag tactccaaag acaacaagat ggactacggc 2520 ggccagaaag gcatcgagcg ggccctggaa ctgggaaaga tcagacaggt gggaacaaaa 2580 atcgtaagca atggcgccat ggtccgcgtg gacatcttta aggacaaaaa aggaaagttc 2640 tacgccgtgc ctatctacac catggacttc gccctgggca tcctccccaa caaggccgtg 2700 gccatcggca aagacaagga cggcgtgatc aaggactgga tcgagatgga cagcaattac 2760 accttctgct tcagcctgtt caaagatgac ctgatcctgg tgaagaagaa agaaatggaa 2820 aaggccgagc tgtgttactt cgtgtctttc gacaccagca ccgccagcat ccaagttgaa 2880 aagcacaaca acaagttcga gggcctgagc gagaacgaga agatcctgta ctctaatgct 2940 acacagaagg aagtggtggg aaagagcatc ggcatccaga acctgaaaac cttcgagaag 3000 taccaggtgt ctccactggg cgagatgcag aaggctgagt tcgaaccttg tcaggacatc 3060 gctttaaaat ctagccctaa gaggaagaac 3090 <210> 28 <211> 3108 <212> DNA <213> Artificial Sequence <400> 28 atgagaattt tcggcttcga catcggcatc accagcatcg gctgggccta cgtggaaagc 60 aatgagctga aagactgtgg cgtgcggatt tttaccaagg ctgaaaaccc caagaacggc 120 aagtccctgg ccctgccacg gaggaggcc cggggtgcca gacggagact ggccagacgg 180 aaggccccgg tgaacgccat caagagactg ctgtgcaagg agttcggcct gaatgtgtct 240 gattactttg ccaacgacgg cgagctccct aaggcctacg agaccaccaa ggatacaaag 300 agccctacg agctgcggag cctggctctg gagcaaaagc tggaacctaa ggaactggcg 360 cgggtgatcc tgcacatcgc caagacacaga ggctatggca acaaacatgc caagacaggc 420 agcgacaagg attctggcaa agtgctgtcc gccatcaagg tcaacgagac agccatgaag 480 gataaatacc aatctgtggg cgagtacctg tacaaggaat tttaccagaa gctgcggctg 540 gaagcgaga agaaaggcaa caatatcacc aaggagttta aaaatgtgag aaacaaggga 600 gagaactacg agcactgtgt ggctcaggag caggttagag ccgaactgga actcatcttc 660 gccaagcaga aggattttgg cgctacattc agcgagaact tcgagtccca gattatagag 720 acagccttct accagcggga cctgaaaagc ttcgaagata aggtgggaaa atgcgtgttc 780 tacgagaacg aaaacagagc ccctaaggac agcctctctg ccatggaatt tgtggccttg 840 acccggatca tcaacaccct gaagaatctg gaggaaaagt ccaagaacct cggcatcggc 900 gaggtgtacg caaaggataa aatccaggag atcctaaaga tcgtgctgga caagggcgaa 960 atgagctaca agaaactgag agaaatcctc cacctggacg agcacatcct gttcgccaaa 1020 gatagcaagc tggattacac gcagggcgtc caggaagctg agaaggccaa gttcatcgag 1080 ctgaagaacc tgaaggcctt caagaaagct atgggcggcg atttcagcaa tttcgcccgc 1140 gaaactgg ataagatcgc caccgacatc accctggtca agagcaagga aaacctggct 1200 aagaaactgc aaaactacag cgccctgagc aaggagcaag tggaagccct gtctaatctg 1260 tctttcgcta agcatatcga cctgagcctg aaggccctgg aacagatcct ccctttcatg 1320 cggggcgaca aaccggcaa gtgcctgaga tacgacgaag ccgtgaagaa ggccgagctg 1380 caggaacaca gaagcacaa gcaaaaggga gagttcctga tccccctgaa ggactacgaa 1440 ccctacctgg ccaaccctgt ggtggcaaga gccctctcgg agtagaaa ggtgctgaac 1500 gcccttctga gaagtacgg