A method for constructing a trace nucleic acid library

Abstract

The present invention discloses a method for constructing a trace nucleic acid library. The method comprises the following steps: (1) obtaining a fragmented single-stranded DNA or cDNA that has been phosphorylated at the 5' end and hydroxylated at the 3' end; (2) performing 3' end auxiliary connection of the DNA fragments obtained in step (1) to extend into a double-stranded DNA; (3) connecting the 5' end of the double-stranded DNA obtained in step (2) to a linker, and then performing dual-template substrate amplification to obtain a library. The present invention improves the efficiency of preparing a trace library and reduces the purification steps, which is of great significance for constructing a library with a trace amount of DNA starting material.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and in particular relates to a method for constructing a trace single-stranded nucleic acid library. Background Art

[0002] Nucleic acid is a general term for deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). It is a biomacromolecule formed by the polymerization of many nucleotide monomers and is one of the most basic substances of life. Among naturally occurring nucleic acids, ribonucleic acid (RNA) mostly exists in single-stranded form and hairpin form, and a small amount is also found in circular form. Deoxyribonucleic acid (DNA) mainly exists in double-stranded form of double helix, and some exist in single-stranded form. In biotechnology such as nucleic acid testing, in vitro diagnosis, gene sequencing and other fields, single-stranded nucleic acids are also produced during various nucleic acid treatment processes. For example, there are organisms in nature that use single-stranded DNA or single-stranded RNA as genetic material, such as human transfusion-transmitted virus (TTV) and microviruses. Sequencing studies of the genetic material of these organisms are not easy to achieve using traditional NGS library construction methods. In the field of forensics, DNA or RNA extracted from various decaying human materials such as bones, nails, hair, etc. are often highly degraded into single-stranded fragmented nucleic acids, and are already trace amounts (such as pg or fg levels). There is currently no efficient library preparation method for these trace amounts of fragmented nucleic acids. In addition, DNA methylation detection also involves the step of heavy salt conversion of DNA, and most of the DNA after heavy salt conversion becomes relatively short fragmented single-stranded DNA. There is currently no particularly efficient technology for processing these single-stranded nucleic acids. Summary of the invention

[0003] The purpose of the present invention is to provide a method for preparing a library of trace nucleic acid (DNA or RNA). The method is independent of the double-stranded structure of DNA. The method has high library preparation efficiency and is widely applicable to trace single-stranded or double-stranded DNA and RNA of various lengths.

[0004] The objects of the present invention are achieved in the following ways.

[0005] A method for constructing a trace single-stranded nucleic acid library comprises the following steps:

[0006] (1) Obtaining fragmented single-stranded DNA or cDNA that has been phosphorylated at the 5' end and hydroxylated at the 3' end;

[0007] (2) The DNA fragment obtained in step (1) is subjected to 3' end auxiliary ligation to extend into a double-stranded DNA;

[0008] (3) The 5' end of the double-stranded DNA obtained in step (2) is connected to a linker, and then dual-template substrate amplification is performed to obtain a library.

[0009] The length of the DNA fragment obtained in step (1) is 10 bp-1000 bp; preferably 50 bp-800 bp, and more preferably 100 bp-300 bp.

[0010] The process of step (2) is carried out in any of the following ways:

[0011] 1) A. DNA fragments are 3'-end assisted ligation using two artificially synthesized nucleotide fragments: an auxiliary and a linker: the linker is connected to the 3'-end tailing sequence of DNA, the 3'-end sequence of the auxiliary is complementary to the 3'-end tailing sequence of DNA, and the 5' end of the auxiliary is complementary to the linker; the 3' ends of the auxiliary and the linker need to be blocked to prevent the tailing enzyme in the system from 3'-end tailing the auxiliary or the linker; after the linker is connected, an extension primer is added to the system, and the extension primer competes with the auxiliary for position by annealing; the extension primer that successfully competes for the position extends the DNA double strand under the action of the polymerase;

[0012] B. Based on method A, a short auxiliary that is at least 5 bases shorter at the 5' end than the 3' end of the long linker is used for auxiliary connection, and then an extension primer complementary to the 3' direction of the linker is used to polymerize the complementary chain of the DNA fragment; the polymerase needs to have chain displacement activity or 5' to 3' exolytic activity to remove the connected auxiliary; the short auxiliary makes room for the extension primer to bind to the 3' end of the linker, and compared with method A, there is no problem of competition between the auxiliary and the extension primer.

[0013] C. Based on method A, the auxiliary contains at least one special modified base or base analog, including: RNA base, deoxyxanthine or abasic site; after the linker ligation reaction is completed, the abasic site enzyme RnaseH or EndonucleaseIV is used to repair DNA damage to perform enzymatic cleavage, so that the auxiliary breaks and exposes the hydroxyl group for polymerase extension polymerization; the polymerase then unblocks and polymerizes to form a complementary chain of the DNA fragment;

[0014] D. Based on method A, RNA helpers are used to replace DNA helpers. RNA helpers are degraded at high temperatures or in the presence of ribonuclease A (RNaseA), and will not compete with extension primers for position after degradation. RNA helpers do not require 3'-end closure. A ligase capable of connecting DNA and RNA hybrid chains to DNA chains is used, preferably SplintR ligase, and then an extension primer is used to polymerize the complementary chains of the DNA fragments.

[0015] 2) A synthetic nucleotide fragment auxiliary subunit and dNTP are used for 3'-end auxiliary connection of DNA fragments, and the dNTP is a mixture of common dNTP and hot-start dNTP, and the common dNTP is selected from any one, two or three of the four dNTPs, and the hot-start dNTP is the selected common dNTP corresponding to the remaining three, two or one; the tailing reaction of DNA fragments is carried out using the common dNTP under relatively low temperature conditions; then a higher temperature is given to the system to make the hot-start dNTP enter an activated working state; and then a relatively low temperature is given to make the auxiliary subunit complementary to the tailing sequence of the 3' end of the DNA fragment, and finally the DNA polymerase uses the auxiliary subunit and the DNA fragment as templates to extend forward respectively, until the complementary chain of the auxiliary subunit is extended using the auxiliary subunit as a template, and the complementary chain of the DNA fragment is extended using the DNA fragment as a template, and the 3' end of the auxiliary subunit contains a sequence complementary to the tailing of the DNA fragment, and the 3' end needs to be blocked to prevent the tailing enzyme in the system from performing 3' tailing on the auxiliary subunit;

[0016] If the 3' end of the auxiliary is modified with a phosphate group or C3Spacer, the base designed at the 3' end of the auxiliary should not be complementary to the DNA chain. The block can be removed by adding a high-fidelity polymerase or other enzymes with 3' exo-cutting activity to the system to remove the non-complementary bases.

