TAU proteinopathy model

By reducing the expression of BANF1, PPP2CA and ANKLE2 in tau disease models and combining exogenous tau coding sequences, the problem of abnormal accumulation of tau proteins in neurodegenerative diseases is solved, providing an effective experimental model to evaluate therapeutic agents.

CN113906134BActive Publication Date: 2025-06-24REGENERON PHARMACEUTICALS INC
View PDF 43 Cites 0 Cited by

Patent Information

Application Number
CN202080039253.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2019-06-14
Filing Date
2020-06-12
Publication Date
2025-06-24
Estimated Expiration
2040-06-12

AI Technical Summary

Technical Problem

The prior art is difficult to effectively solve the problem of abnormal aggregation or fibrosis of tau protein in neurodegenerative diseases, and there is a lack of effective therapeutic intervention strategies.

Method used

Improved tau protein disease models are provided, including reducing the expression of BANF1, PPP2CA and ANKLE2 in non-human animals, animal tissues or animal cells or using corresponding agents, in combination with exogenous microtubule-associated protein tau coding sequences, to accelerate or aggravate the formation of tau aggregates.

Benefits of technology

Through these improved tau disease models, therapeutic agent candidates for tau disease can be more efficiently evaluated and an experimental model closer to the human disease state can be provided, facilitating understanding of disease mechanisms and developing therapeutic strategies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN113906134B_ABST
    Figure CN113906134B_ABST
Patent Text Reader

Abstract

BANF1, PPP2CA, and ANKLE2 are genes that are thought to promote tau aggregation when disrupted. Improved tauopathy models are provided, such as cells, tissues, or animals having mutations in BANF1 and / or PPP2CA and / or ANKLE2 or inhibiting the expression of BANF1 and / or PPP2CA and / or ANKLE2. Also provided are methods of using such improved tauopathy models to evaluate candidate therapeutic agents for treating tauopathies, methods of preparing the improved tauopathy models, and methods of accelerating or exacerbating tau aggregation in tauopathy models.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of U.S. Application No. 62 / 861,553, filed June 14, 2019, which is incorporated herein by reference in its entirety for all purposes.

[0003] Sequence listing citations are submitted as text files via EFS WEB

[0004] The sequence listing written into file 548673SEQLIST.txt is 203 kilobytes, created on June 12, 2020, and is hereby incorporated by reference. Background Art

[0005] Abnormal aggregation or fibrillation of proteins such as tau is a defining feature of many diseases, notably including a variety of neurodegenerative diseases such as Alzheimer's disease (AD) and frontotemporal dementia (FTD). In many of these diseases, the fibrillation of certain proteins into insoluble aggregates is not only a hallmark of the disease but is also considered a causative factor for neurotoxicity. In addition, these diseases are characterized by the spread of aggregation pathology through the central nervous system in a stereotyped pattern, a process that is associated with disease progression. Therefore, identifying genes and genetic pathways that modify the process of abnormal protein aggregation or the intercellular propagation of aggregates is of great value for better understanding the causes of neurodegenerative diseases and developing therapeutic intervention strategies. Summary of the Invention

[0006] Provided herein are non-human animals, animal tissues and zooblasts, which are improved tau disease models, and methods for preparing and using such models. Such improved tau disease models can have one or more or all of BANF1, PPP2CA and ANKLE2 that reduce the gene modification of one or more or all of expression in BANF1, PPP2CA and ANKLE2 respectively, and / or can include one or more or all of BANF1, PPP2CA and ANKLE2 that reduce one or more or all of expression in one or more cells. Some such improved tau disease models can also include microtubule-associated protein tau coding sequence (for example, endogenous or exogenous). Some such improved tau disease models can also include exogenous microtubule-associated protein tau coding sequence (for example, exogenous human microtubule-associated protein tau coding sequence). Alternatively, some such improved tau disease models can include tau coding sequence (endogenous or exogenous), and its coding includes the tau protein of tau disease associated mutation or tau pathogenic mutation.

[0007] On the one hand, a non-human animal, animal tissue or animal cell population is provided, comprising: (a) a microtubule-associated protein tau coding sequence in one or more cells; and (b) (i) a genetic modification of one or more or all of BANF1, PPP2CA and ANKLE2 that reduces the expression of one or more or all of BANF1, PPP2CA and ANKLE2 in the one or more cells; and / or (ii) one or more agents that reduce the expression of one or more or all of BANF1, PPP2CA and ANKLE2 in the one or more cells. Optionally, the microtubule-associated protein tau coding sequence is a human microtubule-associated protein tau coding sequence. Optionally, the microtubule-associated protein tau coding sequence is an exogenous human microtubule-associated protein tau coding sequence. In one aspect, a non-human animal, animal tissue, or animal cell population is provided, comprising: (a) an exogenous human microtubule-associated protein tau coding sequence in one or more cells; and (b) (i) a genetic modification of one or more or all of BANF1, PPP2CA, and ANKLE2 that reduces expression of one or more or all of BANF1, PPP2CA, and ANKLE2 in the one or more cells; and / or (ii) one or more agents that reduce expression of one or more or all of BANF1, PPP2CA, and ANKLE2 in the one or more cells. Optionally, the one or more cells are neuronal cells.

[0008] In some such non-human animals, animal tissues or animal cell populations, the exogenous human microtubule-associated protein tau coding sequence is genomic integrated. In some such non-human animals, animal tissues or animal cell populations, the exogenous human microtubule-associated protein tau coding sequence includes a complementary DNA (cDNA) sequence. In some such non-human animals, animal tissues or animal cell populations, the exogenous human microtubule-associated protein tau coding sequence is codon-optimized for expression in the non-human animal, the animal tissue or the animal cell population.

[0009] In some such non-human animals, animal tissues, or animal cell populations, the exogenous human microtubule-associated protein tau coding sequence is operably linked to a heterologous promoter. Optionally, the heterologous promoter is a mouse prion protein promoter. Optionally, the heterologous promoter is a neuron-specific promoter. Optionally, the neuron-specific promoter is a synapsin-1 promoter.

[0010] In some such non-human animals, animal tissues or animal cell populations, the microtubule-associated protein tau includes tauopathy related mutations. In some such non-human animals, animal tissues or animal cell populations, the tauopathy related mutations include P301S mutations. Optionally, the microtubule-associated protein tau includes the sequence shown in SEQ ID NO:98. In some such non-human animals, animal tissues or animal cell populations, the tauopathy related mutations include A152T / P301L / S320F triple mutations. Optionally, the microtubule-associated protein tau coding sequence includes the sequence shown in SEQ ID NO:83 or the microtubule-associated protein tau includes the sequence shown in SEQ ID NO:84.

[0011] In some such non-human animals, animal tissues or animal cell populations, the exogenous human microtubule-associated protein tau includes tauopathy related mutations. In some such non-human animals, animal tissues or animal cell populations, the tauopathy related mutations include P301S mutations. Optionally, the exogenous human microtubule-associated protein tau includes the sequence shown in SEQ ID NO:98. In some such non-human animals, animal tissues or animal cell populations, the tauopathy related mutations include A152T / P301L / S320F triple mutations. Optionally, the exogenous human microtubule-associated protein tau coding sequence includes the sequence shown in SEQ ID NO:83 or the exogenous human microtubule-associated protein tau includes the sequence shown in SEQ ID NO:84.

[0012] In some such non-human animals, animal tissues, or animal cell populations, the non-human animals, animal tissues, or animal cell populations include the genetic modification that reduces expression of one or more or all of BANF1, PPP2CA, and ANKLE2, respectively, in the one or more cells. In some such non-human animals, animal tissues, or animal cell populations, the non-human animals, animal tissues, or animal cell populations include the one or more agents that reduce expression of one or more or all of BANF1, Ppp2ca, and ANKLE2 in the one or more cells.

[0013] In some such non-human animals, animal tissues or animal cell populations, the one or more agents include a nuclease agent targeting BANF1, PPP2CA or ANKLE2 or a nucleic acid encoding the nuclease agent. In some such non-human animals, animal tissues or animal cell populations, the nuclease agent is a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN) or a clustered regularly interspaced short palindromic repeat (CRISPR)-related (Cas) protein and a guide RNA. Optionally, the nuclease agent is the Cas protein and the guide RNA. Optionally, the Cas protein is a Cas9 protein. Optionally, the Cas protein is a catalytically active Cas protein. Optionally, the Cas protein is a catalytically inactive Cas protein fused to a transcription repressor domain, optionally wherein the transcription repressor domain is a Krüppel-associated box (KRAB) domain. In some such non-human animals, animal tissues, or animal cell populations, the guide RNA targets mouse Banf1 and includes any of the sequences shown in SEQ ID NOs: 44-46, or the guide RNA targets human BANF1 and includes any of the sequences shown in SEQ ID NOs: 27-30. In some such non-human animals, animal tissues, or animal cell populations, the guide RNA targets mouse Ppp2ca and includes any of the sequences shown in SEQ ID NOs: 47-49, or the guide RNA targets human PPP2CA and includes any of the sequences shown in SEQ ID NOs: 31-32. In some such non-human animals, animal tissues, or animal cell populations, the guide RNA targets mouse Ankle2 and includes any of the sequences shown in SEQ ID NOs: 50-52, or the guide RNA targets human ANKLE2 and includes the sequence shown in SEQ ID NO: 38.

[0014] In some such non-human animals, animal tissues or animal cell populations, the one or more agents include a transcriptional repressor targeting BANF1, PPP2CA or ANKLE2 or a nucleic acid encoding the transcriptional repressor. Optionally, the transcriptional repressor comprises a catalytically inactive Cas protein (e.g., a Cas9 protein) fused to a transcriptional repressor domain, optionally wherein the transcriptional repressor domain is a Krüppel-associated box (KRAB) domain. In some such non-human animals, animal tissues or animal cell populations, the guide RNA targets mouse Banf1 and includes any of the sequences shown in SEQ ID NOs: 44-46 or the guide RNA targets human BANF1 and includes any of the sequences shown in SEQ ID NOs: 27-30. In some such non-human animals, animal tissues or animal cell populations, the guide RNA targets mouse Ppp2ca and includes any of the sequences shown in SEQ ID NOs: 47-49 or the guide RNA targets human PPP2CA and includes any of the sequences shown in SEQ ID NOs: 31-32. In some such non-human animals, animal tissues, or animal cell populations, the guide RNA targets mouse Ankle2 and includes any of the sequences shown in SEQ ID NOs:50-52 or the guide RNA targets human ANKLE2 and includes the sequence shown in SEQ ID NO:38.

[0015] In some such non-human animals, animal tissues, or animal cell populations, the one or more agents include antisense oligonucleotides, antisense RNAs, small interfering RNAs (siRNAs), or short hairpin RNAs (shRNAs) targeting BANF1, PPP2CA, or ANKLE2. In some such non-human animals, animal tissues, or animal cell populations, the one or more agents include antisense oligonucleotides or RNAi agents targeting BANF1, PPP2CA, or ANKLE2, or nucleic acids encoding the antisense oligonucleotides or RNAi agents. Optionally, the antisense oligonucleotides or RNAi agents include the sequence shown in any one of SEQ ID NOs: 105-324, or a modified form thereof. Optionally, the antisense oligonucleotides or RNAi agents include the sequence shown in any one of SEQ ID NOs: 105-324, or a modified form thereof. NO:105, 106, 110-113, 115, 120-122, 124, 125, 130, 133, 136, 137, 150, 152, 153, 1 55, 158-160, 162, 165, 166, 169, 171-173, 175, 177, 181-184, 187, 194, 197, 211, 21 3, 215, 216, 220-223, 225, 230-232, 234, 235, 240, 243, 246, 247, 260, 262, 263, 265, 268-270, 272, 275, 276, 279, 281-283, 285, 287, 291-294, 297, 304, 307, 321 and 323. Optionally, the antisense oligonucleotide or RNAi agent comprises one or more phosphorothioate linkages and / or one or more 2'-methoxyethyl modified bases. Optionally, the antisense oligonucleotide is a 5-10-5 gapmer comprising a phosphorothioate backbone, a 5' wing consisting of 2'-methoxyethyl modified bases, a central 10-nucleotide core of DNA, and a 3' wing consisting of 2'-methoxyethyl modified bases.

[0016] In some such non-human animals, animal tissues, or animal cell populations, at least one sign or symptom of tauopathy is increased in the non-human animal, animal tissue, or animal cell population relative to a non-human animal, animal tissue, or animal cell population that does not include the genetic modification of one or more or all of BANF1, PPP2CA, and ANKLE2, or does not include the one or more agents that reduce expression of one or more or all of BANF1, PPP2CA, and ANKLE2. Optionally, the at least one sign or symptom includes tau hyperphosphorylation or tau aggregation. Optionally, the at least one sign or symptom includes tau hyperphosphorylation and tau aggregation. Optionally, the signs of at least one symptom include: increased tau and / or phospho-tau in the insoluble fraction after cell fractionation; increased phospho-tau in the somatodendritic compartment of neurons; increased phospho-tau in the perinuclear region of neurons; decreased nuclear pore complex protein Nup98-Nup96 (Nup98) nuclear-to-cytoplasmic ratio in neurons; decreased GTP-binding nuclear protein Ran (Ran) nuclear-to-cytoplasmic ratio in neurons; decreased Ran GTPase activating protein 1 (RanGAP1) nuclear-to-cytoplasmic ratio in neurons; or any combination thereof.

[0017] In some such animal cell populations, the cells are in vivo. In some such animal cell populations, the cells are in vitro. In some such animal cell populations, the cells are human cells. In some such animal cell populations, the cells are rodent cells, optionally wherein the rodent cells are mouse cells or rat cells. Optionally, the cells are mouse cells. In some such animal cell populations, the cells include neuronal cells. Optionally, the neuronal cells include neurons derived from human induced pluripotent stem cells. Optionally, the neuronal cells include neurons derived from mouse embryonic stem cells. Optionally, the neuronal cells include primary mouse neurons.

[0018] In some such animal tissues, the tissue is in vivo. In some such animal tissues, the tissue is ex vivo. In some such animal tissues, the animal is a rodent, optionally wherein the rodent is a mouse or a rat. Optionally, the animal is the mouse. In some such animal tissues, the tissue is nervous system tissue. Optionally, the tissue is a brain slice (e.g., an organotypic brain slice culture).

[0019] In some such non-human animals, the non-human animal is a rodent, optionally wherein the rodent is a mouse or rat. Optionally, the non-human animal is the mouse. Optionally, the mouse is a PS19 transgenic mouse, further comprising the genetic modification of one or more or all of BANF1, PPP2CA, and ANKLE2 that reduces expression of one or more or all of BANF1, PPP2CA, and ANKLE2 in the one or more cells; and / or further comprising the one or more agents that reduce expression of one or more or all of BANF1, PPP2CA, and ANKLE2 in the one or more cells.

[0020] On the other hand, provide for the method for assessing the therapeutic agent candidate for treating tau disease using any above-mentioned non-human animal, animal tissue and zooblast.Some such methods include: (a) administering candidate agent to any above-mentioned non-human animal, animal tissue and zooblast; (b) carry out one or more determinations, to determine whether the candidate agent has an impact on one or more signs or symptoms relevant to the tau disease; and (c) the candidate agent having an impact on one or more signs or symptoms relevant to the tau disease is accredited as therapeutic agent candidate.In some such methods, the one or more signs or symptoms include tau hyperphosphorylation or tau aggregation. Optionally, the one or more signs or symptoms include tau hyperphosphorylation or tau aggregation. In some such methods, the one or more signs or symptoms include: increased tau and / or phosphorylated tau in the insoluble fraction after cell fractionation; increased phosphorylated tau in the somatodendritic compartment of neurons; increased phosphorylated tau in the perinuclear region of neurons; a decreased nuclear pore complex protein Nup98-Nup96 (Nup98) nuclear-to-cytoplasmic ratio in neurons; a decreased GTP-binding nuclear protein Ran (Ran) nuclear-to-cytoplasmic ratio in neurons; a decreased Ran GTPase activating protein 1 (RanGAP1) nuclear-to-cytoplasmic ratio in neurons; or a combination thereof.

[0021] In some such methods, the candidate agent is administered to the non-human animal. In some such methods, the candidate agent is administered ex vivo to the animal tissue. In some such methods, the candidate agent is administered ex vivo to the animal cell population.

[0022] On the other hand, methods for preparing any of the above-mentioned non-human animals, animal tissues, and animal cell populations are provided. Some such methods include: (a) introducing one or more agents that reduce the expression of one or more or all of BANF1, PPP2CA, and ANKLE2 into a non-human animal, animal tissue, or animal cell population comprising the microtubule-associated protein tau coding sequence; and (b) screening the non-human animal, the animal tissue, or the animal cell population to confirm the presence of the one or more agents. Some such methods include: (a) introducing one or more agents that reduce the expression of one or more or all of BANF1, PPP2CA, and ANKLE2 into a non-human animal, animal tissue, or animal cell population comprising the exogenous human microtubule-associated protein tau coding sequence; and (b) screening the non-human animal, the animal tissue, or the animal cell population to confirm the presence of the one or more agents. Some such methods include: (a) introducing into a non-human animal, animal tissue, or animal cell population: (i) an exogenous human microtubule-associated protein tau coding sequence; and (ii) one or more agents that reduce the expression of one or more or all of BANF1, PPP2CA, and ANKLE2; and (b) screening the non-human animal, the animal tissue, or the animal cell population to confirm the presence of the one or more agents and the exogenous human microtubule-associated protein tau coding sequence. Optionally, the exogenous human microtubule-associated protein tau coding sequence is delivered via adeno-associated virus, lentivirus, or lipid nanoparticles.

[0023] In some such methods, the one or more medicaments are delivered by adeno-associated virus, slow virus or lipid nanoparticles. In some such methods, the method is used to prepare the non-human animal, and the one or more medicaments are used to the non-human animal by intrathecal injection, intracranial injection or intraventricular injection. Optionally, the method is used to prepare the non-human animal, and the one or more medicaments are used to the non-human animal by stereotactic injection into brain or brain region (for example, hippocampus). Optionally, the method is used to prepare the non-human animal, and the one or more medicaments are used to the non-human animal by stereotactic injection into hippocampus.

[0024] On the other hand, the method for accelerating or aggravating the tau aggregation in tau disease model non-human animal, tau disease model animal tissue or tau disease model animal cell group is provided.Some such methods include one or more medicaments that reduce one or more or all of expression in BANF1, PPP2CA and ANKLE2 and are incorporated into described tau disease model non-human animal, described tau disease model animal tissue or described tau disease model animal cell group.

[0025] In some such methods, described tau disease model non-human animal, described tau disease model animal tissue or described tau disease model animal cell group include exogenous human microtubule associated protein tau coding sequence.In some such methods, described exogenous human microtubule associated protein tau coding sequence is through genome integration.In some such methods, described exogenous human microtubule associated protein tau coding sequence includes complementary DNA (cDNA) sequence.In some such methods, described exogenous human microtubule associated protein tau coding sequence has been codon optimized for the expression in described non-human animal, described animal tissue or described animal cell group.

[0026] In some such methods, the exogenous human microtubule-associated protein tau coding sequence is operably linked to a heterologous promoter. Optionally, the heterologous promoter is a mouse prion protein promoter. Optionally, the heterologous promoter is a neuron-specific promoter. Optionally, the neuron-specific promoter is a synapsin-1 promoter.

[0027] In some such methods, the exogenous human microtubule-associated protein tau includes tauopathy related mutations. In some such methods, the tauopathy related mutations include P301S mutations. Optionally, the exogenous human microtubule-associated protein tau includes the sequence shown in SEQ ID NO:98. In some such methods, the tauopathy related mutations include A152T / P301L / S320F triple mutations. Optionally, the exogenous human microtubule-associated protein tau coding sequence includes the sequence shown in SEQ ID NO:83 or the exogenous human microtubule-associated protein tau includes the sequence shown in SEQ ID NO:84.

[0028] In some such methods, the one or more agents include a nuclease agent targeting BANF1, PPP2CA or ANKLE2 or a nucleic acid encoding the nuclease agent. In some such methods, the nuclease agent is a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN) or a clustered regularly interspaced short palindromic repeat (CRISPR)-related (Cas) protein and a guide RNA. Optionally, the nuclease agent is the Cas protein and the guide RNA. Optionally, the Cas protein is a Cas9 protein. Optionally, the Cas protein is a catalytically active Cas protein. Optionally, the Cas protein is a catalytically inactive Cas protein fused to a transcription repressor domain, optionally wherein the transcription repressor domain is a Krüppel-associated box (KRAB) domain. In some such methods, the guide RNA targets mouse Banf1 and includes any of the sequences shown in SEQ ID NOs: 44-46 or the guide RNA targets human BANF1 and includes any of the sequences shown in SEQ ID NOs: 27-30. In some such methods, the guide RNA targets mouse Ppp2ca and includes any of the sequences shown in SEQ ID NOs: 47-49 or the guide RNA targets human PPP2CA and includes any of the sequences shown in SEQ ID NOs: 31- 32. In some such methods, the guide RNA targets mouse Ankle2 and includes any of the sequences shown in SEQ ID NOs: 50-52 or the guide RNA targets human ANKLE2 and includes the sequence shown in SEQ ID NO: 38.

[0029] In some such methods, the one or more agents include a transcriptional repressor targeting BANF1, PPP2CA or ANKLE2 or a nucleic acid encoding the transcriptional repressor. Optionally, the transcriptional repressor comprises a catalytically inactive Cas protein (e.g., a Cas9 protein) fused to a transcriptional repressor domain, optionally wherein the transcriptional repressor domain is a Krüppel-associated box (KRAB) domain. In some such non-human animals, animal tissues, or animal cell populations, the guide RNA targets mouse Banf1 and includes any of the sequences shown in SEQ ID NOs: 44-46 or the guide RNA targets human BANF1 and includes any of the sequences shown in SEQ ID NOs: 27-30. In some such non-human animals, animal tissues, or animal cell populations, the guide RNA targets mouse Ppp2ca and includes any of the sequences shown in SEQ ID NOs: 47-49 or the guide RNA targets human PPP2CA and includes any of the sequences shown in SEQ ID NOs: 31-32. In some such non-human animals, animal tissues, or animal cell populations, the guide RNA targets mouse Ankle2 and includes any of the sequences shown in SEQ ID NOs:50-52 or the guide RNA targets human ANKLE2 and includes the sequence shown in SEQ ID NO:38.

[0030] In some such methods, the one or more agents comprise an antisense oligonucleotide, antisense RNA, small interfering RNA (siRNA), or short hairpin RNA (shRNA) that targets BANF1, PPP2CA, or ANKLE2. In some such methods, the one or more agents comprise an antisense oligonucleotide or RNAi agent that targets BANF1, PPP2CA, or ANKLE2, or a nucleic acid encoding the antisense oligonucleotide or RNAi agent. Optionally, the antisense oligonucleotide or RNAi agent comprises a sequence as set forth in any one of SEQ ID NOs: 105-324, or a modified form thereof. Optionally, the antisense oligonucleotide or RNAi agent comprises a sequence as set forth in any one of SEQ ID NOs: 105-324, or a modified form thereof. NO:105, 106, 110-113, 115, 120-122, 124, 125, 130, 133, 136, 137, 150, 152, 153, 1 55, 158-160, 162, 165, 166, 169, 171-173, 175, 177, 181-184, 187, 194, 197, 211, 21 3, 215, 216, 220-223, 225, 230-232, 234, 235, 240, 243, 246, 247, 260, 262, 263, 265, 268-270, 272, 275, 276, 279, 281-283, 285, 287, 291-294, 297, 304, 307, 321 and 323. Optionally, the antisense oligonucleotide or RNAi agent comprises one or more phosphorothioate linkages and / or one or more 2'-methoxyethyl modified bases. Optionally, the antisense oligonucleotide is a 5-10-5 gapmer comprising a phosphorothioate backbone, a 5' wing consisting of 2'-methoxyethyl modified bases, a central 10-nucleotide core of DNA, and a 3' wing consisting of 2'-methoxyethyl modified bases.

[0031] In some such methods, the one or more agents are delivered by adeno-associated virus, slow virus or lipid nanoparticles. In some such methods, the one or more agents are administered to the non-human animal by intrathecal injection, intracranial injection or intraventricular injection, optionally wherein the one or more agents are administered to the non-human animal by stereotactic injection into the brain or brain region (e.g., hippocampus), and optionally wherein the one or more agents are administered to the non-human animal by stereotactic injection into the hippocampus.

[0032] In some such methods, at least one sign or symptom of tauopathy in the non-human animal, animal tissue, or animal cell population is increased relative to the non-human animal, animal tissue, or animal cell population that does not include the one or more agents that reduce the expression of one or more or all of BANF1, PPP2CA, and ANKLE2. Optionally, the at least one sign or symptom includes tau hyperphosphorylation or tau aggregation. Optionally, the at least one sign or symptom includes: increased tau and / or phosphorylated tau in the insoluble fraction after cell fractionation; increased phosphorylated tau in the somatodendritic compartment of neurons; increased phosphorylated tau in the perinuclear region of neurons; decreased nuclear pore complex protein Nup98-Nup96 (Nup98) nuclear-to-cytoplasmic ratio in neurons; decreased nuclear GTP-binding nuclear protein Ran (Ran) nuclear-to-cytoplasmic ratio in neurons; decreased nuclear GTPase activating protein 1 (RanGAP1) nuclear-to-cytoplasmic ratio in neurons; or any combination thereof.

[0033] In some such methods, the cells are in vivo. In some such methods, the cells are in vitro. In some such methods, the cells are human cells. In some such methods, the cells are rodent cells, optionally wherein the rodent cells are mouse cells or rat cells. Optionally, the cells are mouse cells. In some such methods, the cells comprise neuronal cells. Optionally, the neuronal cells comprise neurons derived from human induced pluripotent stem cells. Optionally, the neuronal cells comprise neurons derived from mouse embryonic stem cells. Optionally, the neuronal cells comprise primary mouse neurons.

[0034] In some such methods, the tissue is in vivo. In some such methods, the tissue is ex vivo. In some such methods, the animal tissue is rodent tissue, optionally wherein the rodent is a mouse or rat. Optionally, the animal tissue is mouse tissue. In some such methods, the tissue is nervous system tissue. Optionally, the tissue is a brain slice (e.g., an organotypic brain slice culture).

[0035] In some such methods, the non-human animal is a rodent, optionally wherein the rodent is a mouse or rat. Optionally, the non-human animal is the mouse. Optionally, the mouse is a PS19 transgenic mouse, further comprising the one or more agents that reduce expression of one or more or all of BANF1, PPP2CA, and ANKLE2.

[0036] In another aspect, a non-human animal genome is provided, comprising an exogenous human microtubule-associated protein tau coding sequence and genetic modifications to reduce the expression of one or more or all of Banf1, Ppp2ca, and Ankle2, respectively.

[0037] In another aspect, an agent that reduces or inhibits the expression of BANF1, PPP2CA or Ankle2 in a cell or a nucleic acid encoding the agent is provided, wherein the agent is a nuclease agent or antisense oligonucleotide, antisense RNA, small interfering RNA (siRNA) or short hairpin RNA (shRNA) targeting BANF1, PPP2CA or ANKLE2. Optionally, the agent is a nuclease agent or antisense oligonucleotide or RNAi agent targeting BANF1, PPP2CA or ANKLE2. Optionally, the antisense oligonucleotide or RNAi agent comprises a sequence as shown in any one of SEQ ID NOs: 105-324 or a modified form thereof. Optionally, the antisense oligonucleotide or RNAi agent comprises a sequence as shown in any one of SEQ ID NOs: 105-324 or a modified form thereof. NO:105, 106, 110-113, 115, 120-122, 124, 125, 130, 133, 136, 137, 150, 152, 153, 1 55, 158-160, 162, 165, 166, 169, 171-173, 175, 177, 181-184, 187, 194, 197, 211, 21 3, 215, 216, 220-223, 225, 230-232, 234, 235, 240, 243, 246, 247, 260, 262, 263, 265, 268-270, 272, 275, 276, 279, 281-283, 285, 287, 291-294, 297, 304, 307, 321 and 323. Optionally, the antisense oligonucleotide or RNAi agent comprises one or more phosphorothioate linkages and / or one or more 2'-methoxyethyl modified bases. Optionally, the antisense oligonucleotide is a 5-10-5 gapmer comprising a phosphorothioate backbone, a 5' wing consisting of 2'-methoxyethyl modified bases, a central 10-nucleotide core of DNA, and a 3' wing consisting of 2'-methoxyethyl modified bases. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 (Not to scale) Schematic representation of the tau isoform 2N4R is shown. The tau biosensor cell line contains only tau4RD-YFP and tau4RD-CFP as transgenes, rather than the complete 2N4R.

[0039] Figure 2 Schematic diagram showing how aggregate formation can be monitored in a tau biosensor cell line via fluorescence resonance energy transfer (FRET). 4RD -CFP protein is excited by violet light and emits blue light. 4RD The tau-YFP fusion protein is excited by blue light and emits yellow light. If there is no aggregation, excitation with violet light will not result in FRET. If tau aggregation is present, excitation with violet light will result in FRET and yellow light emission.

[0040] Figure 3A Shown is tau transduced with a lentiviral Cas9 expression construct. 4RD -CFP / tau 4RD -Relative Cas9 mRNA expression in YFP (TCY) biosensor cell clones relative to clone Cas9H1, which is a poorly performing control for previously isolated Cas9-expressing TCY clones.

[0041] Figure 3B Shown are the cleavage efficiencies at the PERK and SNCA loci in Cas9 TCY clones three and seven days after transduction with sgRNAs targeting PERK and SNCA, respectively.

[0042] Figure 4 Schematic diagram showing the strategy for disrupting target genes in Cas9 TCY biosensor cells using a genome-wide CRISPR / Cas9 sgRNA library.

[0043] Figure 5 It is shown that when tau 4RD Fibril seeding with tau 4RD -YFP cells, containing tau aggregates that stably propagate 4RD Schematic diagram of the derivation of the YFP Agg[+] subclone. Fluorescence microscopy images of subclones with tau aggregates are also shown.

[0044] Figure 6 is shown from tau 4RD Conditioned medium from -YFP Agg[+] subclones collected three days after confluence can provide a source of tau aggregation activity, whereas the tau 4RDFigure 1. Schematic diagram of the medium of the -YFP Agg[-] subclone. Conditioned medium was applied to recipient cells as 75% conditioned medium and 25% fresh medium. Each shows a fluorescence activated cell sorting (FACS) analysis image. The x-axis shows CFP (405nm laser excitation), and the y-axis shows FRET (excitation from CFP emission). The upper right quadrant is FRET[+], the lower right quadrant is CFP[+], and the lower left quadrant is double negative.

[0045] Figure 7 Schematic diagram showing the genome-wide CRISPR nuclease (CRISPRn) screening strategy for identifying modifying genes that promote tau aggregation.

[0046] Figure 8 is a schematic diagram illustrating the concepts of abundance and enrichment for next-generation sequencing (NGS) analysis using genome-wide CRISPRn screening.

[0047] Figure 9 Schematic diagram showing target genes 1-14 identified in the secondary screen for genome-wide modifier genes that promote tau aggregation.

[0048] Figure 10 Graph showing FRET induction in tau aggregation-conditioned media from Cas9 TCY biosensor cells transduced with lentiviral expression constructs for sgRNAs targeting target genes 1 to 14. Secondary screening confirmed that target genes 2 (BANF1) and 8 (PPP2CA) modulate cellular sensitivity to tau seeding / aggregation.

[0049] Figure 11 Figure 2 shows a FACS analysis image of Cas9 TCY biosensor cells transduced with BANF1 gRNA1, PPP2CA gRNA5, non-targeting gRNA, and gRNA-free lentiviral expression constructs. Cells were cultured in conditioned medium or fresh culture medium. The x-axis shows CFP (405nm laser excitation), and the y-axis shows FRET (excitation from CFP emission). The upper right quadrant is FRET[+], the lower right quadrant is CFP[+], and the lower left quadrant is double negative. In response to tau aggregate conditioned medium rather than fresh culture medium, the destruction of BANF1 or PPP2CA can increase the formation of tau aggregates.

[0050] Figure 12Schematic diagram of secondary screening (including mRNA expression analysis, protein expression analysis, and FRET analysis) in Cas9TCY biosensor cells transduced with lentiviral expression constructs of sgRNAs targeting BANF1 and PPP2CA. Two sgRNAs were used against BANF1 (g1 and g3), one sgRNA was used against PPP2CA (g5), and a non-targeting sgRNA (g3) was used as a non-targeting control.

[0051] Figure 13 Shown are the relative expression of BANF1 and PPP2CA in Cas9 TCY biosensor cells as assessed by qRT-PCR on day 6 after transduction with lentiviral sgRNA expression constructs.

[0052] Figure 14 Shown is the expression of BANF1 and PPP2CA proteins in Cas9 TCY biosensor cells as assessed by western blot at day 13 after transduction with lentiviral sgRNA expression constructs.

[0053] Figure 15 Shown is tau aggregation measured by the percentage of FRET[+] cells in Cas9 TCY biosensor cells at day 10 after transduction with lentiviral sgRNA expression constructs. No liposomes were used.

[0054] Figure 16 Shown are the expressions of BANF1 and PPP2CA in knockdown Cas9 TCY cell clones as assessed by Western blotting.

[0055] Figure 17 Shown are the expression of tau in knockdown Cas9 TCY cell clones as assessed by Western blotting and tau phosphorylation at positions S262 and S356 in those clones as assessed by Western blotting.

[0056] Figure 18 Shown are tau aggregation in BANF1 and PPP2CA knockdown Cas9 TCY cell clones as assessed by FRET.

[0057] Figure 19 Shown are tau aggregation in BANF1, VRK1, CDK5, PPP2CA, PPP2R2A, ANKLE2, EMD, LEMD2, LEMD3 / MAN1, and TMPO / LAP2 knockdown Cas9 TCY cell clones as assessed by FRET.

[0058] Figure 20Shown are tau aggregation measured by the percentage of FRET[+] cells in Cas9 TCY biosensor cells after transduction with lentiviral sgRNA expression constructs targeting ANKLE2, EMD, or VRK1.

[0059] Figure 21A Shown are the relative expression of Banf1 in Cas9-prepared mouse embryonic stem cells as assessed by qRT-PCR following transduction with a lentiviral sgRNA expression construct.

[0060] Figure 21B Shown are the relative expression of Ppp2ca in Cas9-prepared mouse embryonic stem cells as assessed by qRT-PCR following transduction with a lentiviral sgRNA expression construct.

[0061] Figure 22A Shown are the relative expression of Ankle2 in F1H4 mouse embryonic stem cells as assessed by qRT-PCR after transduction with lentiviral sgRNA expression constructs (all-in-one (AIO) constructs containing Cas9 or sgRNA alone).

[0062] Figure 22B Shown are the relative expression of Banf1 in F1H4 mouse embryonic stem cells as assessed by qRT-PCR after transduction with lentiviral sgRNA expression constructs (all-in-one (AIO) constructs containing Cas9 or sgRNA alone).

[0063] Figure 22C Shown are the relative expression of Ppp2ca in F1H4 mouse embryonic stem cells as assessed by qRT-PCR following transduction with lentiviral sgRNA expression constructs (all-in-one (AIO) constructs containing Cas9 or sgRNA alone).

[0064] Figure 23 The BANF1 / PPP2CA interactome is shown.

[0065] Figure 24A Relative expression of ANKLE2 in tau-CFP / tau-YFP (TCY) dCas-KRAB clones (targeted knockdown of BANF1 or ANKLE2 or non-targeted) is shown. Figure 24B Shown are the relative expression of BANF1 in tau-CFP / tau-YFP (TCY) dCas-KRAB clones (targeted knockdown of BANF1 or ANKLE2 or non-targeted).

[0066] Figure 25Shown are tau aggregation as measured by the percentage of FRET[+] cells in tau-CFP / tau-YFP(TCY)dCas-KRAB clones (targeted knockdown of BANF1 or ANKLE2) treated with conditioned medium tau-YFP Agg[+] for three days.

[0067] Figure 26 It is shown that cell fractionation of ΔBANF1 and ΔANKLE2 clones enables detection of tau and phospho-tau (serine 356) in the insoluble fraction two days after treatment with tau-YFP Agg[+] cell lysates.

[0068] Figure 27 Shown are the gene list sizes (fold change greater than or equal to 1.5) of significant genes in four comparisons by RNA-seq analysis (BANF1 KD vs. non-targeted control, BANF1 KD vs. parental, ANKLE2 KD vs. non-targeted control, and ANKLE2 KD vs. parental).

[0069] Figure 28 Schematic diagram for testing cDNA complementation to rescue increased tau aggregation in ΔBANF1 and ΔANKLE2 knockdown cells is shown.

[0070] Figure 29 Shown is tau aggregation measured by the percentage of FRET[+] cells after cDNA complementation of tau-CFP / tau-YFP dCas-KRABΔBANF1 and ΔANKLE2 knockdown cells with tau-YFP Agg[+] cell lysate (2 μg) for 2 days. No_KRAB_gRNA refers to the negative control sample without gRNA administration.

[0071] Figure 30A Shown are counts of DAPI+ nuclei in non-targeted mouse primary cortical neurons and in ΔBANF1 and ΔANKLE2 mutant cortical neurons. Figure 30B Shown are MAP2 intensities in the soma as measured by fluorescence intensity in non-targeted mouse primary cortical neurons and in ΔBANF1 and ΔANKLE2 mutant cortical neurons using a two-tailed unpaired Student's t-test (ns = not significant; error bars represent sem).

[0072] Figure 31A Shown are the intensity of phosphorylated tau S356 (as measured by fluorescence intensity) in somata in non-targeted mouse primary cortical neurons and in ΔBANF1 and ΔANKLE2 mutant cortical neurons. Figure 31BShown are the intensity of perinuclear phosphorylated tau S356 (as measured by fluorescence intensity) in non-targeted mouse primary cortical neurons and in ΔBANF1 and ΔANKLE2 mutant cortical neurons. Two-tailed unpaired Student's t-test was used (***=p<0.004, ****=p<0.0001; error bars represent sem).

