Novel coronavirus antibody test strips, kits, and preparation methods and applications thereof

Abstract

The present invention provides a novel coronavirus antibody detection test strip, a kit, and a preparation method and application thereof. The novel coronavirus antibody detection test strip provided by the present invention comprises a bottom plate, on which there are a sample pad, a gold label pad, a nitrocellulose membrane and a water-absorbing pad in sequence, and the gold label pad contains a novel coronavirus recombinant protein S1 labeled with colloidal gold; the nitrocellulose membrane comprises a detection line and a quality control line, on which the novel coronavirus recombinant protein S1 is immobilized, and on which the novel coronavirus positive serum is immobilized; wherein the novel coronavirus recombinant protein S1 is a protein encoded by the nucleotide sequence shown in SEQ ID No.1. The novel coronavirus antibody detection test strip provided by the present invention is assembled into a kit with a sample diluent and can be used to detect the serum of different animals, and can also be used for novel coronavirus traceability detection, novel coronavirus animal infection model research, drug screening, and vaccine evaluation, etc.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and specifically relates to a novel coronavirus antibody detection test strip, a kit, and a preparation method and application thereof. Background Art

[0002] Coronavirus (Coronaviridae) belongs to the Coronavirus genus of the Coronaviridae family. The coronavirus genus is a positive-stranded single-stranded RNA virus with an envelope, about 80-120nm in diameter, and its genetic material is the largest of all RNA viruses. It has a wide range of host infections and can infect humans, mice, pigs, cats, dogs, and avian vertebrates. A variant of the coronavirus is the pathogen that causes atypical pneumonia and is an RNA virus.

[0003] On February 29, 2020, China and the World Health Organization jointly released the "Joint Investigation Report on Novel Coronavirus Pneumonia (COVID-19)", which clearly pointed out that "the new coronavirus is an animal-derived virus, but the intermediate host has not yet been identified." It is urgent and of long-term significance to trace the natural host and intermediate host of the new coronavirus as soon as possible and take targeted prevention and control measures from the source.

[0004] Therefore, for the research on the origin of the new coronavirus and its transmission routes, there is an urgent need for high-throughput detection methods and reagents that can be used for new coronavirus antibodies in the sera of different animals to solve the problem of tracing the origin of different animals.

[0005] During the preparation of the test strips, the technicians of the present invention found that the matrices of sera from different animal sources were different, resulting in false positive test results. They considered developing a sample diluent to eliminate the influence of the matrix in sera from different animals and improve the accuracy of the test. Summary of the invention

[0006] In order to address the deficiencies of the prior art, the present invention provides a novel coronavirus antibody detection test strip prepared based on the double antigen sandwich principle, and a novel coronavirus antibody detection kit assembled from the test strip and a special sample diluent.

[0007] The first aspect of the present invention provides a novel coronavirus antibody detection test strip, which comprises a base plate, on which are arranged in sequence a sample pad, a gold label pad, a nitrocellulose membrane and a water absorbent pad, the gold label pad containing a novel coronavirus recombinant protein S1 labeled with colloidal gold; the nitrocellulose membrane comprises a detection line and a quality control line, the detection line is immobilized with the novel coronavirus recombinant protein S1, and the quality control line is immobilized with novel coronavirus positive serum; wherein the novel coronavirus recombinant protein S1 is a protein encoded by the nucleotide sequence shown in SEQ ID No.1.

[0008] According to some embodiments of the present invention, the new coronavirus antibody detection test strip includes a base plate, which has a first end and a second end, and has a sample pad, a gold label pad, a nitrocellulose membrane and a water-absorbing pad in sequence along the direction from the first end to the second end. The nitrocellulose membrane is in contact with the gold label pad or with the sample pad and the gold label pad so that the complex of the new coronavirus antibody and the new coronavirus recombinant protein S1 can migrate thereon toward the second end of the base plate.

[0009] According to some embodiments of the present invention, the amount of the colloidal gold-labeled SARS-CoV-2 recombinant protein S1 is 5-35 μg / ml, for example, it can be 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 μg / ml.

[0010] According to a preferred embodiment of the present invention, the amount of the colloidal gold-labeled SARS-CoV-2 recombinant protein S1 is preferably 10-20 μg / ml.

[0011] According to a preferred embodiment of the present invention, the amount of the colloidal gold-labeled SARS-CoV-2 recombinant protein S1 is preferably 10-15 μg / ml.

[0012] According to some embodiments of the present invention, the amount of the colloidal gold-labeled SARS-CoV-2 recombinant protein S1 on the gold label pad is 12.5-100 μg / ml.

[0013] According to a preferred embodiment of the present invention, the amount of the colloidal gold-labeled SARS-CoV-2 recombinant protein S1 on the gold label pad is 20 μg / ml.

[0014] According to some embodiments of the present invention, the amount of the SARS-CoV-2 recombinant protein S1 fixed on the test line is 0.4-2.5 mg / ml, for example, it can be 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5 μg / ml.

[0015] According to a preferred embodiment of the present invention, the amount of the SARS-CoV-2 recombinant protein S1 fixed on the detection line is 0.8-1.6 mg / ml.

[0016] According to a preferred embodiment of the present invention, the amount of the SARS-CoV-2 recombinant protein S1 fixed on the detection line is 0.8-1.0 mg / ml.

[0017] According to some embodiments of the present invention, the amount of the new coronavirus positive serum fixed on the quality control line is 0.5-3.0 mg / ml, for example, it can be 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0 mg / ml.

[0018] According to a preferred embodiment of the present invention, the amount of the new coronavirus positive serum fixed on the quality control line is 1.0-3.0 mg / ml.

[0019] A second aspect of the present invention provides a sample diluent comprising phosphate buffer, casein, EDTA, sucrose and a preservative.

[0020] According to some embodiments of the present invention, the pH of the PBS buffer is 7.0-8.0.

[0021] According to a preferred embodiment of the present invention, the pH of the PBS buffer is 7.2-7.6.

[0022] According to some embodiments of the invention, the preservative is selected from NaN3 and / or Proclin300.

[0023] According to a preferred embodiment of the present invention, the preservative is selected from Proclin300.