aaaggtgcac aaaatccacc tggaatttac cagagaggcc 1560 aaactgagcg ccaaggagag acagaaatac gagaaggagc agaagagca cttcgaggcc aatcagcggg ctattcagca gtgcgagatc ctgggcctgc caatcaacgg cacaaacatc ctgaagatga agctgtggct ggaacaaggc gagtgctgcg cctactctgg cgaaaaaatc acaagagagc acctgctgga ctctaatgcc ctgcaggtgg accacatcta cccttactcc agagcttcg acgacagcta catgaacaag gtcctggtgt tcgccaagga aaaccaggac aagggcaata aaaccccttt cgaggcctttt ggcggagaca aggagaagtg ggacagaatc ctgtctctga gcgccaagct gcccaagcag aagcagagaa gaattagcaa taccaatttc aaggacaagg aaggcggctt cctggcccgc aacctgaacg atacaggcta catcgccaaa cttgctagcc aatggaccaa ggattgcctg gattcgagg acctgagaga gaacgaggtg accatcgctg gcgagaaagg aagcagcgtg cacatcgagg tcgtgagcgg ccagctgacc agcatgctgc ggcactactg gggtctgggc aacaaggata gaaacaacca cctgcaccac gccgttgacg ccgttatcct ggcctataca aacaacgcca tgatcaaagc cttcgccaac tttagaaaga accaggagga gacagaag aagttctacg ccaagcagat tgcagagagc 2340 gattaagg ctaagaggc cttcttcgag ccttgtaaaa acttccggca gagagtggaa 2400 gagaaaatta aggaatctt cgtgtccaaa cctcctagaa agagggtgcg cggcgccctg 2460 catcaggaga cattctaccc ctcgagaag tgtgcaacg acaggagta ctccgagaag 2520 ctgaaaatgg actatggtgg agagaagggc atgcagaaag ctattgccct gggaagatc 2580 agacagatcg gcaccagat cgtgtctaac ggagccatgg taagagtgga tatctttaag 2640 gaagaaag gaaagttcta cgcagtgcct atctacacca tggattttgc cctggggcatc 2700 ctgccaaca aggccgttgc tatcggcaa vakaaggacg gcgtgatcaa ggactggatt 2760 gagatggaca gcaattatga ttctgcttc agcctgttca aggatgacct gatcctggtg 2820 cagaagaagg aaatggaaag agccgagctg tgttactcg tgagctcgg ctcacaaac 2880 gcccagatca acgtggaaaa gcacaacac aagttcgagg gcctcagcga gaacgagaag 2940 atcctgtact ctaacgccac acagaggag gtggccggca agagcatcgg aatccagaac 3000 ctgaaaacct tcgagaagta ccaggtgtcc cctctgggcg aagtgcaaaa ggctgagttt 3060. gagccccacc aggagatcaa gctgaagagt agccctaagc ggaaggac 3108. <210> 29 <211> 3171 <212> DNA <213> Artificial Sequence <400> 29 60. atgagcgaca aatccaagat cctgggattc gacatcggca tcaccagcat cggctgggcc 120. tacgtggaag gcgaagagct gatcgactgc ggcgtccgga tctttaccaa ggccgagaat cccaagacca aagaatccct ggccctgcct agacgggag ctagaggcgt gcggcggaga ctggcccgaa gaaaaggcag actgaatgcc atcaagcaac tgatctgcaa ggaattcggc ctgaactacc aagactacat cgctcaggac ggcgagctgc ccaaagccta cgccgggaag ctgattaacc cttatgagct gagatctaag gcccttagag agaagctgga aaaggaagag ctggcccgag tgattctgca catcgccaag caccggggct acggaaacaa gcatgccaag 420 gaaaccgacg atgccgagag cggcaagatc aagaaagcaa ttagcaacaa tgagaagatc ctgaatgaga agggatatca gagcgccgga gagtacctgt accaggaatt tttccagaaa 540 gaaagactgc aggaaaa gaagggcaac aacacgacca aagaattca aaatgtgagg 600 