[0073] Figure 32A Shown are counts of DAPI+ nuclei in non-targeted mouse primary cortical neurons and in ΔBANF1 and ΔANKLE2 mutant cortical neurons. Figure 32B Shown are MAP2 intensities in the soma as measured by fluorescence intensity in non-targeted mouse primary cortical neurons and in ΔBANF1 and ΔANKLE2 mutant cortical neurons. Figure 32C Shown are total tau intensities in the soma as measured by fluorescence intensity in non-targeted mouse primary cortical neurons and in ΔBANF1 and ΔANKLE2 mutant cortical neurons using a two-tailed unpaired Student's t-test (ns = not significant; error bars represent sem).

[0074] Figure 33A Shown are the counts of nuclei in non-targeted mouse primary cortical neurons and in ΔBANF1, ΔANKLE2, and ΔPPP2CA mutant cortical neurons. Figure 33B Shown are MAP2 intensities in the soma as measured by fluorescence intensity in non-targeted mouse primary cortical neurons and in ΔBANF1, ΔANKLE2, and ΔPPP2CA mutant cortical neurons. Figure 33C Shown are the phosphorylated tau AT8 (S202, T205) intensities in the soma as measured by fluorescence intensity in non-targeted mouse primary cortical neurons and in ΔBANF1, ΔANKLE2, and ΔPPP2CA mutant cortical neurons. Figure 33D Shown are the intensities of phosphorylated tau AT8 (S202, T205) in the perinuclear domain in non-targeted mouse primary cortical neurons and in ΔBANF1, ΔANKLE2, and ΔPPP2CA mutant cortical neurons as measured by fluorescence intensity. Figure 33E Shown are total tau intensities in the soma as measured by fluorescence intensity in non-targeted mouse primary cortical neurons and in ΔBANF1, ΔANKLE2, and ΔPPP2CA mutant cortical neurons.

[0075] Figure 34A Shown are counts of DAPI+ nuclei in non-targeted mouse primary cortical neurons and in ΔBANF1 and ΔANKLE2 mutant cortical neurons. Figure 34BShown are the Nup98 nuclear / cytoplasmic ratios in non-targeted mouse primary cortical neurons and in ΔBANF1 and ΔANKLE2 mutant cortical neurons. Figure 34C Shown are the intensity of phosphorylated tau S356 (as measured by fluorescence intensity) in somata in non-targeted mouse primary cortical neurons and in ΔBANF1 and ΔANKLE2 mutant cortical neurons. Figure 34D Shown are the intensity of perinuclear phosphorylated tau S356 in non-targeted mouse primary cortical neurons and in ΔBANF1 and ΔANKLE2 mutant cortical neurons (as measured by fluorescence intensity). Two-tailed unpaired Student's t-test was used (*=p<0.05; error bars represent sem).

[0076] Figure 35A Shown are the RanGAP1 nuclear / cytoplasmic ratios in non-targeted mouse primary cortical neurons and in ΔBANF1 and ΔANKLE2 mutant cortical neurons. Figure 35B Shown are total RanGAP1 levels in non-targeted mouse primary cortical neurons and in ΔBANF1 and ΔANKLE2 mutant cortical neurons. Figure 35C Shown are the Ran nuclear / cytoplasmic ratios in non-targeted mouse primary cortical neurons and in ΔBANF1 and ΔANKLE2 mutant cortical neurons. Figure 35D Shown are total Ran levels in non-targeted mouse primary cortical neurons and in ΔBANF1 and ΔANKLE2 mutant cortical neurons using a two-tailed unpaired Student's t-test (**=p<0.002-ns, not significant; error bars represent sem).

[0077] Figure 36A Shown are the counts of DAPI+ nuclei in non-targeted mouse primary cortical neurons and in ΔBANF1 and ΔANKLE2 mutant cortical neurons when tau-cDNA 3MUT was added. Figure 36B Shown are the intensity of phosphorylated tau S356 (as measured by fluorescence intensity) in somata in non-targeted mouse primary cortical neurons and in ΔBANF1 and ΔANKLE2 mutant cortical neurons when tau-cDNA3MUT was added. Figure 36C Shown are the intensity of perinuclear phosphorylated tau S356 (as measured by fluorescence intensity) in non-targeted mouse primary cortical neurons and in ΔBANF1 and ΔANKLE2 mutant cortical neurons when tau-cDNA3MUT was added. Figure 36DShown is the MAP2 intensity (as measured by fluorescence intensity) in somatic cells in non-targeted mouse primary cortical neurons and in ΔBANF1 and ΔANKLE2 mutant cortical neurons when tau-cDNA 3MUT was added. Two-tailed unpaired Student's t-test was used (*=p<0.05, **=p<0.002-ns, not significant; error bars represent sem).

[0078] Figure 37A Shown are the counts of DAPI+ nuclei in non-targeted mouse primary cortical neurons and in ΔBANF1 and ΔANKLE2 mutant cortical neurons when tau-cDNA 3MUT was added. Figure 37B Shown are total tau intensities (as measured by fluorescence intensity) in the soma in non-targeted mouse primary cortical neurons and in ΔBANF1 and ΔANKLE2 mutant cortical neurons when tau-cDNA3MUT was added. Figure 37C Shown are MAP2 intensity (as measured by fluorescence intensity) in somata in non-targeted mouse primary cortical neurons and in ΔBANF1 and ΔANKLE2 mutant cortical neurons when tau-cDNA 3MUT was added. Two-tailed unpaired Student's t-test was used (ns = not significant; error bars represent sem).

[0079] Figure 38A Shown are counts of DAPI+ nuclei in non-targeted mouse primary cortical neurons and in ΔBANF1 and ΔPPP2CA mutant cortical neurons. Figure 38B Shown are the intensities of phosphorylated tau (S356) in the perinuclear domain in non-targeted mouse primary cortical neurons and in ΔBANF1 and ΔPPP2CA mutant cortical neurons as measured by fluorescence intensity. Figure 38C Shown is the correlation of phosphorylated tau (S356) intensity with the increased detection of misfolded tau in the soma of ΔPPP2CA mutant cortical neurons. Figure 38D Shown are the intensities of phosphorylated tau (S356) in cells as measured by fluorescence intensity in non-targeted mouse primary cortical neurons and in ΔBANF1 and ΔPPP2CA mutant cortical neurons. Figure 38E Aggregate detection reagent (ADR) intensity in cells in non-targeted mouse primary cortical neurons and in ΔBANF1 and ΔPPP2CA mutant cortical neurons. Figure 38FShown is the correlation of phosphorylated tau (S356) intensity with the detection of increased misfolded tau in the soma in ΔBANF1 mutant cortical neurons. Two-tailed unpaired Student's t-test was used (*=p<0.05; **=p<0.02; ***=p<0.004; error bars represent sem; Pearson correlation (ρ)—R squared—two-tailed P value<0.05).

[0080] Figure 39A Shown are counts of DAPI+ nuclei in non-targeted mouse primary cortical neurons and in ΔBANF1 and ΔPPP2CA mutant cortical neurons. Figure 39B Shown are the intensities of phosphorylated tauAT8 (S202, T205) in the perinuclear domain in non-targeted mouse primary cortical neurons and in ΔBANF1 and ΔPPP2CA mutant cortical neurons as measured by fluorescence intensity. Figure 39C Shown is the correlation of phosphorylated tau AT8 (S202, T205) intensity with the increased detection of misfolded tau in the soma in ΔPPP2CA mutant cortical neurons. Figure 39D Shown are the phosphorylated tau AT8 (S202, T205) intensities in the soma as measured by fluorescence intensity in non-targeted mouse primary cortical neurons and in ΔBANF1 and ΔPPP2CA mutant cortical neurons. Figure 39E Aggregate detection reagent (ADR) intensity in somata in non-targeted mouse primary cortical neurons and in ΔBANF1 and ΔPPP2CA mutant cortical neurons. Figure 39F Shown is the correlation between phosphorylated tau AT8 (S202, T205) intensity and the detection of increased misfolded tau in the soma in ΔBANF1 mutant cortical neurons. Two-tailed unpaired Student's t-test (*=p<0.05; **=p<0.02; ***=p<0.004; ns=not significant; error bars represent sem; Pearson correlation (ρ) - R squared - two-tailed P value <0.05).

[0081] Figure 40 A general schematic of ASO design is shown, where the ASO is designed as a 5-10-5 gapmer with a phosphorothioate backbone, 2' methoxyethyl modified bases used in each wing (5 nucleotides from both ends), and a 10 nucleotide core of unmodified DNA bases.

[0082] Figures 41A-41CShown are qPCR results of a screening of mAnkle2 ASOs in mouse NSC34 cells 72 hours after transfection with the ASO. Knockdown of total mRNA of the target was compared to untreated cells. Figure 41A Shown are the results of a primary screen performed at 100 nM ASO concentration (two replicates; upper dashed line indicates 75% knockdown); Figure 41B Results of a secondary screen performed at 50 nM ASO concentration are shown (two replicates; the lowest dashed line indicates 75% knockdown), and Figure 41C Shown are the results of a secondary screen performed at 5 nM ASO concentration (two replicates; middle dashed line indicates 25% knockdown).

[0083] Figures 42A-42C Shown are qPCR results of screening mPpp2ca ASOs in mouse NSC34 cells 72 hours after transfection with the ASO. Knockdown of total mRNA of the target was compared to untreated cells. Figure 42A Shown are the results of a primary screen performed at 100 nM ASO concentration (dashed line indicates 75% knockdown), Figure 42B Results of a secondary screen performed at 50 nM ASO concentration are shown (three replicates; lower dashed line indicates 75% knockdown), and Figure 42C Shown are the results of a secondary screen performed at 5 nM ASO concentration (three replicates; lower dashed line indicates 40% knockdown).

[0084] Figure 43 Shown are qPCR results (two replicates) of screening mBanf1 ASOs in mouse NSC34 cells 72 hours after transfection with 100 nM ASO concentration. Knockdown of total mRNA of the target was compared to untreated cells. The dotted line indicates 75% knockdown.

[0085] definition

[0086] The terms "protein," "polypeptide," and "peptide," used interchangeably herein, encompass polymeric forms of amino acids of any length, including coded and non-coded amino acids, as well as chemically or biochemically modified or chemically or biochemically derivatized amino acids. These terms also encompass polymers that have been modified, such as polypeptides with modified peptide backbones. The term "domain" refers to any portion of a protein or polypeptide that has a specific function or structure.

[0087] Proteins are considered to have an "N-terminus" and a "C-terminus." The term "N-terminus" refers to the beginning of a protein or polypeptide, which ends with an amino acid having a free amine group (-NH2). The term "C-terminus" refers to the end of an amino acid chain (protein or polypeptide), which ends with a free carboxyl group (-COOH).

[0088] The terms "nucleic acid" and "polynucleotide," as used interchangeably herein, include polymeric forms of nucleotides of any length, including ribonucleotides, deoxyribonucleotides, or analogs or modified forms thereof, including single-stranded, double-stranded, and multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, and polymers comprising purine bases, pyrimidine bases, or other natural, chemically modified, biochemically modified, non-natural, or derivatized nucleotide bases.

[0089] Nucleic acids are considered to have a "5' end" and a "3' end" because mononucleotides are reacted to form oligonucleotides in such a way that the 5' phosphate of one mononucleotide pentose ring is attached to the 3' oxygen of its adjacent mononucleotide pentose ring in one direction via a phosphodiester bond. If the 5' phosphate of an oligonucleotide is not connected to the 3' oxygen of a mononucleotide pentose ring, then the end of the oligonucleotide is referred to as the "5' end". If the 3' oxygen of an oligonucleotide is not connected to the 5' phosphate of another mononucleotide pentose ring, then the end of the oligonucleotide is referred to as the "3' end". Even if a nucleic acid sequence is within a larger oligonucleotide, the nucleic acid sequence may be considered to have a 5' end and a 3' end. In a linear or circular DNA molecule, a discrete element is referred to as "upstream" or 5' of a "downstream" or 3' element.

[0090] The term "genomically integrated" refers to a nucleic acid that has been introduced into a cell such that the nucleotide sequence is integrated into the genome of the cell. Any protocol can be used for stably incorporating a nucleic acid into the genome of a cell.

[0091] The term "targeting vector" refers to a recombinant nucleic acid that can be introduced into a target location in the genome of a cell by homologous recombination, non-homologous end joining-mediated ligation, or any other recombination means.

[0092] The term "viral vector" refers to a recombinant nucleic acid that contains at least one element of viral origin and contains elements sufficient or allowing packaging into viral vector particles. The vector and / or particle can be used to transfer DNA, RNA or other nucleic acids into cells in vitro, ex vivo or in vivo. Many forms of viral vectors are known.

[0093] The term "isolated" with respect to cells, tissues (e.g., brain slices), proteins and nucleic acids encompasses cells, tissues (e.g., brain slices), proteins and nucleic acids that are relatively purified relative to other bacteria, viruses, cells or other components that may normally be present in situ, up to and including substantially pure preparations of cells, tissues (e.g., brain slices), proteins and nucleic acids. The term "isolated" also encompasses cells, tissues (e.g., brain slices), proteins and nucleic acids that do not have naturally occurring counterparts, that have been chemically synthesized and are therefore substantially uncontaminated by other cells, tissues (e.g., brain slices), proteins and nucleic acids, or that have been separated or purified from most other components (e.g., cellular components) with which they are naturally associated (e.g., other cellular proteins, polynucleotides or cellular components).

[0094] The term "wild-type" encompasses an entity having the structure and / or activity found in a normal (as compared to mutated, diseased, altered, etc.) state or condition. Wild-type genes and polypeptides typically exist in multiple different forms (e.g., alleles).

[0095] The term "endogenous sequence" refers to a nucleic acid sequence naturally present in a cell or organism. For example, an endogenous MAPT sequence of a cell or organism refers to a natural MAPT sequence naturally present at the MAPT locus in the cell or organism.

[0096] " exogenous " molecule or sequence comprise the molecule or sequence that are not usually present in the cell with described form.Normal existence comprises the existence of the specific developmental stage and environmental conditions about cell.Exogenous molecule or sequence can for example comprise the mutant form of the corresponding endogenous sequence in the cell, such as the humanized form of endogenous sequence, or can comprise with the cell but in different forms (that is, not in chromosome or in the different positions in chromosome or in different chromosomes, such as randomly inserted into the people tau transgenic in the genomic locus except endogenous shape MAPT locus) sequence of the endogenous sequence.By contrast, endogenous molecule or sequence are included in the molecule or sequence that exist with described form usually in specific cell at specific developmental stage under specific environmental conditions.

[0097] When used in the context of a nucleic acid or protein, the term "heterologous" means that the nucleic acid or protein includes at least two segments that are not naturally present together in the same molecule. For example, when used with respect to a segment of a nucleic acid or a segment of a protein, the term "heterologous" indicates that the nucleic acid or protein includes two or more subsequences that are not found in the same relationship (e.g., linked together) to each other in nature. For example, a "heterologous" region of a nucleic acid vector is a nucleic acid fragment that is not found in nature within or attached to another nucleic acid molecule associated with other molecules. For example, a heterologous region of a nucleic acid vector can include a coding sequence flanked by sequences that are not found in nature associated with a coding sequence. Similarly, a "heterologous" region of a protein is a fragment of amino acids that is not found in nature within or attached to another peptide molecule (e.g., a fusion protein or a protein with a tag) associated with other peptide molecules. Similarly, a nucleic acid or protein can include a heterologous marker or a heterologous secretion or localization sequence.

[0098] "Codon optimization" utilizes the degeneracy of codons, as shown by the diversity of the three base pair codon combinations of the specified amino acids, and generally comprises a process of modifying the nucleic acid sequence to enhance expression in a specific host cell by replacing at least one codon of the native sequence with a codon that is more frequently or most frequently used in the genes of the host cell while maintaining the native amino acid sequence. For example, the nucleic acid encoding tau protein can be modified to replace a codon with a higher frequency of use in a given prokaryotic or eukaryotic cell (including bacterial cells, yeast cells, human cells, non-human cells, mammalian cells, rodent cells, mouse cells, rat cells, hamster cells or any other host cell) compared to a naturally occurring nucleic acid sequence. Codon usage tables are readily available, for example, at "codon usage databases." These tables can be modified in a variety of ways. See Nakamura et al. (2000), "Nucleic Acids Res." 28: 292, which is incorporated herein by reference in its entirety for all purposes. Computer algorithms are also available for codon optimization of a specific sequence for expression in a specific host (see, eg, Gene Forge).

[0099] The term " locus " refers to the specific location of the position on the chromosome of the genome of a gene (or significant sequence), a DNA sequence, a polypeptide encoding sequence or an organism. For example, " MAPT locus " can refer to the specific location of the MAPT position that has been identified as this type of sequence position on the chromosome of the genome of a MAPT gene, a MAPT DNA sequence, a microtubule-associated protein tau encoding sequence or an organism." MAPT locus " can include the regulatory element of a MAPT gene, comprises for example enhancer, promoter, 5 ' and / or 3 ' untranslated region (UTR) or its combination.

[0100] The term "gene" refers to a DNA sequence in a chromosome that, if naturally occurring, may contain at least one coding region and at least one non-coding region. The DNA sequence encoding a product (such as, but not limited to, an RNA product and / or a polypeptide product) in a chromosome may include a coding region interrupted by non-coding introns and a sequence (including 5' and 3' non-translated sequences) positioned adjacent to the coding region at both the 5' and 3' ends such that the gene corresponds to a full-length mRNA. In addition, other non-coding sequences, including regulatory sequences (such as, but not limited to, promoters, enhancers, and transcription factor binding sites), polyadenylation signals, internal ribosome entry sites, silencers, insulating sequences, and matrix attachment regions may be present in a gene. These sequences may be close to the coding region of a gene (such as, but not limited to, within 10 kb) or located at a distant site, and these sequences may affect the transcription and translation levels or rates of the gene.

[0101] The term "allele" refers to a variant form of a gene. Some genes have multiple different forms that are located at the same position or locus on a chromosome. Diploid organisms have two alleles at each locus. Each pair of alleles represents the genotype of a specific locus. If there are two identical alleles at a specific locus, the genotype is described as homozygous, and if the two alleles are different, the genotype is described as heterozygous.

[0102] " Promoter " is the regulatory region of DNA, which generally includes a TATA box that can guide RNA polymerase II to initiate RNA synthesis at the appropriate transcription start site of a specific polynucleotide sequence. The promoter may additionally include other regions that affect transcription initiation rate. Promoter sequences disclosed herein regulate the transcription of operably connected polynucleotides. Promoters can be active in one or more cell types in cell types disclosed herein (e.g., human cells, pluripotent cells, single-cell embryos, differentiated cells, or a combination thereof). Promoters can be, for example, constitutively active promoters, conditional promoters, inducible promoters, time-limited promoters (e.g., developmentally regulated promoters) or spatially restricted promoters (e.g., cell-specific or tissue-specific promoters, such as neuron-specific promoters, such as synapsin-1 promoters). Examples of promoters can be found, for example, in WO 2013 / 176772, which is incorporated herein by reference in its entirety for all purposes.

[0103] "Operably linked" or "operably connected" encompasses the juxtaposition of two or more components (e.g., a promoter and another sequence element) such that both components function normally and at least one component is capable of mediating a function imposed on at least one other component. For example, a promoter may be operably linked to a coding sequence if it controls the level of transcription of the coding sequence in response to the presence or absence of one or more transcriptional regulatory factors. Operable linkage can include these sequences being adjacent to each other or acting in trans (e.g., regulatory sequences can act at a distance to control the transcription of a coding sequence).

[0104] The term "variant" refers to a nucleotide sequence that differs from the most prevalent sequence in a population (eg, by one nucleotide) or a protein sequence that differs from the most prevalent sequence in a population (eg, by one amino acid).

[0105] When referring to proteins, the term "fragment" means a protein that is shorter or has fewer amino acids than a full-length protein. When referring to nucleic acids, the term "fragment" means a nucleic acid that is shorter or has fewer nucleotides than a full-length nucleic acid. When referring to protein fragments, a fragment can be, for example, an N-terminal fragment (i.e., a portion of the C-terminus of a protein is removed), a C-terminal fragment (i.e., a portion of the N-terminus of a protein is removed), or an internal fragment (i.e., a portion of each end of the N-terminus and the C-terminus of a protein is removed). When referring to nucleic acid fragments, a fragment can be, for example, a 5' fragment (i.e., a portion of the 3' end of a nucleic acid is removed), a 3' fragment (i.e., a portion of the 5' end of a nucleic acid is removed), or an internal fragment (i.e., a portion of each section of the 5' end and the 3' end of a nucleic acid is removed).

[0106] In the context of two polynucleotides or polypeptide sequences, "sequence identity" or "identity" refers to the residues that are identical in the two sequences when aligned for maximum correspondence over a specified comparison window. When referring to the percentage of sequence identity of a protein, non-identical residue positions typically differ by conservative amino acid substitutions, in which an amino acid residue is substituted by another amino acid residue with similar chemical properties (e.g., charge or hydrophobicity), thereby not changing the functional properties of the molecule. When the conservative substitutions of a sequence are different, the percentage sequence identity can be adjusted upward to correct for the conservative nature of the substitution. Sequences that differ due to such conservative substitutions are considered to have "sequence similarity" or "similarity." Methods for making such adjustments are well known. Typically, this involves counting conservative substitutions as partial mismatches rather than complete mismatches, thereby increasing the percentage sequence identity. Thus, for example, when the score for the identical amino acid is 1 and the score for the non-conservative substitution is zero, the score for the conservative substitution is between zero and 1. Scores for conservative substitutions are calculated, for example, by implementations in Project PC / GENE (Intelligenetics, Mountain View, California).

[0107] "Percentage of sequence identity" includes the value determined by comparing two optimally aligned sequences over a comparison window (the maximum number of fully matched residues), wherein the portion of the polynucleotide sequence in the comparison window may include additions or deletions (i.e., gaps) compared to the reference sequence (excluding additions or deletions) to achieve optimal alignment of the two sequences. The number of matching positions is obtained by calculating the percentage by measuring the number of positions at which the same nucleic acid base or amino acid residue appears in the two sequences, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. Unless otherwise specified (e.g., the shorter sequence comprises a linked heterologous sequence), the comparison window is the full length of the shorter of the two compared sequences.

[0108] Unless otherwise indicated, sequence identity / similarity values ​​comprise values ​​obtained using GAP version 10 using the following parameters: percent identity and percent similarity for nucleotide sequences using a GAP weight of 50, a length weight of 3, and the nwsgapdna.cmp scoring matrix; percent identity and percent similarity for amino acid sequences using a GAP weight of 8 and a length weight of 2, and the BLOSUM62 scoring matrix; or any equivalent thereof. "Equivalent program" includes any sequence comparison program that produces an alignment having identical nucleotide or amino acid residue matches and the same percent sequence identity for any two sequences in question when compared to the corresponding alignment generated by GAP version 10.

[0109] The term "conservative amino acid substitution" refers to replacing the amino acid normally present in the sequence with a different amino acid having a similar size, charge or polarity. Examples of conservative substitutions include replacing another non-polar residue with a non-polar (hydrophobic) residue (such as isoleucine, valine or leucine). Similarly, examples of conservative substitutions include replacing another polar residue with a polar (hydrophilic) residue, such as the polar residue between arginine and lysine, the polar residue between glutamine and asparagine, or the polar residue between glycine and serine. In addition, replacing another basic residue with a basic residue (such as lysine, arginine or histidine) or replacing another acidic residue with a acidic residue (such as aspartic acid or glutamic acid) is another example of conservative substitution. Examples of non-conservative substitutions include substitutions of polar (hydrophilic) residues (such as cysteine, glutamine, glutamic acid or lysine) with non-polar (hydrophobic) amino acid residues (such as isoleucine, valine, leucine, alanine or methionine) and / or substitutions of non-polar residues with polar residues. Typical amino acid classifications are summarized below.

[0110] Table 1: Amino acid classification.

[0111]

[0112] "Homologous" sequences (e.g., nucleic acid sequences) comprise sequences identical or substantially similar to known reference sequences, such that they, for example, have at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to known reference sequences. Homologous sequences can comprise for example orthologous sequences and paralogous sequences. For example, homologous genes typically descend from a common ancestral DNA sequence through a speciation event (orthologous genes) or a gene duplication event (paralogous genes). "Orthologous" genes comprise genes that evolved from a common ancestral gene through speciation in different species. Orthologs typically retain the same function during evolution. "Paralogous" genes comprise genes related to duplication within the genome. Paralogs can evolve new functions during evolution.

[0113] The term "in vitro" encompasses an artificial environment and processes or reactions that occur within an artificial environment (e.g., a test tube or isolated cells or cell lines). The term "in vivo" encompasses a natural environment (e.g., a cell, an organism, or the body) and processes or reactions that occur within a natural environment. The term "ex vivo" encompasses cells or tissues that have been removed from an individual's body (e.g., brain slice cultures, such as organotypic brain slice cultures) and processes or reactions that occur within such cells.

[0114] The term "reporter gene" refers to a nucleic acid having a sequence that a gene product (typically an enzyme) is encoded, and when the construct comprising a reporter gene sequence operably linked to a heterologous promoter and / or enhancer element is introduced into the cell containing (or can be made to contain) a promoter and / or enhancer element necessary for activation, the sequence can be easily and quantitatively determined. Examples of reporter genes include, but are not limited to, gene encoding beta-galactosidase (lacZ), bacterial chloramphenicol acetyltransferase (cat) gene, firefly luciferase gene, gene encoding beta-glucuronidase (GUS), and gene encoding fluorescent protein. "Reporter protein" refers to a protein encoded by a reporter gene.

[0115] As used herein, the term "fluorescent reporter protein" means a reporter protein detectable based on fluorescence, wherein the fluorescence can be directly from the reporter protein, the activity of the reporter protein on a fluorescent substrate, or to a protein with affinity for a fluorescently labeled compound. Examples of fluorescent proteins include green fluorescent proteins (e.g., GFP, GFP-2, tagGFP, turboGFP, eGFP, emerald (Emerald), Azami green, monomer Azami green, CopGFP, AceGFP and ZsGreenl), yellow fluorescent proteins (e.g., YFP, eYFP, lemon yellow, Venus, YPet, PhiYFP and ZsYellowl), blue fluorescent proteins (e.g., BFP, eBFP, eBFP2, azurite, mKalamal, GFPuv, sky blue and T-sky blue (T-sapphire)), cyan fluorescent proteins (e.g., CFP, eCFP, Cerulean (Cerulean), CyPet, AmCya nl and Midoriishi-Cyan), red fluorescent proteins (e.g., RFP, mKate, mKate2, mPlum, DsRed monomer, mCherry, mRFP1, DsRed-expressed, DsRed2, DsRed-monomer, HcRed-Tandem, HcRed1, AsRed2, eqFP611, mRaspberry, mStrawberry, and Jred), orange fluorescent proteins (e.g., mOrange, mKO, Kusabira-Orange, monomeric Kusabira-Orange, mTangerine, and tdTomato), and any other suitable fluorescent protein whose presence in cells can be detected by flow cytometry.

[0116] A composition or method that "comprising" or "including" one or more recited elements may include other elements not specifically recited. For example, a composition that "comprising" or "including" a protein may contain the protein alone or in combination with other ingredients. The transition phrase "consisting essentially of" means that the scope of the claim should be interpreted to encompass the specified elements recited in the claim as well as those elements that do not materially affect the basic and novel characteristics of the claimed invention. Therefore, when used in the claims of the present invention, the term "consisting essentially of" should not be interpreted as equivalent to "comprising."

[0117] "Optional" or "optionally" means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where said event or circumstance occurs and instances where it does not.

[0118] The specification of a numerical range includes all integers within or defining the range and all subranges defined by integers within the range.

[0119] Unless otherwise apparent from the context, the term "about" encompasses values ​​within the standard error of measurement (eg, SEM) of the stated value.

[0120] The term "and / or" refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative ("or").

[0121] The term "or" refers to any one member of a particular list and also includes any combination of members of that list.

[0122] As used herein, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a protein" or "at least one protein" may include a plurality of proteins, including mixtures thereof.

[0123] Statistically significant means p≤0.05. DETAILED DESCRIPTION

[0124] I. Overview

[0125] Tauopathies are a group of heterogeneous neurodegenerative conditions characterized by abnormal tau protein deposition in the brain. For example, in the brain of individuals suffering from Alzheimer's disease, tau is abnormally hyperphosphorylated and appears to be fibrillated into paired helical filaments (PHFs) that show as neurofibrillary tangles (NFTs). Therefore, the intracellular aggregation of hyperphosphorylated tau in NFTs is the neuropathological hallmark of taupathies.

[0126] A genome-wide screen was performed to identify modifier genes that, when disrupted, promote tau aggregation. High-confidence hits emerged for two genes, BANF1 and PPP2CA, which contribute to a process that maintains the integrity of the nuclear envelope. Examination of other proteins involved in this biological process identified an additional gene, ANKLE2, which, when disrupted, also enhances tau aggregation.

[0127] Barrier to autointegration factor protein (BANF1 / BAF) connects chromatin to the nuclear envelope, and serine / threonine-protein phosphatase 2A catalytic subunit alpha isoform (PPP2CA) regulates BANF1 function. BANF1 is a small (10 kDa), abundant, highly conserved DNA-binding protein. BANF1 is involved in multiple pathways, including mitosis, nuclear assembly, viral infection, chromatin and gene regulation, and DNA damage response. BANF1 connects chromatin to the nuclear envelope and binds to DNA in a sequence-independent manner. BANF1 also binds to a LEM (LAP2 / Emerin / MAN1) domain of the inner nuclear membrane (INM) protein. The localization of BANF1 changes during the cell cycle.

[0128] During mitosis, the disassembly and reassembly of the nuclear envelope are controlled by protein phosphorylation. Upon entry into mitosis, phosphorylation of BANF1 by VRK1 disrupts the connection between chromatin, BANF1 and LEM proteins. BANF1 is evenly distributed throughout the cell. After nuclear envelope reorganization, ankyrin repeat and LEM domain-containing protein 2 (ANKLE2) inhibits VRK1 enzymatic activity. ANKLE2 also binds to PPP2CA and promotes its activity to dephosphorylate BANF1, allowing it to reassociate with LEM proteins, chromatin and the nuclear envelope. PPP2CA is the main tau phosphatase. PPP2CA can bind to tau-4RD and has been associated with Alzheimer's disease.

[0129] The new model of tau aggregation disclosed here is used for the in vitro and in vivo research of tau disease.These new models can for example be combined with the sudden change in the expression of BANF1 and / or PPP2CA and / or ANKLE2 or reduction / inhibition and existing tau disease model.Disclosed herein is an improved tau disease model (for example, non-human animal, animal tissue or zooblast), the method for using this type of improved tau disease model to assess the therapeutic agent candidate for the treatment of tau disease, the method for preparing the improved tau disease model and the method for accelerating or aggravating the tau aggregation in the tau disease model.

[0130] II. Improved tauopathy models

[0131] Disclosed herein are tau disease models comprising genetic alterations or reduced / inhibited expression of BANF1, PPP2CA, or ANKLE2 to accelerate the formation of tau aggregates in cells and animals. Such tau disease models can include, for example, genomes, cells, tissues, or animals comprising a microtubule-associated protein tau coding sequence, and genetic alterations or reduced / inhibited expression of BANF1, PPP2CA, or ANKLE2 to accelerate the formation of tau aggregates in cells and animals, thereby allowing for better development of in vitro, ex vivo, and in vivo models of tau disease. As a specific example, an animal (e.g., a non-human animal), an animal tissue (e.g., a non-human animal tissue), or an animal cell or animal cell population (e.g., one or more non-human animal cells) can include (a) a microtubule-associated protein tau coding sequence in one or more cells; and (b) (i) a genetic modification of one or more or all of BANF1, PPP2CA, and ANKLE2 that reduces the expression of one or more or all of BANF1, PPP2CA, and ANKLE2 in the one or more cells; and / or (ii) one or more agents that reduce the expression of one or more or all of BANF1, PPP2CA, and ANKLE2 in the one or more cells. The one or more cells can be any type of cell. In one example, the one or more cells are neuronal cells.

[0132] The animal, tissue or cell population may have at least one sign or symptom of increased tauopathy relative to an animal, tissue or cell population that does not include genetic modification of one or more or all of BANF1, PPP2CA and ANKLE2 or does not include one or more agents that reduce the expression of one or more or all of BANF1, PPP2CA and ANKLE2. Such signs and symptoms are discussed in more detail elsewhere herein and may include, for example, tau hyperphosphorylation and tau aggregation. Other signs or symptoms may include, for example, increased tau and / or phosphorylated tau in the insoluble fraction after cell fractionation, increased phosphorylated tau in the somatodendritic compartment of neurons, increased phosphorylated tau in the perinuclear region of neurons, decreased nuclear pore complex protein Nup98-Nup96 (Nup98) nuclear-to-cytoplasmic ratio in neurons, decreased GTP-binding nuclear protein Ran (Ran) nuclear-to-cytoplasmic ratio in neurons, or decreased Ran GTPase activating protein 1 (RanGAP1) nuclear-to-cytoplasmic ratio in neurons. The phosphorylated tau can be, for example, phosphorylated tau (S356) or phosphorylated tau AT8 (S202, T205).

[0133] The microtubule associated protein tau coding sequence is the coding sequence expressed in one or more cells. The tau coding sequence can be endogenous or exogenous, and the coding sequence can encode wild-type tau protein or include the tau protein of mutation (for example, including tau disease related mutation or tau pathogenic mutation). The tau coding sequence can encode human microtubule associated protein tau, such as exogenous human microtubule associated protein tau. The coding sequence can include coding sequence and non-coding sequence (for example, exons and introns), or the coding sequence can include complementary DNA (cDNA) sequence. The coding sequence can optionally be codon optimized (for example, codon optimized for expression in people or mouse cells) for expression in animals, tissues or cells.

[0134] The tau coding sequence can be integrated through genome or can be extrachromosomal.If integrated through genome, the coding sequence can be randomly integrated into the genome (transgenic) or the coding sequence can be integrated into the targeted genome locus in a targeted manner. The coding sequence can be present in or genome is integrated into all cells in an animal, tissue or cell group, or the coding sequence can be present in or genome is integrated into a part (e.g., neuron) of a cell. The animal comprising a sequence integrated through genome can include a sequence integrated through genome in its germline.

[0135] The tau coding sequence can be operably linked to a promoter, such as a heterologous promoter. The promoter can be endogenous in cells, tissues, or animals, or the promoter can be exogenous. As a specific example, the promoter can be a prion protein promoter, such as a mouse prion protein promoter. As another example, the promoter can be a neuron-specific promoter. Examples of neuron-specific promoters are well known and include, for example, synapsin-1 promoter (e.g., human synapsin-1 promoter or mouse synapsin-1 promoter).

[0136] Microtubule-associated protein tau can be any tau isoform. In a specific example, the tau coding sequence encodes 1N4R isoform. Microtubule-associated protein tau can be wild-type tau protein or it can include one or mutations, such as tau disease-related mutations or tau pathogenic mutations. The example of such mutations is well known and is discussed in more detail elsewhere herein. In a specific example, tau includes a P301S mutation (optionally wherein the tau coding sequence is operably connected to a mouse prion protein promoter). In another specific example, tau includes an A152T / P301L / S320F triple mutation (optionally wherein the tau coding sequence is operably connected to a synapsin-1 promoter). The DNA and protein sequences of 3MUT Tau 1N4R (A152T, P301L, S320F) are shown in SEQ ID NOs: 83 and 84, respectively.

[0137] Examples of agents that can reduce the expression of BANF1, PPP2CA, or ANKLE2 include nuclease agents (e.g., ZFN, TALEN, or CRISPR / Cas), DNA binding proteins fused to transcriptional repressors (e.g., transcriptional repressors such as catalytically inactive Cas fused to KRAB (dCas-KRAB)), or antisense oligonucleotides, siRNA, shRNA, or antisense RNA. Examples of these agents are discussed in more detail elsewhere herein.

[0138] BANF1 (also known as BAF, BCRG1, BCRP1 and L2BP1) encodes a self-integration barrier factor protein (also known as breakpoint cluster region protein 1 and LAP2 binding protein 1). It plays a fundamental role in nuclear assembly, chromatin organization, gene expression and gonadal development, and it can effectively compact chromatin structure and is involved in membrane recruitment and chromatin decondensation during nuclear assembly. Exemplary human self-integration barrier factor protein proteins are designated by accession numbers NP_001137457.1 and NP_003851.1 (NCBI) and O75531 (UniProt). Exemplary human BANF1 mRNA is designated by NCBI accession numbers NM_001143985.1 and NM_003860.3. Exemplary human BANF1 coding sequence is designated by CCDS ID CCDS8125.1. Exemplary human BANF1 gene is designated by NCBI RefSeq GeneID 8815. Exemplary mouse autointegration barrier protein proteins are designated by accession numbers NP_001033320.1, NP_001273537.1, and NP_035923.1 (NCBI) and O54962 (UniProt). Exemplary mouse Banf1 mRNA is designated by NCBI accession numbers NM_001038231.2, NM_001286608.1, and NM_011793.3. An exemplary mouse Banf1 coding sequence is designated by CCDS ID CCDS29458.1. An exemplary mouse Banf1 gene is designated by NCBIRefSeq GeneID 23825. An exemplary rat autointegration barrier protein protein is designated by accession numbers NP_446083.1 (NCBI) and Q9R1T1 (UniProt). An exemplary rat Banf1 mRNA is designated by NCBI accession number NM_053631.3. An exemplary rat Banf 1 gene is designated by NCBI RefSeq GeneID 114087.