[0024] According to some embodiments of the present invention, the sample diluent comprises 0.05-0.15 mol / L PBS buffer, 0.5%-2.0% w / v casein, 0.3%-1.0% w / v EDTA, 0.5%-2.5% w / v sucrose and 0.05-0.2% v / v preservative.

[0025] According to a preferred embodiment of the present invention, the sample diluent comprises 0.08-0.12 mol / L PBS buffer, 0.5%-1.5% w / v casein, 0.5%-0.8% w / v EDTA, 0.8%-1.5% w / v sucrose and 0.08-0.15% v / v preservative.

[0026] According to some embodiments of the invention, the sample diluent comprises 0.1 M PBS at pH 7.4, 0.5%-2.0% w / v casein, 0.5% w / v EDTA, 0.8%-2.5% w / v sucrose, and 0.1% V / V Proclin300.

[0027] According to some embodiments of the present invention, the casein content can be 0.5% w / v, 0.6% w / v, 0.7% w / v, 0.8% w / v, 0.9% w / v, 1.0% w / v, 1.1% w / v, 1.2% w / v, 1.3% w / v, 1.4% w / v, 1.5% w / v, 1.6% w / v, 1.7% w / v, 1.8% w / v, 1.9% w / v, or 2.0% w / v.

[0028] According to some embodiments of the invention, the sucrose content may be 0.8% w / v, 0.9% w / v, 1.0% w / v, 1.1% w / v, 1.2% w / v, 1.3% w / v, 1.4% w / v, 1.5% w / v, 1.6% w / v, 1.7% w / v, 1.8% w / v, 1.9% w / v, 2.0% w / v, 2.1% w / v, 2.2% w / v, 2.3% w / v, 2.4% w / v, or 2.5% w / v.

[0029] According to some specific embodiments of the present invention, the sample diluent comprises 0.1 M PBS at pH 7.4, 1% w / v casein, 0.5% w / v EDTA, 1% w / v sucrose and 0.1% V / V Proclin300.

[0030] According to some specific embodiments of the present invention, the sample diluent comprises 0.1 M PBS at pH 7.4, 0.8% w / v casein, 0.5% w / v EDTA, 1% w / v sucrose and 0.1% V / V Proclin300.

[0031] According to some specific embodiments of the present invention, the sample diluent comprises 0.1 M PBS at pH 7.4, 0.8% w / v casein, 0.5% w / v EDTA, 0.8% w / v sucrose and 0.1% V / V Proclin300.

[0032] The sample diluent according to the present invention can eliminate the influence of different animal serum matrices and avoid false positives, thereby improving the accuracy of detection; in particular, the detection sensitivity is high and the sensitivity is good.

[0033] The third aspect of the present invention includes a novel coronavirus antibody detection kit, which includes the novel coronavirus antibody detection test strip according to the first aspect and / or the sample diluent according to the second aspect.

[0034] According to some preferred embodiments of the present invention, the novel coronavirus antibody detection kit comprises the novel coronavirus antibody detection test strip according to the first aspect and the sample diluent according to the second aspect.

[0035] The fourth aspect of the present invention provides a method for preparing a novel coronavirus antibody detection kit, comprising:

[0036] Step S1: preparing the SARS-CoV-2 recombinant protein S1 encoded by SEQ ID No. 1 by genetic engineering means, labeling the SARS-CoV-2 recombinant protein S1 with colloidal gold to obtain the gold-labeled SARS-CoV-2 recombinant protein S1, and making a gold-labeled pad;

[0037] Step S2: Fix the SARS-CoV-2 recombinant protein S1 and the SARS-CoV-2 positive serum and adsorb them on both ends of the nitrocellulose membrane as the detection line and the quality control line respectively;

[0038] Step S3: Paste the sample pad, the gold label pad prepared in step S1, the nitrocellulose membrane prepared in step S2, and the absorbent paper on the bottom plate in sequence to prepare a COVID-19 antibody test strip;

[0039] Step S4: prepare a sample diluent and assemble it into a test kit together with the novel coronavirus antibody detection test strip prepared in step S3.

[0040] According to some embodiments of the present invention, in step S1, the amount of the colloidal gold-labeled SARS-CoV-2 recombinant protein S1 is 5-35 μg / ml.

[0041] According to a preferred embodiment of the present invention, in step S1, the amount of the SARS-CoV-2 recombinant protein S1 labeled with colloidal gold is 10-20 μg / ml.

[0042] According to some embodiments of the present invention, in step S1, the amount of gold-labeled SARS-CoV-2 recombinant protein S1 coated on the gold-labeled pad is 12.5-100 μg / ml.

[0043] According to some embodiments of the present invention, in step S1, the amount of gold-labeled SARS-CoV-2 recombinant protein S1 coated on the gold-labeled pad is 15-50 μg / ml.

[0044] According to a preferred embodiment of the present invention, in step S1, the amount of gold-labeled SARS-CoV-2 recombinant protein S1 coated on the gold-labeled pad is 20 μg / ml.

[0045] According to some embodiments of the present invention, in step S2, the amount of the SARS-CoV-2 recombinant protein S1 fixed on the detection line is 0.4-2.5 mg / ml.

[0046] According to a preferred embodiment of the present invention, in step S2, the amount of the SARS-CoV-2 recombinant protein S1 fixed on the detection line is 0.8-1.6 mg / m.

[0047] According to some embodiments of the present invention, in step S2, the amount of the new coronavirus positive serum fixed on the quality control line is 0.5-3.0 mg / ml.

[0048] According to a preferred embodiment of the present invention, in step S2, the amount of the new coronavirus positive serum fixed on the quality control line is 1.0-3.0 mg / ml.

[0049] According to some embodiments of the present invention, in step S4, the sample diluent is the sample diluent according to the first aspect.

[0050] The fifth aspect of the present invention provides an application of the reagent strip according to the first aspect, the sample diluent according to the second aspect, the kit according to the third aspect, or the kit obtained according to the preparation method according to the fourth aspect, wherein the application includes tracing the origin of the new coronavirus, screening of animals infected with the new coronavirus, epidemiological surveys of in vitro serum, pathogenic mechanism studies of animal models, drug screening, and vaccine evaluation.