aacaaagctg gcgactacga gcactgtatc gctcagaccc agatgcagaa cgagttgagg 660 cttatttcg agaagcagcg agagttttggc ctgaacttca gcgaggaatt cagagaaa 720 gtgctggaga cggccttttt tcagacct ctgagact tcagcgata gatcggcgat 780 tgcaccttca tcgagggcgc caagcgggcc cctaggaca gcctgagcgc catcgagttc 840 gtggccctgg gagaatcat cacaccctg aaaaatctgc agacacaag cggcgaggtg 900 tacagcagag atagatcaa cgagatcctg caatcgtgc tggataaggg cgagatcagc 960 tacagaaac tgagagaaat cctggacatc gagagcagcg tgcgttttcaa ggacagcaaa 1020 ctggattaca ccaagaact gaggaagcc gagaaaacca agctgttcga gaggagaac 1080 ctccagaaat tcaagaagc tctgggcagc tctccagaga gatcttggac 1140 agtatcgcca aggagatcat gatcacaag gataagaga agctggccaa ggagctgaag 1200 aagttccctc tggatgaaac ccagatccag aacctttcta acttgtcctt cagccaaaca atcaacctgt cactggaagc cctgtctcag atcctgccct tcatgagagg cgagagag 1320 gacaaatgcc tgagatacga cgaggctgtg gaaaaggccg gcctgaagga ggtggccaaa aacaagtcta aggatgactt cctgcctcct ctggaaaact acgagcctta cctggccaat cctgtggtgg cccggggccct ctctgagtat agaaaggtgc tgaacgccct gctgagaaag tacggcaaga tgcacaagat tcacatcgag tttaccagag aagtgggcaa gagcaaagag gagcggaca aaatcgaaaa agaacagaaa gagaatttcg ccaaaaacca ggaggcccag aagcagtgcg agatcctggg cctgcctatc aacggcgcta atatcctgaa gatgaagctg tggcgggagc agcaggagtc ctgcgtgtac agcggcaagg aaatcgccat cgacgacctg 1740. aagaaccccg ccatcctgca ggtggatcac atctatcctt actctagaag ctttgatgat tcttataaca acaaggtgct ggtgttctcc aaagaaacc agaacaaact aacaaact 1860s cctttcgagg ctttcggcga aaacaaggac aaatggggaga aaatcctgtc cctggcttct aagcttccta agcctaagcg ccagaggatc tacaacatgc agttcaagga caaagaacaa 1980 ggctttctga cccggaatat caacgacacc ggctacatcg ctagactggt cagccagtgg 2040 aaaagaact gcctgagctt cgagaagctg agcgaggatg aggtttccat cgccggcgag 2100 aaaggaagca aagtgcacgt ggaagtgatc agcggctccc tgacagccat gctgcggcac 2160 tactggggcc tgggcgacaa gaaccgggac aaccacctgc accacgcggt ggacgccatc 2220 atcatcgctt atagcaacga aaaggtgatc aaggccttct ctgattacaa aaaacataga 2280 2340 aaggttttct tcgaacctac caaccacttc agaaaaag tgctggaaaa gattgacagc 2400 atcttcgtga gcaaacctcc aaagaaga gcccggggag ccctgcacga ggaaacattc 2460 tacagcttcg agagactgtg caacgacaag gagtacgcca agaaagagaa gatggactac 2520 ggcggaaagg ctggcatcca gaaggctatc gccctgggta aaattagaca ggttggaaca 2580 aagatcgtgt ctaacggcac catggtgcgg gtggacatct tccagcacaa gagcaacggc 2640 aagttttacg gcgtccccat ctacacaatg gattttgccc tcggcgtgct gcctaacaag 2700 gctgtggtgt ccggaaaaga taagcaggga gtgatcaagg actggctgga aatggacagc 2760 aactacgagt tttgcttcag tctcttcaag gacgacctga tcctggtgca gaaaaaggag 2820 atggaaaaag cagaactgtg ctactacacc gattttaaca gcaacacggc cggcatcaaa 2880 ttcg...