[0139] PPP2CA encodes the serine / threonine-protein phosphatase 2A catalytic subunit alpha isoform (also known as PP2A-α, replication protein C, RP-C, protein phosphatase 2, protein phosphatase 2A, or PP2A). PP2A is the primary phosphatase of microtubule-associated proteins (MAPs). PP2A can regulate the activity of phosphorylase B kinase casein kinase 2, mitogen-stimulated S6 kinase, and MAP-2 kinase. Exemplary human serine / threonine-protein phosphatase 2A catalytic subunit alpha isoform proteins are designated by accession numbers NP_002706.1 (NCBI) and P67775 (UniProt). Exemplary human PPP2CA mRNA is designated by NCBI accession number NM_002715.2. Exemplary human PPP2CA coding sequence is designated by CCDS ID CCDS4173.1. Exemplary human PPP2CA gene is designated by NCBI RefSeq GeneID 5515. An exemplary mouse serine / threonine-protein phosphatase 2A catalytic subunit alpha isoform protein is designated by accession numbers NP_062284.1 (NCBI) and P63330 (UniProt). An exemplary mouse Ppp2ca mRNA is designated by NCBI accession number NM_019411.4. An exemplary mouse Ppp2ca coding sequence is designated by CCDS ID CCDS24666.1. An exemplary mouse Ppp2ca gene is designated by NCBI RefSeq GeneID 19052. An exemplary rat serine / threonine-protein phosphatase 2A catalytic subunit alpha isoform protein is designated by accession numbers NP_058735.1 (NCBI) and P63331 (UniProt). An exemplary rat Ppp2ca mRNA is designated by NCBI accession number NM_017039.2. Exemplary rat Ppp2ca genes are designated by NCBI RefSeq GeneIDs 24672 and 103694903.

[0140] ANKLE2 (also known as KIAA0692, LEM4, and D5Ertd585e) encodes ankyrin repeat and LEM domain-containing protein 2 (also known as LEM domain-containing protein 4 and liver regeneration-related protein LRRG057). It is involved in the reassembly of the mitotic nuclear envelope by promoting the dephosphorylation of BAF / BANF1 during mitotic exit. It coordinates the control of BAF / BANF1 dephosphorylation by inhibiting VRK1 kinase and promoting the dephosphorylation of BAF / BANF1 by protein phosphatase 2A (PP2A), thereby promoting nuclear envelope assembly. Exemplary human ankyrin repeat and LEM domain-containing protein 2 proteins are designated by accession numbers NP_055929.1 (NCBI) and Q86XL3 (UniProt). Exemplary human ANKLE2 mRNA is designated by NCBI accession number NM_015114.2. Exemplary human ANKLE2 coding sequence is designated by CCDS ID CCDS41869.1. An exemplary human ANKLE2 gene is designated by NCBI RefSeq GeneID 23141. An exemplary mouse ankyrin repeat and LEM domain-containing protein 2 protein is designated by accession numbers NP_001240743.1 and NP_082198.1 (NCBI) and Q6P1H6 (UniProt). An exemplary mouse Ankle2 mRNA is designated by NCBI accession numbers NM_001253814.1 and NM_027922.2. An exemplary mouse Ankle2 coding sequence is designated by CCDS IDs CCDS57372.1 and CCDS80360.1. An exemplary mouse Ankle2 gene is designated by NCBI RefSeq GeneID 71782. An exemplary rat ankyrin repeat and LEM domain-containing protein 2 protein is designated by accession numbers NP_001041366.1 (NCBI) and Q7TP65 (UniProt). An exemplary rat Ankle2 mRNA is designated by NCBI Accession No. NM_001047901.1. An exemplary rat Ankle2 gene is designated by NCBI RefSeq GeneID360829.

[0141] Various tau disease models have been developed. Any of these models can be adapted as disclosed herein by mutation or inhibition / reduction of BANF1 and / or PPP2CA and / or ANKLE2 expression. These models include cell / cell culture models (non-neuronal cell lines, neuronal cell lines such as PC12, SY5Y and CN1.4 cells or primary neuronal cells), tissue models (e.g., brain slice cultures, such as organotypic brain slice cultures), and whole animal transgenic models (e.g., Caenorhabditis elegans, Drosophila, zebrafish, or mice). See, for example, Hall et al. (2005), Biochim. Biophys. Acta 1739: 224-239; Brandt et al. (2005), Biochim. Biophys. Acta 1739: 331-354; and Lee et al. (2005), Biochim. Biophys. Acta 1739: 251-259, each of which is incorporated herein by reference in its entirety for all purposes. Typically, such models are transgenic models in which wild-type or mutant human tau isoforms are overexpressed under the control of various promoters to produce neurofibrillary pathology. Cell-based models have the advantages of being easier to operate and flexible, while whole animal models (e.g., transgenic mouse models) are more complete and more directly relevant to human diseases.

[0142] The animal, tissue, or cell population can be male or female. The cell population can be in vitro, ex vivo, or in vivo. Similarly, the tissue can be ex vivo or in vivo. In one embodiment, the tissue can be a brain slice (e.g., a brain slice culture, such as an organotypic brain slice culture).

[0143] The cell mass can be any type of cell. The cell can be a monoclonal cell line or a cell mass. The cell can be from any source. Such cells can be from model organisms, such as Caenorhabditis elegans, Drosophila or zebrafish. Such cells can be fish cells or bird cells, or such cells can be mammalian cells, such as human cells, non-human mammalian cells, rodent cells, mouse cells or rat cells. Mammals include, for example, humans, non-human primates, monkeys, apes, cats, dogs, horses, bulls, deer, bison, sheep, rodents (e.g., mice, rats, hamsters, guinea pigs), livestock (e.g., cattle species, such as dairy cows and edible bulls; sheep species, such as sheep and goats; and pig species, such as pigs and wild boars). Birds include, for example, chickens, turkeys, ostriches, geese and ducks. Domestic animals and agricultural animals are also included. The term "non-human animal" does not include humans. In a specific example, the cell is a human cell (e.g., HEK293T cell or neuronal cell) or a mouse cell (e.g., neuronal cell).

[0144] The invention relates to a kind of cell that can be used for the treatment of pluripotent stem (ES) cell and the pluripotent stem (ES) cell of embryo.Cell can be for example totipotency cell or pluripotency cell (for example, embryonic stem (ES) cell, as rodent ES cell, mouse ES cell or rat ES cell).Totipotency cell comprises the undifferentiated cell that can produce any cell type, and pluripotency cell comprises the undifferentiated cell with the ability that develops into and exceeds a kind of differentiated cell type.This type of multipotency and / or totipotency cell can be for example ES cell or ES sample cell, as inductive pluripotent stem (iPS) cell.ES cell is included in the embryonic source totipotency or the pluripotency cell that can make contribution to any tissue of development embryo when being introduced in embryo.ES cell can be derived from the inner cell mass of blastocyst, and can be divided into the cell of any layer in three kinds of vertebrate germ layers (endoderm, ectoderm and mesoderm).

[0145] Cell can also be primary somatic cell, or is not a cell of primary somatic cell.Somatic cell can comprise any cell that is not gamete, germ cell, gamete cell or undifferentiated stem cell.Cell can also be primary cell.Primary cell comprises the cell or cell culture directly separated from organism, organ or tissue.Primary cell comprises neither transformed nor immortalized cell.Described primary cell comprises any cell obtained from organism, organ or tissue, and described cell has not been previously gone down to posterity in tissue culture, or has previously been gone down to posterity in tissue culture but can not be gone down to posterity in tissue culture indefinitely.Such cell can be separated and comprise for example neuron by conventional techniques.For example, primary cell can be derived from nervous system tissue (for example, primary neuron, such as primary mouse neuron).

[0146] Such cells also include cells that are not usually infinitely proliferated but can continue to divide due to mutation or change to escape normal cell aging. Such mutation or change can be naturally occurring or intentionally induced. Examples of immortalized cells include Chinese hamster ovary (CHO) cells, human embryonic kidney cells (e.g., HEK293T cells) and mouse embryonic fibroblasts (e.g., 3T3 cells). Various types of immortalized cells are well known. Immortalized or primary cells include cells that are commonly used to culture or express recombinant genes or proteins. Examples of neuronal cell lines include rat PC12 pheochromocytoma cells, human SH-SY5Y neuroblastoma cells, human N-Tera2 (NTERA-2 or NT2) teratocarcinoma cells, H4 human glioma cells, human neuron BE (2)-M17D cells, C1.4 mouse cortical neurons or HCN2A human cortical neurons.

[0147] Cell can also be a differentiated cell, such as a neuronal cell (e.g., a human neuronal cell). Such neuronal cells can be primary neuronal cells (e.g., mouse primary neuronal cells), neurons derived from inducible pluripotent stem (iPS) cells such as human iPS cells, or neurons derived from embryonic stem (ES) cells (e.g., mouse ES cells). For example, a cell can be an iCELL GABA neuron, which is a high-purity population of human neurons derived from iPS cells. The cell is a mixture of postmitotic neural subtypes, mainly composed of GABA neurons, with typical physiological properties and responses.

[0148] Non-human animals as described herein can be prepared by the methods described elsewhere herein. The term "animal" includes any member of the animal kingdom, including, for example, mammals, fish, reptiles, amphibians, birds and worms. Animals can be, for example, fruit flies, Caenorhabditis elegans or zebrafish. In a specific example, non-human animals are non-human mammals. Non-human mammals include, for example, non-human primates, monkeys, apes, orangutans, cats, dogs, horses, bulls, deer, bison, sheep, rabbits, rodents (for example, mice, rats, hamsters and guinea pigs) and livestock (for example, cattle species, such as dairy cows and edible bulls; sheep species, such as sheep and goats; and pig species, such as pigs and wild boars). Birds include, for example, chickens, turkeys, ostriches, geese and ducks. Domestic animals and agricultural animals are also included. The term "non-human animal" does not include humans. Preferred non-human animals include, for example, rodents, such as mice and rats.

[0149] In some embodiments, non-human animals can be from any gene background. For example, suitable mice can be from 129 strains, C57BL / 6 strains, a mixture of 129 and C57BL / 6, BALB / c strains or Swiss Webster strains. The example of 129 strains includes 129P1, 129P2, 129P3, 129X1, 129S1 (for example, 129S1 / SV, 129S1 / Svlm), 129S2, 129S4, 129S5, 129S9 / SvEvH, 129S6 (129 / SvEvTac), 129S7, 129S8, 129T1 and 129T2. See, for example, Festing et al. (1999), Mammalian Genome 10:836, which is incorporated herein by reference in its entirety for all purposes. Examples of C57BL strains include C57BL / A, C57BL / An, C57BL / GrFa, C57BL / Kal_wN, C57BL / 6, C57BL / 6J, C57BL / 6ByJ, C57BL / 6NJ, C57BL / 10, C57BL / 10ScSn, C57BL / 10Cr, and C57BL / Ola. Suitable mice can also be derived from a mixture of the above-mentioned 129 strain and the above-mentioned C57BL / 6 strain (e.g., 50% 129 and 50% C57BL / 6). Similarly, suitable mice can be derived from a mixture of the above-mentioned 129 strain or a mixture of the above-mentioned BL / 6 strain (e.g., 129S6 (129 / SvEvTac) strain).

[0150] Similarly, rats can be from any rat strain, including, for example, the ACI rat strain, the black spiny (DA) rat strain, the Wistar rat strain, the LEA rat strain, the Sprague Dawley (SD) rat strain, or the Fischer rat strain, such as the Fischer F344 or Fischer F6. Rats can also be obtained from mixed strains derived from two or more of the above strains. For example, suitable rats can be from the DA strain or the ACI strain. The ACI rat strain is characterized by having a black spiny with a white abdomen and feet and RT1 av1 Haplotype. Such strains are available from a variety of sources, including Harlan Laboratories. The Black Agouti (DA) rat strain is characterized by having an agouti coat and RT1 av1Haplotype. Such rats are available from a variety of sources, including Charles River and Harlan Laboratories. Some suitable rats can be derived from inbred rat strains. See, for example, US 2014 / 0235933, which is incorporated herein by reference in its entirety for all purposes.

[0151] In one embodiment, the mouse strain is PS19 (tau P301S (PS19); PS19Tg; B6; C3-Tg (Prnp-MAPT*P301S) PS19Vle / J). The genetic background of this strain is C57BL / 6x C3H. PS19 transgenic mice express mutant human microtubule-associated protein tau, MAPT, driven by the mouse prion protein (Prnp) promoter. The transgene encodes the disease-associated P301S mutation and contains four microtubule binding domains and an N-terminal insert (4R / 1N). The transgene is inserted at Chr3: 140354280-140603283 (construction GRCm38 / mm10), resulting in a 249Kb deletion that does not affect any known gene. See Goodwin et al. (2019), Genome Res. 29(3):494-505, which is incorporated herein by reference in its entirety for all purposes. The expression of mutant human tau is five times higher than that of endogenous mouse protein. See Yoshiyama et al. (2007), Neuron 53(3):337-351, which is incorporated herein by reference in its entirety for all purposes. PS19 mice suffer from neuronal loss and brain atrophy at the age of eight months. The mice also form widely distributed tau aggregates, known as neurofibrillary tangle-like inclusions, in the neocortex, amygdala, hippocampus, brainstem and spinal cord. See Yoshiyama et al. (2007). Before obvious tau pathology appeared by histological methods, it was shown that the brains of these mice exhibited tau seeding activity. That is, tau aggregates present in brain homogenates may cause additional tau aggregation, presumably through a prion-like mechanism. See Holmes (2014), Proc. Natl. Acad. Sci. USA 111(41): E4376-E4385, which is incorporated herein by reference in its entirety for all purposes.

[0152] A. Tau and tauopathies

[0153] Microtubule-associated protein tau (also known as neurofibrillary tangle, paired helical filament-tau (PHF-tau) or tau) is a protein that promotes microtubule assembly and stability, and is mainly expressed in neurons, wherein it is preferentially located in the axonal compartment. Tau is encoded by the MAPT gene (also known as MAPTL, MTBT1, TAU or MTAPT). Tau has the effect of stabilizing neuronal microtubules, and therefore promotes axonal growth. In people, it shows as a group of six isoforms, which are formed by differential splicing of the transcripts of the single genes located on chromosome 17. Each tau isoform contains a series of 3 / 4 tandem repeat units (depending on the isoform), which are combined with microtubules and are used to stabilize them. The microtubule-bound repeat region of tau is flanked by a region rich in serine / threonine, which can be phosphorylated by multiple kinases and is relevant to the tau hyperphosphorylation in the family of related neurodegenerative diseases of Alzheimer's disease (AD) and tauopathy.

[0154] The tau protein in the models and methods disclosed herein can be tau protein from any animal or mammal, such as human, mouse, or rat. In one embodiment, tau is human tau protein. Exemplary human tau protein is designated by UniProt accession number P10636 and GeneID 4137. Exemplary mouse tau protein is designated by UniProt accession number P10637 and GeneID 17762. Exemplary rat tau protein is designated by UniProt accession number P19332.

[0155] Tau protein is the product of alternating splicing from a single gene, and the single gene is referred to as MAPT (microtubule associated protein tau) in people. The tau repeat domain carries the sequence motif (that is, the repeat domain is the easy aggregation domain from tau) responsible for aggregation. According to splicing, the repeat domain of tau protein has three or four repeat regions, and the repeat region constitutes the easy aggregation core of protein, which is commonly referred to as repeat domain (RD). Specifically, the repeat domain of tau represents the core of the microtubule binding region, and has the hexapeptide motif responsible for tau aggregation in R2 and R3. In human brain, there are six kinds of tau isoforms with a length of 352 to 441 amino acid. Except the presence or absence of one or two insertion domains at amino terminal, these isoforms change according to the presence of three repeat domains or four repeat domains (R1-R4) at carboxyl terminal. The repeat domain located in the carboxyl-terminal half of tau is considered to be important for microtubule binding and the pathological aggregation of tau into paired helical filaments (PHFs), which are core components of neurofibrillary tangles found in protein diseases. Exemplary sequences of the four repeat domains (R1-R4) are provided in SEQ ID NOs:88-91, respectively. Exemplary coding sequences of the four repeat domains (R1-R4) are provided in SEQ ID NOs:92-95. Exemplary sequences of the four repeat domains of tau are provided in SEQ ID NO:96. Exemplary coding sequences of the four repeat domains of tau are provided in SEQ ID NO:97. Exemplary sequences of the four repeat domains of tau with a P301S mutation are provided in SEQ ID NO:98. Exemplary coding sequences of the four repeat domains of tau with a P301S mutation are provided in SEQ ID NO:99.

[0156] Tauopathies are a group of heterogeneous neurodegenerative conditions characterized by abnormal tau deposition in the brain. These include, for example, Alzheimer's disease, Down's syndrome, Pick's disease, progressive supranuclear palsy (PSP), corticobasal degeneration (CBD), and frontotemporal dementia (FTDP-17) with Parkinson's syndrome associated with chromosome 17. In AD and other tauopathies, tau protein is abnormally hyperphosphorylated and aggregated into filament bundles (paired spiral filaments) that manifest as neurofibrillary tangles.

[0157] In some embodiments, the tau mutation that causes tau disease is related to (for example, being separated from) tau disease or causes tau disease, such as promoting aggregation mutation. Pathogenic tau mutation (can be exon mutation or intron mutation) can change the relative generation of tau isotype conventionally, and can cause microtubule assembly and / or tau aggregation tendency to change. As an example, this sudden change can be the aggregation sensitization sudden change that makes tau to inoculation sensitization but can not cause tau itself to easily assemble. For example, sudden change can be the relevant P301S sudden change of disease. P301S sudden change means people tau P301S sudden change or when with the corresponding sudden change in another kind of tau protein in the time of people tau protein best comparison. Other pathogenic tau mutations include, for example, A152T, G272V, K280del, P301L, S320F, V337M, R406W, P301L / V337M, K280del / I227P / I308P, G272V / P301L / R406W, and A152T / P301L / S320F. See alzforum.org / mutations / mapt, Brandt et al. (2005), Acta Biochimica et Biophysica Sinica 1739:331-354 and Wolfe (2009), J. Biol. Chem. 284(10):6021-6025, each of which is incorporated herein by reference in its entirety for all purposes. The DNA and protein sequences of wild-type tau 1N4R are shown in SEQ ID NOs: 81 and 82, respectively. The DNA and protein sequences of 3MUT Tau 1N4R (A152T, P301L, S320F) are shown in SEQ ID NOs: 83 and 84, respectively.

[0158] Some examples of the signs and symptoms of tauopathy at the cellular level include tau hyperphosphorylation (e.g., in the somatodendritic compartment of neurons because, although generally considered to be axonal proteins, tau is found in the dendritic compartment of degenerating neurons, and this redistribution is considered to be a triggering factor of the neurodegeneration in Alzheimer's disease), tau aggregation, abnormal shape of the nuclear lamina, and impaired nucleoplasmic transport. Other signs and symptoms at the organism level can include neurofibrillary tangles (e.g., in neocortex, amygdala, hippocampus, brainstem, or spinal cord), neuronal loss (e.g., in hippocampus, amygdala, or neocortex), microgliosis, synaptic loss, cognitive impairment, or motor deficits. Other signs or symptoms can include, for example, cell fractionation, an increase in tau and / or phosphorylated tau in the insoluble fraction, an increase in the phosphorylated tau in the somatodendritic compartment of the neuron, an increase in the phosphorylated tau in the perinuclear region of the neuron, a decrease in the nuclear pore complex protein Nup98-Nup96 (Nup98) nuclear to cytoplasmic ratio in the neuron, a decrease in the GTP-binding nuclear protein Ran (Ran) nuclear to cytoplasmic ratio in the neuron, or a decrease in the Ran GTPase activating protein 1 (RanGAP1) nuclear to cytoplasmic ratio in the neuron. Phosphorylated tau can be, for example, phosphorylated tau (S356) or phosphorylated tau AT8 (S202, T205).

[0159] B. Agents for Reducing Expression of BANF1, PPP2CA, or ANKLE2

[0160] Any suitable agent can be used to reduce or inhibit the expression of BANF1, PPP2CA or ANKLE2. Examples of agents that can reduce the expression of BANF1, PPP2CA or ANKLE2 include nuclease agents (e.g., ZFN, TALEN or CRISPR / Cas), DNA binding proteins fused to transcriptional repressors (e.g., transcriptional repressors such as catalytically inactive or dead Cas (dCas) fused to a KRAB domain (dCas-KRAB)), or antisense oligonucleotides, siRNA, shRNA or antisense RNA. Other examples of agents that can reduce the expression of BANF1, PPP2CA or ANKLE2 include nucleic acids encoding nuclease agents (e.g., ZFN, TALEN or CRISPR / Cas), DNA binding proteins fused to transcriptional repressors (e.g., transcriptional repressors such as catalytically inactive / dead Cas (dCas) fused to a KRAB domain (dCas-KRAB)), or antisense oligonucleotides, siRNA, shRNA or antisense RNA. Examples of these agents are discussed in more detail below.

[0161] 1. Nuclease agents and transcription repressors

[0162] Nuclease agents can be used to reduce the expression of BANF1, PPP2CA, or ANKLE2. For example, such nuclease agents can be designed to target and cleave a region of the BANF1, PPP2CA, or ANKLE2 gene that will disrupt its expression. As a specific example, a nuclease agent can be designed to cleave a region of BANF1, PPP2CA, or ANKLE2 near the start codon. For example, the target sequence can be located within approximately 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, or 1,000 nucleotides of the start codon, and cleavage by the nuclease agent may disrupt the start codon. Alternatively, a nuclease agent designed to cleave regions near the start and stop codons can be used to delete the coding sequence between the two nuclease target sequences. DNA binding proteins fused to transcriptional repressor domains can also be used to reduce the expression of BANF1, PPP2CA, or ANKLE2. For example, a DNA binding protein fused to a transcriptional repressor domain (e.g., a catalytically inactive Cas fused to a KRAB transcriptional repressor domain) can be designed to target a region of BANF1, PPP2CA, or ANKLE2 near the start codon, e.g., within about 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, or 1,000 nucleotides of the start codon).

[0163] Cleavage by the nuclease agent can result in double-strand breaks that can be repaired by non-homologous end joining (NHEJ). NHEJ involves repairing double-strand breaks in nucleic acids by directly joining the broken ends to each other or to an exogenous sequence without the need for a homologous template. NHEJ ligating non-contiguous sequences often results in deletions, insertions, or translocations near the double-strand break site. These insertions and deletions (indels) can disrupt the expression of the target gene through, for example, frameshift mutations or disruption of the start codon.

[0164] Any nuclease agent that induces nick or double-strand break into the desired recognition site can be used in the methods and compositions disclosed herein. Naturally occurring or natural nuclease agents can be used, as long as the nuclease agent induces nick or double-strand break in the desired recognition site. Alternatively, modified or engineered nuclease agents can be used. "Engineering nuclease agent" includes nucleases that are engineered from their native form (modified or derived from the native form) to specifically recognize and induce nick or double-strand break in the desired recognition site. Therefore, engineered nuclease agents can be derived from natural, naturally occurring nuclease agents, or can be artificially produced or synthesized. Engineered nucleases can induce nick or double-strand break in, for example, a recognition site, wherein the recognition site is not a sequence identified by a natural (non-engineered or unmodified) nuclease agent. The modification of a nuclease agent can be as little as one amino acid in a protein cleavage agent or one nucleotide in a nucleic acid cleavage agent. Creating a nick or double-strand break in a recognition site or other DNA may be referred to herein as "cutting" or "cleaving" the recognition site or other DNA.

[0165] Also provided are active variants and fragments of exemplary recognition sites. Such active variants may include having at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a given recognition site, wherein the active variant retains biological activity and is therefore capable of being recognized and cut by a nuclease agent in a sequence-specific manner. Determination of double-strand breaks in recognition sites by nuclease agents is known in the art (e.g., qPCR assay, Frendewey et al. (2010), Methods in Enzymology 476:295-307, which is herein incorporated by reference in its entirety for this purpose).

[0166] The recognition site of nuclease agent can be positioned in or near any position of target gene seat.Recognition site can be positioned in the coding region of gene or in the regulatory region that affects gene expression (for example, near the start codon).The recognition site of nuclease agent can be positioned in intron, exon, promoter, enhancer, regulatory region or any non-protein coding region.Alternately, recognition site can be positioned in the polynucleotide that selection marker is encoded.This position can be positioned in the coding region or regulatory region of selection marker, and this can affect the expression of selection marker.Therefore, the recognition site of nuclease agent can be positioned in any non-protein coding region that selection marker is encoded of intron, promoter, enhancer, regulatory region or polynucleotide of selection marker.Nick at recognition site or double-strand break can destroy the activity of selection marker, and the method for measuring the presence or absence of functional selection marker is known.

[0167] One type of nuclease agent is a transcription activator-like effector nuclease (TALEN). TAL effector nucleases are a class of sequence-specific nucleases that can be used to make double-strand breaks at specific target sequences in prokaryotic or eukaryotic genomes. TAL effector nucleases are produced by fusing natural or engineered transcription activator-like (TAL) effectors or their functional parts with the catalytic domain of nucleases such as FokI. The unique modular TAL effector DNA binding domain allows the design of proteins with potential recognition specificity for any given DNA. Therefore, the DNA binding domain of the TAL effector nuclease can be engineered to recognize specific DNA target sites and, therefore, be used to make double-strand breaks at the desired target sequence. See WO 2010 / 079430; Morbitzer et al. (2010), Proceedings of the National Academy of Sciences of the United States of America 107(50):21617-21622; Scholze and Boch (2010), Virulence 1:428-432; Christian et al., Genetics (2010) 186:757-761; Li et al. (2010), Nucleic Acids Res (2011) 39(1):359-372; and Miller et al. (2011), Nature Biotechnology 29:143-148, each of which is incorporated herein by reference in its entirety for all purposes.

[0168] Examples of suitable TAL nucleases and methods for making suitable TAL nucleases are disclosed in, for example, US 2011 / 0239315 A1, US 2011 / 0269234 A1, US 2011 / 0145940 A1, US 2003 / 0232410 A1, US 2005 / 0208489 A1, US 2005 / 0026157 A1, US 2005 / 0064474 A1, US 2006 / 0188987 A1, and US 2006 / 0063231 A1, each of which is incorporated herein by reference in its entirety for all purposes. In various embodiments, the TAL effector nuclease is engineered to cut in or near a target nucleic acid sequence, for example, in a locus of interest or a genomic locus of interest, wherein the target nucleic acid sequence is located at or near a sequence to be modified by the targeting vector. TAL nucleases suitable for use with the various methods and compositions provided herein include those specifically designed to bind at or near a target nucleic acid sequence to be modified by a targeting vector as described herein.

[0169] In some TALENs, each monomer of the TALEN includes 33-35 TAL repeats that recognize a single base pair through two hypervariable residues. In some TALENs, the nuclease agent is a chimeric protein that includes a TAL repeat-based DNA binding domain operably linked to an independent nuclease such as the FokI endonuclease. For example, the nuclease agent can include a first TAL repeat-based DNA binding domain and a second TAL repeat-based DNA binding domain, wherein each of the first and second TAL repeat-based DNA binding domains is operably linked to a FokI nuclease, wherein the first and second TAL repeat-based DNA binding domains recognize two consecutive target DNA sequences in each chain of a target DNA sequence separated by spacer sequences of different lengths (12-20bp), and wherein the FokI nuclease subunits dimerize to produce an active nuclease that makes a double-strand break on the target sequence.

[0170] The nuclease agent used in the various methods and compositions disclosed herein may further include a zinc finger nuclease (ZFN). In some ZFNs, each monomer of the ZFN includes three or more zinc finger-based DNA binding domains, wherein each zinc finger-based DNA binding domain binds to a 3bp subsite. In other ZFNs, the ZFN is a chimeric protein including a zinc finger-based DNA binding domain that is operably linked to an independent nuclease such as a FokI endonuclease. For example, a nuclease agent may include a first ZFN and a second ZFN, wherein the first ZFN and the second ZFN are each operably linked to a FokI nuclease subunit, wherein the first ZFN and the second ZFN recognize two continuous target DNA sequences in each chain of a target DNA sequence separated by about 5-7bp spacers, and wherein the FokI nuclease subunits dimerize to produce an active nuclease that breaks a double strand. See, e.g., US20060246567; US20080182332; US20020081614; US20030021776; WO / 2002 / 057308A2; US20130123484; US20100291048; WO / 2011 / 017293A2; and Gaj et al. (2013) Trends in Biotechnology 31(7):397-405, each of which is incorporated herein by reference in its entirety for all purposes.

[0171] Also provided are active variants and fragments of nuclease agents (i.e., engineered nuclease agents). Such active variants can include and have at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity with natural nuclease agents, wherein active variants retain the ability to cut at the desired recognition site and therefore retain nick or double-strand break inducing activity. For example, any nuclease agent in the nuclease agent described herein can be modified from the natural endonuclease sequence and is designed to recognize and induce nick or double-strand break at the recognition site not recognized by the natural nuclease agent. Therefore, some engineered nucleases have the specificity of inducing nick or double-strand break at the recognition site that is different from the corresponding natural nuclease agent recognition site. The determination of nick or double-strand break inducing activity is known, and the overall activity and specificity of endonuclease to the DNA substrate containing the recognition site are usually measured.

[0172] Nuclease agents can be introduced into cells by any known means. The polypeptide encoding the nuclease agent can be directly introduced into the cell. Alternatively, the polynucleotide encoding the nuclease agent can be introduced into the cell. When the polynucleotide encoding the nuclease agent is introduced into the cell, the nuclease agent can be expressed transiently, conditionally or constitutively in the cell. Therefore, the polynucleotide encoding the nuclease agent can be included in an expression cassette and operably connected to a conditional promoter, an inducible promoter, a constitutive promoter or a tissue-specific promoter. Such promoters of interest are discussed in further detail elsewhere herein. Alternatively, the nuclease agent is introduced into the cell as the mRNA encoding the nuclease agent.

[0173] The polynucleotide encoding the nuclease agent can be stably integrated into the genome of the cell and operably linked to a promoter active in the cell. Alternatively, the polynucleotide encoding the nuclease agent can be in a targeting vector (e.g., a targeting vector comprising an insert polynucleotide, or a vector or plasmid separated from a targeting vector comprising an insert polynucleotide).

[0174] When a nuclease agent is provided to a cell by introducing a polynucleotide encoding the nuclease agent, the polynucleotide encoding the nuclease agent can be modified to substitute codons that are used more frequently in the cell of interest than in the naturally occurring polynucleotide sequence encoding the nuclease agent. For example, the polynucleotide encoding the nuclease agent can be modified to substitute codons that are used more frequently in a given prokaryotic or eukaryotic cell of interest, including bacterial cells, yeast cells, human cells, non-human cells, mammalian cells, rodent cells, mouse cells, rat cells, or any other host cell of interest, than in the naturally occurring polynucleotide sequence.

[0175] CRISPR / Cas system: The methods and compositions disclosed herein can utilize clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated (Cas) systems or components of such systems to modify the genome or alter the expression of genes in cells. The CRISPR / Cas system comprises transcripts and other elements involved in the expression of Cas genes or instructing their activity. The CRISPR / Cas system can be, for example, a type I, type II, type III system, or a type V system (e.g., subtype VA or subtype VB). The methods and compositions disclosed herein can employ a CRISPR / Cas system by utilizing a CRISPR complex, including a guide RNA (gRNA) complexed with a Cas protein, for site-directed binding or cleavage of nucleic acids.

[0176] The CRISPR / Cas systems used in the compositions and methods disclosed herein can be non-naturally occurring. A "non-naturally occurring" system includes anything that indicates artificiality, such as one or more components of the system being altered or mutated from their naturally occurring state, being at least substantially free of at least one other component with which the component is naturally associated in nature or being associated with at least one other component with which the component is not naturally associated. For example, some CRISPR / Cas systems employ non-naturally occurring CRISPR complexes that include a gRNA and a Cas protein that are not naturally present together, employ non-naturally occurring Cas proteins, or employ non-naturally occurring gRNAs.

[0177] Cas protein: Cas protein generally includes at least one RNA recognition or binding domain that can interact with the guide RNA. Cas protein may also include a nuclease domain (e.g., a DNase domain or an RNase domain), a DNA binding domain, a helicase domain, a protein-protein interaction domain, a dimerization domain, and other domains. Some such domains (e.g., a DNase domain) may be derived from natural Cas proteins. Other such domains may be added to prepare modified Cas proteins. The nuclease domain has catalytic activity for nucleic acid cleavage (which comprises the breaking of covalent bonds of nucleic acid molecules). The cleavage may produce blunt ends or staggered ends, and it may be single-stranded or double-stranded. For example, wild-type Cas9 protein will generally produce blunt cleavage products. Alternatively, wild-type Cpf1 protein (e.g., FnCpf1) may produce a cleavage product with a 5 nucleotide 5' overhang, wherein the cleavage occurs after the 18th base pair of the PAM sequence on the non-targeting chain and after the 23rd base on the targeting chain. The Cas protein can have full cleavage activity to generate double-strand breaks (e.g., double-strand breaks with blunt ends) at the target genomic locus, or it can be a nickase that generates single-strand breaks at the target genomic locus.

[0178] Examples of Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas5e (CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8a1, Cas8a2, Cas8b, Cas8c, Cas9 (Csn1 or Csx12), Cas10, Cas10d, CasF, CasG, CasH, Csy1, Csy2, Csy3, Cse1 (CasA), Cse2 (CasB), Cse3 (CasE), Cse4 (CasC), Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, and Cu1966, as well as homologs or modified forms thereof.

[0179] An exemplary Cas protein is a Cas9 protein or a protein derived from a Cas9 protein. Cas9 proteins are from type II CRISPR / Cas systems and generally share four key motifs with conserved structures. Motifs 1, 2, and 4 are RuvC-like motifs, and motif 3 is an HNH motif. Exemplary Cas9 proteins are from Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Staphylococcus aureus, Nocardiopsis dassonvillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenogenum, selenitireducens), Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp., Crocosphaera watsonii, Cyanothece sp., Microcystis aeruginosa, Synechococcus sp.), Acetohalobium arabaticum, Ammonifex degensii, Caldicelulosiruptor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus, Nitrosococcus watsonii watsoni), Pseudoalteromonas shaloplanktis, Ktedonobacter racemifer, Methanohalobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp.), Petrotoga mobilis, Thermosipho africanus, Acaryochloris marina, Neisseria meningitidis, or Campylobacter jejuni. Additional examples of Cas9 family members are described in WO 2014 / 131833, which is incorporated herein by reference in its entirety for all purposes. Cas9 from Streptococcus pyogenes (SpCas9) (designated SwissProt accession number Q99ZW2) is an exemplary Cas9 protein. Cas9 from Staphylococcus aureus (SaCas9) (designated UniProt accession number J7RUA5) is another exemplary Cas9 protein. Cas9 from Campylobacter jejuni (CjCas9) (designated UniProt accession number Q0P897) is another exemplary Cas9 protein. See, for example, Kim et al. (2017), Nat. Commun. 8: 14500, which is incorporated herein by reference in its entirety for all purposes. SaCas9 is smaller than SpCas9, and CjCas9 is smaller than both SaCas9 and SpCas9. Exemplary DNA and protein sequences of SpCas9 are shown in SEQ ID NOs: 86 and 87, respectively. Cas9 (Nme2Cas9) from Neisseria meningitidis is another exemplary Cas9 protein. See, for example, Edraki et al. (2019), Mol. Cell 73 (4): 714-726, which is incorporated herein by reference in its entirety for all purposes. Cas9 proteins from Streptococcus thermophilus (e.g., Streptococcus thermophilus LMD-9Cas9 (St1Cas9) encoded by the CRISPR1 locus or Streptococcus thermophilus Cas9 (St3Cas9) from the CRISPR3 locus) are other exemplary Cas9 proteins. Cas9 from Francisella novicida (FnCas9) or the RHA Francisella novicida Cas9 variant that recognizes an alternative PAM (E1369R / E1449H / R1556A substitution) are other exemplary Cas9 proteins. These and other exemplary Cas9 proteins are reviewed, for example, in Cebrian-Serrano and Davies (2017), Mammal Genome 28(7):247-261, which is incorporated herein by reference in its entirety for all purposes.

[0180] Another example of a Cas protein is Cpf1 (CRISPR from Prevotella and Francisella 1). Cpf1 is a large protein (about 1300 amino acids) containing a RuvC-like nuclease domain homologous to the corresponding domain of Cas9 and a counterpart to the characteristic arginine-rich Cas9 cluster. However, Cpf1 lacks the HNH nuclease domain present in the Cas9 protein, and the RuvC-like domain is continuous in the Cpf1 sequence, while Cas9, on the contrary, contains a long insert containing the HNH domain. See, for example, Zetsche et al. (2015), Cell 163(3):759-771, which is incorporated herein by reference in its entirety for all purposes. Exemplary Cpf1 proteins are from Francisella tularensis 1, Francisella tularensis subsp. novicida, Prevotella albensis, Lachnospiraceae bacterium MC2017 1, Butyrivibrio proteoclasticus, Peregrinibacteria bacterium GW2011_GWA2_33_10, Parcubacteria bacterium GW2011_GWC2_44_17, Smithella sp. SCADC, Acidaminococcus sp.) BV3L6, Lachnospiraceae bacterium MA2020, Candidatus Methanoplasma termitum, Eubacterium eligens, Moraxella bovoculi 237, Leptospira inadai, Lachnospiraceae bacterium ND2006, Porphyromonas crevioricanis 3, Prevotella disiens, and Porphyromonas macacae.Cpf1 from Francisella novicida U112 (FnCpf1; designated UniProt accession number A0Q7Q2) is an exemplary Cpf1 protein.

[0181] The Cas protein can be a wild-type protein (i.e., those proteins present in nature), a modified Cas protein (i.e., a Cas protein variant), or a fragment of a wild-type or modified Cas protein. In terms of the catalytic activity of the wild-type or modified Cas protein, the Cas protein can also be an active variant or fragment. In terms of catalytic activity, the active variant or fragment may include at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the wild-type or modified Cas protein or a portion thereof, wherein the active variant retains the ability to cut at the desired cleavage site and thus retains nick induction or double-strand break induction activity. Assays for nick induction or double-strand break induction activity are known, and typically measure the overall activity and specificity of the Cas protein for DNA substrates containing cleavage sites.

[0182] An example of a modified Cas protein is a modified SpCas9-HF1 protein, which is a high-fidelity variant of Streptococcus pyogenes Cas9 with changes (N497A / R661A / Q695A / Q926A) designed to reduce non-specific DNA contacts. See, for example, Kleinstiver et al. (2016), Nature 529(7587):490-495, which is incorporated herein by reference in its entirety for all purposes. Another example of a modified Cas protein is a modified eSpCas9 variant (K848A / K1003A / R1060A) designed to reduce off-target effects. See, for example, Slaymaker et al. (2016), Science 351(6268):84-88, which is incorporated herein by reference in its entirety for all purposes. Other SpCas9 variants include K855A and K810A / K1003A / R1060A. These and other modified Cas proteins are reviewed, for example, in Cebrian-Serrano and Davies (2017), Mammalian Genomes 28(7): 247-261, which is incorporated herein by reference in its entirety for all purposes. Another example of a modified Cas9 protein is xCas9, which is a SpCas9 variant that can recognize an expanded range of PAM sequences. See, for example, Hu et al. (2018), Nature 556: 57-63, which is incorporated herein by reference in its entirety for all purposes.