[0051] The advantages of the present invention are:

[0052] The serum to be tested used in the kit prepared by the present invention can be serum from different animals. As long as there are antibodies to the new coronavirus, whether it is IgM or IgG antibodies, a specific reaction can occur.

[0053] The kit prepared by the present invention has no cross-reaction with other coronavirus antibodies of animals and has good specificity; it can detect a variety of animal sera, including livestock, poultry and economic animals (pigs, horses, cattle, sheep, chickens, ducks, geese), wild animals (pangolins, camels, bamboo rats, spotted lemurs, alpacas, tigers, rhinos, minks, foxes, peacocks, eagles), pets (dogs, cats) and experimental animals (mice, rats, guinea pigs, rabbits, beagles, macaques) and other animals.

[0054] The kit prepared by the present invention is mainly used for novel coronavirus traceability detection, tracing the natural hosts and intermediate host animals of novel coronavirus; used for screening and detecting whether livestock, poultry and economic animals such as pigs and chickens are infected with novel coronavirus, ensuring stable production of the breeding industry and safety of animal-derived food; used for screening and detecting whether pets such as dogs and cats are infected with novel coronavirus, ensuring public health safety and social stability; used for research on animal infection models of novel coronavirus, as well as pathogenic mechanism research, drug screening and vaccine evaluation based on animal models. DETAILED DESCRIPTION

[0055] The term "new coronavirus pneumonia" (Novel coronavirus pneumonia, NCP) is referred to as COVID-19, which refers to pneumonia caused by infection with the 2019 novel coronavirus (referred to as the new coronavirus, 2019Novel coronavirus, 2019-nCoV).

[0056] Patients infected with the term "SARS-CoV-2" usually present with pneumonia-like symptoms (fever, dry cough, and dyspnea, etc.) and gastrointestinal symptoms such as diarrhea, followed by severe acute respiratory infections. Some cases will experience acute respiratory distress syndrome combined with severe respiratory complications, and even lead to death. There is currently no specific treatment for infected patients. Early diagnosis and timely management are the key to preventing the further spread of the epidemic and controlling new clues of infection. In addition, the possible natural hosts and intermediate hosts of SARS-CoV-2 have not yet been determined. How to determine them as soon as possible and take targeted prevention and control measures from the source is of great significance to controlling the spread of the disease.

[0057] The term "novel coronavirus S1 protein" is located in one of the functional regions of the novel coronavirus S protein. The novel coronavirus S protein is one of the novel coronavirus structural proteins, a spike protein, a spike glycoprotein located on the surface of the virus particle.

[0058] The term "new coronavirus-positive serum" refers to animals used to prepare livestock and poultry and economic animals such as pigs, horses, cattle, sheep, chickens, ducks, and geese, wild animals such as pangolins, camels, bamboo rats, spotted lemurs, alpacas, tigers, rhinos, minks, foxes, peacocks, and eagles, pets and experimental animals such as mice, rats, guinea pigs, rabbits, dogs, cats, ferrets, and macaques; preferably sheep, guinea pigs, and rabbits; most preferably rabbits.

[0059] The terms "quality control line", "control line" and "C line" can be used interchangeably, and "test line" and "T line" can be used interchangeably.

[0060] The term "phosphate buffer" refers to a solution containing phosphoric acid or its salt and adjusted to an ideal pH value. It is the most widely used buffer in biochemical research. Generally, phosphate buffer is prepared from phosphoric acid or phosphates (including but not limited to sodium and potassium salts). Some phosphates are already known in the art, such as sodium dihydrogen phosphate and potassium dihydrogen phosphate, disodium hydrogen phosphate and dipotassium hydrogen phosphate, sodium phosphate and potassium phosphate. It is known that phosphates exist in the form of salt hydrates. Due to the secondary dissociation of the buffer, the pH range of the buffer is very wide, such as a range of about 4-10, preferably a range of about 5-9, more preferably a range of about 6-8, and most preferably about 7.4. Further preferably, the phosphate buffer is a phosphate buffer containing sodium chloride and potassium chloride.

[0061] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are exemplary only and do not constitute any limitation to the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the technical solution of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications and replacements all fall within the scope of protection of the present invention.

[0062] The phosphate buffer used in the embodiment of the present invention is PBS with a pH value of 7.4, and its 1L volume formula is: NaCl 8.0g, KCl 0.2g, Na2HPO4·12H2O 2.9g, KH2PO4 0.2g, and the volume is adjusted to 1L with ultrapure water. However, this implementation manner does not constitute a limitation of the present invention under any circumstances.

[0063] To make the present invention easier to understand, the present invention is further described below in conjunction with specific examples. It should be understood that these examples are only used for the present invention and are not used to limit the scope of the present invention. The experimental methods described in the present invention are conventional methods unless otherwise specified; the biological materials described can be obtained from commercial channels unless otherwise specified.

[0064] Example 1 Preparation and identification of the novel coronavirus recombinant protein S1

[0065] 1.1 Preparation

[0066] According to the reported sequence of the novel coronavirus S protein, the S1 protein sequence was codon-optimized according to the insect cell codon preference during baculovirus expression to obtain the nucleotide sequence shown in SEQ ID No. 1. The sequence was submitted to Genewise for synthesis to obtain the plasmid of the novel coronavirus recombinant protein S1 gene.

[0067] The primer sequences (as shown below) were designed using Primer premier5.0 software and synthesized by Genewise.

[0068] tS-F:CGCGGATCCATGTCCTCCCAATGCGTCAACCTCACTACC

[0069] tS-R: CCCAAGCTTTCAGTGGTGGTGGTGGTGGTGGTAGATGCCCTTCTCCACGGTGAAAGAC

[0070] PH-F: 5'-GGATTATTCATACCGTCCCA-3'

[0071] PH-R: 5'-AACCTCTACAAATGTGGTATGGCTG-3'

[0072] The total volume of PCR amplification was 50 μl, and the system was as follows: 1 μl of the plasmid of the recombinant protein S1 gene, 0.5 μl of PrimeSTAR, 10 μl of 5× PrimeSTAR, 4 μl of dNTPs (25 mmol / L), 1 μl of tS-F (10 pmol / L), 1 μl of tS-R (10 pmol / L), and 32.5 μl of ddH2O. After mixing, the mixture was amplified by the PCR amplification program, which was as follows: 94°C pre-denaturation for 5 minutes, 94°C denaturation for 30 seconds, 58°C annealing for 30 seconds, 72°C extension for 60 seconds, 35 cycles, and finally 72°C extension for 10 minutes. The amplified product was identified by 1% gel electrophoresis, and the result showed that the amplified product showed a target band at about 900 bp. The target band was recovered using a recovery kit.