Claims

1. A Cas9 protein, wherein the Cas9 protein is an Hsp1-Hsp3Cas9 protein with an amino acid sequence of SEQ ID NO: 17, an Hsp1-Hsp3Cas9-Y446A protein with an amino acid sequence of SEQ ID NO: 18, or an Hsp1-Hsp3Cas9-K390A-Y446A protein with an amino acid sequence of SEQ ID NO:

19.

2. A conjugate, comprising: a) the Cas9 protein according to claim 1; b) a modifying moiety selected from another protein or polypeptide, a detectable label or a combination thereof, wherein The additional protein or polypeptide is selected from one or more of an epitope tag, a reporter protein or a nuclear localization signal sequence, a cytosine deaminase, an adenine deaminase, a cytosine methylase DNMT3A and MQ1, a cytosine demethylase Tet1, a transcription activator protein VP64, p65 and RTA, a transcription repressor protein KRAB, a histone acetylase p300, a histone deacetylase LSD1, and an endonuclease FokI; and c) an optional linker for connecting the Cas9 protein to the modification portion.

3. The conjugate according to claim 2, wherein The linker is a linker with a length of 1-50 amino acids.

4. A fusion protein, comprising: a) the Cas9 protein according to claim 1; b) another protein or polypeptide, wherein, The additional protein or polypeptide is selected from one or more of an epitope tag, a reporter protein or a nuclear localization signal sequence, a cytosine deaminase, an adenine deaminase, a cytosine methylase DNMT3A and MQ1, a cytosine demethylase Tet1, a transcription activator protein VP64, p65 and RTA, a transcription repressor protein KRAB, a histone acetylase p300, a histone deacetylase LSD1, and an endonuclease FokI; and c) an optional linker for connecting the Cas9 protein to the additional protein or polypeptide.

5. The fusion protein according to claim 4, wherein The linker is a linker with a length of 1-50 amino acids.

6. An isolated nucleic acid molecule comprising a nucleic acid sequence encoding: a) the Cas9 protein according to claim 1; b) the conjugate of claim 2 or 3; or c) The fusion protein according to claim 4 or 5.

7. The isolated nucleic acid molecule according to claim 6, wherein The isolated nucleic acid molecule comprises the nucleic acid sequence shown in any one of SEQ ID NO:38, SEQ ID NO:39 and SEQ ID NO:40 or a degenerate sequence thereof.

8. The isolated nucleic acid molecule according to claim 6 or 7, wherein the isolated nucleic acid molecule further comprises a nucleic acid sequence encoding a single-stranded guide RNA, the single-stranded guide RNA comprises a scaffold sequence, the nucleic acid sequence of the scaffold sequence is the sequence shown in SEQ ID NO: 43, or is a sequence modified based on the sequence shown in SEQ ID NO: 43 and retains its biological activity.

9. The isolated nucleic acid molecule according to claim 8, wherein The modification is one or more of base phosphorylation, base sulfurization, base methylation and base hydroxylation.

10. The isolated nucleic acid molecule according to claim 8, wherein The single-stranded guide RNA further includes a guide sequence at the 5' end of the scaffold sequence, wherein the guide sequence is a sequence with a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides and can complementarily pair with the target sequence.

11. The isolated nucleic acid molecule according to claim 10, wherein The guide sequence is a sequence with a length of 22 nucleotides and capable of complementary pairing with the target sequence.

12. The isolated nucleic acid molecule of claim 8, wherein The isolated nucleic acid molecule comprises the nucleic acid sequence shown in SEQ ID NO:

45.