[0017] Alternatively, the 3' end of the auxiliary is blocked with a phosphate group or C3spacer, the last base at the 3' end of the auxiliary is not required to be a non-complementary base, and the auxiliary contains at least one special modified base or base analog, including: RNA base, deoxyxanthine or abasic site; after the linker ligation reaction is completed, the abasic site enzyme RnaseH or Endonuclease IV is used to repair DNA damage to perform enzymatic cleavage, so that the auxiliary breaks and exposes the hydroxyl group that the polymerase can extend and polymerize; the polymerase then unblocks and polymerizes to form a complementary chain of the DNA fragment.

[0018] In the first) method:

[0019] The process of assisting the connection and extending the 3' end of the DNA fragment into a double-stranded DNA includes: performing the process in the same reaction system, or performing the process in two reaction systems;

[0020] If the reaction is carried out in the same reaction system, a mixture of common dNTPs and hot-start dNTPs needs to be added to the system, wherein the common dNTPs are selected from any one, two or three of the four dNTPs, and the hot-start dNTPs are selected from the remaining three, two or one of the selected common dNTPs; the tailing reaction of the DNA fragment is carried out using the common dNTPs under a relatively low temperature; then, the DNA fragment is connected to the linker with the help of the auxiliary, and a higher temperature is given to the system to make the hot-start dNTP enter an activated working state; finally, a relatively low temperature is given, and the auxiliary or primer is used to extend forward with the DNA fragment as a template to obtain a complementary chain of the DNA fragment;

[0021] If the process of auxiliary connection and extension of the 3' end of the DNA fragment into a double-stranded DNA is not carried out in the same reaction system, there is no need to use hot-start dNTPs, but ordinary dNTPs are used. In this case, the system is not given a higher temperature to enable the hot-start dNTPs to enter an activated working state; one, two or three of the four ordinary dNTPs are used for tailing, and four ordinary dNTPs are used for extension.

[0022] The above-mentioned common dNTPs select any one, two or three of the four dNTPs, and the hot-start dNTPs are the selected common dNTPs corresponding to the remaining three, two or one; for example, it can be understood that: one common dNTP selects one, and the hot-start dNTP selects the other three; two common dNTPs select two, and the hot-start dNTP selects the other two; three common dNTPs select three, and the hot-start dNTP selects the other one.

[0023] In the first) method:

[0024] The blocking method is a modification that makes the 3' end of the DNA unable to be extended, including any one of phosphate group modification, C3Spacer modification or RNA base modification.

[0025] Further,

[0026] If the 3' end of the auxiliary is modified with a phosphate group or C3Spacer, the base designed at the 3' end of the auxiliary should not be complementary to the DNA chain. The block can be removed by adding a high-fidelity polymerase or other enzymes with 3' exo-cutting activity to the system to remove the non-complementary bases.

[0027] Alternatively, the 3' end of the auxiliary is blocked with a phosphate group or C3spacer, the last base at the 3' end of the auxiliary is a non-complementary base, and the auxiliary contains at least one special modified base or base analog, including: RNA base, deoxyxanthine or abasic site; after the linker ligation reaction is completed, the abasic site enzyme RnaseH or Endonuclease IV is used to repair DNA damage to perform enzyme cleavage, so that the auxiliary breaks and exposes the hydroxyl group that the polymerase can extend and polymerize; the polymerase then unblocks and polymerizes to form a complementary chain of the DNA fragment;

[0028] The RNA base modification method is that at least the first base at the 3' end of the auxiliary is blocked with an RNA base; the RNA base is rA, rG, rC or rU, and the blocking is released by high temperature treatment.

[0029] Specifically, the non-complementary blocking base is dropped under high temperature conditions (such as 95° C.), so that the 3' terminal hydroxyl group of the auxiliary is exposed to allow the polymerase in the system to polymerize and generate a template complementary chain.

[0030] In the first method, two artificially synthesized nucleotide fragments are used for 3'-end auxiliary connection of DNA fragments. The auxiliary and the linker react with DNA to produce three intermediate products before the connection occurs: Product 1: the 3' tail of DNA and the linker are completely complementary with the help of the auxiliary, and there is no base gap or redundant region between the 3' tail of DNA and the linker. At this time, this product is connected by DNA ligase through the formation of phosphodiester bond; Product 2: there is a base gap between the 3' tail of DNA and the 5' end of the linker, which needs to be filled by DNA polymerase polymerization and then connected by DNA ligase; Product 3: there is base redundancy between the 3' tail of DNA and the 5' end of the linker, which needs to be cut off by nuclease endonuclease or exonuclease and then connected by DNA ligase.

[0031] Further,

[0032] DNA 3' end auxiliary ligation reduces or eliminates the generation of product 3 by limiting the number of bases complementary between the auxiliary and the DNA 3' end tail to less than 10.

[0033] Further,

[0034] The length of the linker ranges from 5-80nt, preferably 10-60nt, and more preferably 20-50nt; the length of the auxiliary ranges from 5-80nt, preferably 10-60nt, and more preferably 20-50nt; the length of the tailing ranges from 1-30nt, preferably 2-25nt, and more preferably 3-20nt; the length of the extension primer ranges from 5-75nt, preferably 8-70nt, and more preferably 10-60nt.

[0035] Further,

[0036] If the process of auxiliary connection and extension of the 3' end of the DNA fragment into a double-stranded DNA is carried out in the same reaction system, the reaction is carried out at 25°C-42°C for 1 minute-60 minutes, and the DNA fragment is tailed using the common dNTP; then the linker and the auxiliary are connected to the DNA fragment, and then the reaction is carried out at 90°C-100°C for 5 seconds-60 minutes to allow the hot-start dNTP to enter an activated working state; finally, the reaction is carried out at 42°C-75°C for 5 seconds-60 minutes to obtain the complementary chain of the DNA fragment.

[0037] If the process of auxiliary ligation and extension of DNA fragment 3' end into double-stranded DNA is not carried out in the same reaction system, the reaction procedure of auxiliary ligation at 3' end is: 25℃-42℃ for 1 minute to 60 minutes; 55℃-75℃ for 5 seconds to 60 minutes; the reaction procedure of extension into double-stranded DNA is: 55℃-75℃ for 5 seconds to 60 minutes.