[0073] After double digestion with BamH I and Hind III, the recovered target gene was cloned into the pFastBac vector to obtain the ligation product. The 1% gel electrophoresis identified that the vector band appeared at about 4800 bp and the target gene band appeared at about 900 bp, indicating that the ligation product was initially identified successfully. The ligation product was transferred into DH5α competent cells, transformed in LB liquid medium and obtained the transformed bacterial solution, and cultured at 37°C overnight. Pick a single colony and place it in a medium containing Amp + The culture was cultured overnight in LB liquid medium at 37°C and 220 rpm, and the plasmid was extracted using a plasmid extraction kit. The extracted plasmid was digested and identified using the enzyme digestion system of 1μl plasmid, 0.5μl BamHI, 0.5μl HindⅢ, 2μl 10×Green buffer, and ddH2O was added to 20μl, and digested at 37°C for 30 minutes. The digestion product was identified by 1% gel electrophoresis, and the correctly identified recombinant plasmid was sent to Jinweizhi Company for sequencing analysis. The results showed that the measured gene sequence was consistent with the gene sequence of SEQ ID No.1. The plasmid with correct digestion and sequencing was named pFB-tS.

[0074] The correctly identified plasmid pFB-tS was transformed into DH10Bac competent cells, and the bacterial solution was spread on LB plates containing IPTG, X-gal, kanamycin, tetracycline, and gentamicin. After culturing at 37°C for 48 hours, blue-white screening was performed. After the white colonies were picked and PCR was identified correctly, the recombinant Bacmid was extracted using the Plasmid DNA Miniprep Kit. The extracted Bacmid DNA was used as a template and PCR amplified using PH-F and PH-R. The amplified product was electrophoresed on a 1% agarose gel. The result showed that the target band appeared at about 1000bp, indicating that the target fragment had been successfully transposed into the baculovirus genome, and the recombinant Bacmid was successfully constructed and named Bacmid-S1.

[0075] Recombinant Bacmid-S1 was transfected into Sf9 cells (cell density was 2.0×10 6 -2.5×10 6 / mL), cultured at 27°C and 120 rpm for 72 hours, and the cell supernatant was collected after the cytopathic effect appeared, which was recorded as the P0 generation recombinant baculovirus rnCoV-S1 strain. The P0 generation recombinant virus rnCoV-S1 strain infected Sf9 cells, and after expansion culture, the cell supernatant was collected.

[0076] 1.2 Identification

[0077] The collected cell supernatant was centrifuged at 8000 rpm for 20 minutes, and the supernatant was filtered through a 0.22 μm filter membrane to obtain a filtrate. Samples were taken for SDS-PAGE and Western Blot identification, and a specific band of recombinant protein S1 appeared at about 32 KDa. The remaining filtrate was purified by three chromatography steps as follows:

[0078] (1) The filtrate was purified by affinity chromatography column (Ni HisTrap HP). The nickel column was equilibrated with deionized water and solution A (20 mmol / L Tris-NaCl, 150 mmol / L NaCl, pH 8.0), respectively, and the filtrate was loaded onto the nickel column at a flow rate of 1 mL / min-2 mL / min. After loading, solution A containing 30 mmol / L imidazole was added to elute the impurities, and then solution A containing 300 mmol / L imidazole was added to elute the target protein and collected. The collected solution was dialyzed in solution B (20 mmol / L NaH2PO4, 50 mmol / L NaCl, pH 6.5) at 2-8°C overnight.

[0079] (2) The dialyzed protein was further purified by cation exchange column (SP Sepharose HP) chromatography. The SP column was equilibrated with deionized water and solution B, respectively, and the dialyzed protein was loaded at a flow rate of 1 mL / min-2 mL / min. After loading, impurities were eluted with solution B containing 200 mmol / L NaCl, and then the target protein was eluted with solution B containing 500 mmol / L NaCl.

[0080] (3) The protein purified by the SP column was purified by molecular sieve (Hiload 16 / 600, Superdex 200pg). After balancing the column with deionized water and C solution (20mmol / L NaH2PO4, 150mmol / L NaCl, pH7.4), the sample was loaded at a flow rate of 1mL / min. After the loading was completed, the target protein was separated with C solution. The protein was collected when the peak volume was 75.5mL-78mL, which was the new coronavirus recombinant protein S1 (referred to as the new coronavirus recombinant protein S1).

[0081] The protein content was 0.5 mg / ml as determined by BCA, the purity was ≥99%, and a specific band appeared at about 32 KDa.

[0082] Example 2 Preparation and Identification of COVID-19 Positive Serum

[0083] 2.1 Preparation of SARS-CoV-2 positive serum

[0084] Freund's complete adjuvant and 0.5 mg / ml recombinant protein S1 prepared in Example 1 were mixed and emulsified in equal volumes and then subcutaneously administered to common New Zealand rabbits at multiple points for the first time, 2 ml / rabbit; after an interval of 14 days, Freund's incomplete adjuvant was mixed and emulsified with an equal amount of antigen for the second time. Blood was collected 14 days after the second time, and the blood was placed at 37°C for 30 minutes, then moved to 2-8°C and allowed to stand for 2 hours, centrifuged at 5000 rpm for 3 minutes, and the supernatant was collected, filtered, and sterile packaged.

[0085] 2.2 Identification of SARS-CoV-2 positive serum

[0086] The samples were tested using the IFA method. The IFA method is as follows:

[0087] Preparation of IFA antigen plate: After diluting the recombinant baculovirus rnCoV-S1 strain 1000 times with IB905 SFMpro medium, inoculate a single-layer 96-well Sf9 cell culture plate at 50 μl / well, and set up a normal cell control. Continue to culture in a 27°C incubator for 48 hours. Then discard the supernatant, wash twice with PBS (0.01 mol / L, pH 7.2), add 80% cold acetone, 100 μl / well, and fix at 2-8°C for 30 minutes; discard the acetone, dry it in the air and store it below -20°C for use.