13. A vector comprising a nucleic acid sequence encoding: a) the Cas9 protein according to claim 1; b) the conjugate of claim 2 or 3; or c) The fusion protein according to claim 4 or 5.

14. The carrier according to claim 13, wherein The vector comprises the nucleic acid sequence shown in any one of SEQ ID NO: 38, SEQ ID NO: 39 and SEQ ID NO: 40 or a degenerate sequence thereof.

15. The vector according to claim 13 or 14, wherein The vector is a plasmid vector.

16. The carrier according to claim 15, wherein The vector is a pUC19 vector, an episome vector, a pAAV2_ITR vector, a retroviral vector, a lentiviral vector, an adenoviral vector or an adeno-associated viral vector.

17. The vector according to claim 13 or 14, wherein The vector further comprises a nucleic acid sequence encoding a single-stranded guide RNA, wherein the single-stranded guide RNA comprises a scaffold sequence, and the nucleic acid sequence of the scaffold sequence is the sequence shown in SEQ ID NO:43, or a sequence modified based on the sequence shown in SEQ ID NO:43 and retaining its biological activity.

18. The carrier according to claim 17, wherein The modification is one or more of base phosphorylation, base sulfurization, base methylation and base hydroxylation.

19. The carrier according to claim 17, wherein The single-stranded guide RNA further includes a guide sequence at the 5' end of the scaffold sequence, wherein the guide sequence is a sequence with a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides and can complementarily pair with the target sequence.

20. The carrier according to claim 19, wherein The guide sequence is a sequence with a length of 22 nucleotides and capable of complementary pairing with the target sequence.

21. The vector according to claim 17, wherein The vector comprises the nucleic acid sequence shown in SEQ ID NO:

45.

22. A CRISPR / Cas9 gene editing system, comprising: a) a protein component comprising: 1) The Cas9 protein of claim 1; 2) The conjugate according to claim 2 or 3, or 3) The fusion protein of claim 4 or 5; and b) a nucleic acid component, comprising a single-stranded guide RNA, wherein the single-stranded guide RNA comprises a scaffold sequence, wherein the nucleic acid sequence of the scaffold sequence is the sequence shown in SEQ ID NO: 43, or is a sequence modified based on the sequence shown in SEQ ID NO: 43 and retains its biological activity; Furthermore, the protein component and the nucleic acid component are combined with each other to form a complex.

23. The CRISPR / Cas9 gene editing system according to claim 22, wherein: The modification is one or more of base phosphorylation, base sulfurization, base methylation and base hydroxylation.

24. The CRISPR / Cas9 gene editing system according to claim 22 or 23, wherein: The single-stranded guide RNA further includes a guide sequence at the 5' end of the scaffold sequence, wherein the guide sequence is a sequence with a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides and can complementarily pair with the target sequence.

25. The CRISPR / Cas9 gene editing system according to claim 24, wherein: The guide sequence is a sequence with a length of 22 nucleotides and capable of complementary pairing with the target sequence.

26. A cell comprising: an isolated nucleic acid molecule according to any one of claims 6 to 12, or a vector according to any one of claims 13 to 21, wherein the cell is a non-plant cell, and the cell is not a reproductive cell, a fertilized egg or an embryonic stem cell from an animal.