[0038] The reaction is carried out at 25℃-42℃ for 1 minute to 60 minutes. In this temperature range, terminal transferase tailing and DNA ligase ligation are mainly effective. At this time, only common dNTP types can be added for tailing. The reaction is carried out at 90℃-100℃ for 5 seconds to 60 minutes. The terminal transferase tailing and DNA ligase that worked in the previous temperature range have been inactivated, and the hot-start dNTP enters the activated working state. The auxiliary is denatured and leaves the DNA chain. The RNA block can be unblocked at this temperature, or the all-RNA auxiliary is degraded at this temperature. The reaction is carried out at 42℃-75℃ for 5 seconds to 60 minutes. If there is a DNA auxiliary in the system, the auxiliary can re-anneal and bind to the original position of the DNA within this temperature range. The auxiliary containing a mismatched base at the 3' end can be cut off by the high-fidelity polymerase at this time to achieve unblocking. The enzyme used for polymerization extension or excision of the auxiliary starts to work within this temperature range.

[0039] In summary, each enzyme used in the present invention works only in a specific step program and at a specific temperature. If a primer is used in the system, and tailing, auxiliary ligation, and extension are in a total reaction system, the 5' end of the primer is blocked in a manner including RNA bases. If extension is not in the same reaction system as tailing and auxiliary ligation, the primer does not need to be blocked.

[0040] Further,

[0041] The concentration of the auxiliary substance in the total reaction system is 10nM-20uM, preferably 50nM-10uM, and more preferably 100nM-5uM.

[0042] The concentration of linker to auxiliary in the total reaction system is: 1:1-1:10, preferably 1:3-1:5, more preferably 1:5;

[0043] The total amount of DNA fragments in the total reaction system ranges from 1fmol to 1nmol / 50uL;

[0044] The extension primer concentration range in the total reaction system is 10nM-10uM, preferably 20nM-1uM, and further preferably 50nM-200nM;

[0045] The concentration of RNA auxiliary in the total reaction system ranges from 10nM to 50uM; preferably 50nM to 5uM, and more preferably 150nM to 500nM;

[0046] The concentration of common dNTP in the total reaction system is 2uM-2mM; preferably 10uM-1mM; further preferably 30uM-0.5mM; the concentration of common dNTP in the total reaction system is 1 to 3 times that of each hot start dNTP.

[0047] Further,

[0048] The DNA ligase used for ligation includes: one or more of T4 DNA ligase, T3 DNA ligase, T7 DNA ligase, Taq DNA ligase, E. coli DNA ligase, 9°N DNA ligase, and SplintR ligase; the concentration of the ligase in the reaction system is 0.02U / uL-2U / uL;

[0049] The polymerase used for polymerization includes one or more of T4 DNA polymerase, E. coli DNA polymerase I, Klenow large fragment, DNA polymerase I (E. coli), T7 DNA polymerase, and Bsu DNA polymerase large fragment; the concentration of the polymerase in the reaction system is 0.01U / uL-2U / uL;

[0050] The enzyme used to remove the redundant bases between the 3' tail of DNA and the 5' end of the linker includes one or more of T4 DNA polymerase, DNA polymerase I Klenow large fragment, DNA polymerase I, and endonuclease FEN1; the concentration in the reaction system is 0.01U / uL-2U / uL, preferably 0.1U / uL-1U / uL, and further preferably 0.2U / uL-0.8U / uL;

[0051] The concentration range of terminal transferase in the reaction system is 0.15U / uL-15U / uL, preferably 0.3U / uL-3U / uL, and more preferably 0.5U / uL-2U / uL;

[0052] The polymerase having strand displacement activity or 5' to 3' exo-cutting activity includes: at least one of VentDNA polymerase, DeepVentDNA polymerase, phi29DNA polymerase, Bsu DNA polymerase large fragment, BstDNA polymerase full length, and wild-type Taq polymerase, preferably: at least one of 2G Robust DNA polymerase, rTaq DNA polymerase, and TaqB DNA polymerase, and the concentration in the reaction system is 0.01U / uL-20U / uL, preferably 0.1U / uL-10U / uL, and further preferably 0.5U / uL-2U / uL;

[0053] RnaseH or Endonuclease IV is a baseless site enzyme for repairing DNA damage, with a concentration of 0.01U / uL-5U / uL in the reaction system, preferably 0.1U / uL-2U / uL, and more preferably 0.2U / uL-1U / uL;

[0054] The enzymes for removing the non-complementary bases by high-fidelity polymerase or other 3' exo-active enzymes include: one or more of kapa HIFI hot start high-fidelity polymerase, pfu DNA polymerase, and phusion DNA polymerase; the concentration in the reaction system is 0.01U / uL-20U / uL, preferably 0.04U / uL-5U / uL, and further preferably 0.1U / uL-0.5U / uL.

[0055] Further,

[0056] In step (3), the 5' end connector is connected using a connection enhancer, and the connection enhancer includes: 3-dimethylamino-1,2-propylene glycol, R-(-)-1,2-propylene glycol, (S)-(-)-1,1-diphenyl-1,2-propylene glycol, (S)-(+)-1,2-propylene glycol, hydroxypropyl methacrylate, tripropylene glycol, propylene glycol butyl ether, (S)-(+)-3-chloro-1,2-propylene glycol, (R)-(-)-3-chloro-1,2-propylene glycol propylene glycol acetal At least one of ketone, 1,2-diacetoxypropane, (S)-(-)-propylene carbonate, (R)-(+)-propylene carbonate, 3-amino-1,2-propylene glycol, propylene glycol methyl ether, 1-thioglycerol, (R)-3-amino-1,2-propylene glycol, tris(2-carboxyethyl)phosphine hydrochloride, propylene glycol methyl ether acetate, and 1,2-propylene glycol; the concentration (W / W) in the reaction system is 0.1%-50%, preferably 1%-10%, and more preferably 2%-6%.

[0057] In order to better understand the present invention, various specific examples for achieving the objectives of the invention are described in more detail below.

[0058] Nucleic acid fragmentation: The starting template of the present invention can be double-stranded or single-stranded DNA, or it can be RNA. It can be various lengths of 10bp-1000bp. Preferably 50bp-800bp, and more preferably 100bp-300bp. If the DNA or RNA is too long, it needs to be fragmented first. The fragmentation treatment scheme can be a commonly used scheme in the genetic testing industry. For example, long double-stranded DNA can be treated with ultrasonic fragmentation, endonuclease digestion, etc. Long-chain RNA can be treated with divalent metal ions and high temperatures above 95°C, etc. It is not limited to the treatment methods exemplified above, and any method that can effectively fragment nucleic acids can be used. If the nucleic acid itself is already a shorter fragment, fragmentation is not required.