[0088] IFA detection: Wash the IFA antigen plate three times with PBS (0.01 mol / L, pH 7.2), add serially diluted serum to be tested (1:20, 1:40, 1:80, 1:160, 1:320, 1:640, 1:1280, 1:2560, 1:5120, 1:10240) to each well, and add 1:200 diluted baculovirus gp64 protein monoclonal antibody as positive control, PBS (0.01 mol / L, The cells were treated with 50 μl / well PBS (pH 7.2) as negative control, at 37°C for 1 hour; the supernatant was discarded, and the cells were washed three times with PBS (0.01 mol / L, pH 7.2); FITC-labeled SPA (1:200) was added, at 50 μl / well, at 37°C for 30 minutes; the supernatant was discarded, and the cells were washed three times with PBS (0.01 mol / L, pH 7.2); the results were observed under a fluorescence microscope; the highest dilution with obvious fluorescence was the IFA titer of the serum.

[0089] Results: The IFA titer of the SARS-CoV-2 positive serum was 1:2560-1:5120. The protein content was 3-5 mg / ml as determined by BCA.

[0090] Example 3 Preparation and detection method of novel coronavirus antibody test strip

[0091] 3.1 Preparation of the kit

[0092] 3.1.1 Antibody test strips

[0093] Preparation of colloidal gold: Prepare colloidal gold solution by sodium citrate reduction method, prepare 100ml of 0.01% chloroauric acid solution, quickly add 1.0ml of 1% sodium citrate after heating, continue heating and boiling for 5-8 minutes, the color of the solution gradually changes from dark blue to bright red, stop boiling, cool naturally, and restore to the original volume with ultrapure water to obtain colloidal gold solution. The colloidal gold solution is quality controlled by appearance and ultraviolet spectrophotometry scanning. The appearance color is a red clear liquid, which is pure, transparent, without precipitation and floating matter; the maximum absorption peak determined by ultraviolet spectrophotometry is 524nm.

[0094] Colloidal gold labeled novel coronavirus protein: HAuC14 was first prepared into a 0.01% aqueous solution, 100 ml was taken and heated to boiling, 1.0 ml of 1% trisodium citrate (Na3C6H5O7·2H2O) aqueous solution was accurately added under stirring, and the heating and boiling were continued for 15 minutes. When the color gradually stabilized to red, it was cooled to room temperature and restored to the original volume of 100 ml with distilled water, and stored at 2-8°C. The pH of the colloidal gold solution was adjusted to 7.6 with 0.2 mol / L K2CO3, and stirred at a uniform speed for 30 minutes. The novel coronavirus recombinant protein S1 prepared in Example 1 (working concentration was 5-35 μg / ml) was added to the colloidal gold solution, stirred at a uniform speed for 30 minutes, and an appropriate amount of 10% BSA was added dropwise. After stirring at a uniform speed for 30 minutes, the solution was centrifuged at 4°C and 12000 rpm for 30 minutes. The resuspended precipitate was the gold-labeled novel coronavirus recombinant protein S1, and its concentration after resuspension was 12.5-100 μg / ml.

[0095] Preparation of test strips: Spray or soak to make a gold-labeled pad coated with the gold-labeled COVID-19 recombinant protein S1 at a final concentration of 12.5-100 μg / ml; spray the COVID-19 recombinant protein S1 prepared in Example 1 (coating concentration of 0.4-2.5 mg / ml) and the COVID-19 positive serum prepared in Example 2 (coating concentration of 0.8-3 mg / ml) on the nitrocellulose membrane as the test line (T) and quality control line (C), respectively. Paste the sample pad made of glass cellulose membrane, the gold-labeled pad, the nitrocellulose membrane and the absorbent pad made of absorbent paper on the bottom plate to obtain the COVID-19 colloidal gold test strip.

[0096] 3.1.1 Sample diluent

[0097] The sample processing tube contains a sample diluent. The sample diluent formula is: 0.1M PBS with pH 7.4, 0.5%-2.0% w / v casein, 0.5% w / v EDTA, 0.8%-2.5% w / v sucrose, 0.1% V / V Proclin300, after preparation and mixing, filter and aseptically package.

[0098] 3.2 Establishment of detection method

[0099] The steps are as follows:

[0100] (1) Sampling: Collect animal serum, plasma or whole blood samples;

[0101] (2) Sample addition: First add 10 μl of the sample to be tested to the sample loading hole of the test strip, then add 2 drops of sample diluent, let it stand horizontally at room temperature for 5-15 minutes, observe the results, and make judgments based on the following result judgment criteria.

[0102] Result judgment criteria: When the reaction time is 5-15 minutes, if both the control line and the test line show color, it is judged as positive; if only the control line shows color and the test line does not, it is judged as negative; if the control line does not show color, it is judged as invalid regardless of whether the test line shows color.

[0103] 3.3 Selection of the working concentration of the SARS-CoV-2 recombinant protein S1 for the gold label in the test strip

[0104] The gold-labeled COVID-19 recombinant protein S1 was labeled at the final concentrations in Table 1, and the gold-labeled protein with a final content of 20 μg / ml was fixed on a glass cellulose membrane to prepare a gold-labeled pad; the fixed COVID-19 recombinant protein S1 was coated on a nitrocellulose membrane at 1.0 mg / ml (T line) and the COVID-19 positive serum was coated on a nitrocellulose membrane at 1.0 mg / ml (C line). Then, the sample pad, gold-labeled pad, nitrocellulose membrane, and absorbent pad were assembled into test strips 1A-1G, and the sample diluent 3F prepared in Example 3.5 was used. According to the detection method of Example 3.2, 1 positive serum of the new coronavirus (IFA titer is 1:5120) and 20 negative sera (including 2 parts of pigs, 1 part of horses, 2 parts of chickens, 1 part of minks, 1 part of foxes, 1 part of mice, 2 parts of rats, 2 parts of guinea pigs, 2 parts of rabbits, 2 parts of dogs, 2 parts of cats, 1 part of ferrets, and 1 part of macaques) were evaluated respectively. The results are shown in Table 1: When the gold-labeled antibody is labeled at a concentration of 5-35 μg / ml, the dilution multiple of the positive serum detected is 80 times to 640 times, and the negative sera detected are all negative; when the labeling concentration is 10-20 μg / ml, the dilution multiple of the positive serum detected is 320 times to 640 times, and the negative sera detected are all negative.