[0183] The Cas protein can be modified to increase or decrease one or more of nucleic acid binding affinity, nucleic acid binding specificity, and enzymatic activity. The Cas protein can also be modified to change any other activity or property of the protein, such as stability. For example, one or more nuclease domains of the Cas protein can be modified, deleted, or inactivated, or the Cas protein can be truncated to remove domains that are unnecessary for protein function or to optimize (e.g., enhance or reduce) the activity or property of the Cas protein.

[0184] Cas protein can include at least one nuclease domain, such as a DNase domain. For example, wild-type Cpf1 protein generally includes a RuvC-like domain that cuts two chains of target DNA, which may be in a dimer configuration. Cas protein can also include at least two nuclease domains, such as a DNase domain. For example, wild-type Cas9 protein generally includes a RuvC-like nuclease domain and an HNH-like nuclease domain. The RuvC domain and the HNH domain can each cut different chains of double-stranded DNA to produce double-strand breaks in DNA. See, for example, Jinek et al. (2012), Science 337: 816-821, which is incorporated herein by reference in its entirety for all purposes.

[0185] One or more or all nuclease domains in the nuclease domain can be missing or mutated so that it no longer has function or has reduced nuclease activity.For example, if one of the nuclease domains in the Cas9 protein is missing or mutated, the resulting Cas9 protein can be referred to as a nickase, and single-strand breaks can be produced in double-stranded target DNA, but double-strand breaks will not be produced (that is, it can cut complementary strands or non-complementary strands, but can not cut both simultaneously).If both nuclease domains are missing or mutated, the ability of the two chains of the resulting Cas protein (for example, Cas9) cutting double-stranded DNA (for example, nuclease is invalid or nuclease-inactivated Cas protein, or catalytically dead Cas protein (dCas)) will be reduced.The example of the mutation Cas9 is converted into a nickase is the D10A (aspartic acid is converted to alanine at position 10 of Cas9) mutation in the RuvC domain of the Cas9 from Streptococcus pyogenes. Similarly, H939A (histidine to alanine at amino acid position 839), H840A (histidine to alanine at amino acid position 840) or N863A (asparagine to alanine at amino acid position N863) in the HNH domain of Cas9 from Streptococcus pyogenes can convert Cas9 into a nickase. Other examples of mutations that Cas9 is converted into a nickase include corresponding mutations of Cas9 from Streptococcus thermophilus. See, for example, Sapranauskas et al. (2011), Nucleic Acids Research 39:9275-9282 and WO 2013 / 141680, each of which is incorporated herein by reference in its entirety for all purposes. Such mutations can be produced using methods such as site-directed mutagenesis, PCR-mediated mutagenesis, or total gene synthesis. Other mutation examples that produce nickase can be found in, for example, WO 2013 / 176772 and WO2013 / 142578, and each document in the document is incorporated herein by reference as a whole for all purposes.If all nuclease domains in Cas protein are missing or mutated (for example, two nuclease domains in Cas9 protein are missing or mutated), the ability of two chains of the Cas protein (for example, Cas9) cutting double-stranded DNA (for example, the Cas protein of nuclease invalid or nuclease inactivation) of gained will be reduced. An instantiation is D10A / H840A Streptococcus pyogenes Cas9 double mutant or the corresponding double mutant from the Cas9 of another species when compared with Streptococcus pyogenes Cas9 best. Another instantiation is D10A / N863A Streptococcus pyogenes Cas9 double mutant or the corresponding double mutant from the Cas9 of another species when compared with Streptococcus pyogenes Cas9 best.

[0186] The example of the inactivation mutation in the catalytic domain of xCas9 is the same as the mutation for SpCas9 described above. The example of the inactivation mutation in the catalytic domain of Staphylococcus aureus Cas9 protein is also known. For example, Staphylococcus aureus Cas9 enzyme (SaCas9) can include a substitution (e.g., N580A substitution) at position N580 and a substitution (e.g., D10A substitution) at position D10 for producing a nuclease-inactivated Cas protein. See, for example, WO 2016 / 106236, which is incorporated herein by reference as a whole for all purposes. The example of the inactivation mutation in the catalytic domain of Nme2Cas9 is also known (e.g., a combination of D16A and H588A). The example of the inactivation mutation in the catalytic domain of St1Cas9 is also known (e.g., a combination of D9A, D598A, H599A and N622A). The example of the inactivation mutation in the catalytic domain of St3Cas9 is also known (e.g., a combination of D10A and N870A). Examples of inactivating mutations in the catalytic domain of CjCas9 are also known (e.g., a combination of D8A and H559A). Examples of inactivating mutations in the catalytic domains of FnCas9 and RHAFnCas9 are also known (e.g., N995A).

[0187] Examples of inactivating mutations in the catalytic domain of Cpf1 proteins are also known. With reference to Cpf1 proteins from Francisella novicida U112 (FnCpf1), Acidaminococcus sp. BV3L6 (AsCpf1), Lachnospiraceae sp. ND2006 (LbCpf1), and Moraxella bovis 237 (MbCpf1 Cpf1), such mutations may include mutations at positions 908, 993, or 1263 of AsCpf1, or corresponding positions in Cpf1 orthologs, or at positions 832, 925, 947, or 1180 of LbCpf1, or corresponding positions in Cpf1 orthologs. Such mutations may include, for example, one or more of the mutations D908A, E993A, and D1263A of AsCpf1 or corresponding mutations in Cpf1 orthologs, or D832A, E925A, D947A, and D1180A of LbCpf1 or corresponding mutations in Cpf1 orthologs. See, for example, US 2016 / 0208243, which is incorporated herein by reference in its entirety for all purposes.

[0188] Cas protein can also be operably connected to a heterologous polypeptide as a fusion protein. For example, Cas protein can be fused with a cleavage domain, an epigenetic modification domain or a transcription repressor domain. Referring to WO 2014 / 089290, the document is incorporated herein by reference in its entirety for all purposes. Examples of transcription repressor domains include inducible cAMP early repressor (ICER) domains, Kruppel-associated box A (KRAB-A) (or Kruppel-associated box (KRAB)) repressor domains, YY1 glycine-rich repressor domains, Sp1-like repressors, E (spl) repressors, IκB repressors and MeCP2. Other examples include transcriptional repressor domains from A / B, KOX, TGF-β inducible early gene (TIEG), v-erbA, SID, SID4X, MBD2, MBD3, DNMT1, DNMG3A, DNMT3B, Rb, ROM2, see, for example, EP3045537 and WO 2011 / 146121, each of which is incorporated by reference in its entirety for all purposes. Cas proteins can also be fused to heterologous polypeptides to provide increased or decreased stability. The fusion domain or heterologous polypeptide can be located at the N-terminus, C-terminus, or within the Cas protein.

[0189] For example, the Cas protein can be fused to one or more heterologous polypeptides that provide subcellular localization. Such heterologous polypeptides may include, for example, one or more nuclear localization signals (NLS), such as a single-point SV40 NLS and / or a double-point α-import protein NLS for targeting the nucleus, a mitochondrial localization signal for targeting mitochondria, an ER retention signal, etc. See, for example, Lange et al. (2007), J. Biol. Chem. 282: 5101-5105, which is incorporated herein by reference in its entirety for all purposes. Such subcellular localization signals can be located at any position within the N-terminus, C-terminus, or Cas protein. The NLS may include a basic amino acid segment and may be a single-point sequence or a double-point sequence. Optionally, the Cas protein may include two or more NLSs, including an NLS at the N-terminus (e.g., an α-import protein NLS or a single-point NLS) and an NLS at the C-terminus (e.g., an SV40 NLS or a double-point NLS). The Cas protein may also include two or more NLSs at the N-terminus and / or two or more NLSs at the C-terminus.

[0190] Cas protein can also be operably connected to cell penetrating domain or protein transduction domain.For example, cell penetrating domain can be derived from HIV-1 TAT protein, TLM cell penetration motif, MPG, Pep-1, VP22, cell penetrating peptide or polyarginine peptide sequence from herpes simplex virus from human hepatitis B virus.See, for example, WO 2014 / 089290 and WO 2013 / 176772, each document in the document is incorporated herein by reference as a whole for all purposes.Cell penetrating domain can be positioned at any position in N-terminal, C-terminal or Cas protein.

[0191] Cas proteins can also be operably linked to heterologous polypeptides for tracking or purification, such as fluorescent proteins, purification tags or epitope tags. Examples of fluorescent proteins include green fluorescent proteins (e.g., GFP, GFP-2, tagGFP, turboGFP, eGFP, emerald, Azami green, monomeric Azami green, CopGFP, AceGFP, ZsGreenl), yellow fluorescent proteins (e.g., YFP, eYFP, lemon yellow, Venus, YPet, PhiYFP, ZsYellowl), blue fluorescent proteins (e.g., eBFP, eBFP2, azurite, mKalamal, GFPuv, sky blue, T-sapphire), cyan fluorescent proteins (e.g., eCFP, Cerulean, CyPet, AmCyan1, Midoriishi-Cyan), red fluorescent proteins (e.g., mKate, mKate2, mPlum, DsRed monomer, mCherry, mRFP1, DsRed-expressed, DsRed2, DsRed-monomer, HcRed-Tandem, HcRed1, AsRed2, eqFP611, mRaspberry, mStrawberry, Jred), orange fluorescent proteins (e.g., mOrange, mKO, Kusabira-Orange, monomeric Kusabira-Orange, mTangerine, tdTomato), and any other suitable fluorescent protein. Examples of tags include glutathione-S-transferase (GST), chitin binding protein (CBP), maltose binding protein, thioredoxin (TRX), poly (NANP), tandem affinity purification (TAP) tag, myc, AcV5, AU1, AU5, E, ECS, E2, FLAG, hemagglutinin (HA), nus, Softag 1, Softag 3, Strep, SBP, Glu-Glu, HSV, KT3, S, S1, T7, V5, VSV-G, histidine (His), biotin carboxyl carrier protein (BCCP), and calmodulin.

[0192] Cas proteins can also be tethered to labeled nucleic acids. This tethering (i.e., physical connection) can be achieved through covalent or non-covalent interactions, and the tethering can be direct (e.g., by direct fusion or chemical conjugation, which can be achieved by modification of cysteine ​​or lysine residues on the protein or intron modification), or can be achieved through one or more intermediate linkers or adapter molecules such as streptavidin or aptamers. See, e.g., Pierce et al. (2005), Mini Rev. Med. Chem. 5(1):41-55; Duckworth et al. (2007), Angew. Chem. Int. Ed. Engl. 46(46):8819-8822; Schaeffer and Dixon (2009), Australian J. Chem. 62(10):1328-1332; Goodman et al. (2009), Chembiochem. 10(9):1551-1557; and Khatwani et al. (2012), Bioorg. Med. Chem. 20(14):4532-4539, each of which is incorporated herein by reference in its entirety for all purposes. Non-covalent strategies for synthesizing protein-nucleic acid conjugates include biotin-streptavidin and nickel-histidine methods. Covalent protein-nucleic acid conjugates can be synthesized by connecting appropriately functionalized nucleic acids and proteins using a variety of chemical reactions. Some of these chemical reactions involve attaching oligonucleotides directly to amino acid residues (e.g., lysine amine or cysteine ​​thiol) on the protein surface, while other more complex schemes require the participation of post-translational modification of proteins or catalytic or reactive protein domains. Methods for covalent attachment of proteins to nucleic acids can include, for example, chemical cross-linking of oligonucleotides to protein lysine or cysteine ​​residues, expressed protein connections, chemoenzymatic methods, and the use of photoaptamers. Labeled nucleic acids can be tethered to the C-terminus, N-terminus, or internal regions within the Cas protein. In one example, the labeled nucleic acid is tethered to the C-terminus or N-terminus of the Cas protein. Similarly, the Cas protein can be tethered to the 5' end, 3' end, or internal region within the labeled nucleic acid. That is, labeled nucleic acids can be tethered in any orientation and polarity. For example, the Cas protein can be tethered to the 5' end or the 3' end of the labeled nucleic acid.

[0193] Cas protein can be provided in any form. For example, Cas protein can be provided in the form of protein, such as Cas protein compounded with gRNA. Alternatively, Cas protein can be provided in the form of nucleic acid encoding Cas protein, such as RNA (for example, messenger RNA (mRNA)) or DNA. Optionally, the nucleic acid encoding Cas protein can be codon optimized to be effectively translated into protein in a specific cell or organism. For example, compared with naturally occurring polynucleotide sequences, the nucleic acid encoding Cas protein can be modified to replace codons with higher usage frequencies in bacterial cells, yeast cells, human cells, non-human cells, mammalian cells, rodent cells, mouse cells, rat cells or any other host cells of interest. When the nucleic acid encoding Cas protein is introduced into a cell, the Cas protein can be expressed transiently, conditionally or constitutively in the cell.

[0194] The Cas protein provided as mRNA can be modified to improve stability and / or immunogenic properties. One or more nucleosides within the mRNA can be modified. Examples of chemical modifications of mRNA nucleobases include pseudouridine, 1-methyl-pseudouridine, and 5-methyl-cytidine. For example, capped and polyadenylated Cas mRNAs containing N1-methylpseudouridine can be used. Similarly, Cas mRNAs can be modified by deleting uridine using synonymous codons.

[0195] The nucleic acid encoding the Cas protein can be stably integrated in the genome of the cell and operably connected to a promoter active in the cell. Alternatively, the nucleic acid encoding the Cas protein can be operably connected to a promoter in an expression construct. The expression construct comprises any nucleic acid construct that can direct the expression of a gene or other nucleic acid sequence (e.g., Cas gene) and can transfer such nucleic acid sequence to a target cell. For example, the nucleic acid encoding the Cas protein can be in a vector comprising a DNA encoding gRNA. Alternatively, it can be in a vector or plasmid separated from a vector comprising a DNA encoding gRNA. The promoter that can be used for expression constructs is included in one or more cells in, for example, eukaryotic cells, human cells, non-human cells, mammalian cells, non-human mammalian cells, rodent cells, mouse cells, rat cells, pluripotent cells, embryonic stem (ES) cells, adult stem cells, developmentally restricted progenitor cells, inducible pluripotent stem (iPS) cells, or single-cell embryos. Such promoters can be, for example, conditional promoters, inducible promoters, constitutive promoters, or tissue-specific promoters. Optionally, the promoter can be a bidirectional promoter that drives expression of the Cas protein in one direction and drives expression of the guide RNA in the other direction. Such bidirectional promoters can be composed of: (1) a complete, conventional, unidirectional Pol III promoter containing three external control elements: a distal sequence element (DSE), a proximal sequence element (PSE), and a TATA box; (2) a second basic Pol III promoter containing a PSE and a TATA box fused to the 5' end of the DSE in the opposite orientation. For example, in the H1 promoter, the DSE is adjacent to the PSE and the TATA box, and the promoter can be bidirectionalized by generating a hybrid promoter in which reverse transcription is controlled by an additional PSE and a TATA box derived from the U6 promoter. See, for example, US 2016 / 0074535, which is incorporated herein by reference in its entirety for all purposes. The use of a bidirectional promoter to simultaneously express genes encoding Cas proteins and guide RNAs allows the generation of compact expression cassettes to facilitate delivery.

[0196] Guide RNA: A "guide RNA" or "gRNA" is an RNA molecule that binds to a Cas protein (e.g., a Cas9 protein) and targets the Cas protein to a specific location within the target DNA. A guide RNA can include two fragments: a "DNA targeting fragment" and a "protein binding fragment." A "fragment" comprises a portion or region of a molecule, such as a continuous stretch of nucleotides in an RNA. Some gRNAs, such as those of Cas9, can include two separate RNA molecules: an "activator RNA" (e.g., tracrRNA) and a "targeting factor RNA" (e.g., CRISPR RNA or crRNA). Other gRNAs are single RNA molecules (single RNA polynucleotides), which can also be referred to as "single-molecule gRNA," "single guide RNA," or "sgRNA." See, for example, WO 2013 / 176772, WO 2014 / 065596, WO 2014 / 089290, WO 2014 / 093622, WO 2014 / 099750, WO 2013 / 142578, and WO 2014 / 131833, each of which is incorporated herein by reference in its entirety for all purposes. For example, for Cas9, a single guide RNA may include a crRNA fused to tracrRNA (e.g., via a joint). For example, for Cpf1, only crRNA is required to achieve binding to the target sequence. The terms "guide RNA" and "gRNA" include both bimolecular (i.e., modular) gRNA and single molecule gRNA.

[0197] Exemplary bimolecular gRNAs include crRNA-like ("CRISPR RNA" or "targeting factor RNA" or "crRNA" or "crRNA repeats") molecules and corresponding tracrRNA-like ("trans-acting CRISPR RNA" or "activator RNA" or "tracrRNA") molecules. The crRNA includes a DNA-targeting segment (single strand) and a nucleotide stretch that forms one half of the dsRNA duplex of the protein-binding segment of the gRNA. Examples of crRNA tails positioned downstream (3') of the DNA-targeting segment include, essentially consisting of, or consisting of GUUUUAGAGCUAUGCU (SEQ ID NO: 65). Any of the DNA-targeting segments (guide sequences) disclosed herein can be ligated to the 5' end of SEQ ID NO: 65 to form a crRNA. Such DNA targeting segments include, for example, SEQ ID NOs: 44-46 (mouse Banf 1), SEQ ID NOs: 27-30 (human BANF1), SEQ ID NOs: 47-49 (mouse Ppp2ca), SEQ ID NOs: 31-32 (human PPP2CA), SEQ ID NOs: 50-52 (mouse Ankle2), and SEQ ID NO: 38 (human ANKLE2).

[0198] The corresponding tracrRNA (activator RNA) includes a nucleotide segment that forms the other half of the dsRNA duplex of the protein-binding segment of the gRNA. The nucleotide segment of the crRNA is complementary to the nucleotide segment of the tracrRNA and hybridizes with it to form a dsRNA duplex of the protein-binding domain of the gRNA. Therefore, each crRNA can be considered to have a corresponding tracrRNA. Examples of tracrRNA sequences include

[0199] AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUU (SEQ ID NO: 66),

[0200] AAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUU(SEQ ID NO:100) or

[0201] GUUGGAACCAUUCAAAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO: 101).

[0202] In a system requiring both crRNA and tracrRNA, crRNA and corresponding tracrRNA hybridize to form gRNA. In a system requiring only crRNA, crRNA can be gRNA. CrRNA additionally provides a single-stranded DNA targeting fragment hybridized with the complementary strand of the target DNA. If used for intracellular modification, the exact sequence of a given crRNA or tracrRNA molecule can be designed to be specific to the species in which the RNA molecule will be used. See, for example, Mali et al. (2013), Science 339:823-826; Jinek et al. (2012), Science 337:816-821; Hwang et al. (2013), Nature Biotechnology 31:227-229; Jiang et al. (2013), Nature Biotechnology 31:233-239; and Cong et al. (2013), Science 339:819-823, each of which is incorporated herein by reference in its entirety for all purposes.

[0203] The DNA targeting fragment (crRNA) of a given gRNA includes a nucleotide sequence complementary to the sequence on the complementary strand of the target DNA, as described in more detail below. The DNA targeting fragment of gRNA interacts with the target DNA in a sequence-specific manner by hybridization (i.e., base pairing). Therefore, the nucleotide sequence of the DNA targeting fragment can be different, and the positioning in the target DNA that the gRNA and target DNA interact with is determined. The DNA targeting fragment of the subject gRNA can be modified to hybridize with any desired sequence in the target DNA. Naturally occurring crRNA is different because of the CRISPR / Cas system and organism, but generally contains a length of 21 to 72 nucleotides flanked by two direct repeat sequences (DR) of 21 to 46 nucleotides in length (see, for example, WO 2014 / 131833, which is incorporated herein by reference in its entirety for all purposes). In the case of Streptococcus pyogenes, the length of DR is 36 nucleotides, and the length of the targeting fragment is 30 nucleotides. The DR positioned at 3' is complementary and hybridized with the corresponding tracrRNA, which in turn binds to the Cas protein.

[0204] The length of the DNA targeting segment can be, for example, at least about 12, 15, 17, 18, 19, 20, 25, 30, 35 or 40 nucleotides. The length of such DNA targeting segments can be, for example, about 12 to about 100, about 12 to about 80, about 12 to about 50, about 12 to about 40, about 12 to about 30, about 12 to about 25 or about 12 to about 20 nucleotides. For example, the DNA targeting segment can be about 15 to about 25 nucleotides (e.g., about 17 to about 20 nucleotides or about 17, 18, 19 or 20 nucleotides). See, for example, US2016 / 0024523, which is incorporated herein by reference in its entirety for all purposes. For Cas9 from Streptococcus pyogenes, typical DNA-targeting segments are between 16 and 20 nucleotides in length or between 17 and 20 nucleotides in length. For Cas9 from Staphylococcus aureus, typical DNA-targeting segments are between 21 and 23 nucleotides in length. For Cpf1, typical DNA-targeting segments are at least 16 nucleotides in length or at least 18 nucleotides in length.

[0205] TracrRNA can be in any form (for example, full-length tracrRNA or active partial tracrRNA) and have different lengths.TracrRNA can include primary transcripts or processed forms.For example, tracrRNA (as a part of a single guide RNA or as a separate molecule as a part of a bimolecular gRNA) can include a wild-type tracrRNA sequence (for example, about or more than about 20, 26, 32, 45, 48, 54, 63, 67, 85 or more nucleotides of a wild-type tracrRNA sequence), is essentially composed of or consists of. The example of the wild-type tracrRNA sequence from Streptococcus pyogenes includes 171-nucleotides, 89-nucleotides, 75-nucleotides and 65-nucleotide forms.See, for example, Deltcheva et al. (2011), Nature 471: 602-607; WO 2014 / 093661, each of which is incorporated herein by reference in its entirety for all purposes. Examples of tracrRNA within a single guide RNA (sgRNA) include tracrRNA segments found in sgRNAs of the form +48, ​​+54, +67, and +85, where "+n" indicates that up to +n nucleotides of wild-type tracrRNA are included in the sgRNA. See US 8,697,359, which is incorporated herein by reference in its entirety for all purposes.

[0206] The complementarity percentage between the DNA targeting segment of the guide RNA and the complementary strand of the target DNA can be at least 60% (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% or 100%). The complementarity percentage between the DNA targeting segment and the complementary strand of the target DNA can be at least 60% over about 20 consecutive nucleotides. For example, the complementarity percentage between the DNA targeting segment and the complementary strand of the target DNA can be 100% over 14 consecutive nucleotides at the 5' end of the complementary strand of the target DNA and as low as 0% over the rest. In such cases, the DNA targeting segment can be considered to be 14 nucleotides in length. As another example, the complementarity percentage between the DNA targeting segment and the complementary strand of the target DNA can be 100% over seven consecutive nucleotides at the 5' end of the complementary strand of the target DNA and as low as 0% over the rest. In such cases, the DNA targeting segment can be considered to be 7 nucleotides in length. In some guide RNAs, at least 17 nucleotides in the DNA targeting segment are complementary to the complementary strand of the target DNA. For example, the length of the DNA targeting segment can be 20 nucleotides and can include 1, 2 or 3 mismatches with the complementary strand of the target DNA. In one example, the mismatch is not adjacent to the region of the complementary strand corresponding to the protospacer adjacent motif (PAM) sequence (i.e., the reverse complement of the PAM sequence) (e.g., the mismatch is located at the 5' end of the DNA targeting segment of the guide RNA, or the mismatch is at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 or 19 base pairs away from the region of the complementary strand corresponding to the PAM sequence).

[0207] The protein binding fragment of the gRNA can include two nucleotide segments that are complementary to each other. The complementary nucleotides of the protein binding fragment hybridize to form a double-stranded RNA duplex (dsRNA). The protein binding fragment of the subject gRNA interacts with the Cas protein, and the gRNA guides the bound Cas protein to a specific nucleotide sequence within the target DNA through the DNA targeting fragment.

[0208] A single guide RNA can include a DNA targeting segment and a scaffold sequence (i.e., the protein binding or Cas binding sequence of the guide RNA). For example, such a guide RNA can have a 5' DNA targeting segment connected to a 3' scaffold sequence. Exemplary scaffold sequences include, consist essentially of, or consist of:

[0209] GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU (Version 1; SEQ ID NO:67);

[0210] GUUGGAACCAUUCAAAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (Version 2; SEQ ID NO:68);

[0211] GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (Version 3; SEQ ID NO:69);

[0212] GUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (Version 4; SEQ ID NO:70);

[0213] GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU (Version 5; SEQ ID NO:102);

[0214] GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (Version 6; SEQ ID NO:103); or

[0215] GUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUU (version 7; SEQ ID NO: 104). A guide RNA targeting any of the guide RNA target sequences disclosed herein can comprise, for example, a DNA targeting segment on the 5' end of the guide RNA fused to any of the exemplary guide RNA scaffold sequences on the 3' end of the guide RNA. That is, any of the DNA targeting segments (guide sequences) disclosed herein can be linked to the 5' end of any of the above scaffold sequences to form a single guide RNA (chimeric guide RNA). Such DNA targeting segments include, for example, SEQ ID NOs: 44-46 (mouse Banf 1), SEQ ID NOs: 27-30 (human BANF1), SEQ ID NOs: 47-49 (mouse Ppp2ca), SEQ ID NOs: 31-32 (human PPP2CA), SEQ ID NOs: 50-52 (mouse Ankle2), and SEQ ID NO: 38 (human ANKLE2).

[0216] The guide RNA may comprise modifications or sequences that provide additional desired characteristics (e.g., modified or regulated stability; subcellular targeting; tracking with fluorescent labels; binding sites for proteins or protein complexes; etc.). Examples of such modifications include, for example, a 5' cap (e.g., a 7-methylguanylate cap (m7G)); a 3' polyadenylation tail (i.e., a 3' poly(A) tail); a riboswitch sequence (e.g., to allow regulation of stability and / or regulation of accessibility of a protein and / or protein complex); a stability control sequence; a sequence that forms a dsRNA duplex (i.e., a hairpin); a modification or sequence that targets the RNA to a subcellular location (e.g., the nucleus, mitochondria, chloroplasts, etc.); a modification or sequence that provides for tracking (e.g., direct conjugation to a fluorescent molecule, conjugation to a moiety that facilitates fluorescence detection, a sequence that allows fluorescence detection, etc.); a modification or sequence that provides a binding site for a protein (e.g., a protein that acts on DNA, including transcriptional activators, transcriptional repressors, DNA methyltransferases, DNA demethylases, histone acetyltransferases, histone deacetylases, etc.); and combinations thereof. Other examples of modification include engineered stem-loop duplex structures, engineered bulge regions, engineered hairpins 3' of stem-loop duplex structures, or any combination thereof. See, for example, US 2015 / 0376586, which is incorporated herein by reference in its entirety for all purposes. The bulge can be an unpaired region of nucleotides within the duplex consisting of a crRNA-like region and a minimal tracrRNA-like region. The bulge can include unpaired 5'-XXXY-3' on one side of the duplex, wherein X is any purine, and Y can include nucleotides that can form a wobble pair with the nucleotides on the opposite chain; and include an unpaired nucleotide region on the other side of the duplex.

[0217] Unmodified nucleic acids may be susceptible to degradation. Exogenous nucleic acids may also induce an innate immune response. Modifications may help introduce stability and reduce immunogenicity. Guide RNAs may include modified nucleosides and modified nucleotides, including, for example, one or more of the following: (1) alteration or replacement of one or both of the non-linked phosphate oxygens and / or one or more of the linked phosphate oxygens in the phosphodiester backbone bond; (2) alteration or replacement of the ribose moiety, such as alteration or replacement of the 2' hydroxyl group on the ribose; (3) replacement of the phosphate moiety with a dephospholinker; (4) modification or replacement of naturally occurring nucleobases; (5) replacement or modification of the ribose phosphate backbone; (6) modification of the 3' or 5' end of the oligonucleotide (e.g., removal, modification or replacement of a terminal phosphate group, or partial conjugation); and (7) modification of the sugar. Other possible guide RNA modifications include modification or replacement of uracil or polyuracil tracts. See, for example, WO 2015 / 048577 and US 2016 / 0237455, each of which is incorporated herein by reference in its entirety for all purposes. Similar modifications can be made to Cas encoding nucleic acids such as Cas mRNA. For example, Cas mRNA can be modified by depleting uridine using synonymous codons.

[0218] For example, the nucleotides at the 5' end or 3' end of the guide RNA can include a phosphorothioate bond (e.g., a base can have a modified phosphate group, and the modified phosphate group is a phosphorothioate group). For example, the guide RNA can include a phosphorothioate bond between 2, 3 or 4 terminal nucleotides at the 5' or 3' end of the guide RNA. As another example, the nucleotides at the 5' and / or 3' end of the guide RNA can have a 2'-O-methyl modification. For example, the guide RNA can include 2'-O-methyl modifications at 2, 3 or 4 terminal nucleotides at the 5' and / or 3' end (e.g., 5' end) of the guide RNA. See, for example, WO 2017 / 173054 A1 and Finn et al. (2018), Cell Rep. 22 (9): 2227-2235, each of which is incorporated herein by reference in its entirety for all purposes. Other possible modifications are described in more detail elsewhere herein. In a specific example, the guide RNA comprises a 2'-O-methyl analog at the first three 5' and 3' terminal RNA residues and a 3' phosphorothioate internucleotide bond. Such chemical modifications can, for example, provide greater stability and protection against exonucleases in the guide RNA, allowing the guide RNA to persist longer in the cell than unmodified guide RNA. For example, such chemical modifications can also prevent innate intracellular immune responses that can actively degrade RNA or trigger an immune cascade leading to cell death.

[0219] Guide RNA can be provided in any form. For example, gRNA can be provided in the form of RNA, as two molecules (individual crRNA and tracrRNA) or as one molecule (sgRNA), and optionally provided in the form of a complex with Cas protein. gRNA can also be provided in the form of a DNA encoding gRNA. The DNA encoding gRNA can encode a single RNA molecule (sgRNA) or a separate RNA molecule (e.g., a separate crRNA and tracrRNA). In the latter case, the DNA encoding gRNA can be provided as a DNA molecule or as a separate DNA molecule encoding crRNA and tracrRNA respectively.

[0220] When gRNA is provided in the form of DNA, gRNA can be transient, conditional or constitutively expressed in cells. The DNA encoded by gRNA can be stably integrated into the genome of the cell and be operably connected to a promoter active in the cell. Alternatively, the DNA encoded by gRNA can be operably connected to a promoter in an expression construct. For example, the DNA encoded by gRNA can be in a vector including heterologous nucleic acids such as nucleic acids encoding Cas proteins. Alternatively, the DNA encoded by gRNA can be in a vector or plasmid separated from a vector including nucleic acids encoding Cas proteins. The promoter that can be used for such expression constructs is included in one or more cells in, for example, eukaryotic cells, human cells, non-human cells, mammalian cells, non-human mammalian cells, rodent cells, mouse cells, rat cells, pluripotent cells, embryonic stem (ES) cells, adult stem cells, developmentally restricted progenitor cells, inducible pluripotent stem (iPS) cells or single cell stage embryos and has an active promoter. Such promoters can be, for example, conditional promoters, inducible promoters, constitutive promoters, or tissue-specific promoters. Such promoters can also be, for example, bidirectional promoters. Specific examples of suitable promoters include RNA polymerase III promoters, such as human U6 promoter, rat U6 polymerase III promoter, or mouse U6 polymerase III promoter.

[0221] Alternatively, gRNA can be prepared by various other methods. For example, gRNA can be prepared by in vitro transcription using, for example, T7 RNA polymerase (see, for example, WO 2014 / 089290 and WO 2014 / 065596, each document in the document is incorporated herein by reference in its entirety for all purposes). Guide RNA can also be a synthetic molecule prepared by chemical synthesis. For example, guide RNA can be chemically synthesized to comprise 2'-O-methyl analogs and 3' phosphorothioate internucleotide bonds at the first three 5' and 3' end RNA residues.

[0222] The guide RNA (or nucleic acid encoding the guide RNA) can be in a composition comprising one or more guide RNAs (e.g., 1, 2, 3, 4 or more guide RNAs) and a carrier that increases the stability of the guide RNA (e.g., prolongs the time that degradation products remain below a threshold value, such as less than 0.5% of the weight of the starting nucleic acid or protein, under given storage conditions (e.g., -20°C, 4°C or ambient temperature); or increases in vivo stability). Non-limiting examples of such carriers include poly(lactic acid) (PLA) microspheres, poly(D,L-lactic-co-glycolic acid) (PLGA) microspheres, liposomes, micelles, reverse micelles, lipospiracle, and lipid microtubules. Such compositions can further include a Cas protein, such as a Cas9 protein, or a nucleic acid encoding a Cas protein.

[0223] Guide RNA target sequence:The target DNA for guide RNA includes the nucleic acid sequence present in DNA, and the DNA targeting fragment of gRNA will be combined with it, provided that there are enough binding conditions.Suitable DNA / RNA binding conditions include the physiological conditions normally present in the cell.Other suitable DNA / RNA binding conditions (for example, conditions in cell-free systems) are known in the art (see, for example, "Molecular Cloning: A Laboratory Manual", 3rd edition (Sambrook et al., Harbor Laboratory Press (Harbor Laboratory Press) 2001), which are incorporated herein by reference in their entirety for all purposes). The chain of the target DNA that is complementary and hybridized with gRNA can be referred to as "complementary chain", and the chain of the target DNA that is complementary to the "complementary chain" (and therefore not complementary to Cas protein or gRNA) can be referred to as "non-complementary chain" or "template chain".

[0224] The target DNA comprises a sequence on the complementary strand to which the guide RNA hybridizes and a corresponding sequence on the non-complementary strand (e.g., adjacent to the protospacer sequence adjacent motif (PAM)). As used herein, the term "guide RNA target sequence" specifically refers to a sequence on the non-complementary strand that corresponds to the sequence to which the guide RNA hybridizes on the complementary strand (i.e., its reverse complement). That is, the guide RNA target sequence refers to a sequence adjacent to the PAM on the non-complementary strand (e.g., upstream or 5' of the PAM in the case of Cas9). The guide RNA target sequence is equivalent to the DNA targeting segment of the guide RNA, but has thymine instead of uracil. For example, the guide RNA target sequence of the SpCas9 enzyme can refer to a sequence upstream of the 5'-NGG-3' PAM on the non-complementary strand. The guide RNA is designed to complement the complementary strand of the target DNA, wherein hybridization between the DNA targeting segment of the guide RNA and the complementary strand of the target DNA promotes the formation of the CRISPR complex. Complete complementarity is not necessarily required, provided that there is sufficient complementarity to cause hybridization and promote the formation of the CRISPR complex. If a guide RNA is referred to herein as targeting a guide RNA target sequence, it means that the guide RNA hybridizes to a complementary strand sequence of the target DNA that is the reverse complement of the guide RNA target sequence on the non-complementary strand.

[0225] The target DNA or guide RNA target sequence can include any polynucleotide and can be located, for example, in the nucleus or cytoplasm of a cell or in an organelle of the cell, such as a mitochondria or chloroplast. The target DNA or guide RNA target sequence can be any nucleic acid sequence that is endogenous or exogenous to the cell. The guide RNA target sequence can be a sequence encoding a gene product (e.g., a protein) or a non-coding sequence (e.g., a regulatory sequence) or can comprise both.

[0226] Site-specific binding and cleavage of the target DNA by the Cas protein can occur at a location determined by both (i) base pairing complementarity between the guide RNA and the complementary strand of the target DNA and (ii) a short motif in the non-complementary strand of the target DNA, known as a protospacer adjacent motif (PAM). The PAM can flank the guide RNA target sequence. Optionally, the guide RNA target sequence can be flanked by a PAM on the 3' end (e.g., for Cas9). Alternatively, the guide RNA target sequence can be flanked by a PAM on the 5' end (e.g., for Cpf1). For example, the cleavage site of the Cas protein can be about 1 to about 10 or about 2 to about 5 base pairs (e.g., 3 base pairs) upstream or downstream of the PAM sequence (e.g., within the guide RNA target sequence). In the case of SpCas9, the PAM sequence (i.e., on the non-complementary strand) can be 5'-N1GG-3', where N1 is any DNA nucleotide and the PAM is immediately 3' of the guide RNA target sequence on the non-complementary strand of the target DNA. Thus, the sequence corresponding to the PAM on the complementary strand (i.e., the reverse complement) will be 5'-CCN2-3', where N2 is any DNA nucleotide and is immediately 5' of the sequence to which the DNA targeting segment of the guide RNA hybridizes on the complementary strand of the target DNA. In some such cases, N1 and N2 can be complementary, and the N1-N2 base pair can be any base pair (e.g., N1 = C and N2 = G; N1 = G and N2 = C; N1 = A and N2 = T; or N1 = T and N2 = A). In the case of Cas9 from Staphylococcus aureus, the PAM can be NNGRRT or NNGRR, where N can be A, G, C, or T, and R can be G or A. In the case of Cas9 from Campylobacter jejuni, the PAM can be, for example, NNNNACAC or NNNNRYAC, where N can be A, G, C, or T, and R can be G or A. In some cases (eg, for FnCpf1), the PAM sequence may be located upstream of the 5' terminus and have the sequence 5'-TTN-3'.