[0059] Phosphorylation of cDNA 5' end and hydroxylation of 3' end: For RNA molecules, a reverse transcription primer with 5' end phosphorylation can be used during reverse transcription, so that the product of reverse transcription is a cDNA that meets the conditions of 5' end phosphorylation and 3' end hydroxylation. It is also possible to use T4PNK enzyme or other enzymes with the same effect to perform 5' end phosphorylation modification during or during reverse transcription. For DNA molecules, 5' end phosphorylation modification and 3' end hydroxylation treatment can be performed using T4PNK enzyme or other enzymes with the same effect. The processing method of this step is not limited to the described scheme, and any processing scheme that can achieve the same effect can be implemented in the present invention.

[0060] Tailing of nucleic acid 3' end: There are many ways to tail the nucleic acid 3' end. For example, RNA terminal adenylate transferase uses ATP or its analogs as precursors to add single nucleotides to the 3' tail of the nucleic acid. If the 3' tailing of the nucleic acid is achieved by this method, the steps of the present invention can be swapped, for example, the 3' tailing of the nucleic acid is first performed, and then the 3' auxiliary connection is performed, and then RNA reverse transcription is performed. Terminal transferase (TdT) can also be used to tail the nucleic acid 3' end using one, two or three of the four dNTPs A, T, G, and C as materials. The number of tails added can be from 1 base to dozens of bases. The length of the tail added can be controlled by adjusting the concentration of various dNTPs.

[0061] In some cases, one, two or three modified dNTPs may be included so that they cannot be used by the tailing enzyme or polymerase at lower temperatures, but can be used by the enzyme at higher temperatures. A similar example of such a modifiable dNTP is the hot start dNTP of TriLINK. In some cases, the next step, i.e., DNA 3' end auxiliary ligation, can be carried out in the same reaction system and reaction conditions as the 3' end tailing reaction of nucleic acid.

[0062] DNA 3' end auxiliary ligation: DNA 3' end auxiliary ligation can use two artificially synthesized nucleotide fragments, an auxiliary and a linker. The 3' end sequence of the auxiliary can be complementary to the tailing sequence of the 3' end of the nucleic acid, and the 5' end of the auxiliary can be partially complementary to the linker. The 3' ends of the auxiliary and the linker in this scheme need to be blocked to prevent the DNA tailing reaction from mistaking the auxiliary for the template DNA for the wrong tailing operation. During the invention process of the present invention, the inventors were surprised to find that under certain suitable reaction systems, the auxiliary and the linker do not need to undergo additional annealing reactions in advance. This makes subsequent experiments based on heating reactions to decompose the auxiliary possible. Because if the auxiliary is to be decomposed through a subsequent heating reaction, it is impossible to anneal the auxiliary and the linker through thermal denaturation and annealing before the connection event. The specific feasible process is: in the reaction system, the auxiliary first finds the 3' end sequence of the nucleic acid that has been tailed and complementarily binds to it, and the linker also binds to the 5' end sequence of the auxiliary. Three types of products may be produced here (such as Figure 3 ): Product 1: The 3' tail of DNA and the linker are completely complementary with the help of the auxiliary, and there is no base gap or redundant region between them. At this time, this product can be connected by DNA ligase through the formation of phosphodiester bond; Product 2: There is a base gap between the 3' tail of DNA and the 5' end of the linker. The gap is filled by DNA polymerase and then connected by DNA ligase; Product 3: There is base redundancy between the 3' tail of DNA and the 5' end of the linker. The redundant bases are cut off by nuclease or exonuclease and then connected by DNA ligase. DNA 3' end assisted connection can also reduce or eliminate the production of product 3 by limiting the number of bases complementary to the auxiliary and DNA 3' tail (that is, the number of complementary bases at the 3' end of the auxiliary) (such as Figure 4 ). For example, the number of bases complementary to the 3' tail of DNA by the auxiliary is reduced to 10 or 9 or 8 or 7 or 6 or 5 or 4 or 3 or 2 or 1. Since the auxiliary is first complementary to the bases near the tail of the 3' tail of DNA, reducing the number of bases complementary to the 3' tail of DNA by the auxiliary can not only significantly reduce or eliminate Figure 3 The production of product 3 is reduced, and the number of bases added to the 3' end of DNA is shortened. In NGS sequencing, the sequencing of the 3' end of DNA is meaningless, so this is conducive to reducing meaningless base sequencing and reducing sequencing costs. DNA 3' end auxiliary connection can also use only one artificially synthesized nucleotide fragment, namely the auxiliary. The specific principle of this scheme is (such as Figure 5 ): The dNTPs in the system are a mixture of common dNTPs and hot-start dNTPs. Figure 5An example is given in which dNTPs are ordinary dATP and hot-start dTTP, dCTP, and dGTP. Lower temperatures are suitable for DNA tailing reactions, and suitable tailing enzymes can only add ordinary dATP to the 3' end of DNA. Then give the system a higher temperature to activate the hot-start dTTP, dCTP, and dGTP to work. Then give a relatively low temperature to allow the auxiliary to complementarily bind to the 3'-end tailing sequence of the DNA, and then the DNA polymerase extends forward along the 3'-end tail of the DNA until the complementary chain of the auxiliary is extended using the auxiliary as a template. The 3' end of the auxiliary in this scheme needs to be blocked to prevent the DNA tailing reaction from mistaking the auxiliary for the template DNA for the tailing operation. The advantage of this scheme is that it will not produce Figure 3 The three intermediate products in the scheme do not need to be connected. Another advantage of this scheme is that DNA tailing and DNA 3' end auxiliary connection can be carried out in one reaction system. It improves efficiency and reduces purification steps. This is of great significance for trace amounts of DNA starting materials. Another preferred scheme for DNA 3' end auxiliary connection is as follows Figure 6 : The last base at the 3' end of the auxiliary is not complementary to the 3' end of the DNA. Under appropriate temperature conditions, the corresponding enzyme with correction activity in the system converts the non-complementary base ( Figure 6 The example is G base) and the blocking is removed, so that the auxiliary exposing the 3' terminal hydroxyl group, for the polymerase in the system to polymerize and generate template complementary chain. The advantage of this scheme is that it will not produce Figure 3 The three intermediate products in the scheme, more importantly, DNA tailing, DNA 3' end auxiliary connection, and template chain extension can be carried out in one reaction system. This further improves efficiency and reduces the number of operation steps. In another solution, a long linker and a short auxiliary can be used for auxiliary connection (such as Figure 7 ). Then, a short extension primer complementary to the 3' direction of the linker is used to polymerize the complementary strand of the template strand. In this solution, the polymerase needs to have strand displacement activity or 5' to 3' exo-cutting activity. The advantage of this preferred solution is that there is no competition between the auxiliary and the extension primer, ensuring high efficiency extension of the extension primer. In another preferred solution, a long auxiliary and a long linker (such as Figure 8). The long auxiliary can contain one or more special modified bases or base analogs. Such as RNA bases, deoxyxanthine, abasic sites, etc. After the linker connection reaction is completed, the abasic site enzymes such as RnaseH or Endonuclease IV that repair DNA damage can be used for enzymatic cutting to break the long auxiliary and expose the hydroxyl group that the polymerase can extend and polymerize. The polymerase then unblocks and polymerizes to form a template complementary chain. The advantage of this preferred solution is that there is no need to add additional extension primers to compete with the blocked auxiliary, ensuring the efficient formation of double-stranded extension products. In another preferred solution, RNA auxiliary can be used. The connection of this solution must be combined with a specific ligase (such as SplintR ligase, NEB, #M0375). Fig. 9 The advantages of this preferred solution are that firstly, the auxiliary subunit is a nucleic acid fragment of RNA base, and its 3' end does not need special base blocking, which saves costs. Secondly, the auxiliary subunit of RNA base is easier to be completely removed in the reaction (such as using RNase, etc.) to prevent it from competing with the extension primer in the subsequent extension reaction.