[0105] Table 1 Optimization of different concentrations of gold-labeled SARS-CoV-2 recombinant protein S1 in the reagent strip

[0106]

[0107] 3.4 Selection of working concentration of SARS-CoV-2 recombinant protein S1 for fixation in test strips

[0108] The SARS-CoV-2 recombinant protein S1 was coated at the final concentrations in Table 2 to prepare the test line (T line for short), and the SARS-CoV-2 positive serum was coated on the nitrocellulose membrane at 1.0 mg / ml (C line); the gold-labeled SARS-CoV-2 recombinant protein S1 was labeled at 10 μg / ml, and the gold-labeled protein with a final content of 20 μg / ml was fixed on the glass cellulose membrane to prepare a gold-labeled pad. The sample pad, gold label pad, nitrocellulose membrane, and absorbent pad were then assembled into test strips 2A to 2F, and evaluated with SARS-CoV-2 positive serum (IFA titer of 1:5120), negative eye and nasal swabs, and negative serum (all identified by RT-PCR). The results are shown in Table 2: When the concentration of the fixed SARS-CoV-2 recombinant protein S1 was 0.4 mg / ml, 2.0 mg / ml, or 2.5 mg / ml, the dilution multiple of the SARS-CoV-2 positive serum was 160 times, and the negative serum was negative; when the final concentration of the fixed SARS-CoV-2 recombinant protein S1 was 0.8-1.6 mg / ml, the dilution multiple of the SARS-CoV-2 positive serum was 320-640 times, and the negative serum was negative.

[0109] Table 2 Optimization of different concentrations of immobilized SARS-CoV-2 recombinant protein S1 in reagent strips

[0110]

[0111] 3.5 Selection of working concentration of positive serum for COVID-19 fixed in test strips

[0112] The SARS-CoV-2 positive serum was coated at 0.5, 1.0, 2.0, and 3.0 mg / ml to prepare the quality control line (also called the control line, referred to as the C line). The gold-labeled SARS-CoV-2 recombinant protein S1 was labeled at 10 μg / ml and the fixed SARS-CoV-2 recombinant protein S1 was coated at 0.8 mg / ml to prepare test strips 1-4. The SARS-CoV-2 positive serum and negative serum were used for evaluation. The results showed that the color of the quality control line was slightly weaker when the SARS-CoV-2 positive serum was 0.5 mg / ml, but it did not affect the result determination; when the SARS-CoV-2 positive serum was 1.0, 2.0, and 3.0 mg / ml, the color intensity of the quality control line was not much different.

[0113] 3.6 Selection of sample diluent

[0114] The gold-labeled COVID-19 recombinant protein S1 was labeled at 10 μg / ml, and the gold-labeled protein with a final content of 20 μg / ml was fixed on a glass cellulose membrane to prepare a gold-labeled pad; the fixed COVID-19 recombinant protein S1 was coated on a nitrocellulose membrane at 0.8 mg / ml (T line) and the COVID-19 positive serum was coated at 1.0 mg / ml (C line). Then the sample pad, gold-labeled pad, nitrocellulose membrane, and absorbent pad were assembled into test strip A. The following sample dilutions were prepared (see Table 3), and samples were taken for appearance inspection and sterility inspection (performed according to the appendix of the current Chinese Pharmacopoeia of Veterinary Medicine). The results are shown in Table 3. In addition, 16 negative sera from livestock, poultry and economic animals (labeled as serum A, including 3 parts from pigs, 2 parts from horses, 2 parts from cattle, 2 parts from sheep, 3 parts from chickens, 2 parts from ducks, and 2 parts from geese), 15 negative sera from wild animals (labeled as serum B, including 2 parts from pangolins, 2 parts from camels, 1 part from bamboo rats, 1 part from spotted lemurs, 1 part from alpacas, 1 part from tigers, 1 part from rhinoceros, 2 parts from minks, 2 parts from foxes, 1 part from peacocks, and 1 part from eagles), and 14 negative sera from pets and experimental animals (labeled as serum C, including 2 parts from mice, 2 parts from rats, 2 parts from guinea pigs, 2 parts from rabbits, 2 parts for dogs, 2 parts for cats, 1 part for ferrets, and 1 part for macaques) were tested with sample diluents 3A-3F according to the detection method of Example 3.2. The results (see Table 4) showed that when the sample diluents were 3A-3E, the sensitivity of detecting positive serum was low, and there were false positives in detecting negative serum; only when the sample diluent was 3F, the dilution factor of detecting positive serum was high (640 times), and the negative serum of 26 kinds of animals including livestock and poultry, economic animals, wild animals, pets and experimental animals were all negative.

[0115] Table 3 Summary of components contained in sample diluent

[0116]

[0117]

[0118] Table 4 Summary of test results after preparing the kit with different sample diluents

[0119]

[0120] In order to evaluate the casein content in the sample diluent, the casein content was adjusted to 0.1%, 0.5%, 0.8% (sample diluent number: 3F-1), 1.6%, 2.0%, and 2.5% w / v in 3F while keeping other components unchanged to prepare a test kit and conduct detection. The results showed that when the casein content in the sample diluent was 0.1% and 2.5%, the sensitivity of the prepared test kit for detecting the new coronavirus positive serum decreased by 8-16 times; when the casein content in the sample diluent was 0.5%-2.0% w / v, the prepared test kit detected the new coronavirus positive serum and negative serum, and the detection results were equivalent to those of 3F, so the casein content in the sample diluent was set to 0.5%-2.0% w / v.

[0121] In order to evaluate the sucrose content in the sample diluent, the sucrose content was adjusted to 0.1%, 0.5%, 0.8% (sample diluent number: 3F-2), 1.6%, 2.0%, 2.5%, and 3.0% w / v in 3F while keeping other components unchanged to prepare a test kit and conduct detection. The results showed that when the sucrose content in the sample diluent was 0.1%, 0.5%, and 3.0%, the sensitivity of the prepared test kit for detecting the new coronavirus positive serum decreased by 8-16 times; when the sucrose content in the sample diluent was 0.8%-2.5% w / v, the prepared test kit detected the new coronavirus positive serum and negative serum, and the detection results were equivalent to those of 3F, so the sucrose content in the sample diluent was set to 0.8%-2.5% w / v.