[0227] An example of a guide RNA target sequence is a 20-nucleotide DNA sequence immediately preceding the NGG motif recognized by the SpCas9 protein. For example, two examples of guide RNA target sequences plus a PAM are GN 19 NGG (SEQ ID NO: 71) or N 20 NGG (SEQ ID NO: 72). See, for example, WO 2014 / 165825, which is incorporated herein by reference in its entirety for all purposes. The guanine at the 5' end can promote transcription by RNA polymerase in cells. Other examples of guide RNA target sequences plus PAM can include two guanine nucleotides at the 5' end (e.g., GGN 20NGG; SEQ ID NO: 73) to promote efficient transcription by T7 polymerase in vitro. See, for example, WO 2014 / 065596, which is incorporated herein by reference in its entirety for all purposes. Other guide RNA target sequences plus PAMs can have SEQ ID NOs: 71-73 with a length of 4-22 nucleotides, including a 5' G or GG and a 3' GG or NGG. Still other guide RNA target sequences plus PAMs can have SEQ ID NOs: 71-73 with a length between 14 and 20 nucleotides. Examples of guide RNA target sequences for BANF1, PPP2CA, and ANKLE2 include SEQ ID NOs: 1-4 (human BANF1), SEQ ID NOs: 5-6 (human PPP2CA), SEQ ID NO: 12 (human ANKLE2), SEQ ID NOs: 18-20 (mouse Banf1), SEQ ID NOs: 21-23 (mouse Ppp2ca), and SEQ ID NOs: 24-26 (mouse Ankle2).

[0228] The formation of a CRISPR complex hybridized with the target DNA can result in cutting of one or both chains of the target DNA in or near the region corresponding to the guide RNA target sequence (i.e., the guide RNA target sequence on the non-complementary strand of the target DNA and the guide RNA on the complementary strand hybridizing thereto). For example, the cleavage site can be within the guide RNA target sequence (e.g., at a defined location relative to the PAM sequence). The "cleavage site" comprises the position of the target DNA where the Cas protein produces a single-strand break or a double-strand break. The cleavage site can be only on one strand of the double-stranded DNA (e.g., when using a nickase) or on both strands. The cleavage site can be at the same position on both chains (producing blunt ends; e.g., Cas9) or at different sites on each chain (producing staggered ends (i.e., overhangs); e.g., Cpf1). For example, staggered ends can be produced by using two Cas proteins, each of which produces a single-strand break at different cleavage sites on different chains, thereby producing a double-strand break. For example, a first nickase can produce a single-strand break on a first strand of double-stranded DNA (dsDNA), and a second nickase can produce a single-strand break on a second strand of the dsDNA, such that an overhang sequence is generated. In some cases, the guide RNA target sequence or cleavage site for the nickase on the first strand is separated from the guide RNA target sequence or cleavage site for the nickase on the second strand by at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 75, 100, 250, 500, or 1,000 base pairs.

[0229] 2. Antisense oligonucleotides, antisense RNA, siRNA, or shRNA

[0230] Antisense oligonucleotides, antisense RNA, small interfering RNA (siRNA) or short hairpin RNA (shRNA) can also be used to reduce the expression of BANF1, PPP2CA or ANKLE2. Such antisense RNA, siRNA or shRNA can be designed to target any region of BANF1, PPP2CA or ANKLE2 mRNA.

[0231] The term "antisense RNA" refers to a single-stranded RNA that is complementary to a messenger RNA chain transcribed in a cell. The term "small interfering RNA (siRNA)" refers to a typical double-stranded RNA molecule that induces RNA interference (RNAi) pathways. The length of these molecules can vary (usually between 18-30 base pairs) and contain varying degrees of complementarity with the target mRNA in its antisense strand. Some, but not all, siRNAs have unpaired overhanging bases on the 5' end or 3' end of the sense strand and / or antisense strand. The term "siRNA" comprises a duplex of two separate chains, and a single strand of a hairpin structure that can form a duplex region. The length of the double-stranded structure can be, for example, less than 20, 25, 30, 35, 40, 45, or 50 nucleotides. For example, the length of the double-stranded structure can be about 21-23 nucleotides, about 19-25 nucleotides, or about 19-23 nucleotides. The term "short hairpin RNA (shRNA)" refers to a single-stranded RNA base that self-hybridizes in a hairpin structure and can induce RNA interference (RNAi) pathways when processed. The length of these molecules can vary (typically about 50-90 nucleotides in length, or in some cases greater than 250 nucleotides in length, such as shRNA adapted to microRNAs). The shRNA molecule is processed to form siRNA within the cell, which in turn can knock down gene expression. shRNA can be integrated into a vector. The term "shRNA" also refers to a DNA molecule from which a short hairpin RNA molecule can be transcribed.

[0232] Antisense oligonucleotides and RNAi agents can also be used to reduce the expression of BANF1, PPP2CA or ANKLE2. Such antisense oligonucleotides or RNAi agents can be designed to target any region of BANF1, PPP2CA or ANKLE2 mRNA.

[0233] "RNAi agent" is a composition comprising a small double-stranded RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule that can promote the degradation or inhibition of the translation of a target RNA such as messenger RNA (mRNA) in a sequence-specific manner. The oligonucleotide in the RNAi agent is a polymer of linked nucleosides, each of which can be independently modified or unmodified. The RNAi agent works through an RNA interference mechanism (i.e., by inducing RNA interference by interacting with the RNA interference pathway mechanism (RNA-induced silencing complex or RISC) of mammalian cells). Although the term RNAi agent as used herein is considered to work primarily through an RNA interference mechanism, the disclosed RNAi agent is not constrained or limited by any particular pathway or mechanism of action. The RNAi agents disclosed herein include a sense strand and an antisense strand, and include, but are not limited to, short interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), and dicer substrates. The antisense strand of the RNAi agents described herein is at least partially complementary to a sequence (ie, consecutive or ordered nucleobases or nucleotides, described by consecutive letters using standard nomenclature) in a target RNA.

[0234] The basic principle shared by single-stranded antisense oligonucleotides (ASOs) and RNA interference (RNAi) is that the oligonucleotides bind to the target RNA through Watson-Crick base pairing. Without wishing to be bound by theory, during RNAi, small RNA duplexes (RNAi agents) are associated with the RNA-induced silencing complex (RISC), one strand (the follower strand) is lost, and the remaining strand (the guide strand) cooperates with RISC to bind to the complementary RNA. The catalytic component of RISC, Argonaute 2 (Ago2), then cuts the target RNA. The guide strand is always associated with the complementary sense strand or protein (RISC). In contrast, ASOs must survive and function as single strands. ASOs bind to the target RNA and block ribosomes or other factors such as splicing factors from binding to the RNA or recruiting proteins such as nucleases. Different modifications and target regions are selected for ASOs based on the desired mechanism of action. Gapmers are ASO oligonucleotides containing 2-5 chemically modified nucleotides (e.g., LNA or 2'-MOE) flanking a central 8-10 base gap in DNA on each end. After binding to the target RNA, the DNA-RNA hybrid serves as a substrate for RNase H.

[0235] ASOs are DNA oligomers, typically 15-25 bases long, designed to be in an antisense orientation relative to the RNA of interest. Hybridization of the ASO with the target RNA mediates RNase H cleavage of the RNA, which can prevent protein translation of the mRNA. In order to increase nuclease resistance, phosphorothioate (PS) modifications can be added to the oligonucleotide. The phosphorothioate bond also promotes binding to serum proteins, which increases the bioavailability of the ASO and promotes productive cellular uptake. In phosphorothioate, a sulfur atom replaces the non-bridging oxygen in the oligophosphate backbone. ASOs can be chimeras comprising both DNA and modified RNA bases. Modified RNAs such as 2'-O-methoxy-ethyl (2'-MOE) RNA, 2'-O-methyl (2'OMe) RNA, or affinity-locked nucleic acid bases are used in chimeric antisense designs to increase nuclease stability and the affinity of the antisense oligonucleotide to the target RNA (T m ) both. However, these modifications do not activate RNase H cleavage (i.e., ASO is completely composed of sugar-modified RNA-like nucleotides (such as 2'-MOE)), however, RNase H cleavage of complementary RNA is not supported). Therefore, a kind of antisense strategy is "gapmer" design, which incorporates 2'-O-modified RNA or affinity-locked nucleic acid bases into chimeric antisense oligonucleotides that retain RNase-H activation domains. Standard gapmers retain a central region of PS-modified DNA bases sufficient to induce RNase H cleavage. These bases are flanked on both sides by 2'-modified blocks that will increase the binding affinity to the target. For example, gapmers can contain a central segment of deoxynucleotides that allow induction of RNase H cleavage, wherein the central portion is flanked by blocks of 2'-O-alkyl-modified ribonucleotides that protect the central segment from nuclease degradation. Once delivered to the cell, the ASO enters the nucleus and binds to its complementary endogenous RNA target. Hybridization of the ASO gapmer to the target RNA forms a DNA:RNA heteroduplex in the central region, which becomes the substrate for cleavage by the enzyme RNase H1.

[0236] In one example, an ASO is used as a 5-10-5 gapper containing 5' and 3' wings of 5 chemically modified nucleotides flanking a central 10 nucleotide core of DNA. In a specific example, an ASO is used as a 5-10-5 gapper containing a phosphorothioate backbone, 2' methoxyethyl modified bases in the wings (5 nucleotides from both ends), and a 10 nucleotide core of unmodified DNA bases. See, e.g. Figure 40 .

[0237] In one example, the ASO targeting mBanf1 may include a modified version of the parent antisense RNA sequence shown in any one of SEQ ID NOs: 215-236. In another example, the ASO targeting mBanf1 may include a modified version of the parent antisense RNA sequence shown in any one of SEQ ID NOs: 215, 216, 220-223, 225, 230-232, 234, and 235. Such modifications may include, for example, one or more of the following: replacing one or more RNA bases with one or more DNA bases, adding one or more phosphorothioate bonds, or replacing one or more bases with modified RNA bases, such as 2'-O-methoxy-ethyl (2'-MOE) RNA, 2'-O-methyl (2'OMe) RNA, or affinity-enhanced locked nucleic acid. In one example, the ASO targeting mBanf1 may include a sequence shown in any one of SEQ ID NOs: 105-126, or a modified version thereof. In another example, the ASO targeting mBanf1 may include the sequence shown in any one of SEQ ID NOs: 105, 106, 110-113, 115, 120-122, 124, and 125, or a modified form thereof. Such modifications may include, for example, the addition of one or more phosphorothioate bonds and / or the replacement of one or more bases with modified RNA bases, such as 2'-O-methoxy-ethyl (2'-MOE) RNA, 2'-O-methyl (2'OMe) RNA, or affinity-locked nucleic acid. In another example, the ASO targeting mBanf1 may include any of the sequences and / or modification patterns shown in Table 13. In any of the above sequences, any "T" in the first 5 or last 5 nucleotides may be replaced by "U."

[0238] In one example, the ASO targeting mPpp2ca can include a modified version of the parent antisense RNA sequence shown in any one of SEQ ID NOs: 237-278. In another example, the ASO targeting mPpp2ca can include a modified version of the parent antisense RNA sequence shown in any one of SEQ ID NOs: 240, 243, 246, 247, 260, 262, 263, 265, 268-270, 272, 275, and 276. Such modifications can include, for example, one or more of the following: replacing one or more RNA bases with one or more DNA bases, adding one or more phosphorothioate bonds, or replacing one or more bases with modified RNA bases, such as 2'-O-methoxy-ethyl (2'-MOE) RNA, 2'-O-methyl (2'OMe) RNA, or affinity plus locked nucleic acid. In one example, the ASO targeting mPpp2ca can include a sequence shown in any one of SEQ ID NOs: 127-168, or a modified version thereof. In another example, an ASO targeting mPpp2ca may include a sequence as shown in any one of SEQ ID NOs: 130, 133, 136, 137, 150, 152, 153, 155, 158-160, 162, 165, and 166, or a modified version thereof. Such modifications may include, for example, the addition of one or more phosphorothioate bonds and / or replacement of one or more bases with modified RNA bases, such as 2'-O-methoxy-ethyl (2'-MOE) RNA, 2'-O-methyl (2'OMe) RNA, or affinity-locked nucleic acid. In another example, an ASO targeting mPpp2ca may include any of the sequences and / or modification patterns shown in Table 14. In any of the above sequences, any "T" in the first 5 or last 5 nucleotides may be replaced with "U."

[0239] In one example, an ASO targeting mAnkle2 may include a modified version of the parent antisense RNA sequence shown in any one of SEQ ID NOs: 279-324. In another example, an ASO targeting mAnkle2 may include a modified version of the parent antisense RNA sequence shown in any one of SEQ ID NOs: 279, 281-283, 285, 287, 291-294, 297, 304, 307, 321, and 323. Such modifications may include, for example, one or more of the following: replacing one or more RNA bases with one or more DNA bases, adding one or more phosphorothioate bonds, or replacing one or more bases with modified RNA bases, such as 2'-O-methoxy-ethyl (2'-MOE) RNA, 2'-O-methyl (2'OMe) RNA, or affinity plus locked nucleic acid. In one example, an ASO targeting mAnkle2 may include a sequence shown in any one of SEQ ID NOs: 169-214, or a modified version thereof. In another example, an ASO targeting mAnkle2 may include a sequence as set forth in any one of SEQ ID NOs: 169, 171-173, 175, 177, 181-184, 187, 194, 197, 211, and 213, or a modified version thereof. Such modifications may include, for example, the addition of one or more phosphorothioate bonds and / or the replacement of one or more bases with modified RNA bases, such as 2'-O-methoxy-ethyl (2'-MOE) RNA, 2'-O-methyl (2'OMe) RNA, or affinity-enhanced locked nucleic acid. In another example, an ASO targeting mAnkle2 may include any of the sequences and / or modification patterns shown in Table 15. In any of the above sequences, any "T" in the first 5 or last 5 nucleotides may be replaced with "U."

[0240] III. Methods for Preparing Improved Tauopathy Models and Methods for Accelerating Tau Aggregation in Tauopathy Models

[0241] Also provided is a method for preparing the improved tau disease model disclosed in detail elsewhere herein.Such methods can start from pre-existing tau disease model (for example, transgenic cell, tissue or animal comprising exogenous human tau coding sequence).That is to say, such methods can be the method for accelerating or aggravating the tau aggregation in pre-existing tau disease model (for example, tau disease model non-human animal, tau disease model animal tissue or tau disease model animal cell).For example, such methods can include one or more medicaments that will reduce one or more or all of expression in BANF1, PPP2CA and ANKLE2 and be incorporated into pre-existing tau disease model cell, tissue or animal (for example, non-human animal, animal tissue or animal cell group comprising exogenous human microtubule-associated protein tau coding sequence).Any tau disease model discussed in more detail elsewhere herein can be used.

[0242] Various tau disease models have been developed. These models include cell / cell culture models (non-neuronal cell lines, neuronal cell lines such as PC12, SY5Y and CN1.4 cells, primary neuronal cells), tissue models (e.g., brain slice cultures, such as organotypic brain slice cultures) and whole animal transgenic models (e.g., Caenorhabditis elegans, Drosophila, zebrafish or mice). See, for example, Hall et al. (2005), Acta Biochimica et Biophysica Sinica 1739: 224-239; Brandt et al. (2005), Acta Biochimica et Biophysica Sinica 1739: 331-354; and Lee et al. (2005), Acta Biochimica et Biophysica Sinica 1739: 251-259, each document in the document is incorporated herein by reference in its entirety for all purposes. Typically, such models are transgenic models, in which wild-type or mutant tau isoforms are overexpressed under the control of various promoters to produce neurofibrillary pathology. Cell-based models have the advantages of being easier to manipulate and more flexible, whereas whole animal models (e.g., transgenic mouse models) are more complete and more directly relevant to human disease.

[0243] A specific tauopathy model is the PS19 (Tau P301S (PS19); PS19Tg; B6; C3-Tg (Prnp-MAPT*P301S) PS19Vle / J) mouse line. The genetic background of this strain is C57BL / 6x C3H. PS19 transgenic mice express mutant human microtubule-associated protein tau, MAPT, driven by the mouse prion protein (Prnp) promoter. The transgene encodes the disease-associated P301S mutation and contains four microtubule binding domains and an N-terminal insert (4R / 1N). A transgene is inserted at Chr3: 140354280-140603283 (constructing GRCm38 / mm10), resulting in a 249Kb deletion that does not affect any known gene. See Goodwin et al. (2019), Genome Research 29(3): 494-505, which is incorporated herein by reference in its entirety for all purposes. Expression of mutant human tau is five times higher than that of the endogenous mouse protein. See Yoshiyama et al. (2007), Neuron 53(3):337-351, which is incorporated herein by reference in its entirety for all purposes. PS19 mice suffer from neuronal loss and brain atrophy at eight months of age. The mice also form widely distributed tau aggregates, known as neurofibrillary tangle-like inclusions, in the neocortex, amygdala, hippocampus, brainstem, and spinal cord. See Yoshiyama et al. (2007). Before obvious tau pathology appeared by histological methods, the brains of these mice were shown to exhibit tau seeding activity. That is, tau aggregates present in brain homogenates may cause additional tau aggregation, presumably through a prion-like mechanism. See Holmes (2014), Proceedings of the National Academy of Sciences of the United States of America 111(41):E4376-E4385, which is incorporated herein by reference in its entirety for all purposes.

[0244] Other such methods can include not only one or more agents that reduce the expression of one or more or all of BANF1, PPP2CA and ANKLE2, but also introduce an exogenous microtubule-associated protein tau encoding sequence (e.g., an exogenous human microtubule-associated protein tau encoding sequence). Examples of such encoding sequences are discussed in more detail elsewhere herein, such as in the section on improved tau disease models. Any such sequence can be used.

[0245] The agent (and optional tau coding sequence) can be introduced by any known means. "Introduction" includes presenting an agent (e.g., nucleic acid or protein) to a cell or animal in such a way that the sequence obtains access to a cell or cell interior within a tissue or animal. The methods provided herein do not rely on a specific method for introducing an agent, as long as the nucleic acid or protein obtains access to at least one cell interior. Methods for introducing nucleic acids and proteins into various cell types are known, including, for example, stable transfection methods, transient transfection methods, and viral-mediated methods.

[0246] The molecules introduced into non-human animals or cells (e.g., Cas proteins or guide RNAs or RNAi agents or ASOs) can be in a composition that includes a carrier that increases the stability of the introduced molecule (e.g., prolongs the time that degradation products remain below a threshold value, such as less than 0.5% of the weight of the starting nucleic acid or protein, under given storage conditions (e.g., -20°C, 4°C, or ambient temperature); or increases in vivo stability). Non-limiting examples of such carriers include poly(lactic acid) (PLA) microspheres, poly(D,L-lactic-co-glycolic acid) (PLGA) microspheres, liposomes, micelles, reverse micelles, lipid helices, and lipid microtubules.

[0247] Provided herein are various methods and compositions allowing molecules (e.g., nucleic acids or proteins) to be introduced into cells or non-human animals. Methods for introducing molecules into various cell types are known and include, for example, stable transfection methods, transient transfection methods, and virus-mediated methods.

[0248] Transfection protocols and protocols for introducing molecules (e.g., nucleic acids or proteins) into cells can vary. Non-limiting transfection methods include chemical-based transfection methods using liposomes; nanoparticles; calcium phosphate (Graham et al. (1973), Virology 52(2):456-67; Bacchetti et al. (1977), Proceedings of the National Academy of Sciences 74(4):1590-4; and Kriegler, M (1991). Transfer and Expression: A Laboratory Manual. New York: WH Freeman and Company, pp. 96-97, each of which is incorporated herein by reference in its entirety for all purposes); dendrimers; or cationic polymers such as DEAE dextran or polyethyleneimine. Non-chemical methods include electroporation, sonoporation, and phototransfection. Particle-based transfection includes the use of a gene gun or magnet-assisted transfection (Bertram (2006), Current Pharmaceutical Biotechnology 7, 277-28), which is incorporated herein by reference in its entirety for all purposes. Viral methods can also be used for transfection.

[0249] The introduction of molecules (e.g., nucleic acids or proteins) into cells can also be mediated by electroporation, intracytoplasmic injection, viral infection, adenovirus, adeno-associated virus, lentivirus, retrovirus, transfection, lipid-mediated transfection, or nucleofection. Nucleofection is an improved electroporation technique that enables nucleic acid substrates to be delivered not only to the cytoplasm, but also to enter the cell nucleus through the nuclear membrane. In addition, the use of nucleofection in the methods disclosed herein generally requires far fewer cells than conventional electroporation (e.g., only about 2 million compared to 7 million for conventional electroporation). In one example, using NUCLEOFECTOR TM System for nucleofection.

[0250] Alternatively, microinjection can be performed by injecting a needle into the nucleus and injecting the first amount of the needle, and then injecting the second amount of the needle into the nucleus when the needle is removed from the cell. The method for performing microinjection is well known. See, e.g., Nagy et al. (Nagy A, Gertsenstein M, Vintersten K, Behringer R., 2003, Manipulating the Mouse Embryo. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press); Meyer et al. (2010), Proc. Natl. Acad. Sci. USA 107: 15022-15026 and Meyer et al. (2012), Proc. Natl. Acad. Sci. USA 109: 9354-9359, each of which is incorporated herein by reference in its entirety for all purposes.

[0251] Other methods for introducing molecules (e.g., nucleic acids or proteins) into cells can include, for example, vector delivery, particle-mediated delivery, exosome-mediated delivery, lipid nanoparticle-mediated delivery, cell-penetrating peptide-mediated delivery, or implantable device-mediated delivery. Methods for administering nucleic acids or proteins to subjects to modify cells in vivo are disclosed elsewhere herein. As a specific example, molecules (e.g., nucleic acids or proteins) can be introduced into cells or non-human animals with carriers such as poly (lactic acid) (PLA) microspheres, poly (D, L-lactic-co-glycolic acid) (PLGA) microspheres, liposomes, micelles, reverse micelles, lipid helices, or lipid microtubules. Some specific examples of delivery to non-human animals include hydrodynamic delivery, viral-mediated delivery (e.g., adeno-associated virus (AAV)-mediated delivery), and lipid nanoparticle-mediated delivery.

[0252] In one example, the agent (and optionally the tau coding sequence) can be introduced by viral transduction, such as lentiviral transduction or adeno-associated viral transduction.

[0253] In some methods, the components of the CRISPR / Cas system are introduced into non-human animals or cells. Guide RNA can be introduced into non-human animals or cells in the form of RNA (e.g., RNA transcribed in vitro) or in the form of DNA encoding the guide RNA. When introduced in the form of DNA, the DNA encoding the guide RNA can be operably connected to a promoter active in the cells of non-human animals. For example, the guide RNA can be delivered by AAV and expressed in vivo under the U6 promoter. Such DNA can be in one or more expression constructs. For example, such expression constructs can be components of a single nucleic acid molecule. Alternatively, it can be separated in any combination between two or more nucleic acid molecules (i.e., the DNA encoding one or more CRISPR RNAs and the DNA encoding one or more tracrRNAs can be components of separate nucleic acid molecules).

[0254] Similarly, the Cas protein can be provided in any form. For example, the Cas protein can be provided in the form of a protein, such as a Cas protein compounded with a gRNA. Alternatively, the Cas protein can be provided in the form of a nucleic acid encoding the Cas protein, such as RNA (e.g., messenger RNA (mRNA)) or DNA. Optionally, the nucleic acid encoding the Cas protein can be codon optimized to be effectively translated into protein in a specific cell or organism. For example, the nucleic acid encoding the Cas protein can be modified to replace a codon with a higher frequency of use in mammalian cells, rodent cells, mouse cells, rat cells or any other host cell of interest compared to a naturally occurring polynucleotide sequence. When the nucleic acid encoding the Cas protein is introduced into a non-human animal, the Cas protein can be expressed transiently, conditionally or constitutively in the cells of the non-human animal.

[0255] The nucleic acid encoding Cas protein or guide RNA can be operably connected to the promoter in the expression construct.Expression construct includes any nucleic acid construct that can guide the expression of gene or other nucleic acid sequence (for example, Cas gene) and such nucleic acid sequence can be transferred to target cell.For example, the nucleic acid encoding Cas protein can be in a vector including the DNA encoding one or more gRNA. Alternatively, it can be in a vector or plasmid separated from a vector including the DNA encoding one or more gRNA. Suitable promoters that can be used for expression constructs include, for example, eukaryotic cells, human cells, non-human cells, mammalian cells, non-human mammalian cells, rodent cells, mouse cells, rat cells, hamster cells, rabbit cells, pluripotent cells, embryonic stem (ES) cells, adult stem cells, developmentally restricted progenitor cells, inducible pluripotent stem (iPS) cells or single cell stage embryos with active promoters in one or more.Such promoters can be, for example, conditional promoters, inducible promoters, constitutive promoters or tissue-specific promoters. Optionally, the promoter can be a bidirectional promoter that drives expression of the Cas protein in one direction and expression of the guide RNA in the other direction. Such bidirectional promoters can be composed of: (1) a complete, conventional, unidirectional Pol III promoter containing three external control elements: a distal sequence element (DSE), a proximal sequence element (PSE), and a TATA box; (2) a second basic Pol III promoter containing a PSE and a TATA box fused to the 5' end of the DSE in the opposite orientation. For example, in the H1 promoter, the DSE is adjacent to the PSE and the TATA box, and the promoter can be bidirectionalized by generating a hybrid promoter in which reverse transcription is controlled by an additional PSE and a TATA box derived from the U6 promoter. See, for example, US 2016 / 0074535, which is incorporated herein by reference in its entirety for all purposes. The use of a bidirectional promoter to simultaneously express genes encoding Cas proteins and guide RNAs allows the generation of compact expression cassettes to facilitate delivery.

[0256] The introduction of nuclease agents can also be accomplished by viral-mediated delivery such as AAV-mediated delivery or lentiviral-mediated delivery. Other exemplary viruses / viral vectors include retroviruses, adenoviruses, vaccinia viruses, poxviruses, and herpes simplex viruses. Viruses can infect dividing cells, non-dividing cells, or both dividing and non-dividing cells. The virus can be integrated into the host genome, or alternatively not integrated into the host genome. Such viruses can also be engineered to have reduced immunity. The virus may have replication ability or may have replication defects (e.g., defects in one or more genes necessary for replication and / or packaging of additional rounds of virions). The virus can cause transient expression, long-term expression (e.g., at least 1 week, 2 weeks, 1 month, 2 months, or 3 months) or permanent expression (e.g., Cas9 and / or gRNA). Exemplary viral titers (e.g., AAV titers) include about 10 12 About 10 13 About 10 14 About 10 15 and about 10 16 Vector genomes / ml. Other exemplary viral titers (e.g., AAV titers) include about 10 12 About 10 13 About 10 14 About 10 15 and about 10 16 vector genomes (vg) / kg body weight.

[0257] The ssDNA AAV genome consists of two open reading frames, Rep and Cap, which are flanked by two inverted terminal repeats that allow the synthesis of complementary DNA chains. When constructing the AAV transfer plasmid, the transgene is placed between the two ITRs, and Rep and Cap can be provided in trans. In addition to Rep and Cap, AAV may also require a helper plasmid containing adenoviral genes. These genes (E4, E2a and VA) mediate AAV replication. For example, the transfer plasmid, Rep / Cap and helper plasmid can be transfected into HEK293 cells containing the adenoviral gene E1+ to produce infectious AAV particles. Alternatively, Rep, Cap and adenoviral helper genes can be combined into a single plasmid. Similar packaging cells and methods can be used for other viruses, such as retroviruses.

[0258] A variety of AAV serotypes have been identified. These serotypes differ in the cell types they infect (i.e., their tropism), allowing for preferential transduction of specific cell types. The serotypes of CNS tissues include AAV1, AAV2, AAV4, AAV5, AAV8, and AAV9. The serotypes of cardiac tissues include AAV1, AAV8, and AAV9. The serotypes of renal tissues include AAV2. The serotypes of lung tissues include AAV4, AAV5, AAV6, and AAV9. The serotypes of pancreatic tissues include AAV8. The serotypes of photoreceptor cells include AAV2, AAV5, and AAV8. The serotypes of retinal pigment epithelial tissues include AAV1, AAV2, AAV4, AAV5, and AAV8. The serotypes of skeletal muscle tissues include AAV1, AAV6, AAV7, AAV8, and AAV9. The serotypes of liver tissues include AAV7, AAV8, and AAV9, and particularly AAV8. The selectivity of AAV serotypes for gene delivery in neurons is discussed, for example, in Hammond et al. (2017), PLoS One 12(12):e0188830, which is incorporated herein by reference in its entirety for all purposes.

[0259] Tropism can be further refined by pseudotyping, which is a mixture of capsids and genomes from different viral serotypes. For example, AAV2 / 5 indicates a virus containing a serotype 2 genome packaged in a capsid from serotype 5. The use of pseudotyped viruses can improve transduction efficiency and alter tropism. Hybrid capsids derived from different serotypes can also be used to alter viral tropism. For example, AAV-DJ contains hybrid capsids from eight serotypes and exhibits high infectivity in a wide range of cell types in vivo. AAV-DJ8 is another example that exhibits the properties of AAV-DJ, but with enhanced brain uptake. AAV serotypes can also be modified by mutations. Examples of AAV2 mutation modifications include Y444F, Y500F, Y730F, and S662V. Examples of AAV3 mutation modifications include Y705F, Y731F, and T492V. Examples of AAV6 mutation modifications include S663V and T492V. Other pseudotyped / modified AAV variants include AAV2 / 1, AAV2 / 6, AAV2 / 7, AAV2 / 8, AAV2 / 9, AAV2.5, AAV8.2, and AAV / SASTG.

[0260] To accelerate transgene expression, self-complementary AAV (scAAV) variants can be used. Because AAV relies on the cell's DNA replication machinery to synthesize the complementary strand of the AAV single-stranded DNA genome, transgene expression may be delayed. To address this delay, scAAV can be used that contains complementary sequences that can spontaneously anneal after infection, thereby eliminating the need for host cell DNA synthesis. However, single-stranded AAV (ssAAV) vectors can also be used.

[0261] To increase packaging capacity, a longer transgene can be split between two AAV transfer plasmids, the first with a 3' splice donor and the second with a 5' splice acceptor. After co-infection of the cells, these viruses form concatemers, splice together, and the full-length transgene can be expressed. While this allows for expression of longer transgenes, the expression efficiency is lower. A similar approach for increasing capacity utilizes homologous recombination. For example, a transgene can be split between two transfer plasmids but with a large amount of sequence overlap, so that co-expression induces homologous recombination and expression of the full-length transgene.

[0262] The introduction of nucleic acids and proteins can also be accomplished by lipid nanoparticle (LNP)-mediated delivery. For example, LNP-mediated delivery can be used to deliver a combination of Cas mRNA and guide RNA or a combination of Cas protein and guide RNA. Delivery by such methods can result in transient Cas expression, and biodegradable lipids can improve clearance, improve tolerance and reduce immunogenicity. Lipid formulations can protect biomolecules from degradation while improving their cellular uptake. Lipid nanoparticles are particles comprising multiple lipid molecules that are physically associated with each other by intermolecular forces. These particles include microspheres (including unilamellar and multilamellar vesicles, e.g., liposomes), dispersed phases in emulsions, micelles, or internal phases in suspensions. Such lipid nanoparticles can be used to encapsulate one or more nucleic acids or proteins for delivery. Formulations containing cationic lipids can be used to deliver polyanions such as nucleic acids. Other lipids that can be included are neutral lipids (i.e., uncharged or zwitterionic lipids), anionic lipids, helper lipids that enhance transfection, and stealth lipids that increase the length of time that nanoparticles can exist in vivo. The example of suitable cationic lipid, neutral lipid, anionic lipid, helper lipid and stealth lipid can be found in WO2016 / 010840 A1, and described document is incorporated herein by reference in its entirety for all purposes.Exemplary lipid nanoparticles can comprise cationic lipid and one or more other components.In one example, other components can comprise helper lipids such as cholesterol.In another example, other components can comprise helper lipids such as cholesterol and neutral lipids such as DSPC.In another example, other components can comprise helper lipids such as cholesterol, optional neutral lipids such as DSPC and stealth lipids such as S010, S024, S027, S031 or S033.

[0263] LNP can contain one or more or all of the following: (i) lipids for encapsulation and for endosome escape; (ii) neutral lipids for stabilization; (iii) auxiliary lipids for stabilization; (iv) stealth lipids. See, for example, Finn et al. (2018), Cell Reports 22(9):2227-2235 and WO 2017 / 173054 A1, each of which is incorporated herein by reference in its entirety for all purposes. In some LNPs, the payload can include guide RNA or nucleic acids encoding guide RNA. In some LNPs, the payload can include mRNA encoding Cas nucleases such as Cas9 and guide RNA or nucleic acids encoding guide RNA.

[0264] The lipid for encapsulation and endosome escape can be a cationic lipid. Lipid can also be a biodegradable lipid, such as a biodegradable ionizable lipid. An example of a suitable lipid is lipid A or LPO1, i.e. (9Z, 12Z) -3- ((4, 4- bis (octyloxy) butyryl) oxy) -2- ((((3- (diethylamino) propoxy) carbonyl) oxy) methyl) propyl group 18-9, 12- dienoate, also known as 3- ((4, 4- bis (octyloxy) butyryl) oxy) -2- ((((3- (diethylamino) propoxy) carbonyl) oxy) methyl) propyl group (9Z, 12Z) -18-9, 12- dienoate. See, for example, Finn et al. (2018), Cell Reports 22 (9): 2227-2235 and WO 2017 / 173054 A1, each of which is incorporated herein by reference in its entirety for all purposes. Another example of a suitable lipid is lipid B, i.e., ((5-((dimethylamino)methyl)-1,3-phenylene)bis(oxy))bis(octane-8,1-diyl)bis(decanoate), also known as ((5-((dimethylamino)methyl)-1,3-phenylene)bis(oxy))bis(octane-8,1-diyl)bis(decanoate). Another example of a suitable lipid is lipid C, i.e., 2-((4-(((3-(dimethylamino)propoxy)carbonyl)oxy)hexadecanoyl)oxy)propane-1,3-diyl(9Z,9'Z,12Z,12'Z)-bis(octadec-9,12-dienoate). Another example of a suitable lipid is lipid D, i.e., 3-(((3-(dimethylamino)propoxy)carbonyl)oxy)-13-(octanoyloxy)tridecyl 3-octyl undecanoate. Other suitable lipids include heptathriacontac-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butyrate (also known as Dlin-MC3-DMA (MC3)).

[0265] Some such lipids suitable for LNP as herein described are biodegradable in vivo. For example, LNP comprising such lipids are included in at least 75% of those that remove lipids from blood plasma within 8 hours, 10 hours, 12 hours, 24 hours, or 48 hours, or within 3 days, 4 days, 5 days, 6 days, 7 days, or 10 days. As another example, at least 50% of the LNP are removed from blood plasma within 8 hours, 10 hours, 12 hours, 24 hours, or 48 hours, or within 3 days, 4 days, 5 days, 6 days, 7 days, or 10 days.

[0266] In some embodiments, lipid can be ionizable. For example, in slightly acidic medium, lipid can be protonated and therefore have positive charge. On the contrary, in weakly alkaline medium, for example, in blood having a pH of approximately 7.35, lipid may not be protonated and therefore have no charge. In certain embodiments, lipid can be protonated at a pH of at least about 9, 9.5 or 10. The charged ability of this lipid is relevant with its intrinsic pKa. For example, the pKa of lipid can be independently in the range of about 5.8 to about 6.2.

[0267] The role of neutral lipids is to stabilize and improve the processing of LNP. The example of suitable neutral lipids includes various neutral, uncharged or zwitterionic lipids. The example of neutral phospholipids suitable for the present disclosure includes but is not limited to 5-heptadecanediol-1,3-diol (resorcinol), dipalmitoylphosphatidylcholine (DPPC), distearoylphosphatidylcholine (DSPC), phosphorylcholine (DOPC), dimyristoylphosphatidylcholine (DMPC), phosphatidylcholine (PLPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DAPC), phosphatidylethanolamine (PE), egg phosphatidylcholine (EPC), dilauroylphosphatidylcholine (DLPC), dimyristoylphosphatidylcholine (DMPC), 1-myristoyl-2-palmitoylphosphatidylcholine (MPPC), 1-palmitoyl-2-myristoylphosphatidylcholine (PMPC). The neutral phospholipids include, but are not limited to, 1,2-diisopropylphosphatidylcholine (DPPC), 1-stearoyl-2-palmitoylphosphatidylcholine (SPPC), 1,2-diisopropylphosphatidylcholine (DEPC), palmitoyloleoylphosphatidylcholine (POPC), lysophosphatidylcholine, dioleoylphosphatidylethanolamine (DOPE), dilinoleoylphosphatidylcholine distearoylphosphatidylethanolamine (DSPE), dimyristoylphosphatidylethanolamine (DMPE), dipalmitoylphosphatidylethanolamine (DPPE), palmitoyloleoylphosphatidylethanolamine (POPE), lysophosphatidylethanolamine, and combinations thereof. For example, the neutral phospholipids may be selected from the group consisting of distearoylphosphatidylcholine (DSPC) and dimyristoylphosphatidylethanolamine (DMPE).

[0268] Helper lipids include lipids that enhance transfection. The mechanism by which helper lipids enhance transfection may include enhanced particle stability. In some cases, helper lipids may enhance membrane fusogenicity. Helper lipids include steroids, sterols, and alkylresorcinols. Examples of suitable helper lipids include cholesterol, 5-heptadecanylresorcinol, and cholesterol hemisuccinate. In one example, the helper lipid may be cholesterol or cholesterol hemisuccinate.

[0269] Stealth lipids include lipids that change the length of time a nanoparticle can exist in vivo. Stealth lipids can help the formulation process by, for example, reducing particle aggregation and controlling particle size. Stealth lipids can modulate the pharmacokinetic properties of LNPs. Suitable stealth lipids include lipids with a hydrophilic head group attached to the lipid moiety.

[0270] The hydrophilic head group of the stealth lipid can include, for example, a polymer moiety selected from polymers based on PEG (sometimes referred to as poly(ethylene oxide)), poly(oxazoline), poly(vinyl alcohol), poly(glycerol), poly(N-vinyl pyrrolidone), polyamino acids, and poly-N-(2-hydroxypropyl)methacrylamide. The term PEG means any polyethylene glycol or other polyalkylene ether polymer. In certain LNP formulations, the PEG is PEG-2K, also known as PEG 2000, which has an average molecular weight of approximately 2,000 Daltons. See, for example, WO 2017 / 173054 A1, which is incorporated herein by reference in its entirety for all purposes.

[0271] The lipid portion of the stealth lipid can be derived, for example, from a diacylglycerol or dialkylglycylamide, including those comprising a dialkylglycerol or dialkylglycylamide group having an alkyl chain length independently comprising from about C4 to about C40 saturated or unsaturated carbon atoms, wherein the chain can include one or more functional groups, such as amides or esters. The diacylglycerol or dialkylglycylamide group can further include one or more substituted alkyl groups.