[0063] Extension primer conversion and extension: In some of the schemes described in the previous step (DNA 3' end auxiliary connection), some schemes have already carried out extension primer conversion and extension reactions simultaneously. In this extension reaction, various qualified DNA polymerases can be used, such as high-fidelity DNA polymerases, various Taq DNA polymerases, etc. In the present invention, Taq DNA polymerase is preferred for this step because the 3' end of its extended product has an A base protruding. The product with this characteristic is extremely important in the following connection step.

[0064] 5' end adapter connection: This reaction completes the connection of double-stranded or partially double-stranded DNA adapters to the double-stranded extension product. The adapter to be connected depends on the characteristics of the double-stranded extension product. If the extension uses a high-fidelity polymerase (or a polymerase with exo-cutting activity in the 3' to 5' direction), the product has a flat end, and the corresponding connection adapter used should also be a flat end adapter. If the extension uses a polymerase that does not have exo-cutting activity in the 3' to 5' direction, such as Taq DNA polymerase, the product has a sticky end with an A base at 3', and the corresponding connection adapter used should be a sticky end adapter with a T base at 3'. The present invention preferably uses the latter scheme. Because the latter scheme can first ensure that the double-stranded extension products and the double-stranded adapters will not self-connect, that is, it can ensure that only the double-stranded extension product and the double-stranded adapter can be connected. More importantly, this connection scheme connects both the upper and lower chains of the double-stranded extension product to the adapter sequence. This also means that this scheme further makes full use of the trace template DNA, which is originally not much. In addition, the practitioners of the present invention surprisingly found that using certain chemicals as ligation enhancers in the ligation system can greatly improve the efficiency of ligation, which obviously further improves the conversion efficiency of the library of trace nucleic acids compared with the common 30%-50% ligation efficiency in the industry.

[0065] Dual-template substrate amplification: As described in the previous step, in the preferred embodiment of the present invention, since the nucleic acid template itself and its extended complementary chain are connected to the adapter sequence, the universal primer can be used for library amplification, and finally during the exponential phase of PCR amplification, the library yield can be doubled compared to the scheme of connecting only one chain (the nucleic acid template itself or its complementary chain). BRIEF DESCRIPTION OF THE DRAWINGS

[0066] Figure 1 This is the technical process of the present invention using RNA as an example;

[0067] Figure 2 It is the specific technical details of the present invention;

[0068] Figure 3 There are three structures of products to be connected;

[0069] Figure 4 It is the number of DNA tailing bases that affects the ratio of the three products to be connected;

[0070] Figure 5 It is a scheme that uses hot-start dNTP;

[0071] Figure 6 It is a preferred solution using hot-start dNTPs;

[0072] Figure 7 It is a scheme to avoid competition between the helper and the extension primer;

[0073] Figure 8 It is a scheme that does not require primer extension;

[0074] Fig. 9 It is a connection scheme in which RNA acts as a helper;

[0075] Fig.10 This is the gel image of the library of Example 1;

[0076] Fig.11 This is the gel image of the library of Example 2;

[0077] Fig.12 This is the gel image of the library of Example 3;

[0078] Fig.13 This is the gel image of the library of Example 4;

[0079] Fig.14 This is the gel image of the library of Example 5;

[0080] Fig.15 This is the glue picture of the connection product of Example 6. DETAILED DESCRIPTION

[0081] The following examples are intended to further illustrate the present invention, but are not intended to limit the present invention.

[0082] Example 1

[0083] Long RNA molecule library preparation

[0084] Arabidopsis mRNA was extracted using a commercial kit. 500 pg of mRNA was used to construct a library. Reverse transcription primer P1 sequence:

[0085] 5'P-NNNNNNNN-3'

[0086] 1. Nucleic acid fragmentation

[0087] The reaction system is as follows:

[0088]

[0089] React at 70°C for 1.5 minutes.

[0090] Purification by Qiagen column.

[0091] 2. RNA Reverse Transcription

[0092] The reaction system is as follows:

[0093] Fragmented mRNA 11uL Reverse transcription primer P1 (0.3ug / uL) 1uL Total volume 12uL

[0094] Incubate at 65°C for 5 minutes and place on ice immediately.

[0095] Prepare the following reaction reagents:

[0096] 5x First Strand Buffer 4uL DTT(100mM) 2uL dNTP (10mM each) 1uL Rnase inhibitor 0.5uL Total volume 7.5uL

[0097] Add 12uL of the RNA-containing reaction system from the previous step to 7.5uL of the reagent.

[0098] After reacting at 25°C for 2 minutes, Superscript III reverse transcriptase was immediately added.

[0099] 1uL. After mixing, proceed with the following reaction:

[0100] 25℃ for 10 minutes, 42℃ for 50 minutes, and store at 4℃.

[0101] After the reaction was completed, it was purified by Qiagen column.

[0102] 3. cDNA 3' end tailing and auxiliary ligation

[0103] Auxiliary A1 sequence:

[0104] GTGACTGGAGTTCAGACGTGT-ap-CTCTTCCGATCTTTTT-C3 (3' end C3 spacer closed) sequence see SEQ ID NO.1,

[0105] (ap is an empty base site, which can be cut off by a specific enzyme, such as the enzyme Tth Endonuclease IV in this example)

[0106] Linker L1 sequence:

[0107] p-AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC-C3 (3' end C3 spacer closed) sequence see SEQ ID NO.2;

[0108] The reaction system is as follows:

[0109]

[0110] First, 30uL cDNA was incubated at 95℃ for 1 minute on a PCR instrument and stored at 4℃.

[0111] Add the above 20uL reaction mixture to the above cDNA and mix well.

[0112] Incubate at 37°C for 10 min, 65°C for 15 min on a PCR machine, and store at 4°C.