[0122] According to the above results, from the perspective of cost and detection effect, the gold-labeled new coronavirus recombinant protein S1 was labeled at 10μg / ml, and the gold-labeled protein with a final content of 20μg / ml was fixed on the glass cellulose membrane to prepare the gold-labeled pad; the fixed new coronavirus recombinant protein S1 was coated on the nitrocellulose membrane at 0.8mg / ml (T line) and the new coronavirus positive serum was coated on the nitrocellulose membrane at 1.0mg / ml (C line). Then the sample pad, gold-labeled pad, nitrocellulose membrane, and absorbent pad were assembled into test strip A. Together with the preferred sample diluents 3F, 3F-1, and 3F-2, they were prepared into test kits A1, A2, and A3 in turn for subsequent evaluation.

[0123] Example 4 Study on the type of antibody detected by test strips

[0124] 4.1 Preparation of positive sera from different animal sources

[0125] The novel coronavirus recombinant protein S1 prepared in Example 1 was injected into 5 SPF mice and 5 healthy rabbits (500 μg / mouse), and 5 mice were set up as non-immunized control groups. Blood was collected on days 0, 1, 3, 5, 7, 9, 10, and 14 after immunization to collect serum.

[0126] 4.2 Preparation of IgM antibody detection kit by indirect ELISA method

[0127] Take the antigen-coated plate with a coating concentration of 0.5 μg / ml of the new coronavirus recombinant protein S1 prepared in Example 3, and use commercial enzyme-labeled goat anti-mouse IgM antibody and enzyme-labeled goat anti-rabbit IgM antibody 1:10000 times dilution as secondary antibodies, together with washing solution, color developing solution, stop solution, and stop solution to prepare an indirect ELISA IgM antibody kit, referred to as mouse IgM kit and rabbit IgM kit.

[0128] 4.3 Preparation of IgG antibody detection kit by indirect ELISA method

[0129] Take the antigen-coated plate with a coating concentration of 0.5 μg / ml of the recombinant protein S1 of the new coronavirus prepared in Example 3, and use the commercial enzyme-labeled goat anti-mouse IgG antibody and the enzyme-labeled goat anti-rabbit IgG antibody 1:10000 times dilution as the secondary antibody, together with the washing solution, the color developing solution, the stop solution, and the stop solution to prepare an indirect ELISA IgG antibody kit, referred to as the mouse IgG kit and the rabbit IgG kit.

[0130] 4.4 Comparison of Kits A1, A2, and A3 for Detecting Mouse IgM and IgG Antibodies

[0131] Kits A1, A2, A3 and mouse IgM kit and mouse IgG kit were used to detect the sera of mice on days 0, 1, 3, 5, 7, 9, 10 and 14, respectively. The results were as follows (see Table 5): the sera of the control group were all negative, and the experiment was established. The mouse IgM kit could only detect antibodies on days 3-9 after immunization, and the mouse IgG kit could only detect antibodies on days 7-14 after immunization, while kits A1, A2 and A3 could all detect antibodies on days 4-14 after immunization, and the color of the T line of the antibody detected by test strip A gradually deepened with the extension of immunization time.

[0132] Table 5 Results of testing immunized mice on different days

[0133]

[0134]

[0135] 4.5 Comparison of Kits A1, A2, and A3 for Detecting Rabbit IgM and IgG Antibodies

[0136] Kits A1, A2, A3 and rabbit IgM kit and rabbit IgG kit were used to detect rabbit sera on days 0, 1, 3, 5, 7, 9, 10 and 14, respectively. The results were as follows (see Table 6): the sera of the control group were all negative, and the experiment was established. The rabbit IgM kit could only detect antibodies on days 3-9 after immunization, and the rabbit IgG kit could only detect antibodies on days 7-14 after immunization. Kits A1, A2 and A3 could all detect antibodies on days 4-14 after immunization, and the color of the T line of the antibody detected by test strip A gradually deepened with the extension of immunization time.

[0137] Table 6 Results of testing immunized rabbits on different days

[0138]

[0139] This indicates that test strip A together with test kits A1, A2, and A3 prepared with sample diluent can be used for the detection of different animal sera. As long as there are antibodies to the new coronavirus, whether IgM or IgG antibodies, specific reactions can occur.

[0140] Example 5 Application of Kits A1, A2, and A3

[0141] 5.1 Nonspecific detection of different SPF animal sera

[0142] 103 samples of 5 kinds of SPF animal sera, including 32 samples of SPF mouse sera, 22 samples of SPF rat sera, 30 samples of SPF chicken sera, 9 samples of SPF duck sera, and 10 samples of SPF pig sera, were tested by kits A1, A2, and A3, and the results were all negative, indicating that the kits A1, A2, and A3 had no nonspecific reaction in detecting multiple animal sera.

[0143] 5.2 Detection of other coronavirus antibody-positive sera from different animal sources

[0144] 128 positive sera of 6 coronavirus antibodies from 4 animals were taken, including 26 positive sera of 1 avian coronavirus, i.e., chicken infectious bronchitis virus antibody, 3 porcine coronaviruses (including 20 positive sera of porcine epidemic diarrhea virus antibody, 20 positive sera of porcine transmissible gastroenteritis virus antibody, and 20 positive sera of porcine delta coronavirus antibody), 22 positive sera of 1 mouse coronavirus, i.e., mouse hepatitis virus antibody, and 20 positive sera of 1 rat coronavirus, i.e., rat sialolacrimal glanditis virus antibody, and the results were all negative after detection by kits A1, A2, and A3, indicating that kits A1, A2, and A3 had no cross-reaction with other coronaviruses from different animal sources (including avian, porcine, mouse, and rat sources).