[0272] As an example, the stealth lipid can be selected from PEG-dilaurin, PEG-dimyristoylglycerol (PEG-DMG), PEG-dipalmitoylglycerol, PEG-distearoylglycerol (PEG-DSPE), PEG-dilaurylamide, PEG-dimyristoylglyceramide, PEG-dipalmitoylglyceramide and PEG-distearoylglyceramide, PEG-cholesterol (1-[8'-(cholest-5-en-3[β]-oxy)formamido-3',6'-dioxaoctyl]carbamoyl-[ω]-methyl-poly(ethylene glycol), PEG-DMB (3,4-dioctylbenzyl-[ω]-methyl-poly(ethylene glycol) ether), 1,2-dimyristoylglycerol. In one embodiment, the stealth lipid may be PEG2k-DMG, 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000](PEG2k-DSPE), 1,2-distearoyl-sn-glycero, methoxypolyethylene glycol (PEG2k-DSG), poly(ethylene glycol)-2000-dimethacrylate (PEG2k-DMA), and 1,2-distearoyloxypropyl-3-amine-N-[methoxy(polyethylene glycol)-2000](PEG2k-DSA). In a specific example, the stealth lipid may be PEG2k-DMG.

[0273] LNP can comprise the component lipid of corresponding mol ratio in the composite.The mol-% of CCD lipid can be for example about 30mol-% to about 60mol-%, about 35mol-% to about 55mol-%, about 40mol-% to about 50mol-%, about 42mol-% to about 47mol-% or about 45%.The mol-% of helper lipid can be for example about 30mol-% to about 60mol-%, about 35mol-% to about 55mol-%, about 40mol-% to about 50mol-%, about 41mol-% to about 46mol-% or about 44mol-%.The mol-% of neutral lipid can be for example about 1mol-% to about 20mol-%, about 5mol-% to about 15mol-%, about 7mol-% to about 12mol-% or about 9mol-%. The mol-% of stealth lipids can be, for example, about 1 mol-% to about 10 mol-%, about 1 mol-% to about 5 mol-%, about 1 mol-% to about 3 mol-%, about 2 mol-%, or about 1 mol-%.

[0274] LNP can have different ratios between the positively charged amine group of biodegradable lipid (N) and the negatively charged phosphate group (P) of nucleic acid to be encapsulated.This can be mathematically represented by equation N / P.For example, the N / P ratio can be about 0.5 to about 100, about 1 to about 50, about 1 to about 25, about 1 to about 10, about 1 to about 7, about 3 to about 5, about 4 to about 5, about 4, about 4.5 or about 5.The N / P ratio can also be about 4 to about 7 or about 4.5 to about 6.In a specific example, the N / P ratio can be 4.5 or can be 6.

[0275] In some LNPs, the cargo can include Cas mRNA and gRNA. The ratio of Cas mRNA to gRNA can be different. For example, the ratio of Cas mRNA to gRNA nucleic acid of the LNP formulation can range from about 25:1 to about 1:25, about 10:1 to about 1:10, about 5:1 to about 1:5 or about 1:1. Alternatively, the ratio of Cas mRNA to gRNA nucleic acid of the LNP formulation can be about 1:1 to about 1:5 or about 10:1. Alternatively, the ratio of Cas mRNA to gRNA nucleic acid of the LNP formulation can be about 1:10, 25:1, 10:1, 5:1, 3:1, 1:1, 1:3, 1:5, 1:10 or 1:25. Alternatively, the LNP formulation can include a ratio of Cas mRNA to gRNA nucleic acid of about 1:1 to about 1:2. In a specific example, the ratio of Cas mRNA to gRNA can be about 1:1 or about 1:2.

[0276] Specific examples of using LNPs for delivery to the brain are disclosed in Nabhan et al. (2016), Sci. Rep. 6:20019, which is incorporated herein by reference in its entirety for all purposes.

[0277] In vivo administration can be by any suitable approach, including, for example, parenteral, intravenous, oral, subcutaneous, intraarterial, intracranial, intrathecal, intraperitoneal, local, intranasal or intramuscular administration. Systemic administration includes, for example, oral and parenteral approaches. The example of parenteral approach includes intravenous, intraarterial, intraosseous, intramuscular, intradermal, subcutaneous, intranasal and intraperitoneal approaches. Specific example is intravenous infusion. Nasal drip and intravitreal injection are other specific examples. Local administration includes, for example, intrathecal, intraventricular, intracerebral (for example, in local brain parenchyma, delivered to the striatum (for example, into the caudate nucleus or into the putamen), cerebral cortex, precentral gyrus, hippocampus (for example, into the dentate gyrus or CA3 area), temporal cortex, amygdala, frontal cortex, thalamus, cerebellum, medulla, hypothalamus, tectum, tegmentum or substantia nigra), intraocular, intraorbital, subconjunctival, intravitreal, subretinal and transscleral approaches. Compared with systemic administration (for example, intravenously), when local administration (for example, in brain parenchyma or in vitreous body), significantly less amount of components (compared with systemic methods) can play a role. Local administration mode can also reduce or eliminate the incidence of potential toxic and side effects that may occur when the components of systemic administration therapeutically effective amount. In a specific example, the administration carried out to the animal is carried out by intrathecal injection or by intracranial injection (for example, stereotactic surgery or intraventricular injection for injection in hippocampus and other brain regions).

[0278] The frequency of administration and the number of doses can depend on factors such as the half-life of the agent and the route of administration. The introduction of a nucleic acid or protein into a cell or non-human animal can be performed once or multiple times over a period of time. For example, the introduction can be performed at a frequency of at least twice over a period of time, at least three times over a period of time, at least four times over a period of time, at least five times over a period of time, at least six times over a period of time, at least seven times over a period of time, at least eight times over a period of time, at least nine times over a period of time, at least ten times over a period of time, at least eleven times over a period of time, at least twelve times over a period of time, at least thirteen times over a period of time, at least fourteen times over a period of time, at least fifteen times over a period of time, at least sixteen times over a period of time, at least seventeen times over a period of time, at least eighteen times over a period of time, at least nineteen times over a period of time, or at least twenty times over a period of time.

[0279] Such methods can further include screening cells, tissues, or animals to confirm the presence of one or more agents (and optionally tau coding sequences). Cells, tissues, or animals comprising an agent (and optionally a tau coding sequence) can be screened by any known means.

[0280] For example, reporter genes can be used to screen cells with a pharmaceutical agent (or optionally a tau coding sequence). For example, a tau coding sequence can encode tau proteins fused to reporter genes such as fluorescent proteins. Exemplary reporter genes include those encoding the following reporter genes: luciferase, beta-galactosidase, green fluorescent protein (GFP), enhanced green fluorescent protein (eGFP), cyan fluorescent protein (CFP), yellow fluorescent protein (YFP), enhanced yellow fluorescent protein (eYFP), blue fluorescent protein (BFP), enhanced blue fluorescent protein (eBFP), DsRed, ZsGreen, MmGFP, mPlum, mCherry, tdTomato, mStrawberry, J-Red, mOrange, mKO, mCitrine, Venus, YPet, emerald, CyPet, sky blue, T-sapphire, and alkaline phosphatase. For example, if the first reporter gene and the second reporter gene are fluorescent proteins (e.g., CFP and YFP), cells including these reporter genes can be selected by flow cytometry to select double-positive cells. Double-positive cells can then be combined to generate a polyclonal line, or a monoclonal line can be generated from a single double-positive cell.

[0281] As another example, a selection marker can be used to screen for cells that have the agent (or optionally the tau coding sequence). Exemplary selection markers include neomycin phosphotransferase (neo r ), hygromycin B phosphotransferase (hyg r ), puromycin-N-acetyltransferase (puromycin r ), blasticidin S deaminase (bsr r ), xanthine / guanine phosphoribosyltransferase (GPT), or herpes simplex virus thymidine kinase (HSV-k).

[0282] Then the cells or tissues can be inoculated with tau aggregates by any suitable method. This can be, for example, carried out after about 1 day, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 1 week, about 2 weeks or about 3 weeks (for example, about 1 week in culture) in culture after introducing one or more agents (and optionally tau coding sequences). Alternatively, cells or tissues can be inoculated with tau aggregates before introducing one or more agents (and optionally tau coding sequences). For example, cells or tissues can be treated with recombinant fibrotic tau (for example, recombinant fibrotic tau repeat domains) to inoculate the aggregation of tau repeat domain proteins stably expressed by these cells. Tau intercellular propagation may also be caused by the tau aggregation activity secreted by cells containing aggregates. For example, cells or tissues can be cultured using conditioned medium harvested from cultured tau aggregation-positive cells, wherein the tau repeat domains are stably present in an aggregated state. Conditioned medium refers to the spent culture medium collected from cultured cells. The conditioned medium contains metabolites, growth factors and extracellular matrix proteins secreted into the culture medium by the cultured cells. For example, conditioned medium can be produced by collecting the culture medium on the tau aggregation positive Agg[+] cells that have converged. Culture medium can have been in the Agg[+] cells that have converged for about 12 hours, about 24 hours, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days or about 10 days. For example, culture medium can have been in the Agg[+] cells that have converged for about 1 to about 7 days, about 2 to about 6 days, about 3 to about 5 days or about 4 days. Conditioned medium can then be applied to cells or tissues in combination with fresh culture medium. The ratio of conditioned medium to fresh medium can be, for example, about 10: 1, about 9: 1, about 8: 1, about 7: 1, about 6: 1, about 5: 1, about 4: 1, about 3: 1, about 2: 1, about 1 : 1, about 1 : 2, about 1 : 3, about 1 : 4, about 1 : 5, about 1 : 6, about 1 : 7, about 1 : 8, about 1 : 9, or about 1 : 10. For example, the ratio of conditioned medium to fresh medium can be about 5: 1 to about 1 : 1, about 4: 1 to about 2: 1, or about 3: 1.For example, use of conditioned medium can include culturing the genetically modified cell population in about 90% conditioned medium and about 10% fresh medium, about 85% conditioned medium and about 15% fresh medium, about 80% conditioned medium and about 20% fresh medium, about 75% conditioned medium and about 25% fresh medium, about 70% conditioned medium and about 30% fresh medium, about 65% conditioned medium and about 35% fresh medium, about 60% conditioned medium and about 40% fresh medium, about 55% conditioned medium and about 45% fresh medium. Fresh medium, about 50% conditioned medium and about 50% fresh medium, about 45% conditioned medium and about 55% fresh medium, about 40% conditioned medium and about 60% fresh medium, about 35% conditioned medium and about 65% fresh medium, about 30% conditioned medium and about 70% fresh medium, about 25% conditioned medium and about 75% fresh medium, about 20% conditioned medium and about 80% fresh medium, about 15% conditioned medium and about 85% fresh medium or about 10% conditioned medium and about 90% fresh medium. In one example, the use of conditioned medium can include culturing a genetically modified cell population in a medium comprising at least about 50% conditioned medium and no more than about 50% fresh medium. In a specific example, the use of conditioned medium can include culturing a genetically modified cell population in about 75% conditioned medium and about 25% fresh medium.

[0283] Conditioned medium can be used in the absence of co-culture. Conditioned medium without co-culture has not been used as an inoculum in this context before. However, conditioned medium is particularly useful for large-scale whole genome screening because tau fibers produced in vitro are limited resources. In addition, conditioned medium is more physiologically relevant because it is produced by cells rather than in vitro. The use of conditioned medium as described herein provides an enhancement of tau seeding activity (e.g., about 0.1% measured by FRET induction as disclosed elsewhere herein) to sensitize cells to tau aggregation.

[0284] Then one or more signs or symptoms of tauopathy can be assessed by any suitable means.The example of such signs and symptoms is discussed in more detail elsewhere herein, and comprises for example tau hyperphosphorylation or tau aggregation.Other signs or symptoms can comprise after for example cell fractionation, tau and / or phosphorylated tau in the insoluble fraction increase, the phosphorylated tau in the somatodendritic compartment of the neuron increase, the phosphorylated tau in the nuclear periphery of the neuron increase, the nuclear pore complex protein Nup98-Nup96 (Nup98) nucleus-to-cytoplasm ratio reduction, the GTP in the neuron binds to the nuclear protein Ran (Ran) nucleus-to-cytoplasm ratio reduction or the Ran GTPase activating protein 1 (RanGAP1) nucleus-to-cytoplasm ratio reduction in the neuron.Phosphorylated tau can be for example phosphorylated tau (S356) or phosphorylated tau AT8 (S202, T205). This can be done, for example, about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, or more after tau inoculation or after introduction of one or more agents (and optionally a tau encoding sequence). For example, the assessment can be done about 2 weeks to about 6 weeks or about 3 weeks to about 5 weeks after tau inoculation or after introduction of one or more agents (and optionally a tau encoding sequence).

[0285] IV. Methods of Testing Candidate Tauopathies Therapeutics

[0286] Provide for using the improved tau disease model disclosed in detail elsewhere herein to identify or assess the whole bag of tricks for the treatment of the therapeutic agent candidate for tau disease.Such methods can include, for example, applying candidate agent to the improved tau disease model disclosed elsewhere herein (for example, as disclosed elsewhere herein, animal, tissue or cell); Carry out one or more determinations to determine whether candidate agent has an impact on one or more signs or symptoms related to tau disease; And if candidate agent has an impact on one or more signs or symptoms related to tau disease, candidate agent is accredited as therapeutic agent candidate.

[0287] Any candidate agent can be tested. Such candidates can include, for example, macromolecules or small molecules such as siRNA, antibodies, or CRISPR / Cas gRNA. The candidate agent can be administered to a non-human animal or non-human animal cell by any suitable route.

[0288] Any determination of the signs or symptoms relevant to tau disease can be used to measure.The example of such signs and symptoms is disclosed in other places herein.As a first example, signs or symptoms can be tau hyperphosphorylation (for example, AT8 staining as shown in the examples).As a second example, signs or symptoms can be tau aggregation (for example, Thioflavin S staining as shown in the examples).Other signs or symptoms can comprise after such as cell fractionation, tau and / or phosphorylated tau in the insoluble fraction increase, the phosphorylated tau in the somatodendritic compartment of neurons increases, the phosphorylated tau in the perinuclear area of ​​neurons increases, the nuclear pore complex protein Nup98-Nup96 (Nup98) nuclear-to-cytoplasmic ratio in neurons reduces, the GTP-binding nuclear protein Ran (Ran) nuclear-to-cytoplasmic ratio in neurons reduces or Ran GTPase activating protein 1 (RanGAP1) nuclear-to-cytoplasmic ratio in neurons reduces.Phosphorylated tau can be such as phosphorylated tau (S356) or phosphorylated tau AT8 (S202, T205).

[0289] Candidate agents can be administered to an animal, and one or more assays can be performed in the animal. Alternatively, a candidate agent can be administered to an animal, and one or more assays can be performed in vitro in cells isolated from the animal after administration of the candidate agent. Alternatively, a candidate agent can be administered to cells (e.g., neurons) in vitro or to tissues (e.g., brain slices, such as organotypic brain slice cultures) in vitro, and these assays can be performed in cells or in vitro in tissues.

[0290] Optionally, before or after administering the candidate agent, cells or tissues can be inoculated with tau aggregates in any suitable manner. For example, cells or tissues can be treated with recombinant fibrotic tau (e.g., recombinant fibrotic tau repeat domains) to inoculate the aggregation of tau repeat domain proteins stably expressed by these cells. Tau intercellular transmission may also be caused by tau aggregation activity secreted by cells containing aggregates. For example, cells or tissues can be cultured using conditioned medium harvested from cultured tau aggregation-positive cells, wherein the tau repeat domains are stably present in an aggregated state. Conditioned medium refers to the spent culture medium collected from cultured cells. The conditioned medium contains metabolites, growth factors, and extracellular matrix proteins secreted into the culture medium by cultured cells. For example, conditioned medium can be produced by collecting the culture medium on the tau aggregation-positive Agg[+] cells that have converged. The culture medium can have been on the Agg[+] cells that have converged for about 12 hours, about 24 hours, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days or about 10 days. For example, the culture medium can have been on the Agg[+] cells that have converged for about 1 to about 7 days, about 2 to about 6 days, about 3 to about 5 days or about 4 days. The conditioned medium can then be applied to cells or tissues in combination with fresh culture medium. The ratio of conditioned medium to fresh culture medium can be, for example, about 10:1, about 9:1, about 8:1, about 7:1, about 6:1, about 5:1, about 4:1, about 3:1, about 2:1, about 1:1, about 1:2, about 1:3, about 1:4, about 1:5, about 1:6, about 1:7, about 1:8, about 1:9 or about 1:10. For example, the ratio of conditioned medium to fresh medium can be about 5: 1 to about 1: 1, about 4: 1 to about 2: 1, or about 3: 1. For example, use of conditioned medium can include culturing the genetically modified cell population in about 90% conditioned medium and about 10% fresh medium, about 85% conditioned medium and about 15% fresh medium, about 80% conditioned medium and about 20% fresh medium, about 75% conditioned medium and about 25% fresh medium, about 70% conditioned medium and about 30% fresh medium, about 65% conditioned medium and about 35% fresh medium, about 60% conditioned medium and about 40% fresh medium, about 55% conditioned medium and about 45% fresh medium. fresh medium, about 50% conditioned medium and about 50% fresh medium, about 45% conditioned medium and about 55% fresh medium, about 40% conditioned medium and about 60% fresh medium, about 35% conditioned medium and about 65% fresh medium, about 30% conditioned medium and about 70% fresh medium, about 25% conditioned medium and about 75% fresh medium, about 20% conditioned medium and about 80% fresh medium, about 15% conditioned medium and about 85% fresh medium, or about 10% conditioned medium and about 90% fresh medium.In one example, the use of conditioned medium can include culturing the genetically modified cell population in a medium comprising at least about 50% conditioned medium and no more than about 50% fresh medium. In a specific example, the use of conditioned medium can include culturing the genetically modified cell population in about 75% conditioned medium and about 25% fresh medium.

[0291] Then one or more signs or symptoms of tau disease can be assessed by any suitable means at any suitable time after inoculation or after using candidate's agent.This can for example be carried out after tau inoculation or after using candidate's agent about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks or longer time.For example, can be assessed after tau inoculation or after using candidate's agent about 2 weeks to about 6 weeks or about 3 weeks to about 5 weeks.

[0292] For all purposes, all patent applications, websites, other publications, accession numbers, etc. cited above or below are incorporated by reference as a whole, to the extent that each individual project is individually and specifically pointed out to be incorporated by reference. If different versions of a sequence are associated with accession numbers at different times, it is meant that the version in which the effective submission date of the present application is associated with the accession number is referred to. The effective submission date refers to the earlier date in the actual submission date or the submission date (where applicable) of the priority application that mentions the accession number. Similarly, if different versions of a publication, website, etc. are published at different times, unless otherwise stated, the version most recently published on the effective submission date of the application is referred to. Unless otherwise specifically stated, any feature, step, element, embodiment, or aspect of the present invention can be used in combination with any other feature, step, element, embodiment, or aspect. Although the present invention has been described in detail by diagram and example for the sake of clarity and understanding, it is apparent that certain changes and modifications can be made within the scope of the appended claims.

[0293] Brief description of sequence

[0294] The nucleotide and amino acid sequences listed in the accompanying sequence table are illustrated using the standard alphabetical abbreviations for nucleotide bases and the three-letter code for amino acids. The nucleotide sequence follows the standard convention starting from the 5' end of the sequence and forward (i.e., from left to right in each row) to the 3' end. Each nucleotide sequence shows only one chain, but any display chain mentioned should be understood to comprise a complementary chain. When providing a nucleotide sequence encoding an amino acid sequence, it should be understood that degenerate codon variants are also provided that encode the same amino acid sequence. The amino acid sequence follows the standard convention starting from the amino terminus of the sequence and forward (i.e., from left to right in each row) to the carboxyl terminus.

[0295] Table 2: Sequence description.

[0296]

[0297]

[0298]

[0299]

[0300] Examples

[0301] Example 1: Development of a genome-wide CRISPR / Cas9 screening platform for identifying genetic modifiers of tau aggregation

[0302] Abnormal aggregation or fibrosis of proteins is a defining feature of many diseases, notably including a variety of neurodegenerative diseases such as Alzheimer's disease (AD), Parkinson's disease (PD), frontotemporal dementia (FTD), amyotrophic lateral sclerosis (ALS), chronic traumatic encephalopathy (CTE), Creutzfeldt-Jakob disease (CJD), etc. In many of these diseases, the fibrosis of certain proteins into insoluble aggregates is not only a hallmark of the disease, but is also considered a causative factor of neurotoxicity. In addition, these diseases are characterized by the spread of aggregation pathology through the central nervous system in a stereotyped pattern, a process that is associated with disease progression. Therefore, identifying genes and genetic pathways that modify the process of abnormal protein aggregation or the intercellular propagation of aggregates is of great value in better understanding the causes of neurodegenerative diseases and developing therapeutic intervention strategies.

[0303] To identify genes and pathways that modify the process of abnormal tau protein aggregation, a platform was developed for genome-wide screening using a CRISPR nuclease (CRISPRn) sgRNA library to identify genes that regulate the potential of cells to be "seeded" with tau disease-associated protein aggregates (i.e., genes whose disruption makes cells more susceptible to forming tau aggregates when exposed to a source of tau fibrotic protein). The identification of such genes could elucidate the mechanism of tau cell-to-cell aggregate propagation and the genetic pathways that control the susceptibility of neurons to form tau aggregates in the context of neurodegenerative diseases.

[0304] The screening used a tau biosensor human cell line consisting of HEK293T cells stably expressing the four repeat sequence domains of tau, tau_4RD, which include the tau microtubule binding domain (MBD) with the P301S pathogenic mutation fused to CFP or YFP. In other words, the HEK293T cell line contains two transgenes stably expressing disease-associated protein variants fused to the fluorescent protein CFP or the fluorescent protein YFP: tau 4RD -CFP / tau 4RD -YFP (TCY), in which the tau repeat domain (4RD) contains the P301S pathogenic variant. Figure 1 In these biosensor cell lines, tau-CFP / tau-YFP protein aggregation generates a FRET signal, which is the result of fluorescence energy transfer from the donor CFP to the acceptor YFP. Figure 2 FRET-positive cells containing tau aggregates can be sorted and isolated by flow cytometry. At baseline, unstimulated cells express the reporter gene in a stable, soluble state, where the FRET signal is minimal. Upon stimulation (e.g., liposomal transfection of seed particles), the reporter protein forms aggregates, generating a FRET signal. Cells containing aggregates can be isolated by FACS. Stably propagating cell lines containing aggregates, Agg[+], can be isolated by clonal serial dilution of the Agg[-] cell line.

[0305] Several modifications were made to this tau biosensor cell line to make it useful for genetic screening. First, these tau biosensor cells were modified by introducing a transgenic line expressing Cas9 (SpCas9) via a lentiviral vector. Clonal transgenic cell lines expressing Cas9 were selected with blasticidin and isolated by clonal serial dilution to obtain single cell-derived clones. The results were analyzed by qRT-PCR ( Figure 3A ) to assess the Cas9 expression levels of clones and to determine the expression of Cas9 by digital PCR ( Figure 3B ) to assess DNA cleavage activity. Table 3 also shows the relative Cas9 expression levels.

[0306] Table 3: Relative Cas9 expression levels.

[0307]

[0308] Specifically, Cas9 mutation efficiency was assessed by digital PCR 3 and 7 days after transduction of lentivirus encoding gRNA for the two selected target genes. The cutting efficiency was limited by the level of Cas9 in the low-expressing clones. Clones with sufficient Cas9 expression levels were required to achieve maximum activity. Several derivative clones with lower Cas9 expression were unable to effectively cut the target sequence, while clones with higher expression (including clones used for screening) were able to produce mutations at the target sequences in the genes PERK and SNCA with an efficiency of approximately 80% after three days of culture. Effective cutting was observed 3 days after gRNA transduction, with only a slight improvement after 7 days. Clone 7B10-C3 was selected as a high-performance clone for subsequent library screening.

[0309] Secondly, reagents and methods were developed to sensitize cells to tau seeding activity. Tau cell-to-cell spread may be caused by tau aggregation activity secreted by cells containing aggregates. To study the proliferation of cells aggregated with tau, a subclone of the tau-YFP cell line was obtained, which consists of HEK293T cells stably expressing the tau repeat domain tau_4RD, which includes the tau microtubule binding domain (MBD) fused to YFP with the P301S pathogenic mutation. See Figure 5 . Cells in which tau-YFP protein is stably present in an aggregated state (Agg[+]) are obtained by treating these tau-YFP cells with recombinant fibrotic tau mixed with a liposome reagent, so as to inoculate the aggregation of tau-YFP protein stably expressed by these cells. The "seeded" cells are then serially diluted to obtain single cell-derived clones. These clones are then expanded to identify clonal cell lines in which tau-YFP aggregates are stably present in all cells, which grow and are passaged multiple times over time. One of these tau-YFP_Agg[+] clones, Clone_18, is used to produce conditioned medium by collecting culture medium that has been in confluent tau-YFP_Agg[+] cells for four days. Conditioned medium (CM) is then applied to the original biosensor tau-CFP / Tau-YFP cells at a ratio of 3:1CM: fresh culture medium, so that tau aggregation is induced in a small portion of these recipient cells. No liposomes are used. Liposomes were not used in order to make the assay as physiological as possible, and liposomes were not used to induce recipient cells to force / increase tau aggregation. Conditioned media consistently induced FRET in approximately 0.1% of cells, as measured by flow cytometry to assess the percentage of cells producing a FRET signal as a measure of aggregation. Figure 6 In conclusion, tau-YFP_Agg[+] cells cannot generate FRET signals, but they can provide a source of tau seeds.

[0310] Example 2. Genome-wide CRISPR / Cas9 screening to identify genetic modifiers of Tau aggregation

[0311] To reveal tau aggregation-modifying genes as sgRNAs enriched in FRET(+) cells, aggregate-free (Agg[–]) Cas9-expressing tau-CFP / tau-YFP biosensor cells were transduced with two whole-human genome CRISPR sgRNA libraries using a lentiviral delivery method to introduce knockout mutations at each target gene. Figure 4 . Each CRISPR sgRNA library targets 5' constitutive exons for functional knockout, with an average coverage of approximately 3 sgRNAs per gene (a total of 6 gRNAs per gene in the two libraries combined). The read count distribution of each library (i.e., the representation of each gRNA in the library) was normal and similar. sgRNAs were designed to avoid off-target effects by avoiding sgRNAs with two or fewer mismatches with off-target genomic sequences. The library covers 19,050 human genes and 1864 miRNAs, as well as 1000 non-targeting control sgRNAs. The library was transduced with a multiplicity of infection (MOI) of <0.3, with coverage of >300 cells per sgRNA. tau biosensor cells were grown under puromycin selection to select cells that integrated and expressed unique sgRNAs. Puromycin selection was initiated 24 hours after transduction at 1 μg / mL. Five independent screening replicates were used in the primary screening.

[0312] Samples of the complete transduced cell population were collected at cell passages on days 3 and 6 after transduction. After the day 6 passage, cells were grown in conditioned medium to sensitize the cells to seeding activity. On day 10, fluorescence assisted cell sorting (FACS) was used to specifically isolate the FRET[+] cell subpopulation. Figure 7 The screen consisted of five replicate experiments. DNA isolation and PCR amplification of the integrated sgRNA constructs allowed characterization of the sgRNA library by next-generation sequencing (NGS) at each time point.

[0313] Statistical analysis of NGS data allowed the identification of sgRNAs that were enriched in the FRET[+] subpopulation at day 10 across five experiments compared to the sgRNA pools at earlier time points, day 3 and day 6. The concepts of relative abundance and enrichment in NGS analysis are described in Figure 8. The first strategy for identifying potential tau modifiers is to use DNA sequencing to generate sgRNA read counts in each sample using the DESeq algorithm to find sgRNAs that are more abundant on day 10 versus day 3 or day 10 versus day 6, but not on day 6 versus day 3 (fold change (fc) ≥ 1.5 and negative binomial test p < 0.01). Fc ≥ 1.5 means that the ratio of (average of day 10 counts) / (average of day 3 or day 6 counts) is ≥ 1.5. P < 0.01 means that there is no chance of a statistical difference between day 10 and day 3 or day 6 counts < 0.01. The DESeq algorithm is a widely used algorithm for “differential expression analysis of sequence count data”. See, for example, Anders et al. (2010) Genome Biology 11: R106, which is incorporated herein by reference in its entirety for all purposes.

[0314] Specifically, two comparisons were used in each library to identify significant sgRNAs: day 10 versus day 3, and day 10 versus day 6. For each of these four comparisons, the DESeq algorithm was used, and the cutoff thresholds for being considered significant were a fold change ≥ 1.5 and a negative binomial test p < 0.01. Once a significant guide was identified in each of these comparisons for each library, the gene was considered significant if it met one of the following two criteria: (1) at least two sgRNAs corresponding to the gene were considered significant in one comparison (day 10 versus day 3 or day 10 versus day 6); and (2) at least one sgRNA was significant in both comparisons (day 10 versus day 3 and day 10 versus day 6). Using this algorithm, five genes were identified as significant from the first library, and four genes were identified from the second library. See Table 4.

[0315] Table 4: Genes identified using strategy #1.

[0316]

[0317] However, the first strategy requires that the level of read count homogeneity within each experimental group may be too stringent. For the same sgRNA, many factors can produce read count variability between samples within each experimental group (day 3, day 6 or day 10 samples), such as initial virus counts in the screening library, infection or gene editing efficiency, and relative growth rate after gene editing. Therefore, a second strategy was also used based on the positive appearance of guides for each gene in each sample on day 10 (after selection) (read count>30) rather than the exact read count. Given the library size (x), the number of guides per gene (n) and the total number of positive guides in the post-selection sample (m), a formal statistical p-value was calculated to positively observe multiple guides in the post-selection sample (n') ("number" refers to the sgRNA type (i.e., unique guide RNA sequence), not the read count) (p n' =nCn'*(x-n')C(mn) / xCm). The probability that a gene g has n' or more guides by chance is calculated as follows:

[0318]

[0319] The overall enrichment of gene read counts after selection compared to pre-selection was used as an additional parameter for identifying positive genes: (relative abundance = [read count of gene] / [read count of all genes] and enrichment after selection = [relative abundance after selection] / [relative abundance pre-selection]).

[0320] More specifically, the second strategy is a new, more sensitive analysis method for CRISPR positive selection. The goal of CRISPR positive selection is to use DNA sequencing to identify genes whose perturbations performed by sgRNA are related to phenotypes. In order to reduce the noise background, multiple sgRNAs of the same gene and experimental replicates are usually used in these experiments. However, the currently commonly used statistical analysis methods that require a certain degree of homogeneity / consistency between the sgRNAs of the same gene and between technical replicates are not effective. This is because due to many possible reasons (e.g., different infection or gene editing efficiencies, initial virus counts in the screening library, and the presence of other sgRNAs with the same phenotype), these methods cannot handle the huge differences between sgRNAs and the repetitions of the same gene. In contrast, a method that is robust to large changes has been developed. The method is based on the number of positive occurrences of the guide of each gene in a separate experiment, rather than the exact read count of each sgRNA. Given the library size, the number of sgRNAs per gene, and the total number of positive sgRNAs in each experiment, the formal statistical p value is calculated to actively observe the number of sgRNAs in the experimental repetitions. The relative sgRNA sequence read enrichment before and after phenotypic selection was also used as a parameter. The method performed better than the currently widely used methods (including DESeq, MAGECK and others). Specifically, the method comprises the following steps:

[0321] (1) For each experiment, identify any guides present in cells with a positive phenotype.

[0322] (2) At the gene level, calculate the random chance of a guide existing in each experiment: nCn'*(x-n')C(mn) / xCm, where x is the number of guides before phenotypic selection, m is the number of guides after phenotypic selection, n is the number of guides per gene before phenotypic selection, and n' is the number of guides per gene after phenotypic selection. Calculate the overall chance of a guide existing across multiple experiments by multiplying the above calculated probabilities obtained for each experiment.

[0323] (3) Calculate the average enrichment of guides at the gene level: Enrichment score = relative abundance after selection / relative abundance after pre-selection. Relative abundance = guide read count of the gene / read count of all guides.

[0324] (4) Select genes with significantly lower enrichment scores than would exist by random chance and higher than a specific enrichment score.

[0325] Fourteen target genes identified as enriched in FRET[+] cells by two different methods (one or both methods) were selected as the best candidate genes for further validation after visual inspection based on read count data. See Table 5. Thirty individual sgRNAs were tested in the secondary screen for validation. A schematic diagram of the secondary screen is shown in Figure 9 The results are shown in Figure 10 As shown in Figure 2. Multiple tested sgRNAs disrupting BANF1 or PPP2CA increased the sensitivity of cells to form tau aggregates in response to a source of tau seeding activity (conditioned medium). In cells disrupted with either of these two targets, the induction of FRET signal increased 15-20 fold. Disruption of both target genes increased the formation of tau aggregates in response to conditioned medium but not fresh medium. See Figure 2. Figure 11 .

[0326] Table 5: Identified targets.

[0327]

[0328] Additional experiments were then performed with BANF1 and PPP2CA to further validate that targeting each gene promoted tau aggregation. Figure 12 Two different sgRNAs targeting BANF1 were tested and one sgRNA targeting PPP2CA was used. A non-targeting sgRNA was used as a negative control. Four independent lentiviral transductions were performed for each guide RNA on day 0. On day 6, tau was inoculated with conditioned medium in the presence or absence of liposomes, and samples were collected for qRT-PCR. Figure 13 qRT-PCR data are shown in . Each of the two sgRNAs targeting BANF1 reduced BANF1 mRNA expression, and the gRNA targeting PPP2CA reduced PPP2CA expression. On day 10, FACS analysis was performed to assess the induction of FRET signals. Tau aggregation was increased by each of the two sgRNAs targeting BANF1 and the gRNA targeting PPP2CA. See Figure 15 On day 13, samples were collected for western blot analysis. Figure 14 Western blot results are shown in Table 6. The antibodies used are shown in Table 6. Similar to the qRT-PCR experiments evaluating mRNA expression, the expression of barrier to autointegration factor protein (BANF1) protein was reduced by two sgRNAs targeting BANF1, and the expression of serine / threonine-protein phosphatase 2A catalytic subunit alpha (PPP2CA) protein was reduced by sgRNA targeting PPP2CA.

[0329] Table 6: Antibodies used for Western blotting.

[0330] target supplier Catalog Number Dilution for WB BANF1 Abcam ab129074 1:1,000 PPP2CA Proteintech 13482-1-AP 1:1,000 Phospho-tau S356 Abcam ab75603 1:1,000 Phosphorylated tau S262 Abcam ab131354 1:10,000 Histone H3 Protein Technologies 17168-1-AP 1:10,000 Total tau dako A0024 1:150,000

[0331] BANF1 and PPP2CA were further validated as modifiers of tau aggregation by isolating individual BANF1 knockdown clones and individual PPP2CA knockdown clones for validation. Aggregate-free Cas9-expressing tau-CFP / tau-YFP biosensor cells (Agg[–]) were transduced with lentivirus expressing BANF1 sgRNA 1, PPP2CA sgRNA 5, or a non-targeting sgRNA. Serial clonal dilutions were then performed to select individual clones. BANF1 and PPP2CA mRNA levels were assessed by qRT-PCR (TaqMan qRT-PCR assays obtained from Thermo Fisher Scientific, assay IDs Hs00427805_g1 and Hs00427260_m1), and autointegration barrier factor (BANF1) and serine / threonine-protein phosphatase 2A catalytic subunit alpha (PPP2CA) protein levels were assessed by Western blotting. Each BANF1 sgRNA clone had reduced BANF1 mRNA expression (data not shown) and autointegration barrier factor protein (BANF1) protein expression ( Figure 16 ), and each PPP2CA sgRNA clone had reduced PPP2CA mRNA expression (data not shown) and serine / threonine-protein phosphatase 2A catalytic subunit α (PPP2CA) protein expression ( Figure 16 ).

[0332] Tau expression and tau phosphorylation were also assessed in each clone by Western blotting. PPP2CA knockdown increased both phosphorylated tau and tau levels. Figure 17 .

[0333] Next, each clone was inoculated with conditioned medium for 3 days and FRET analysis was performed to assess tau aggregation. Knockdown clones validated BANF1 and PPP2CA as modifiers of tau aggregation. Figure 18 FRET enhancement directly correlated with the extent of gene editing in BANF1 and PPP2CA mutant clones.

[0334] Individual clones were then further characterized by next generation sequencing to determine which modifications had been made to the BANF1 and PPP2CA loci. These modifications are summarized in Table 7 below. Almost all mutant clones contained some percentage of the wild-type allele. The percentage of FRET(+) cells (tau aggregation activity) correlated with the percentage of indels caused by non-homologous end joining at the cleavage site (i.e., tau aggregation was inversely correlated with the percentage of wild-type allele—the lower the percentage of wild-type allele, the higher the percentage of Fret(+) cells). See Figure 16 and Table 7.

[0335] Table 7: Characterization of BANF1 and PPP2CA clones.

[0336]

[0337] We investigated whether BANF1 and PPP2CA participate in the same biological pathway or function using String, a software program based on protein-protein interaction networks. See Szklarczyk et al. (2015), Nucleic Acids Res. 43(Database Special): D447-D452, which is incorporated herein by reference in its entirety for all purposes. Using BANF1 and PPP2CA as input, we discovered a "catalytic" relationship between BANF1 and PPP2CA based on the Reactome pathway. See Figure 23 BANF1 also interacts with several proteins that play important roles in the biology of the nuclear envelope. These targets were tested as potential modifiers of tau aggregation.

[0338] Cas9-expressing tau biosensor cells were transduced with lentiviral vectors containing sgRNAs targeting the genes of interest. The target sequences of these sgRNAs are provided in Table 8. Antibiotic selection was initiated after 24 hours. After one week of culture, conditioned medium (CM) collected after 3 days on confluent tau-YFP (Agg[+]) was applied to the transduced cells as 75% CM / 25% fresh medium, and seeding activity was assessed as the percentage of FRET[+] cells. Specific target knockdown was assessed by qRT-PCR. As expected, disruption of BANF1 or PPP2CA enhanced tau aggregation. Disruption of ANKLE2 also enhanced tau aggregation. See Figure 19 ANKLE2 is the only LEM domain protein that is localized to both the endoplasmic reticulum and the inner nuclear membrane.