[0113] 4. Primer extension conversion and extension

[0114] In step 3 of this embodiment, the conversion of the auxiliary to the extension primer has been completed by enzyme cleavage of the auxiliary, so only the extension reaction solution needs to be prepared.

[0115] Prepare the following reaction solution:

[0116]

[0117] Add 20uL of the reaction solution into the reaction system completed in step 3.

[0118] Incubate at 72°C for 12 minutes in a PCR instrument and store at 4°C.

[0119] 2x Ampure xp beads purification.

[0120] 5.5' terminal connector

[0121] 5' end adapter ADT1 production:

[0122] ADT1-U:

[0123] AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, sequence see SEQ ID NO.3;

[0124] ADT1-D:

[0125] p-GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG, sequence see SEQ ID NO.4;

[0126] After mixing ADT1-U and ADT1-D, incubate in a PCR machine at 98°C for 2 minutes, then slowly lower the temperature to room temperature to anneal them into double strands.

[0127] Prepare the following reaction system:

[0128]

[0129] Incubate at 25°C for 15 minutes, 65°C for 20 minutes on a PCR instrument, and store at 4°C.

[0130] 2x Ampure xp beads purification.

[0131] 6. Dual-template substrate amplification

[0132] The amplification primer sequences are as follows:

[0133] PCR-F1:

[0134] AATGATACGGCGACCACCGA, sequence see SEQ ID NO.5,

[0135] PCR-R1:

[0136] CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGT, sequence see SEQ ID NO.6,

[0137] The amplification reaction system is as follows:

[0138] Connect products 33uL 5x buffer A 10uL 2G Robust DNA Polymerase (5U / uL) 1uL dNTP(2.5mM) 4uL Primer PCR-F1 (10uM) 1uL Primer PCR-R1 (10uM) 1uL Total volume 50uL

[0139] The amplification procedure is as follows:

[0140]

[0141] Take 5uL of the final library for 2% agarose gel electrophoresis.

[0142] Example 1 Experimental results are shown in Fig.10 .

[0143] Example 2

[0144] Method for competition between extension primer and helper position

[0145] Take a 180 bp PCR product with 5' phosphorylated end.

[0146] 1.3' end auxiliary connection

[0147] Auxiliary A2 sequence:

[0148] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTTTT-C3 (3' end C3 spacer closed) sequence see SEQ ID NO.7,

[0149] Linker L1 sequence:

[0150] p-AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC-C3 (3' end C3 spacer blocked) extension primer Y1 sequence:

[0151] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATrC (3' end RNA base rC blocked) sequence see SEQ ID NO.8,

[0152] The reaction system is as follows:

[0153]

[0154]

[0155] First, 30uL30ng180bp PCR product was incubated at 95℃ for 1 minute on a PCR instrument and stored at 4℃.

[0156] Add the above 20uL reaction mixture to the above DNA and mix well.

[0157] Incubate at 37°C for 10 minutes, 95°C for 2 minutes, 72°C for 5 minutes on a PCR instrument and store at 4°C.

[0158] Purify using 2X AmpureXP beads.

[0159] 2.5' end connector connection

[0160] 5' end adapter ADT1 production:

[0161] ADT1-U:

[0162] AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTADT1-D:

[0163] After mixing p-GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTGADT1-U and ADT1-D and other substances, incubate at 98°C for 2 minutes on a PCR instrument, then slowly lower the temperature to room temperature to anneal them into double strands to prepare the 5' end adapter ADT1.

[0164] Prepare the following reaction system:

[0165]

[0166] Incubate at 25°C for 15 minutes, 65°C for 20 minutes on a PCR instrument, and store at 4°C.

[0167] 2x Ampure xp beads purification.

[0168] 3. Dual template substrate amplification

[0169] The amplification primer sequences are as follows:

[0170] PCR-F1:

[0171] AATGATACGGCGACCACCGA

[0172] PCR-R1:

[0173] CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGT

[0174] The amplification reaction system is as follows:

[0175] Connect products 33uL 5x buffer A 10uL 2G Robust DNA Polymerase (5U / uL) 1uL dNTP(2.5mM) 4uL Primer PCR-F1 (10uM) 1uL Primer PCR-R1 (10uM) 1uL Total volume 50uL

[0176] The amplification procedure is as follows:

[0177]

[0178] Take 5uL of the final library for 2% agarose gel electrophoresis.

[0179] Example 2 Experimental results are shown in Fig.11 .

[0180] Example 3

[0181] Method for carrying out DNA tailing, DNA 3' end auxiliary connection and template chain extension in the same reaction system

[0182] Take 180 bp of PCR product.

[0183] Auxiliary A3 sequence (using C3spacer to block the 3' end):

[0184] TTCAGACGTGTGCTCTTCCGATCTTTTTTTTTTTTTTG-C3 sequence is shown in SEQ ID NO.9,

[0185] 1. The reaction system is as follows:

[0186]

[0187] First, 30uL (10ng) of 180bp PCR product was incubated at 95°C for 1 minute on a PCR instrument and stored at 4°C.

[0188] Add the above 20uL reaction mixture to the above DNA and mix well.

[0189] Incubate on PCR instrument at 37°C for 10 minutes, 95°C for 10 minutes, 72°C for 15 minutes, and store at 4°C.

[0190] 2x Ampure xp beads purification.

[0191] 2.5' end connector connection

[0192] 5' end adapter ADT1 production:

[0193] ADT1-U:

[0194] AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAGCTCTTCCGATCT

[0195] ADT2-D:

[0196] p-AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG sequence is shown in SEQ ID NO.10,

[0197] After mixing the substances such as ADT1-U and ADT2-D, incubate them at 98°C for 2 minutes on a PCR instrument, and then slowly cool them to room temperature to anneal them into double strands to prepare the 5' end adapter ADT2.

[0198] Prepare the following reaction system:

[0199]

[0200] Incubate at 25°C for 15 minutes, 65°C for 20 minutes on a PCR instrument, and store at 4°C.

[0201] 2x Ampure xp beads purification.

[0202] 3. Dual template substrate amplification

[0203] The amplification primer sequences are as follows:

[0204] PCR-F1:

[0205] AATGATACGGCGACCACCGA

[0206] PCR-R1:

[0207] CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGT

[0208] The amplification reaction system is as follows:

[0209]

[0210]

[0211] The amplification procedure is as follows:

[0212]

[0213] Take 5uL of the final library for 2% agarose gel electrophoresis.

[0214] Example 3 Experimental results are shown in Fig.12 .

[0215] Electrophoresis results Fig.12 This indicates that the library can be effectively constructed by using the auxiliary A4 with an incomplete 3' end match in combination with a high-fidelity polymerase in this example.