27. The cell according to claim 26, wherein The cell is a prokaryotic cell or an animal cell.

28. The cell according to claim 27, wherein The animal cells are mammalian cells.

29. The cell according to claim 28, wherein The mammalian cells are human cells.

30. A method for non-therapeutic purposes of gene editing a target sequence in a cell or in vitro environment, the method comprising: Contacting any of the following (1) to (4) with a target sequence in a cell or in vitro environment: (1) the Cas9 protein according to claim 1, the conjugate according to claim 2 or 3, or the fusion protein according to claim 4 or 5, and a single-stranded guide RNA, (2) A vector according to any one of claims 13 to 16 and a vector comprising a nucleic acid sequence encoding a single-stranded guide RNA; (3) The vector according to any one of claims 17 to 21; and (4) The CRISPR / Cas9 gene editing system according to any one of claims 22 to 25; wherein, after contacting with the target sequence, the Cas9 protein, its conjugate or fusion protein recognizes the respective protospacer adjacent sequence PAM, the PAM is located at the 3' end of the target sequence, and, for the Hsp1-Hsp3Cas9 protein, the Hsp1-Hsp3Cas9-Y446A protein and the Hsp1-Hsp3Cas9-K390A-Y446A protein, or their respective conjugates or fusion proteins, the PAM is 5'-NNNNCY, 5'-NNNNCY and 5'-NNNNCY, respectively; Wherein, the single-stranded guide RNA comprises a scaffold sequence, and the nucleic acid sequence of the scaffold sequence is the sequence shown in SEQ ID NO:43, or is a sequence modified based on the sequence shown in SEQ ID NO:43 and retains its biological activity.

31. The method according to claim 30, wherein: The modification is one or more of base phosphorylation, base sulfidation, base methylation, and base hydroxylation.

32. The method according to claim 30 or 31, wherein: The single-stranded guide RNA further includes a guide sequence at the 5' end of the scaffold sequence, wherein the guide sequence is a sequence with a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides and can complementarily pair with the target sequence.

33. The method of claim 32, wherein: The guide sequence is a sequence with a length of 22 nucleotides and capable of complementary pairing with the target sequence.

34. The method according to claim 30 or 31, wherein: The cell is a prokaryotic cell or an animal cell.

35. The method of claim 34, wherein: The animal cells are mammalian cells.

36. The method of claim 35, wherein: The mammalian cells are human cells.

37. The method according to claim 30 or 31, wherein: The gene editing includes one or more of gene knockout of the target sequence, site-specific base changes, site-specific insertions, DNA methylation regulation, DNA acetylation modification, histone acetylation modification, and chromatin imaging tracking.

38. The method according to claim 30 or 31, wherein: The gene editing includes regulation of gene transcription level.

39. The method according to claim 30 or 31, wherein: The gene editing includes single base conversion.

40. The method of claim 39, wherein: The single base conversion includes the conversion of the base adenine to guanine, the conversion of cytosine to thymine, or the conversion of cytosine to uracil.

41. The method according to claim 30 or 31, wherein: The CRISPR guide sequence of the single-stranded guide RNA forms a complete base complementary pairing structure with the target sequence, and forms an incomplete base complementary pairing structure with the non-target sequence.

42. The method according to claim 41, wherein: The incomplete base complementary pairing structure includes one or more base mismatch structures.

43. The method of claim 42, wherein: The incomplete base complementary pairing structure includes a structure with two or more base mismatches.

44. A kit for gene editing a target sequence in a cell or in vitro environment, comprising: a) selected from any one of the following 1) to 6): 1) the Cas9 protein according to claim 1, the conjugate according to claim 2 or 3, or the fusion protein according to claim 4 or 5, and a single-stranded guide RNA, 2) An isolated nucleic acid molecule according to claim 6 or 7 and an isolated nucleic acid molecule comprising a nucleic acid sequence encoding a single-stranded guide RNA; 3) The isolated nucleic acid molecule according to any one of claims 8 to 12; 4) A vector according to any one of claims 13 to 16 and a vector comprising a nucleic acid sequence encoding a single-stranded guide RNA; 5) A vector according to any one of claims 17 to 21; or 6) The CRISPR / Cas9 gene editing system according to any one of claims 22-25; as well as b) Instructions for performing gene editing on target sequences in cells or in vitro; in, The single-stranded guide RNA comprises a scaffold sequence, and the nucleic acid sequence of the scaffold sequence is the sequence shown in SEQ ID NO:43, or is a sequence modified based on the sequence shown in SEQ ID NO:43 and retains its biological activity.

Images