[0339] Table 8: Figure 19 and Figure 20 sgRNA target sequences used in .

[0340]

[0341] We then further evaluated genes in the BANF1 / PPP2CA interaction network. Specifically, ANKLE2, EMD, and VRK1 were evaluated. To evaluate genes in the BANF1 / PPP2CA interaction network, sgRNAs targeting ANKLE2, EMD, or VRK1 were tested in non-targeted clones 4-1 and 4-19. The percentage of FRET[+] cells was assessed after 3 days in conditioned medium. Disruption of genes in the BANF1 / PPP2CA interaction network revealed ANKLE2 as a modifier of tau aggregation (see Figure 20 ) and VRK1 acts as an enhancer of BANF1-induced aggregation (data not shown).

[0342] This further supports the link between tau aggregation and the BANF1 / PPP2CA pathway that regulates nuclear envelope integrity. Consistent with this, laminin staining revealed abnormal nuclear envelopes in BANF1 and ANKLE2 knockdown tau biosensor cell clones expressing dCas9-KRAB relative to non-targeted clones, and similar results were observed in BANF1 and ANKLE2 mutant Cas9 tau biosensor cell clones relative to non-targeted clones (data not shown). BANF1 interacts with two major components of the nuclear lamina, laminin A / C and laminin B1. Recent studies have linked abnormal morphology of the nuclear lamina to neurodegenerative processes in FTD and AD. Disruption of the laminin nuclear skeleton in the Drosophila tauopathy model causes heterochromatin relaxation and neuronal cell death. Laminin pathology is conserved in postmortem AD brains. After transduction of tau biosensor cells expressing dCas9-KRAB, knockdown clones of BANF1 and ANKLE2 were isolated. Laminin staining revealed abnormal nuclear envelopes in these BANF1 and ANKLE2 knockdown clones relative to clones transduced and selected for non-targeting sgRNAs (data not shown). The striking abnormalities in nuclear lamina shape are similar to those recently reported in FTD neurons.

[0343] Abnormalities in the nuclear pore complex (NPC) and resulting nucleocytoplasmic transport (NCT) defects contribute to the pathogenesis in mouse tauopathy models. Disruption of the NPC and functional nuclear transport can also be present in cells containing hyperphosphorylated tau in human neurons, as well as in mouse and cellular tauopathy models. Nuclear pore and nuclear envelope defects may be a common mechanism of neurodegeneration in ALS / FTD and Huntington's disease.

[0344] Immunostaining for the GTP-binding nuclear protein Ran (Ran), Ran GTPase-activating protein 1 (RanGAP1), and regulator of chromosome condensation (RCC1) can be used to investigate disruption of NCTs in cells. The Ran protein gradient is important for active transport through the NPC. Most Ran protein is located within the nucleus, primarily containing Ran-GTP. RanGAP1 is localized to the cytoplasm of the NPC and converts Ran-GTP to Ran-GDP. RCC1 is localized to the nucleus and converts Ran-GDP to Ran-GTP.

[0345] To determine subcellular localization, neurons were stained for tau, phosphorylated tau, Ran, RanGAP1, RCC1, the nuclear pore complex protein Nup98-Nup96 (Nup98) (which interacts with phosphorylated tau) and the nuclear pore glycoprotein p62 (Nup62), a core component of the NPC that can form hydrogels, as well as TAR DNA-binding protein 43 (TDP-43) (N-terminus), the RNA-binding protein FUS (FUS), and heterogeneous nuclear ribonucleoprotein A1 (HNRNPA1). Mislocalization of TDP-43, HNRNPA1, and FUS from the nucleus to the cytoplasm is associated with ALS / FTD.

[0346] This verification confirms the value of the initial screening method in identifying genes, which can regulate the sensitivity of cells to tau inoculation when exposed to an external source of tau inoculation activity. Therefore, the target identified by screening may be a related target of tau pathology cell-to-cell transmission in the context of neurodegenerative diseases, and will be further explored. In FRET biosensor cell lines, the whole genome screening of tau aggregation modifiers identified multiple targets (BANF1, PPP2CA and ANKLE2) involved in nuclear envelope integrity. BANF1 and ANKLE2 mutant clones showed a significant abnormality in nuclear lamina shape, which is similar to the abnormality reported in FTD neurons and Alzheimer's disease postmortem neurons.

[0347] Example 3: Targeting Ankle2, Banf1, and Ppp2ca in mouse cells

[0348] In order to verify the putative tau-modifying genes in the mouse tau disease model, it is first necessary to verify the CRISPR tools that can modify the expression of these genes in mouse cells. sgRNAs targeting the mouse genes Ankle2, Banf1, and Ppp2ca and non-targeting (NT) control sgRNAs that do not match any genomic sequence were tested in mouse ES cells. The expression of these genes was subsequently assessed by qRT-PCR (using TaqMan assays from Thermo Fisher Scientific, normalized to the expression of the housekeeping gene Drosha).

[0349] In the first experiment, the following plasmids containing sgRNA (obtained from GenScript) were packaged into lentivirus (LV) and transduced into a Cas9-ready mouse ES cell line (2600A-A3), in which Cas9 expression was driven from the Rosa26 locus. The sgRNA target sequences are provided in Table 9.

[0350] Table 9: Mouse sgRNA target sequences.

[0351]

[0352] Expression was selected by puromycin selection (1.5 μg / mL). Mouse ES cells were transduced with individual LVs at an MOI of 600 in the presence of polybrene (64 μg / mL). Cells were grown feeder-free for 10 days under puromycin selection. RNA was collected from the cells and target gene expression was assessed by qRT-PCR. In this experiment, targeting cells with Banf1 g2 or Banf1 g3 resulted in a specific reduction of Banf1 expression by approximately 35% relative to NT controls. See Figure 21A Likewise, targeting cells with Ppp2ca g2 resulted in a specific decrease in Ppp2ca expression of approximately 65% ​​relative to NT controls. Figure 21B .

[0353] To further evaluate sgRNAs targeting these mouse genes, the following plasmids (obtained from Kingstar Technologies) were packaged into LV and transduced in F1H4 mouse ES cells, which are wild-type mouse ES cells under a hybrid genetic background (50% C57BL / 6NTac 50% 129S6 / SvEvTac). The pLentiCRISPR-v2 plasmid construct contains both the Cas9 coding sequence and the sequence of a specific sgRNA in a single "all-in-one" (AIO) vector, where the expression of both Cas9 and sgRNA can be selected by puromycin. As an additional negative control, sgRNAs targeting Banf1 or Ppp2ca in the pLentiGuide-puro vector (containing sgRNA but lacking Cas9) were also used. The vectors are shown in Table 10.

[0354] Table 10: Mouse sgRNA target sequences.

[0355]

[0356] In this experiment, mouse ES cells were again transduced with LV at an MOI of 600 in the presence of polybrene and grown for 10 days under puromycin selection. RNA was extracted and qRT-PCR analysis was performed (TaqMan qRT-PCR assays from Thermo Fisher Scientific, assay IDs Mm01205802_m1, Mm01231514_g1, and Mm00479816_m1). Confirming the results of the previous experiment, Ppp2ca g2 again caused a specific and dramatic reduction in Ppp2ca expression, in this case >80%, confirming the specific effect of this sgRNA. See Figure 22C More significantly, in this experiment, selective expression of several sgRNAs (Ankle2 g1, Ankle2 g3, Banf1 g1, Banf1 g2, Banf1 g3, and Ppp2ca g3) caused extensive cell death and loss of all cells, making RNA collection impossible. Figures 22A-22C . Notably, transduction with the NT control sgRNA in the all-in-one vector did not cause cell death, indicating that Cas9 expression from this construct is not inherently toxic to the cells. Furthermore, expression of Banf1- and Ppp2ca-targeting sgRNAs in the pLentiGuide-puro vector (lacking Cas9) likewise did not cause cell death. Therefore, it was concluded that Cas9-mediated activity of these sgRNAs, which caused specific destruction of their target genes, was the cause of cell death in these cells, suggesting that the sgRNAs may be effective in hitting their targets. This result is not entirely surprising, as BANF1 and PPP2CA have been reported to be essential for the viability and / or pluripotency of ES cells.

[0357] Example 4: Improving tauopathy models

[0358] Tau inclusions are the pathological hallmark of tauopathies, including AD, progressive supranuclear palsy, corticobasal degeneration, Pick's disease, and frontotemporal dementia with Parkinson's syndrome associated with chromosome 17 (FTDP-17). Tau inclusions are composed of various forms of aggregated, post-translationally modified tau, including highly phosphorylated, cleaved, and acetylated species. Next, we set out to develop a new screening platform that reproduces tau hyperphosphorylation and tau aggregation in vitro in neurons derived from human induced pluripotent stem (iPS) cells (e.g., iCELL GABA neurons), neurons derived from mouse embryonic stem (ES) cells, and primary mouse neurons (isolated mouse cortical neurons). For human iPS-derived neurons, human iPS-derived neurons that are already postmitotic and ready to use are used. According to the method for Cells were thawed and plated according to the established protocol for GABANeurons.

[0359] First, several constructs were generated to express human tau cDNA (1N4R) under the control of the human synapsin 1 promoter. These constructs were codon-optimized for use with either human or mouse neurons. Seven constructs were generated: (1) pSynapsin1-GFP (SEQ ID NO:74); (2) pSynapsin1-hTAU WT (SEQ ID NO:75); (3) pSynapsin1-hTAU WT-GFP (SEQ ID NO:76); (4) pSynapsin1-GFP-hTAU WT (SEQ ID NO:77); (5) pSynapsin1-hTAU 3MUT (A152T, P301L, S320F) (SEQ ID NO:78); (6) pSynapsin1-hTAU3MUT (A152T, P301L, S320F)-GFP (SEQ ID NO:79); and (7) pSynapsin1-GFP-hTAU 3MUT (A152T, P301L, S320F) (SEQ ID NO:80). The synapsin 1 gene promoter confers neuronal-specific expression. These constructs can be packaged in lentivirus or adeno-associated virus for delivery. The DNA and protein sequences of wild-type tau 1N4R are shown in SEQ ID NOs: 81 and 82, respectively. The DNA and protein sequences of 3MUT Tau 1N4R (A152T, P301L, S320F) are shown in SEQ ID NOs: 83 and 84, respectively.

[0360] The TaqMan assay is designed to specifically detect transgenic expression of human tau cDNA in human or mouse neurons. Using specific primers and probes for detecting codon-optimized sequences of wild-type (WT) and mutant (MUT) TAU cDNA, quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed to detect transgenic human TAU. According to the manufacturer's protocol (Zymo Research), total RNA was isolated using the Direct-zol RNA Miniprep plus kit. According to the manufacturer's protocol (Invitrogen), total RNA was treated with DNase using a Turbo DNA-free kit and diluted to 20 ng / μL. Reverse transcription (RT) and PCR were performed using the Quantitect probe RT-PCR kit (Qiagen) in a one-step reaction. The qRT-PCR reaction contained 2 μL RNA and 8 μL mixture (containing RT-PCR Master mixture, ROX dye, RT-mixture and gene-specific primer-probe mixture) in a final volume of 10 μL. After reverse transcription, the PCR reaction solution was reconstituted to a final volume of 8 μL (containing 3 μL cDNA and 5 μL PCR mix, probe and gene-specific primers). Unless otherwise specified, the final primer and probe concentrations were 0.5 μM and 0.25 μM, respectively. TM qPCR and qRT-PCR were performed on a 7 real-time PCR detection system (Thermo Fisher Scientific). PCR reactions were performed in quadruplicate in an optical 384-well plate under the following conditions: 95°C for 10 minutes and 95°C for 3 seconds, 60°C for 30 seconds (with an RT step of 45°C for 10 minutes followed by 95°C for 10 minutes) and 2-step cycles (95°C for 5 seconds, 60°C for 30 seconds) for 45 cycles. The sequences of the primers and probes used in each analysis are provided in Table 11 below.

[0361] Table 11: Primers and probes for human tau.

[0362]

[0363] Neurons were plated in 6-well plates (about 300,000 cells / well) for biochemical assays and in 96-well plates (about 15,000 neurons / well) for immunostaining, followed by high-content imaging and image analysis. Neurons were transduced with human tau constructs alone or in combination with an all-in-one virus (SEQ ID NO: 85) expressing a Cas9 transgene under a specific promoter (e.g., EF1α promoter) and BANF1, PPP2CA, ANKLE2, or non-targeting sgRNA (e.g., under the control of the U6 promoter). The DNA and protein sequences of Cas9 are shown in SEQ ID NOs: 86 and 87, respectively.

[0364] After about one week of culture, the cells were exposed to 50% conditioned medium tau-YFP (Agg[+]) and maintained in culture. Finally, the cells in the 96-well plates were fixed and immunostained with specific antibodies to detect the following: tau hyperphosphorylation and tau aggregation (AT8 and S356 antibodies for tau hyperphosphorylation detected by subcellular localization (axonal, somatodendritic compartments)); abnormal morphology of the nuclear lamina and impaired nucleocytoplasmic transport (laminin A / C, laminin B1, FUS, TDP-43, HNRPA1, NPC and NPT); and cell survival (DAPI / NeuN / MAP2) in cells transduced with BANF1, PPP2CA or ANKLE2 sgRNA compared to non-targeting sgRNA. Thioflavin S was also used to stain and visualize β-amyloid structures. Neuronal function (neurite retraction, synaptic loss, abnormal calcium homeostasis and imbalance of neurotransmitter release) was also assessed. The high-content imager Phenix Opera (96-well format) was used for cell viability assays (DAPI / NeuN / MAP2), phosphorylated tau assays (AT8, S356), and Thioflavin S assays. Cells in 6-well plates were harvested for cell fractionation assays and revealed the presence of insoluble and mislocalized tau.

[0365] We then set out to develop a new screening platform that reproduces tau hyperphosphorylation and tau aggregation in vitro in mouse brain slice cultures. Brain slice assays are well known. See, for example, Polleux et al. (2002), Sci. STKE 2002 (136) p19 (doi: 10.1126 / stke.2002.136.p19), which is incorporated herein by reference in its entirety for all purposes.

[0366] Mouse neonatal brain slice cultures were transduced with an all-in-one lentivirus or adeno-associated virus (inducing expression of Cas9 and specific sgRNA) or antisense oligonucleotides (ASOs), and the brain slice cultures were exposed to conditioned medium tau-YFP (Agg[+]) and maintained in culture. Finally, the slices were fixed to reveal tau hyperphosphorylation and tau aggregation as described above. Slices were also collected to reveal the presence of insoluble tau.

[0367] We then set out to develop a screening platform that reproduces tau hyperphosphorylation and tau aggregation in vivo. Adult PS19 mice (6-8 weeks) were injected intracranially (stereotactic surgery for injection in the hippocampus and other brain regions or intracerebroventricular injection) or intrathecally (in the spinal cord) with: (1) lipid nanoparticles (LNPs) with Cas9 mRNA and sgRNA; (2) LNPs with siRNA; (3) all-in-one lentivirus (LV) (Cas9+sgRNA); (4) all-in-one adeno-associated virus (AAV) (Cas9+sgRNA); or (5) antisense oligonucleotides (ASOs). PS19 mice (available at jax.org / strain / 008169, which is incorporated herein by reference in its entirety for all purposes) were used.

[0368] sgRNA, siRNA, and antisense oligonucleotides targeted the genes Banf1, Ppp2ca, Ankle2 or consisted of non-targeting control sequences. After sectioning and staining the brain, animals were sacrificed to reveal tau hyperphosphorylation (AT8 staining) and tau aggregation as described above. The brain was also collected to reveal the presence of insoluble and mislocalized tau (thioflavin S staining).

[0369] Since BANF1 / PPP2CA / ANKLE2 are essential in mitotic cells, it was hypothesized that a knockdown strategy would provide a better understanding of this novel link to tau aggregation. The transcriptionally repressive dCas9-KRAB CRISPRi system was introduced into tau biosensor cells and specific sgRNAs were transduced targeting the promoter region immediately before the transcription start site. Figure 24A and 24B ΔBANF1 and ΔANKLE2 knockdown clones were isolated by clonal serial dilution, which could induce tau aggregation after treatment with conditioned medium tau-YFP (Agg[+]). Figure 25 This indicates that CRISPRi dCas9-KRAB ΔBANF1 and ΔANKLE2 targeted knockdown clones can induce tau aggregation.

[0370] Next, ΔBANF1 and ΔANKLE2 clones were subjected to cell fractionation, which enabled the detection of tau and phosphorylated tau (serine 356) in the insoluble fraction two days later using tau-YFP Agg[+] cell lysates, providing functional evidence of a link between ΔBANF1 and ΔANKLE2 clones with tau insolubility and phosphorylation at serine 356. Figure 26 .

[0371] RNA was also collected from ΔBANF1 and ΔANKLE2 clones and two control groups (non-targeted and parental). RNA-seq analysis characterized the significant differences between the ΔBANF1 and ΔANKLE2 knockdown clones and the two control groups. RNA-seq analysis of CRISPRi knockdown clones revealed that the ΔBANF1 knockdown samples were more different from the samples of the ΔANKLE2 or non-targeted groups. Figure 27 Ten transcriptional differences between these groups were identified (data not shown). Expression of these ten target genes was reduced in both ΔBANF1 and ΔANKLE2 knockdown clones.

[0372] The cDNA complementation approach was then performed by adding BANF1 cDNA (with luciferase cDNA as a control). Figure 28 A schematic diagram of the cDNA complementation experimental design is shown in FIG.

[0373] BANF1 cDNA was subcloned into the pLVX-EF1a plasmid and packaged for lentiviral transduction of the cDNA in ΔBANF1 knockdown cells, ΔANKLE2 knockdown cells, and non-targeting control cells. Specifically, the cDNA was tested to rescue the increased tau aggregation in ΔBANF1 and ΔANKLE2 knockdown cells. Cells expressing the cDNA were treated with tau-YFP Agg[+] cell lysate for two days. The results showed that BANF1 cDNA could rescue tau aggregation in ΔBANF1 and ΔANKLE2 knockdown cells, providing another functional link between BANF1 / ANKLE2 and tau aggregation. See Figure 29 .

[0374] Next, primary cultures of mouse cortical neurons were used to study the effects of ΔBANF1 and ΔANKLE2 mutations on tau phosphorylation, misfolding, and insolubility in postmitotic cells. Cortical neurons were transduced with All_In_One lentivirus (AIO_LV, LV_Cas9_sgRNA) expressing Cas9 and sgRNA (Banf1_g3, Ankle2_g3, or Ppp2ca_g2) that had previously been verified to be effective in mouse ESC. Two days after plating with AIO_LV, primary mouse cortical neurons were transduced and maintained in culture for 14 days for fluorescent immunostaining and western blot studies (using ProteinSimple's WES technology). For immunofluorescence, primary C57BL / 6 mouse cortical neurons (commercially available) were plated in 96-well poly-D-lysine-coated plates at a density of 25,000 neurons per well at day 0. On day 2, neurons were transduced with AIO-LV targeting Banf1_g3 or Ankle2_g3 or Ppp2ca_g2 or non-targeting gRNA control at a multiplicity of infection of 40,000 viral genomes per neuron. The culture medium was replaced every 3-4 days. On day 16, neurons were fixed with 4% paraformaldehyde (PFA) solution and studied by fluorescent immunostaining. For western blot studies, 400,000 neurons were plated in poly-D lysine 6-wells and transduced with AIO-LV (25,000 VG per neuron). The culture medium was replaced every 3-4 days. Neurons were collected after 14 days of culture and prepared for protein studies.

[0375] After 14 days, neurons transduced with AIO_LV were also collected to determine the extent of gene editing (INDEL%). It was found that gene editing using Banf1_g3 sgRNA was consistently higher than gene editing using Ankle2_g3. See Table 12.

[0376] Table 12: Gene editing.

[0377]

[0378] For fluorescent immunostaining studies, we focused on abnormal phenotypes that have been associated with tauopathies, such as tau hyperphosphorylation (in the somatodendritic domain), nuclear pore complex integrity (Nup98 mislocalization), and impaired nucleocytoplasmic transport (reduced Ran / RanGAP1 nucleocytoplasmic ratio).

[0379] Opera Phenix high content confocal imager (Perkin Elmer (Perkin Elmer)) was used in combination with Harmony software (Perkin Elmer) to carry out the automation and unbiased imaging analysis method of image data analysis. For each experiment, six biological replicates were averaged, and about 70 visual fields were imaged in each well and analyzed for each biological replicate, and fluorescently conjugated secondary antibodies were used to mark primary antibodies. Secondary antibodies were conjugated with Alexa-488nm (green), -568nm (orange) and -647nm (far red). 4', 6-diamidino-2-phenylindole (DAPI) was used for nuclear staining.

[0380] For each field of view, first DAPI + The number of neurons was counted. Secondly, the fluorescence intensity of microtubule-associated protein-2 (Map2), a neuronal marker of the somatodendritic domain, was used to segment the cytoplasm containing the somatodendritic domain and count the number of healthy neurons. Third, the fluorescence intensity of different cell markers (phosphorylated tau S356, phosphorylated tau AT8 (S202, T205), total tau, Nup98, LaminB1, Ran, RanGAP1) was determined in several cell compartments containing the cytoplasm, the nucleus, and the perinuclear region around the nucleus. Fourth, the average fluorescence intensity in each well (biological replicates) was calculated, which included the average of all cells in all fields of view in each well.

[0381] Image analysis methods were developed to quantify marker intensities in the following combinations: phosphorylated tau and total tau; phosphorylated tau and LaminB1 or nuclear pore complex (NPC); and nuclear-to-cytoplasmic ratio and phosphorylated tau intensity for Nup98, Ran, and RanGAP1.

[0382] Cortical neurons from ΔBanf1 and ΔAnkle2 mutant mice showed similar Map2 somatodendritic staining intensity as non-targeted cortical neurons. Figure 30A and 30B This suggests that disruption of Banf1 and Ankle2 does not affect neuronal survival in postmitotic cortical neurons after 14 days.

[0383] Phospho-tau (serine 356) staining was increased in the somatodendritic compartment of ΔBanf1 (p-value < 0.004) and ΔAnkle2 (p-value < 0.001) mutant cortical neurons compared to non-targeted cortical neurons. Figure 31AThis is reminiscent of observations in Alzheimer's disease, where the protein tau forms hyperphosphorylated aggregates in the somatodendritic domain. Notably, the increased intensity of phosphorylated tau staining was found to be particularly prominent in the perinuclear region. Figure 31B Data are presented as mean ± standard error of the mean (SEM), and the number of biological replicates for each experimental condition is represented as dots. When comparisons were made between two samples (i.e., ΔBanf1 versus non-targeted cortical neurons), data were analyzed by unpaired Student's t-test.

[0384] As a control experiment, we determined that total tau staining intensity was not increased in the somatodendritic compartment of ΔBanf1 and ΔAnkle2 mutants compared to non-targeted cortical neurons. Figures 32A-32C .

[0385] like Figures 33A-33E As shown, phosphorylated tau AT8 (S202, T205) staining was increased in the somatodendritic compartment of ΔBanf1 and ΔAnkle2 mutant neurons compared with non-targeted cortical neurons.

[0386] Pathological tau can impair nuclear import and export in tau-overexpressing transgenic mice and human AD brain tissue. Phosphorylated tau disrupts the diffusion barrier function of the nuclear pore complex. The nuclear pore complex protein nucleoporin Nup98 accumulates in the cell bodies of some neurons with tangles and can promote tau aggregation in vitro. The subcellular localization of Nup98 was investigated and found to be enriched in the somata of ΔBanf1 and ΔAnkle2 mutants compared with non-targeted cortical neurons. The nuclear to cytoplasmic ratio of Nup98 is reduced. See Figures 34A-34D .

[0387] Additionally, the reduced nuclear-to-cytoplasmic ratio of Ran and RanGAP1 compared to non-targeted cortical neurons provides evidence for impaired active trafficking of nuclear pore complexes in ΔBanf1 and ΔAnkle2 mutants. Figures 35A-35D .

[0388] Mouse primary cortical neurons were transduced two days after plating with AIO_LV_NT, AIO_LV_Banf1_g3, and AIO_LV_Ppp2ca_g2 and maintained in culture for 14 days for fluorescent phosphorylated tau immunostaining (at serine 356 and serine 202 / threonine 205, also known as AT8 antibody) and misfolded tau detection. Aggregate Detection Kit ADR is a robust and quantitative method for detecting misfolded protein aggregates (aggresomes) that has been optimized for antibody colocalization studies. The dye specifically inserts into the cross-β ridges of the quaternary protein structure, which is often found in misfolded and aggregated proteins, which inhibits the rotation of the dye and leads to strong fluorescence. At day 16, neurons were fixed with 4% paraformaldehyde (PFA) solution and studied for fluorescent immunostaining. Increased phosphorylation of tau on serine 356 in the somatodendritic compartment of ΔBanf1 (p value < 0.026) and ΔPpp2ca (p value < 0.0087) was revealed in mutant cortical neurons compared to non-targeted cortical neurons. Figure 38D Notably, the increased phosphorylated tau staining intensity was found to be particularly prominent in the cytoplasmic region immediately surrounding the nucleus, defined as the perinuclear region (ΔBanf1 p-value < 0.002 and ΔPpp2ca p-value < 0.04). Figure 38B Similarly, increased phosphorylated tau (serine 202 / threonine 205) in the perinuclear region was observed in mutant cortical neurons of ΔBanf1 (p value < 0.026) and ΔPpp2ca (p value < 0.0087) compared to non-targeted cortical neurons. Figure 39B and 39D . Data are expressed as mean ± standard error of the mean (SEM), and the number of biological replicates for each experimental condition is represented as dots. When comparisons were made between two samples (i.e., ΔBanf1 vs. nontargeted cortical neurons), data were analyzed by unpaired Student's t-test. Increased tau phosphorylation on serine 356 (Pearson correlation (ρ) = 0.85–R squared = 0.72 for ΔBanf1; ρ = 0.92–R squared = 0.85 for ΔPpp2ca) and on serine 202 and threonine 205 (ρ = 0.86–R squared = 0.74 for ΔBanf1; ρ = 0.94–R squared = 0.89 for ΔPpp2ca) compared to nontargeted correlated with increased detection of misfolded tau in the soma of mutant neurons. See Figures 38A-38F and 39A-39F. Correlation analysis was performed using Pearson's parametric test. P values ​​< 0.05 were considered significant. Disruption of Banf1, Ankle2, or Ppp2ca has been shown to increase tau phosphorylation and misfolding.

[0389] Next, experiments were performed using tau seeding in mutant cortical neurons using brain cell lysates from mice transduced with tau cDNA 3MUT or P301S. When tau-cDNA 3MUT was added, phosphorylated tau (serine 356) staining was increased in the somatodendritic domains of ΔBanf1 and ΔAnkle2 mutants compared to non-targeted cortical neurons. Figures 36A-36DHowever, when tau-cDNA 3MUT was added, total tau staining was not increased in the somatodendritic domains of ΔBanf1 and ΔAnkle2 mutants compared to non-targeted cortical neurons. Figures 37A-37C .

[0390] Organotypic brain slice cultures were then used to validate Banf1, Ankle2, and Ppp2ca as genetic modifiers of tau aggregation. Organotypic brain slice cultures were prepared from wild-type C57BL / 6 mice and cultured on day 0 for 10 10 Transduction was performed with LV-All-In-One (AIO) constructs containing Cas9_Banf1_g3, Cas9_Ankle2_g3, Cas9_Ppp2ca_g2, and Cas9_non-targeting_g3 under VG. Alternatively, organotypic brain slice cultures were prepared from wild-type C57BL / 6 mice and transduced with ASOs targeting Ankle2, Ppp2ca, or Banf1 on day 0. On day 14, samples were collected for NGS analysis (INDEL%), phosphorylated tau staining (S356 and AT8), and ThS staining of misfolded tau.

[0391] Stereotaxic AIO-LV injection in the mouse hippocampus was then used to validate Banf1, Ankle2, and Ppp2ca as genetic modifiers for tau aggregation. A total of 24 C57BL / 6 wild-type animals were injected (NT, AIO Cas9_Banf1, AIOCas9_Ankle2, and AIO Cas9_Ppp2ca). Two animals were removed 7 days after injection (for each case). NGS revealed significant editing (such as INDEL% approximately>15%; data not shown). Afterwards, the animals were removed for western blot analysis (phosphorylated tau, misfolded tau, total tau) and tau seeding assays of hippocampal lysates in tau biosensor cells were performed. dCas9-KRAB was then used to add gRNA targeting Banf1, Ankle2, or Ppp2ca to stereotaxic AIO-LV injection in the mouse hippocampus to validate Banf1, Ankle2, and Ppp2ca as genetic modifiers for tau aggregation.

[0392] Stereotaxic injection of ASOs into the mouse hippocampus was then used to validate Banf1, Ankle2, and Ppp2ca as genetic modifiers of tau aggregation. Examples of ASOs targeting mouse Banf1 are shown in Table 13. Examples of ASOs targeting mouse Ppp2ca are shown in Table 14. Examples of ASOs targeting mouse Ankle2 are shown in Table 15. The parent antisense RNA sequences used to design the ASOs in Tables 13-15 are shown in Table 16.

[0393] Table 13: mBanf1 ASOs.

[0394]

[0395]

[0396] * indicates a phosphorothioate bond; 2MOEr indicates a 2'-methoxyethyl-modified base; i indicates an internal base; 5 / 3 indicates bases at the 5' and 3' ends

[0397] Table 14: mPpp2ca ASO.

[0398]

[0399]

[0400]

[0401]

[0402] * indicates a phosphorothioate bond; 2MOEr indicates a 2'-methoxyethyl-modified base; i indicates an internal base; 5 / 3 indicates bases at the 5' and 3' ends

[0403] Table 15: mAnkle2 ASOs.

[0404]

[0405]

[0406]

[0407]

[0408]

[0409] * indicates a phosphorothioate bond; 2MOEr indicates a 2'-methoxyethyl-modified base; i indicates an internal base; 5 / 3 indicates bases at the 5' and 3' ends

[0410] Table 16: Parental antisense RNA sequences used for design of mBanf1, mPpp2ca and mAnkle2 ASOs.

[0411]

[0412]

[0413]

[0414]

[0415] All ASOs were designed as 5-10-5 gapmers with a phosphorothioate backbone. 2' methoxyethyl modified bases were used in the wings (5 nucleotides from both ends) and the 10 nucleotide core had unmodified DNA bases. Figure 40 . The primary screen was first performed in NSC34 cells at a 100 nM ASO concentration. All ASOs were transfected using lipofectamineRNAiMAx, and cells were incubated for 72 hours before harvesting RNA for TaqMan qPCR. Knockdown of total mRNA of the target was compared to untreated cells. Based on the primary screening data, hits for the secondary screen were selected at 50 nM and 5 nM. Transfection and TaqMan qPCR analysis were performed in a similar manner to the primary screen. Figure 41A The preliminary screening results for mAnkle2 are shown in Figure 41B and 41C The results of the secondary screening for mAnkle2 are shown in FIG. Figure 42A The preliminary screening results for mPpp2ca are shown in Figure 42B and 42C The results of the secondary screening for mPpp2ca are shown in . Figure 43 The preliminary screening results for mBanf1 are shown in Figure 2. As shown in these results, ASOs targeting Banf1, Ankle2, or Ppp2ca have been validated in NSC34 cells and showed >75% reduction in expression.

[0416] In summary, three approaches have been developed to validate Banf1, Ankle2, and Ppp2ca as regulators of tau aggregation in vitro (primary cultures of mouse cortical neurons), ex vivo (organotypic brain slice cultures), and in vivo (stereotaxic injections into the hippocampus). It is proposed that disruption of Banf1, Ankle2, and / or Ppp2ca could be used to develop novel mouse tauopathy models. Sequence Listing <110> Regeneron Pharmaceuticals, Inc. <120> Tauopathies Model <130> 057766 / 548673 <150> US 62 / 861,553 <151> 2019-06-14 <160> 324 <170> PatentIn version 3.5 <210> 1 <211> 20 <212> DNA <213> Homo sapiens <400> 1 ttgcaggcct atgttgtcct 20 <210> 2 <211> 20 <212> DNA <213> Homo sapiens <400> 2 gcttcggatg ccttcgagag 20 <210> 3 <211> 20 <212> DNA <213> Homo sapiens <400> 3 tttcctccag cttcttgccc 20 <210> 4 <211> 20 <212> DNA <213> Homo sapiens <400> 4 cgccaacgcc aagcagtccc 20 <210> 5 <211> 20 <212> DNA <213> Homo sapiens <400> 5 gagctctaga caccaacgtg 20 <210> 6 <211> 20 <212> DNA <213> Homo sapiens <400> 6 caagcagctg tccgagtccc 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthesis <400> 7 cttcgacgcc atcgtgctca 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthesis <400> 8 cgcctctcac gtgtaggctt 20 <210> 9 <211> 20 <212> DNA <213> Homo sapiens <400> 9 tttaaggaac ccagtgacaa 20 <210> 10 <211> 20 <212> DNA <213> Homo sapiens <400> 10 ggccttgaac acagttccgt 20 <210> 11 <211> 20 <212> DNA <213> Homo sapiens <400> 11 tagagttgtc atctttcaac 20 <210> 12 <211> 20 <212> DNA <213> Homo sapiens <400> 12 aaggagccgc ccctgtacta 20 <210> 13 <211> 20 <212> DNA <213> Homo sapiens <400> 13 tccggccagg atcaactcgt 20 <210> 14 <211> 20 <212> DNA <213> Homo sapiens <400> 14 tacttacggc tatatattct 20 <210> 15 <211> 20 <212> DNA <213> Homo sapiens <400> 15 aagaacgctt tctgttcaag 20 <210> 16 <211> 20 <212> DNA <213> Homo sapiens <400> 16 gtgaaatacg gagtgaatcc 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthesis <400> 17 atagccgccg ctcattactt 20 <210> 18 <211> 20 <212> DNA <213> House mouse (Mus musculus) <400> 18 atgaagacct cttccgagaa 20 <210> 19 <211> 20 <212> DNA <213> House mouse (Mus musculus) <400> 19 atcccggcca ggctccccac 20 <210> 20 <211> 20 <212> DNA <213> House mouse (Mus musculus) <400> 20 ttggtgacgt cctgagcaag 20 <210> twenty one <211> 20 <212> DNA <213> House mouse (Mus musculus) <400> twenty one ccgagcactc gatcgcctac 20 <210> twenty two <211> 20 <212> DNA <213> House mouse (Mus musculus) <400> twenty two acatcgaacc tcttgaacgt 20 <210> twenty three <211> 20 <212> DNA <213> House mouse (Mus musculus) <400> twenty three gggatatctc ctcggggagc 20 <210> twenty four <211> 20 <212> DNA <213> House mouse (Mus musculus) <400> twenty four gatacaggtc aacaacgtag 20 <210> 25 <211> 20 <212> DNA <213> House mouse (Mus musculus) <400> 25 ttcgacagct ttccgcagct 20 <210> 26 <211> 20 <212> DNA <213> House mouse (Mus musculus) <400> 26 ccagaaccaa ttagatatcg 20 <210> 27 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> synthesis <400> 27 uugcaggccu auguuguccu 20 <210> 28 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> synthesis <400> 28 gcuucggaug ccuucgagag 20 <210> 29 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> synthesis <400> 29 uuuccuccag cuucuugccc 20 <210> 30 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> synthesis <400> 30 cgccaacgcc aagcaguccc 20 <210> 31 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> synthesis <400> 31 gagcucuaga caccaacgug 20 <210> 32 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> synthesis <400> 32 caagcagcug uccgaguccc 20 <210> 33 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> synthesis <400> 33 cuucgacgcc aucgugcuca 20 <210> 34 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> synthesis <400> 34 cgccucucac guguaggcuu 20 <210> 35 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> synthesis <400> 35 uuuaaggaac ccagugacaa 20 <210> 36 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> synthesis <400> 36 ggccuugaac acaguuccgu 20 <210> 37 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> synthesis <400> 37 uagaguuguc aucuuucaac 20 <210> 38 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> synthesis <400> 38 aaggagccgc cccuguacua 20 <210> 39 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> synthesis <400> 39 uccggccagg aucaacucgu 20 <210> 40 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> synthesis <400> 40 uacuuacggc uauauauucu 20 <210> 41 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> synthesis <400> 41 aagaacgcuu ucuguucaag 20 <210> 42 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> synthesis <400> 42 gugaaauacg gagugaaucc 20 <210> 43 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> synthesis <400> 43 auagccgccg cucauuacuu 20 <210> 44 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> synthesis <400> 44 augaagaccu cuuccgagaa 20 <210> 45 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> synthesis <400> 45 aucccggcca ggcuccccac 20 <210> 46 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> synthesis <400> 46 uuggugacgu ccugagcaag 20 <210> 47 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> synthesis <400> 47 ccgagcacuc gaucgccuac 20 <210> 48 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> synthesis <400> 48 acaucgaacc ucuugaacgu 20 <210> 49 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> synthesis <400> 49 gggauaucuc cucggggagc 20 <210> 50 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> synthesis <400> 50 gauacagguc aacaacguag 20 <210> 51 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> synthesis <400> 51 uucgacagcu uuccgcagcu 20 <210> 52 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> synthesis <400> 52 ccagaaccaa uuagauaucg 20 <210> 53 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> synthesis <400> 53 agaatctgaa gcatcaaccg g 21 <210> 54 <211> twenty two <212> DNA <213> Artificial Sequence <220> <223> synthesis <400> 54 ggtttgtaaa cgatctgcac tg 22 <210> 55 <211> twenty four <212> DNA <213> Artificial Sequence <220> <223> synthesis <400> 55 aatatcaagc acgtccctgg aggc 24 <210> 56 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> synthesis <400> 56 ccgaaaatct caagcatcag c 21 <210> 57 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthesis <400> 57 acacaatctg tacgcttccg 20 <210> 58 <211> twenty four <212> DNA <213> Artificial Sequence <220> <223> synthesis <400> 58 tgcacgttag acaggtccag cttc 24 <210> 59 <211> twenty four <212> DNA <213> Artificial Sequence <220> <223> synthesis <400> 59 ggcggtaagg tccaaattat aaac 24 <210> 60 <211> twenty two <212> DNA <213> Artificial Sequence <220> <223> synthesis <400> 60 ggtttgtaaa cgatctgaac gg 22 <210> 61 <211> twenty four <212> DNA <213> Artificial Sequence <220> <223> synthesis <400> 61 aatgtccaaa gcaagtgtgg cagc 24 <210> 62 <211> twenty two <212> DNA <213> Artificial Sequence <220> <223> synthesis <400> 62 ggtagtacag agaacctgaa gc 22 <210> 63 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthesis <400> 63 ctttgctccc acatttgctc 20 <210> 64 <211> twenty four <212> DNA <213> Artificial Sequence <220> <223> synthesis <400> 64 cggtggtggt aaggtccaga tcat 24 <210> 65 <211> 16 <212> RNA <213> Artificial Sequence <220> <223> synthesis <400> 65 guuuuagagc uaugcu 16 <210> 66 <211> 67 <212> RNA <213> Artificial Sequence <220> <223> synthesis <400> 66 agcauagcaa guuaaaauaa ggcuaguccg uuaucaacuu gaaaaagugg caccgagucg 60 gugcuuu 67 <210> 67 <211> 77 <212> RNA <213> Artificial Sequence <220> <223> synthesis <400> 67 guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc cguuaucaac uugaaaaagu 60 ggcaccgagu cggugcu 77 <210> 68 <211> 82 <212> RNA <213> Artificial Sequence <220> <223> synthesis <400> 68 guuggaacca uucaaaacag cauagcaagu uaaaauaagg cuaguccguu aucaacuuga 60 aaaaguggca ccgagucggu gc 82 <210> 69 <211> 76 <212> RNA <213> Artificial Sequence <220> <223> synthesis <400> 69 guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc cguuaucaac uugaaaaagu 60 ggcaccgagu cggugc 76 <21...