[0216] Example 4

[0217] Method for assisted ligation using long linkers and short helpers

[0218] Take 10 ng of 220 bp PCR product.

[0219] Auxiliary A4 sequence:

[0220] The sequence of CTCTTCCGATCTTTTT-C3 (using C3 spacer to block the 3' end) is shown in SEQ ID NO.11,

[0221] Linker L1 sequence:

[0222] p-AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC-C3 (using C3spacer to block the 3' end)

[0223] Extension primer Y2 sequence:

[0224] GTGACTGGAGTTCAGACG sequence is shown in SEQ ID NO.12,

[0225]

[0226] First, 30uL (10ng) of 180bp PCR product was incubated at 95°C for 1 minute on a PCR instrument and stored at 4°C.

[0227] Add the above 20uL reaction mixture to the above DNA and mix well.

[0228] Incubate at 37°C for 10 minutes, 65°C for 20 minutes on a PCR instrument, and store at 4°C.

[0229] Prepare the following reaction system

[0230]

[0231] Add 50uL of reaction solution into the 50uL reaction system completed in the above step.

[0232] Incubate at 72°C for 12 minutes in a PCR instrument and store at 4°C.

[0233] 2x Ampure xp beads purification.

[0234] 2.5' end connector connection

[0235] 5' end adapter ADT1 production:

[0236] ADT1-U:

[0237] AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAGCTCTTCCGATCT

[0238] ADT1-D:

[0239] p-GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG

[0240] After mixing ADT1-U and ADT1-D and other substances, incubate at 98°C for 2 minutes on a PCR instrument, and then slowly cool to room temperature to anneal them into double strands to produce the 5' end adapter ADT1.

[0241] Prepare the following reaction system:

[0242]

[0243] Incubate at 25°C for 15 minutes, 65°C for 20 minutes on a PCR instrument, and store at 4°C.

[0244] 2x Ampure xp beads purification.

[0245] 3. Dual template substrate amplification

[0246] The amplification primer sequences are as follows:

[0247] PCR-F1:

[0248] AATGATACGGCGACCACCGA

[0249] PCR-R1:

[0250] CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGT

[0251] The amplification reaction system is as follows:

[0252]

[0253]

[0254] The amplification procedure is as follows:

[0255]

[0256] Take 5uL of the final library for 2% agarose gel electrophoresis.

[0257] Example 4 Experimental results are shown in Fig.13 .

[0258] Example 4 shows that the library can also be efficiently constructed by using a long linker and a short helper, in combination with an extension primer that does not compete with the helper.

[0259] Example 5

[0260] Method for assisted ligation using RNA as an assistant

[0261] Take a 180 bp PCR product with 5' phosphorylated end.

[0262] 1.3' end auxiliary connection

[0263] Auxiliary A5 sequence:

[0264] rUrUrCrArGrArCrGrUrGrUrGrCrUrCrUrUrCrCrGrArUrCrUr ...

[0265] Linker L1 sequence:

[0266] p-AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC-C3

[0267] Extension primer Y1 sequence:

[0268] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATrC

[0269] The reaction system is as follows:

[0270]

[0271] First, 30 ng of 180 bp PCR product was incubated at 95°C for 1 minute on a PCR instrument and stored at 4°C.

[0272] Add the above 20uL reaction mixture to the above DNA and mix well.

[0273] Incubate at 30°C for 10 minutes, 95°C for 2 minutes, 72°C for 5 minutes on a PCR instrument and store at 4°C.

[0274] Purify using 2X AmpureXP beads.

[0275] 2.5' end connector connection

[0276] 5' end adapter ADT1 production:

[0277] ADT1-U:

[0278] AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAGCTCTTCCGATCT

[0279] ADT1-D:

[0280] p-GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG

[0281] After mixing ADT1-U and ADT1-D and other substances, incubate at 98°C for 2 minutes on a PCR instrument, and then slowly cool to room temperature to anneal them into double strands to produce the 5' end adapter ADT1.

[0282] Prepare the following reaction system:

[0283]

[0284] Incubate at 25°C for 15 minutes, 65°C for 20 minutes on a PCR instrument, and store at 4°C.

[0285] 2x Ampure xp beads purification.

[0286] 3. Dual template substrate amplification

[0287] The amplification primer sequences are as follows:

[0288] PCR-F1:

[0289] AATGATACGGCGACCACCGA

[0290] PCR-R1:

[0291] CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGT

[0292] The amplification reaction system is as follows:

[0293]

[0294]

[0295] The amplification procedure is as follows:

[0296]

[0297] Take 5uL of the final library for 2% agarose gel electrophoresis.

[0298] Example 5 Experimental results are shown in Fig.14 .

[0299] Example 6

[0300] 5' end adapter ligation using ligation enhancer to improve ligation efficiency

[0301] The following oligonucleotide sequences were artificially synthesized:

[0302] OLG1 sequence:

[0303] ACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCA sequence is shown in SEQ ID NO.14, OLG2 sequence:

[0304] GAGACATGTATAGCATGGAACCAAGTAACATTGGAAAAGAAAGGTA sequence is shown in SEQ ID NO.15, ADT1 sequence:

[0305] AGATCGGAAGAGCACT sequence is shown in SEQ ID NO.16, ADT2 sequence:

[0306] GTGCTCTTCCGATCT sequence is shown in SEQ ID NO.17,

[0307] The OLG1 sequence and the OLG2 sequence anneal to form an OLG double-stranded DNA of about 47 bp with an A base overhanging at both 3' ends, and the ADT1 sequence and the ADT2 sequence anneal to form an ADT double-stranded linker of about 16 bp with a T base overhanging at one 3' end.

[0308] 19 commonly used laboratory reagents were selected as ligation enhancers, and the reagents that have an enhancing effect on the ligation reaction were selected. The experimental system is as follows:

[0309]

[0310] S0 is a negative control without the addition of T4 DNA ligase.

[0311] S1 is a positive reaction control without the addition of enhancer.

[0312] The corresponding enhancers and proportional concentrations are shown in the following table:

[0313]

[0314]

[0315] The ligation product was run on 4% agarose gel.

[0316] Example 6 Experimental results are shown in Fig.15 .