[0145] 5.3 Clinical application of kits A1, A2, and A3

[0146] 964 clinical sera from 26 kinds of animals were collected, including livestock, poultry and economic animals (45 pigs, 10 horses, 49 cattle, 54 sheep, 45 chickens, 81 ducks, 19 geese), wild animals (17 pangolins, 31 camels, 8 bamboo rats, 1 spotted lemur, 5 alpacas, 8 tigers, 5 rhinos, 20 minks, 20 foxes, 4 peacocks, 1 eagle), pets (234 dogs, 51 cats) and experimental animals (32 mice, 22 rats, 20 guinea pigs, 20 rabbits, 130 beagles, 2 cats, 2 ferrets, 28 macaques). The results of the tests with kits A1, A2 and A3 were all negative. This indicates that kits A1, A2 and A3 can be used for the detection and monitoring of novel coronavirus infection in a variety of animals, and can be used for the screening of novel coronavirus infection in economic animals, experimental animals, pets and the like, and the research and evaluation of animal models of artificial infection with novel coronavirus.

[0147] In summary, the serum to be tested used in the kit prepared by the present invention through the new coronavirus colloidal gold antibody test strip and the sample diluent can be the serum of different animals. As long as there are new coronavirus antibodies, whether it is IgM or IgG antibodies, specific reactions can occur. The kit prepared by the present invention can be used for new coronavirus source tracing detection, tracing the natural host and intermediate host animals of SARS-CoV-2; it can be used for the investigation and detection of whether livestock, poultry and economic animals such as pigs and chickens are infected with the new coronavirus, ensuring stable production of the breeding industry and animal-derived food safety; it can be used for the investigation and detection of whether pets such as dogs and cats are infected with the new coronavirus, ensuring public health safety and social stability; it can be used for SARS-CoV-2 animal infection model research, as well as pathogenic mechanism research, drug screening and vaccine evaluation based on animal models.

[0148] The above is only a preferred embodiment of the present invention, and does not limit the present invention in any form. Although the present invention has been disclosed as a preferred embodiment, it is not used to limit the present invention. Any technician familiar with this profession can make some changes or modifications to equivalent embodiments of equivalent changes using the technical contents disclosed above without departing from the scope of the technical solution of the present invention. However, any simple modification, equivalent change and modification made to the above embodiments based on the technical essence of the present invention without departing from the content of the technical solution of the present invention still falls within the scope of the technical solution of the present invention.

Claims

1. A novel coronavirus antibody test strip, comprising a base plate, on which are arranged in sequence a sample pad, a gold label pad, a nitrocellulose membrane and a water-absorbing pad, wherein the gold label pad contains a novel coronavirus recombinant protein S1 labeled with colloidal gold; the nitrocellulose membrane comprises a detection line and a quality control line, wherein the detection line is immobilized with the novel coronavirus recombinant protein S1, and the quality control line is immobilized with novel coronavirus positive serum; wherein, The novel coronavirus recombinant protein S1 is a protein encoded by the nucleotide sequence shown in SEQ ID No. 1; The amount of the colloidal gold-labeled SARS-CoV-2 recombinant protein S1 is 10-20 μg / ml; The amount of the colloidal gold-labeled SARS-CoV-2 recombinant protein S1 on the gold label pad is 12.5-100 μg / ml; The amount of the novel coronavirus recombinant protein S1 fixed on the detection line is 0.8-1.6 mg / ml; The amount of the novel coronavirus-positive serum fixed on the quality control line is 0.5-3.0 mg / ml.

2. The test strip according to claim 1, characterized in that The amount of the colloidal gold-labeled SARS-CoV-2 recombinant protein S1 on the gold label pad is 15-50 μg / ml; and / or The amount of the novel coronavirus-positive serum fixed on the quality control line is 1.0-3.0 mg / ml.

3. The test strip according to claim 2, characterized in that: The amount of the colloidal gold-labeled SARS-CoV-2 recombinant protein S1 on the gold label pad is 20 μg / ml.

4. A novel coronavirus antibody detection kit, comprising the novel coronavirus antibody detection test strip according to any one of claims 1 to 3.

5. A method for preparing a novel coronavirus antibody detection kit, comprising: Step S1: preparing the SARS-CoV-2 recombinant protein S1 encoded by SEQ ID No. 1 by genetic engineering means, labeling the SARS-CoV-2 recombinant protein S1 with colloidal gold to obtain the gold-labeled SARS-CoV-2 recombinant protein S1, and making a gold-labeled pad; Step S2: Fix the SARS-CoV-2 recombinant protein S1 and the SARS-CoV-2 positive serum and adsorb them on both ends of the nitrocellulose membrane as the detection line and the quality control line respectively; Step S3: Paste the sample pad, the gold label pad prepared in step S1, the nitrocellulose membrane prepared in step S2, and the absorbent paper on the bottom plate in sequence to prepare a COVID-19 antibody test strip; Step S4: prepare a sample diluent and assemble it into a test kit together with the novel coronavirus antibody detection test strip prepared in step S3.

6. The preparation method according to claim 5, characterized in that: In step S1, the amount of the SARS-CoV-2 recombinant protein S1 labeled with colloidal gold is 10-20 μg / ml; and / or In step S1, the amount of the gold-labeled SARS-CoV-2 recombinant protein S1 coated on the gold-labeled pad is 12.5-100 μg / ml; and / or In step S2, the amount of the SARS-CoV-2 recombinant protein S1 fixed on the detection line is 0.8-1.6 mg / ml; and / or In step S2, the amount of the novel coronavirus-positive serum fixed on the quality control line is 0.5-3.0 mg / ml.

7. The preparation method according to claim 6, characterized in that: In step S1, the amount of the gold-labeled SARS-CoV-2 recombinant protein S1 coated on the gold-labeled pad is 15-50 μg / ml; and / or In step S2, the amount of the novel coronavirus-positive serum fixed on the quality control line is 1.0-3.0 mg / ml.

8. The preparation method according to claim 7, characterized in that: In step S1, the amount of gold-labeled SARS-CoV-2 recombinant protein S1 coated on the gold-labeled pad is 20 μg / ml.

9. A test strip according to any one of claims 1-3, a kit according to claim 4, or a kit obtained by the preparation method according to any one of claims 5-8 for use in purposes other than disease diagnosis and treatment, wherein the application includes tracing the origin of the new coronavirus, studying the pathogenic mechanism of animal models, drug screening, and vaccine evaluation.

Images