Claims

1. An animal tissue or animal cell population, wherein the animal cells are not embryonic stem (ES) cells, comprising: (a) an exogenous human microtubule-associated protein tau coding sequence in a plurality of cells, wherein the exogenous human microtubule-associated protein tau comprises a tauopathy-related mutation; and (b) (i) a genetic modification, wherein the genetic modification is in one or both of BANF1 and ANKLE2, and the genetic modification reduces the expression of one or both of BANF1 and ANKLE2 in the plurality of cells; and / or (ii) one or more agents, wherein the one or more agents reduce the expression of one or both of BANF1 and ANKLE2 in the plurality of cells, wherein the animal tissue or animal cell population comprises the plurality of cells, wherein the plurality of cells are neuronal cells, wherein at least one sign or symptom of tauopathy in the animal tissue or animal cell population is increased as compared to an animal tissue or animal cell population that does not comprise the genetic modification or does not comprise the one or more agents, and wherein the at least one sign or symptom comprises: (I) tau hyperphosphorylation or tau aggregation; and / or (II) an increase in tau and / or phosphorylated tau (phospho-tau) in the insoluble fraction after cell fractionation; an increase in phosphorylated tau in the somatodendritic compartment of neurons; an increase in phosphorylated tau in the perinuclear region of neurons; a decrease in the nucleocytoplasmic ratio of the nuclear pore complex protein Nup98-Nup96 in neurons; a decrease in the nucleocytoplasmic ratio of the GTP-binding nuclear protein Ran in neurons; or a decrease in the nucleocytoplasmic ratio of Ran GTPase-activating protein 1 in neurons.

2. The animal tissue or animal cell population according to claim 1, wherein the exogenous human microtubule-associated protein tau coding sequence is genomically integrated.

3. The animal tissue or animal cell population according to claim 1, wherein the exogenous human microtubule-associated protein tau coding sequence comprises a complementary DNA sequence.

4. The animal tissue or animal cell population according to claim 1, wherein the exogenous human microtubule-associated protein tau coding sequence is codon-optimized for expression in the animal tissue or animal cell population.

5. The animal tissue or animal cell population according to claim 1, wherein the exogenous human microtubule-associated protein tau coding sequence is operably linked to a heterologous promoter.

6. The animal tissue or animal cell population according to claim 5, wherein the heterologous promoter is a murine prion protein promoter.

7. The animal tissue or animal cell population according to claim 5, wherein the heterologous promoter is a neuron-specific promoter.

8. The animal tissue or animal cell population according to claim 7, wherein the neuron-specific promoter is a synapsin-1 promoter.

9. The animal tissue or animal cell population according to claim 1, wherein the tauopathy-related mutation comprises the P301S mutation.

10. The animal tissue or animal cell population according to claim 1, wherein the microtubule-associated protein tau comprises the sequence shown in SEQ ID NO:

98.

11. The animal tissue or animal cell population according to claim 1, wherein the tauopathy-related mutation comprises the A152T / P301L / S320F triple mutation.

12. The animal tissue or animal cell population according to claim 11, wherein the microtubule-associated protein tau coding sequence comprises the sequence shown in SEQ ID NO: 83 or the microtubule-associated protein tau comprises the sequence shown in SEQ ID NO:

84.

13. The animal tissue or animal cell population according to any one of claims 1-12, wherein the animal tissue or the animal cell population comprises the gene modification.

14. The animal tissue or animal cell population according to any one of claims 1-12, wherein the animal tissue or the animal cell population comprises the one or more agents.

15. The animal tissue or animal cell population according to any one of claims 1-12, wherein the one or more agents comprise a nuclease agent targeting BANF1 or ANKLE2 or a nucleic acid encoding the nuclease agent.

16. The animal tissue or animal cell population according to claim 15, wherein the nuclease agent is a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), or a clustered regularly interspaced short palindromic repeat (CRISPR)-associated protein and a guide RNA.

17. The animal tissue or animal cell population according to claim 16, wherein the nuclease agent is the CRISPR-associated protein and the guide RNA.

18. The animal tissue or animal cell population according to claim 17, wherein the CRISPR-associated protein is Cas9 protein.

19. The animal tissue or animal cell population according to claim 17 or 18, wherein the CRISPR-associated protein is a catalytically active Cas protein.

20. The animal tissue or animal cell population according to any one of claims 1-12, wherein the one or more agents comprise a transcriptional repressor targeting BANF1 or ANKLE2 or a nucleic acid encoding the transcriptional repressor.

21. The animal tissue or animal cell population according to claim 20, wherein the transcriptional repressor comprises a guide RNA and an inactive Cas protein fused to a transcriptional repressor domain.

22. The animal tissue or animal cell population according to claim 21, wherein the transcriptional repressor domain is a Krüppel-associated box (KRAB) domain.

23. The animal tissue or population of animal cells according to any one of claims 17, 18, 21, and 22, wherein the guide RNA targets murine Banf1 and comprises any one of the sequences shown in SEQ ID NOs: 44 - 46, or the guide RNA targets human BANF1 and comprises any one of the sequences shown in SEQ ID NOs: 27 - 30.

24. The animal tissue or population of animal cells according to any one of claims 17, 18, 21, and 22, wherein the guide RNA targets murine Ankle2 and comprises any one of the sequences shown in SEQ ID NOs: 50 - 52, or the guide RNA targets human ANKLE2 and comprises the sequence shown in SEQ ID NO:

38.

25. The animal tissue or population of animal cells according to any one of claims 1 - 12, wherein the one or more agents comprise an antisense oligonucleotide or an RNAi agent targeting BANF1 or ANKLE2, or a nucleic acid encoding the antisense oligonucleotide or the RNAi agent.

26. The animal tissue or population of animal cells according to claim 25, wherein the antisense oligonucleotide comprises the sequence shown in any one of SEQ ID NOs: 105 - 126, 169 - 236, or 279 - 324, or a modified form thereof.

27. The animal tissue or population of animal cells according to claim 26, wherein the antisense oligonucleotide comprises the sequence shown in any one of the following, or a modified form thereof: SEQ ID NOs: 105, 106, 110 - 113, 115, 120 - 122, 124, 125, 169, 171 - 173, 175, 177, 181 - 184, 187, 194, 197, 211, 213, 215, 216, 220 - 223, 225, 230 - 232, 234, 235, 279, 281 - 283, 285, 287, 291 - 294, 297, 304, 307, 321, and 323.

28. The animal tissue or population of animal cells according to claim 26 or 27, wherein the antisense oligonucleotide comprises one or more phosphorothioate linkages and / or one or more 2'-methoxyethyl-modified bases.

29. The animal tissue or population of animal cells according to claim 28, wherein the antisense oligonucleotide comprises a phosphorothioate backbone, a 5' wing composed of 2'-methoxyethyl-modified bases, a central 10-nucleotide core of DNA, and a 3' wing composed of 2'-methoxyethyl-modified bases.

30. The population of animal cells according to any one of claims 1 - 12, 16 - 18, 21, 22, 26, 27, and 29, wherein the cells are in vivo.

31. The population of animal cells according to any one of claims 1 - 12, 16 - 18, 21, 22, 26, 27, and 29, wherein the cells are in vitro.

32. The population of animal cells according to claim 31, wherein the cells are human cells.

33. An animal cell population according to any one of claims 1 - 12, 16 - 18, 21, 22, 26, 27, and 29, wherein the cells are rodent cells.

34. An animal cell population according to claim 33, wherein the rodent cells are mouse cells or rat cells.

35. An animal cell population according to claim 34, wherein the rodent cells are mouse cells.

36. An animal cell population according to any one of claims 1 - 12, 16 - 18, 21, 22, 26, 27, 29, and 32, wherein the neuronal cells include neurons derived from human induced pluripotent stem cells.

37. An animal cell population according to any one of claims 1 - 12, 16 - 18, 21, 22, 26, 27, 29, 34, and 35, wherein the neuronal cells include neurons derived from mouse embryonic stem cells.

38. An animal cell population according to any one of claims 1 - 12, 16 - 18, 21, 22, 26, 27, 29, 34, and 35, wherein the neuronal cells include primary mouse neurons.

39. An animal tissue according to any one of claims 1 - 12, 16 - 18, 21, 22, 26, 27, and 29, wherein the tissue is in vivo.

40. An animal tissue according to any one of claims 1 - 12, 16 - 18, 21, 22, 26, 27, and 29, wherein the tissue is ex vivo.

41. An animal tissue according to any one of claims 1 - 12, 16 - 18, 21, 22, 26, 27, and 29, wherein the animal is a rodent.

42. An animal tissue according to claim 41, wherein the rodent is a mouse or a rat.

43. An animal tissue according to claim 42, wherein the rodent is the mouse.

44. An animal tissue according to any one of claims 1 - 12, 16 - 18, 21, 22, 26, 27, 29, 42, and 43, wherein the tissue is nervous system tissue.

45. An animal tissue according to claim 44, wherein the tissue includes brain slices.

46. A method for evaluating a candidate therapeutic agent for treating tauopathies, the method comprising: (a) administering a candidate agent to a non - human animal, animal tissue, or animal cell population, the non - human animal, animal tissue, or animal cell population comprising: (i) an exogenous human microtubule - associated protein tau coding sequence in a plurality of cells, wherein the exogenous human microtubule - associated protein tau includes tauopathy - related mutations; and (ii) (A) a genetic modification, wherein the genetic modification is in one or both of BANF1 and ANKLE2, and the genetic modification reduces the expression of one or both of BANF1 and ANKLE2 in the plurality of cells; and / or (B) one or more agents, wherein the one or more agents reduce the expression of one or both of BANF1 and ANKLE2 in the plurality of cells; (b) Perform one or more assays to determine whether the candidate agent has an effect on one or more signs or symptoms associated with the tauopathy; and (c) Identify the candidate agent that has an effect on one or more signs or symptoms associated with the tauopathy as a therapeutic agent candidate, wherein the non-human animal, the animal tissue, or the animal cell population comprises the plurality of cells, and wherein the plurality of cells are neuronal cells, wherein the one or more signs or symptoms include: (I) Tau hyperphosphorylation or tau aggregation; and / or (II) An increase in tau and / or phosphorylated tau (phospho-tau) in the insoluble fraction after cell fractionation; an increase in phosphorylated tau in the somatodendritic compartment of neurons; an increase in phosphorylated tau in the perinuclear region of neurons; a decrease in the nucleocytoplasmic ratio of the nuclear pore complex protein Nup98-Nup96 in neurons; a decrease in the nucleocytoplasmic ratio of the GTP-binding nuclear protein Ran in neurons; or a decrease in the nucleocytoplasmic ratio of Ran GTPase-activating protein 1 in neurons.

47. The method according to claim 46, wherein the candidate agent is administered to the non-human animal.

48. The method according to claim 46, wherein the candidate agent is administered ex vivo to the animal tissue.

49. The method according to claim 46, wherein the candidate agent is administered in vitro to the animal cell population.

50. A method of preparing a non-human animal, animal tissue, or animal cell population, the non-human animal, animal tissue, or animal cell population comprising: (i) An exogenous human microtubule-associated protein tau coding sequence in a plurality of cells, wherein the exogenous human microtubule-associated protein tau comprises a tauopathy-related mutation; and (ii) (A) A genetic modification, wherein the genetic modification is in one or both of BANF1 and ANKLE2, and the genetic modification reduces the expression of one or both of BANF1 and ANKLE2 in the plurality of cells; and / or (B) One or more agents, wherein the one or more agents reduce the expression of one or both of BANF1 and ANKLE2 in the plurality of cells, the method comprising: (a) Introducing the one or more agents into a non-human animal, animal tissue, or animal cell population comprising the exogenous human microtubule-associated protein tau coding sequence, wherein the exogenous human microtubule-associated protein tau comprises a tauopathy-related mutation; and (b) Screening the non-human animal, the animal tissue, or the animal cell population to confirm the presence of the one or more agents, wherein the non-human animal, the animal tissue, or the animal cell population comprises the plurality of cells, and wherein the plurality of cells are neuronal cells, wherein, relative to a non-human animal, animal tissue, or population of animal cells that does not comprise the gene modification or does not comprise the one or more agents, at least one sign or symptom of tauopathy in the non-human animal, the animal tissue, or the population of animal cells is increased, and wherein the at least one sign or symptom comprises: (I) tau hyperphosphorylation or tau aggregation; and / or (II) an increase in tau and / or phosphorylated tau (phospho-tau) in the insoluble fraction after cell fractionation; an increase in phosphorylated tau in the somatodendritic compartment of neurons; an increase in phosphorylated tau in the perinuclear region of neurons; a decrease in the nucleocytoplasmic ratio of the nuclear pore complex protein Nup98-Nup96 in neurons; a decrease in the nucleocytoplasmic ratio of the GTP-binding nuclear protein Ran in neurons; or a decrease in the nucleocytoplasmic ratio of Ran GTPase-activating protein 1 in neurons.

51. A method of producing a non-human animal, animal tissue, or population of animal cells, the non-human animal, animal tissue, or population of animal cells comprising: (i) an exogenous human microtubule-associated protein tau coding sequence in a plurality of cells, wherein the exogenous human microtubule-associated protein tau comprises a tauopathy-associated mutation; and (ii) (A) a gene modification, wherein the gene modification is in one or both of BANF1 and ANKLE2, and the gene modification reduces the expression of one or both of BANF1 and ANKLE2 in the plurality of cells; and / or (B) one or more agents, wherein the one or more agents reduce the expression of one or both of BANF1 and ANKLE2 in the plurality of cells, the method comprising: (a) introducing into a non-human animal, animal tissue, or population of animal cells: (i) an exogenous human microtubule-associated protein tau coding sequence, wherein the exogenous human microtubule-associated protein tau comprises a tauopathy-associated mutation; and (ii) the one or more agents, wherein the one or more agents reduce the expression of one or both of BANF1 and ANKLE2; and (b) screening the non-human animal, the animal tissue, or the population of animal cells to confirm the presence of the one or more agents and the exogenous human microtubule-associated protein tau coding sequence, wherein the non-human animal, the animal tissue, or the population of animal cells comprises the plurality of cells, wherein the plurality of cells are neuronal cells, wherein, relative to a non-human animal, animal tissue, or population of animal cells that does not comprise the gene modification or does not comprise the one or more agents, at least one sign or symptom of tauopathy in the non-human animal, the animal tissue, or the population of animal cells is increased, and wherein the at least one sign or symptom comprises: (I) tau hyperphosphorylation or tau aggregation; and / or (II) After cellular fractionation, there is an increase in tau and / or phosphorylated tau (phospho-tau) in the insoluble fraction; an increase in phosphorylated tau in the somatodendritic compartment of neurons; an increase in phosphorylated tau in the perinuclear region of neurons; a decrease in the nucleocytoplasmic ratio of the nuclear pore complex protein Nup98-Nup96 in neurons; a decrease in the nucleocytoplasmic ratio of the GTP-binding nuclear protein Ran in neurons; or a decrease in the nucleocytoplasmic ratio of Ran GTPase-activating protein 1 in neurons.

52. The method according to claim 51, wherein the exogenous human microtubule-associated protein tau coding sequence is delivered by an adeno-associated virus, a lentivirus, or a lipid nanoparticle.

53. The method according to any one of claims 50 to 52, wherein the one or more agents are delivered by an adeno-associated virus, a lentivirus, or a lipid nanoparticle.

54. The method according to any one of claims 50 to 52, wherein the method is for preparing the non-human animal, and the one or more agents are administered to the non-human animal by intrathecal injection, intracranial injection, or intraventricular injection.

55. The method according to claim 54, wherein the one or more agents are administered to the non-human animal by stereotaxic injection into the brain.

56. The method according to claims 46 and 50 - 52, wherein the exogenous human microtubule-associated protein tau coding sequence is genomically integrated.

57. The method according to claims 46 and 50 - 52, wherein the exogenous human microtubule-associated protein tau coding sequence comprises a complementary DNA sequence.

58. The method according to claims 46 and 50 - 52, wherein the exogenous human microtubule-associated protein tau coding sequence is codon-optimized for expression in the non-human animal, the animal tissue, or the animal cell population.

59. The method according to claims 46 and 50 - 52, wherein the exogenous human microtubule-associated protein tau coding sequence is operably linked to a heterologous promoter.

60. The method according to claim 59, wherein the heterologous promoter is the murine prion protein promoter.

61. The method according to claim 59, wherein the heterologous promoter is a neuron-specific promoter.

62. The method according to claim 61, wherein the neuron-specific promoter is the synapsin-1 promoter.

63. The method according to any one of claims 46, 50 - 52, and 60 - 62, wherein the tauopathy-related mutation comprises the P301S mutation.

64. The method according to any one of claims 46, 50 - 52, and 60 - 62, wherein the microtubule-associated protein tau comprises the sequence shown in SEQ ID NO:

98.

65. The method according to any one of claims 46, 50 - 52, and 60 - 62, wherein the tauopathy - related mutation includes the A152T / P301L / S320F triple mutation.

66. The method according to claim 65, wherein the microtubule - associated protein tau coding sequence includes the sequence shown in SEQ ID NO:83 or the microtubule - associated protein tau includes the sequence shown in SEQ ID NO:

84.

67. The method according to any one of claims 46, 50 - 52, 60 - 62, and 66, wherein the non - human animal, the animal tissue, or the population of animal cells includes the gene modification.

68. The method according to any one of claims 46, 50 - 52, 60 - 62, and 66, wherein the non - human animal, the animal tissue, or the population of animal cells includes the one or more agents.

69. The method according to any one of claims 46, 50 - 52, 60 - 62, and 66, wherein the one or more agents include a nuclease agent targeting BANF1 or ANKLE2 or a nucleic acid encoding the nuclease agent.

70. The method according to claim 69, wherein the nuclease agent is a zinc - finger nuclease (ZFN), a transcription activator - like effector nuclease (TALEN), or a clustered regularly interspaced short palindromic repeats - associated protein and a guide RNA.

71. The method according to claim 70, wherein the nuclease agent is the clustered regularly interspaced short palindromic repeats - associated protein and the guide RNA.

72. The method according to claim 71, wherein the clustered regularly interspaced short palindromic repeats - associated protein is a Cas9 protein.

73. The method according to claim 71 or 72, wherein the clustered regularly interspaced short palindromic repeats - associated protein is a catalytically active Cas protein.

74. The method according to any one of claims 46, 50 - 52, 60 - 62, and 66, wherein the one or more agents include a transcriptional repressor targeting BANF1 or ANKLE2 or a nucleic acid encoding the transcriptional repressor.

75. The method according to claim 74, wherein the transcriptional repressor includes a guide RNA and an inactive Cas protein fused to a transcriptional repressor domain.

76. The method according to claim 75, wherein the transcriptional repressor domain is a Krüppel - associated box (KRAB) domain.

77. The method according to any one of claims 71, 72, 75, and 76, wherein the guide RNA targets mouse Banf1 and includes any one of the sequences shown in SEQ ID NO:44 - 46 or the guide RNA targets human BANF1 and includes any one of the sequences shown in SEQ ID NO:27 - 30.

78. The method according to any one of claims 71, 72, 75, and 76, wherein the guide RNA targets mouse Ankle2 and comprises any one of the sequences shown in SEQ ID NOs: 50 - 52, or the guide RNA targets human ANKLE2 and comprises the sequence shown in SEQ ID NO:

38.

79. The method according to any one of claims 46, 50 - 52, 60 - 62, and 66, wherein the one or more agents comprise an antisense oligonucleotide or an RNAi agent targeting BANF1 or ANKLE2, or a nucleic acid encoding the antisense oligonucleotide or the RNAi agent.

80. The method according to claim 79, wherein the antisense oligonucleotide comprises the sequence shown in any one of SEQ ID NOs: 105 - 126, 169 - 236, or 279 - 324, or a modified form thereof.

81. The method according to claim 80, wherein the antisense oligonucleotide comprises the sequence shown in any one of the following, or a modified form thereof: SEQ ID NOs: 105, 106, 110 - 113, 115, 120 - 122, 124, 125, 169, 171 - 173, 175, 177, 181 - 184, 187, 194, 197, 211, 213, 215, 216, 220 - 223, 225, 230 - 232, 234, 235, 279, 281 - 283, 285, 287, 291 - 294, 297, 304, 307, 321, and 323.

82. The method according to claim 80 or 81, wherein the antisense oligonucleotide comprises one or more phosphorothioate linkages and / or one or more 2'-methoxyethyl-modified bases.

83. The method according to claim 82, wherein the antisense oligonucleotide comprises a phosphorothioate backbone, a 5'-wing composed of 2'-methoxyethyl-modified bases, a central 10-nucleotide core of DNA, and a 3'-wing composed of 2'-methoxyethyl-modified bases.

84. The method according to any one of claims 46, 50 - 52, 60 - 62, 66, 70 - 72, 75, 76, 80, 81, and 83, wherein the population of animal cells is in vivo.

85. The method according to any one of claims 46, 50 - 52, 60 - 62, 66, 70 - 72, 75, 76, 80, 81, and 83, wherein the population of animal cells is in vitro.

86. The method according to claim 85, wherein the cells are human cells.

87. The method according to any one of claims 46, 50 - 52, 60 - 62, 66, 70 - 72, 75, 76, 80, 81, and 83, wherein the cells are rodent cells.

88. The method according to claim 87, wherein the rodent cells are mouse cells or rat cells.

89. The method according to claim 88, wherein the rodent cells are mouse cells.

90. The method according to any one of claims 46, 50 - 52, 60 - 62, 66, 70 - 72, 75, 76, 80, 81, and 83, wherein the neuronal cells comprise neurons derived from human induced pluripotent stem cells.

91. The method according to any one of claims 46, 50 - 52, 60 - 62, 66, 70 - 72, 75, 76, 80, 81, and 83, wherein the neuronal cells comprise neurons derived from mouse embryonic stem cells.

92. The method according to any one of claims 46, 50 - 52, 60 - 62, 66, 70 - 72, 75, 76, 80, 81, and 83, wherein the neuronal cells comprise primary mouse neurons.

93. The method according to any one of claims 46, 50 - 52, 60 - 62, 66, 70 - 72, 75, 76, 80, 81, and 83, wherein the tissue is in vivo.

94. The method according to any one of claims 46, 50 - 52, 60 - 62, 66, 70 - 72, 75, 76, 80, 81, and 83, wherein the tissue is ex vivo.

95. The method according to any one of claims 46, 50 - 52, 60 - 62, 66, 70 - 72, 75, 76, 80, 81, and 83, wherein the animal tissue is rodent tissue.

96. The method according to claim 95, wherein the rodent is a mouse or a rat.

97. The method according to claim 96, wherein the rodent is the mouse.

98. The method according to any one of claims 46, 50 - 52, 60 - 62, 66, 70 - 72, 75, 76, 80, 81, 83, 96, and 97, wherein the tissue is nervous system tissue.

99. The method according to claim 98, wherein the tissue comprises brain slices.

100. The method according to any one of claims 46, 50 - 52, 60 - 62, 66, 70 - 72, 75, 76, 80, 81, and 83, wherein the gene modification is in multiple neuronal cells of the non - human animal, and / or wherein the one or more agents are in multiple neuronal cells of the non - human animal, wherein the multiple neuronal cells are located in the hippocampus.

101. The method according to any one of claims 46, 50 - 52, 60 - 62, 66, 70 - 72, 75, 76, 80, 81, and 83, wherein the non - human animal is a rodent.

102. The method according to claim 101, wherein the rodent is a mouse or a rat.

103. The method according to claim 102, wherein the rodent is the mouse.

104. The method according to claim 103, wherein the mouse is a PS19 transgenic mouse, and the PS19 transgenic mouse further comprises the gene modification; and / or further comprises the one or more agents.

105. A method for accelerating or exacerbating tau aggregation in a non-human animal, an animal tissue, or a population of animal cells of a tauopathy model, the method comprising introducing one or more agents into the non-human animal, the animal tissue, or the population of animal cells of the tauopathy model, wherein the one or more agents reduce the expression of one or both of BANF1 and ANKLE2, wherein the non-human animal, the animal tissue, or the population of animal cells of the tauopathy model comprises an exogenous human microtubule-associated protein tau coding sequence, and wherein the exogenous human microtubule-associated protein tau comprises a tauopathy-related mutation.

106. The method according to claim 105, wherein the exogenous human microtubule-associated protein tau coding sequence is genomically integrated.

107. The method according to claim 105 or 106, wherein the exogenous human microtubule-associated protein tau coding sequence comprises a complementary DNA sequence.

108. The method according to claim 105 or 106, wherein the exogenous human microtubule-associated protein tau coding sequence is codon-optimized for expression in the non-human animal, the animal tissue, or the population of animal cells.

109. The method according to claim 105 or 106, wherein the exogenous human microtubule-associated protein tau coding sequence is operably linked to a heterologous promoter.

110. The method according to claim 109, wherein the heterologous promoter is a murine prion protein promoter.

111. The method according to claim 109, wherein the heterologous promoter is a neuron-specific promoter.

112. The method according to claim 111, wherein the neuron-specific promoter is a synapsin-1 promoter.

113. The method according to any one of claims 105, 106, and 110-112, wherein the tauopathy-related mutation comprises a P301S mutation.

114. The method according to claim 113, wherein the exogenous human microtubule-associated protein tau comprises the sequence shown in SEQ ID NO:

98.

115. The method according to any one of claims 105, 106, and 110-112, wherein the tauopathy-related mutation comprises an A152T / P301L / S320F triple mutation.

116. The method according to claim 115, wherein the exogenous human microtubule-associated protein tau coding sequence comprises the sequence shown in SEQ ID NO: 83 or the exogenous human microtubule-associated protein tau comprises the sequence shown in SEQ ID NO:

84.

117. The method according to any one of claims 105, 106, 110-112, 114, and 116, wherein the one or more agents comprise a nuclease agent targeting BANF1 or ANKLE2 or a nucleic acid encoding the nuclease agent.

118. The method according to claim 117, wherein the nuclease agent is a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), or a clustered regularly interspaced short palindromic repeat (CRISPR)-associated protein and a guide RNA.

119. The method according to claim 118, wherein the nuclease agent is the CRISPR-associated protein and the guide RNA.

120. The method according to claim 119, wherein the CRISPR-associated protein is a Cas9 protein.

121. The method according to claim 119 or 120, wherein the CRISPR-associated protein is a catalytically active Cas protein.

122. The method according to any one of claims 105, 106, 110-112, 114, and 116, wherein the one or more agents comprise a transcriptional repressor that targets BANF1 or ANKLE2 or a nucleic acid encoding the transcriptional repressor.

123. The method according to claim 122, wherein the transcriptional repressor comprises a guide RNA and a catalytically inactive Cas protein fused to a transcriptional repressor domain.

124. The method according to claim 123, wherein the transcriptional repressor domain is a Krüppel-associated box (KRAB) domain.

125. The method according to any one of claims 119, 120, 123, and 124, wherein the guide RNA targets murine Banf1 and comprises any one of the sequences shown in SEQ ID NOs: 44-46 or the guide RNA targets human BANF1 and comprises any one of the sequences shown in SEQ ID NOs: 27-30.

126. The method according to any one of claims 119, 120, 123, and 124, wherein the guide RNA targets murine Ankle2 and comprises any one of the sequences shown in SEQ ID NOs: 50-52 or the guide RNA targets human ANKLE2 and comprises the sequence shown in SEQ ID NO:

38.

127. The method according to any one of claims 105, 106, 110-112, 114, and 116, wherein the one or more agents comprise an antisense oligonucleotide or an RNAi agent that targets BANF1 or ANKLE2 or a nucleic acid encoding the antisense oligonucleotide or the RNAi agent.

128. The method according to claim 127, wherein the antisense oligonucleotide comprises the sequence shown in any one of SEQ ID NOs: 105-126, 169-236, or 279-324 or a modified form thereof.

129. The method according to claim 128, wherein the antisense oligonucleotide comprises a sequence shown in any of the following or a modified form thereof: SEQ ID NO: 105, 106, 110-113, 115, 120-122, 124, 125, 169, 171-173, 175, 177, 181-184, 187, 194, 197, 211, 213, 215, 216, 220-223, 225, 230-232, 234, 235, 279, 281-283, 285, 287, 291-294, 297, 304, 307, 321 and 323.

130. The method according to claim 128 or 129, wherein the antisense oligonucleotide comprises one or more phosphorothioate bonds and / or one or more 2'-methoxyethyl-modified bases.

131. The method according to claim 130, wherein the antisense oligonucleotide comprises a phosphorothioate backbone, a 5'-wing composed of 2'-methoxyethyl-modified bases, a central 10-nucleotide core of DNA, and a 3'-wing composed of 2'-methoxyethyl-modified bases.

132. The method according to any one of claims 105, 106, 110-112, 114, 116, 118-120, 123, 124, 128, 129 and 131, wherein the one or more agents are delivered by adeno-associated virus, lentivirus or lipid nanoparticles.

133. The method according to any one of claims 105, 106, 110-112, 114, 116, 118-120, 123, 124, 128, 129 and 131, wherein the one or more agents are administered to the non-human animal by intrathecal injection, intracranial injection or intraventricular injection.

134. The method according to claim 133, wherein the one or more agents are administered to the non-human animal by stereotaxic injection into the brain.

135. The method according to any one of claims 105, 106, 110-112, 114, 116, 118-120, 123, 124, 128, 129 and 131, wherein at least one sign or symptom of tauopathy in the non-human animal, the animal tissue or the animal cell population is increased as compared to a non-human animal, animal tissue or animal cell population that does not comprise the one or more agents.

136. The method according to claim 135, wherein the at least one sign or symptom comprises tau hyperphosphorylation or tau aggregation.

137. The method according to claim 135, wherein the at least one sign or symptom comprises: After cell fractionation, tau and / or phosphorylated tau in the insoluble fraction increases; phosphorylated tau in the somatodendritic compartment of neurons increases; phosphorylated tau in the perinuclear region of neurons increases; the nucleocytoplasmic ratio of the nuclear pore complex protein Nup98-Nup96 in neurons decreases; the nucleocytoplasmic ratio of the GTP-binding nuclear protein Ran (Ran) in neurons decreases; or the nucleocytoplasmic ratio of Ran GTPase-activating protein 1 in neurons decreases.

138. The method according to any one of claims 105, 106, 110-112, 114, 116, 118-120, 123, 124, 128, 129, 131, 136, and 137, wherein the cell is in vivo.

139. The method according to any one of claims 105, 106, 110-112, 114, 116, 118-120, 123, 124, 128, 129, 131, 136, and 137, wherein the cell is in vitro.

140. The method according to claim 139, wherein the cell is a human cell.

141. The method according to any one of claims 105, 106, 110-112, 114, 116, 118-120, 123, 124, 128, 129, 131, 136, and 137, wherein the cell is a rodent cell.

142. The method according to claim 141, wherein the rodent cell is a mouse cell or a rat cell.

143. The method according to claim 142, wherein the rodent cell is a mouse cell.

144. The method according to any one of claims 105, 106, 110-112, 114, 116, 118-120, 123, 124, 128, 129, 131, 136, 137, 142, and 143, wherein the cell comprises a neuronal cell.

145. The method according to claim 144, wherein the neuronal cell comprises neurons derived from human induced pluripotent stem cells.

146. The method according to claim 144, wherein the neuronal cell comprises neurons derived from mouse embryonic stem cells.

147. The method according to claim 144, wherein the neuronal cell comprises primary mouse neurons.

148. The method according to any one of claims 105, 106, 110-112, 114, 116, 118-120, 123, 124, 128, 129, 131, 136, and 137, wherein the tissue is in vivo.

149. The method according to any one of claims 105, 106, 110-112, 114, 116, 118-120, 123, 124, 128, 129, 131, 136, and 137, wherein the tissue is ex vivo.

150. A method according to any one of claims 105, 106, 110 - 112, 114, 116, 118 - 120, 123, 124, 128, 129, 131, 136 and 137, wherein the animal tissue is rodent tissue.

151. The method according to claim 150, wherein the rodent tissue is mouse tissue or rat tissue.

152. The method according to claim 150, wherein the animal tissue is mouse tissue.

153. A method according to any one of claims 105, 106, 110 - 112, 114, 116, 118 - 120, 123, 124, 128, 129, 131, 136, 137, 151 and 152, wherein the tissue is nervous system tissue.

154. The method according to claim 153, wherein the tissue comprises brain slices.

155. A method according to any one of claims 105, 106, 110 - 112, 114, 116, 118 - 120, 123, 124, 128, 129, 131, 136 and 137, wherein the non - human animal is a rodent.

156. The method according to claim 155, wherein the rodent is a mouse or a rat.

157. The method according to claim 156, wherein the rodent is the mouse.

158. The method according to claim 157, wherein the mouse is a PS19 transgenic mouse, and the PS19 transgenic mouse further comprises the one or more agents.

159. A non - human animal genome comprising an exogenous human microtubule - associated protein tau coding sequence and a genetic modification, wherein the genetic modification is in one or both of Banf1 and Ankle2, and the genetic modification reduces the expression of one or both of Banf1 and Ankle2, and wherein the microtubule - associated protein tau comprises a tau - proteinopathy - related mutation.

160. The non - human animal genome according to claim 159, wherein the exogenous human microtubule - associated protein tau coding sequence comprises a complementary DNA sequence.

161. The non - human animal genome according to claim 159 or 160, wherein the exogenous human microtubule - associated protein tau coding sequence is codon - optimized for expression in the non - human animal.

162. The non - human animal genome according to claim 159 or 160, wherein the exogenous human microtubule - associated protein tau coding sequence is operably linked to a heterologous promoter.

163. The non - human animal genome according to claim 162, wherein the heterologous promoter is a mouse prion protein promoter.

164. The non - human animal genome according to claim 162, wherein the heterologous promoter is a neuron - specific promoter.

165. The non - human animal genome according to claim 164, wherein the neuron - specific promoter is a synapsin - 1 promoter.

166. The non-human animal genome according to any one of claims 159, 160, and 163-165, wherein the tauopathy-related mutation includes the P301S mutation.

167. The non-human animal genome according to claim 166, wherein the microtubule-associated protein tau comprises the sequence shown in SEQ ID NO:

98.

168. The non-human animal genome according to any one of claims 159, 160, and 163-165, wherein the tauopathy-related mutation includes the A152T / P301L / S320F triple mutation.

169. The non-human animal genome according to claim 168, wherein the microtubule-associated protein tau coding sequence comprises the sequence shown in SEQ ID NO: 83 or the microtubule-associated protein tau comprises the sequence shown in SEQ ID NO:

84.

170. The non-human animal genome according to any one of claims 159, 160, 163-165, 167, and 169, wherein at least one sign or symptom of tauopathy in the non-human animal comprising the non-human animal genome is increased as compared to a non-human animal that does not comprise the gene modification.

171. The non-human animal genome according to claim 170, wherein the at least one sign or symptom in the non-human animal comprising the non-human animal genome comprises tau hyperphosphorylation or tau aggregation. The non-human animal genome according to claim 170, wherein said at least one physical sign or symptom of the non-human animal comprising said non-human animal genome comprises: After cell fractionation, tau and / or phosphorylated tau (phospho-tau) in the insoluble fraction is increased; phosphorylated tau in the somatodendritic compartment of neurons is increased; phosphorylated tau in the perinuclear region of neurons is increased; the nucleoplasmic ratio of the nuclear pore complex protein Nup98-Nup96 in neurons is decreased; the nucleoplasmic ratio of the GTP-binding nuclear protein Ran (Ran) in neurons is decreased; or the nucleoplasmic ratio of Ran GTPase-activating protein 1 in neurons is decreased.

173. The non-human animal genome according to any one of claims 159, 160, 163-165, 167, 169, 171, and 172, wherein the non-human animal is a rodent.

174. The non-human animal genome according to claim 173, wherein the rodent is a mouse or a rat.

175. The non-human animal genome according to claim 174, wherein the rodent is a mouse.

Citation Information

Patent Citations

  • Induction motor overload detector and overload detecting method

    CN1366188A

  • Engineering and optimization of systems, methods and compositions for sequence manipulation with functional domains

    EP3045537A1

  • Functional genomics using zinc finger proteins

    US20020081614A1

  • Regulation of angiogenesis with zinc finger proteins

    US20030021776A1

  • Methods and compositions for using zinc finger endonucleases to enhance homologous recombination

    US20030232410A1