[0317] The experimental results show that S4, S5, S6, S9, S13, S14, S15, S16, S19, and S20 have a relatively obvious enhancing effect on the ligation reaction within the concentration range of the embodiment. Sequence Listing <110> Hunan Dadi Tongnian Biotechnology Co., Ltd. <120> A method for constructing a trace nucleic acid library <160> 17 <170> SIPOSequenceListing 1.0 <210> 1 <211> 37 <212> DNA <213> Artificial Sequence <400> 1 gtgactggag ttcagacgtg tctcttccga tcttttt 37 <210> 2 <211> 34 <212> DNA <213> Artificial Sequence <400> 2 agatcggaag agcacacgtc tgaactccag tcac 34 <210> 3 <211> 58 <212> DNA <213> Artificial Sequence <400> 3 aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatct 58 <210> 4 <211> 63 <212> DNA <213> Artificial Sequence <400> 4 gatcggaaga gcacacgtct gaactccagt cacatcacga tctcgtatgc cgtcttctgc 60 ttg 63 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <400> 5 aatgatacgg cgaccaccga 20 <210> 6 <211> 49 <212> DNA <213> Artificial Sequence <400> 6 caagcagaag acggcatacg agatcgtgat gtgactggag ttcagacgt 49 <210> 7 <211> 38 <212> DNA <213> Artificial Sequence <400> 7 gtgactggag ttcagacgtg tgctcttccg atcttttt 38 <210> 8 <211> 33 <212> DNA / RNA <213> Artificial Sequence <400> 8 gtgactggag ttcagacgtg tgctcttccg atc 33 <210> 9 <211> 38 <212> DNA <213> Artificial Sequence <400> 9 ttcagacgtg tgctcttccg atcttttttt tttttttg 38 <210> 10 <211> 64 <212> DNA <213> Artificial Sequence <400> 10 agatcggaag agcacacgtc tgaactccag tcacatcacg atctcgtatg ccgtcttctg 60 cttg 64 <210> 11 <211> 16 <212> DNA <213> Artificial Sequence <400> 11 ctcttccgat cttttt 16 <210> 12 <211> 18 <212> DNA <213> Artificial Sequence <400> 12 gtgactggag ttcagacg 18 <210> 13 <211> 29 <212> RNA <213> Artificial Sequence <400> 13 uucagacgugugcucuuccgaucuuuuuu 29 <210> 14 <211> 46 <212> DNA <213> Artificial Sequence <400> 14 acctttcttt tccaatgtta cttggttcca tgctatacat gtctca 46 <210> 15 <211> 46 <212> DNA <213> Artificial Sequence <400> 15 gagacatgta tagcatggaa ccaagtaaca ttggaaaaga aaggta 46 <210> 16 <211> 16 <212> DNA <213> Artificial Sequence <400> 16 agatcggaag agcact 16 <210> 17 <211> 15 <212> DNA <213> Artificial Sequence <400> 17 gtgctcttcc gatct 15

Claims

1. A method for constructing a trace nucleic acid library, characterized in that: The following steps are involved: (1) Obtaining fragmented single-stranded DNA or cDNA that has been phosphorylated at the 5' end and hydroxylated at the 3' end; (2) The DNA fragments obtained in step (1) are subjected to 3' end auxiliary connection to extend into double-stranded DNA; (3) The 5' end of the double-stranded DNA obtained in step (2) is connected to a linker, and then a dual-template substrate amplification is performed to obtain a library; The process of step (2) is performed in the following manner: The DNA fragments are subjected to 3' end auxiliary connection using two artificially synthesized nucleotide fragments: an auxiliary and a linker; the 3' end sequence of the auxiliary is complementary to the tailing sequence at the 3' end of the DNA, the 5' end of the auxiliary is complementary to the linker, and the linker is connected to the 3' end tailing sequence of the DNA by DNA ligase; the 3' ends of the auxiliary and the linker need to be blocked to prevent the tailing enzyme in the system from 3' tailing the auxiliary or the linker; after the linker is connected, an extension primer is added to the system, and the extension primer competes with the auxiliary for position by annealing; The extended primer that successfully competes for the position extends the DNA double strand under the action of polymerase; The process of auxiliary connection and extension of the 3' end of the DNA fragment into a double-stranded DNA includes: a mixture of common dNTPs and hot-start dNTPs needs to be added to the system, the common dNTPs are any one of the four dNTPs, and the hot-start dNTPs are the remaining three corresponding to the selected common dNTPs; the number of bases complementary between the auxiliary subunit and the 3' tail of the DNA in the auxiliary connection of the DNA 3' end is 4-7; the length range of the linker is 10-60nt, the length range of the auxiliary subunit is 10-60nt; the tailing length range is 3-20nt; the extension primer length range is 10-60nt; the process of auxiliary connection and extension of the 3' end of the DNA fragment into a double-stranded DNA is carried out in the same reaction system, reacting at 25℃-42℃ for 10 minutes-60 minutes, and tailing the DNA fragment using the common dNTP; then the linker and the auxiliary subunit are connected to the DNA fragment, and then reacting at 90℃-100℃ for 2 minutes-60 minutes, so that the hot-start dNTP enters the activated working state; finally, at 42℃-75℃ The reaction is carried out under the following conditions for 5 minutes to 60 minutes to obtain the complementary chain of the DNA fragment; the concentration of the auxiliary subunit in the total reaction system is 10nM-20μM; the concentration of the linker and the auxiliary subunit in the total reaction system is 1:1-1:10; the total amount of DNA fragments in the total reaction system ranges from 1fmol to 1nmol / 50μL; the concentration of the extension primer in the total reaction system ranges from 10nM to 10μM; the concentration of the common dNTP in the total reaction system is 2μM to 2mM; the concentration of the common dNTP in the total reaction system is 1 to 3 times that of each hot start dNTP.

2. The method according to claim 1, characterized in that The length of the DNA fragment obtained in step (1) is 10nt-1000nt.

3. The method according to claim 1, characterized in that The DNA ligase used for ligation includes: one or more of T4 DNA ligase, T3 DNA ligase, T7 DNA ligase, Taq DNA ligase, E.coli DNA ligase, 9°N DNA ligase, and SplintR ligase; the concentration of the ligase in the reaction system is 0.02U / μL-2U / μL; the polymerase used for polymerization includes one or more of T4 DNA polymerase, E.coli DNA polymerase I, and T7 DNA polymerase; the concentration of the polymerase in the reaction system is 0.01U / μL-2U / μL.

4. The method according to claim 1, characterized in that: In step (3), the 5' end joint connection uses a connection enhancer, and the connection enhancer includes: one of (S)-(-)-1,1-diphenyl-1,2-propanediol, (S)-(+)-1,2-propanediol, hydroxypropyl methacrylate, (S)-(+)-3-chloro-1,2-propanediol, (R)-(+)-propylene carbonate, 3-amino-1,2-propanediol, propylene glycol methyl ether, 1-thioglycerol, propylene glycol methyl ether acetate, and 1,2-propanediol; the concentration in the reaction system is 0.1%-50% (W / W).

Images