Method for producing L-type cyclic amino acids

Abstract

The object of the present invention is to provide a method for producing high-purity L-cyclic amino acids from cyclic amino acids having a double bond at position 1 more cheaply, efficiently and industrially, and the object is solved by allowing a specific enzyme having a catalytic performance of reducing a cyclic amino acid having a double bond at position 1 to act on the cyclic amino acid having a double bond at position 1 to produce L-cyclic amino acids.

Description

Technical Field

[0001] The present invention relates to a method for producing L-cyclic amino acids useful in industry. Background Art

[0002] L-cyclic amino acids are substances useful as drug intermediate raw materials such as thrombin inhibitors, HIV protease inhibitors, NMDA receptor antagonists, TNF-α converting enzyme inhibitors, angiotensin converting enzyme inhibitors, and anti-inflammatory agents.

[0003] As L-cyclic amino acids, amino acids such as L-proline (L-Proline), L-hydroxyproline, etc. which are 5-membered ring amino acids represented by the following chemical formula, 6-membered ring amino acids such as L-pipecolic acid, and 4-membered ring amino acids such as azetidine-2-carboxylic acid are known.

[0004]

[0005] In addition, substances useful as drug intermediate raw materials such as L-thioproline, L-3-morpholine carboxylic acid, and L-3-thiomorpholine carboxylic acid which are heterocycles are also known.

[0006]

[0007] As methods for producing L-cyclic amino acids, organic synthesis methods and biochemical methods are known.

[0008] As a method for producing L-cyclic amino acids by organic synthesis, a method for producing pipecolic acid proposed by Garcia et al. (Non-Patent Document 1) is known. However, these methods can hardly be called methods that can be industrially practical in terms of both optical purity and yield.

[0009] As a method for biochemically producing L-cyclic amino acids, there are known methods for producing L-pipecolic acid starting from L-lysine using pyrroline-5-carboxylic acid reductase (EC 1.5.1.2) (Non-Patent Document 2), a method for producing L-proline starting from L-ornithine using ornithine cyclodeaminase (Non-Patent Document 3), a method for producing various cyclic amino acids starting from various diamino acids using ornithine cyclodeaminase (Patent Document 1), etc.

[0010] The method reported by Fujii et al. (Non-Patent Document 2) is a method in which L-lysine 6-aminotransferase is used for L-lysine to generate Δ 1 -piperidine-6-carboxylic acid as an intermediate, and then the reductase is brought into contact therewith to obtain L-pipecolic acid. However, this method can only handle the case where the raw material is L-lysine and cannot be applied to the production of other L-cyclic amino acids.

[0011] The method reported by Costilow et al. (Non-Patent Document 3: Journal of Biological Chemistry (1971)) is a method in which ornithine cyclase is used for L-ornithine to obtain L-proline, but there is no description of products other than proline.

[0012] Denis et al. (Patent Document 1) reported a method for obtaining L-pipecolic acid, L-thiomorpholine-2-carboxylic acid, 5-hydroxy-L-pipecolic acid, etc. using ornithine cyclase, but there is no description of the yield, optical purity, etc.

[0013] In addition, in any of the above methods, the optical purity of the L-cyclic amino acid as the product depends on the optical purity of the raw material amino acid, and it is considered difficult to obtain L-cyclic amino acids with high efficiency from racemic raw materials.

[0014] On the other hand, a method via a cyclic amino acid having a double bond at the 1-position as an intermediate can use racemic cyclic amino acids and diamino acids as raw materials, and is therefore industrially advantageous.

[0015] For example, as an enzyme for reducing a cyclic amino acid having a double bond at the 1-position, it has been reported that, for example, pyrroline-2-carboxylate reductase (EC 1.5.1.1) derived from an animal or a mold reduces Δ 1 -pyrroline-2-carboxylic acid to produce proline, and reduces Δ 1 -pyrroline-2-carboxylic acid to produce pipecolic acid (Non-Patent Document 4). 1 -piperidine-2-carboxylic acid to produce pipecolic acid (Non-Patent Document 4). 1 -piperidine-2-carboxylic acid to produce pipecolic acid (Non-Patent Document 4).

[0016] In addition, it has been reported that the metabolism of bacteria belonging to the genus Pseudomonas that produces L-pipecolic acid from D-lysine using Δ 1 -piperidine-2-carboxylic acid as an intermediate, and it has also been reported that piperideine-2-carboxylate reductase (EC 1.5.1.21) catalyzes the reduction reaction (Non-Patent Document 5). 1 -piperidine-2-carboxylic acid as an intermediate, and it has also been reported that piperideine-2-carboxylate reductase (EC 1.5.1.21) catalyzes the reduction reaction (Non-Patent Document 5).

[0017] However, these reports only biochemically confirmed the enzyme reactions and are not examples of industrial production.

[0018] In addition, it has been described that enzymes derived from animals are very unstable and industrial production using these enzymes is difficult to put into practical use.

[0019] Patent Document 2 describes a method for producing an L-type cyclic amino acid by obtaining a cyclic amino acid having a double bond at the 1-position as an intermediate from a di-amino acid and a racemic cyclic amino acid, and reducing it with N-methyl-L-amino acid dehydrogenase derived from bacteria belonging to the genus Pseudomonas. This method aims to provide a method for producing a high-purity L-type cyclic amino acid at low cost, but in order to be industrially practical, it is required to produce the L-type cyclic amino acid with higher efficiency.

[0020] Prior Art Documents

[0021] Patent Documents

[0022] Patent Document 1: WO 02 / 101003

[0023] Patent Document 2: Japanese Patent No. 4590981

[0024] Non-Patent Documents

[0025] Non-Patent Document 1: Concepcion F Garcia et al., Tetrahedron Asymmetry (1995) vol.6, pp.2905-2906

[0026] Non-Patent Document 2: Tadashi Fujii et al., Bioscience Biotechnology Biochem (2002) vol.66, pp.1981-1984

[0027] Non-Patent Document 3: Ralph N Costilow et al., Journal of Biological Chemistry (1971) vol.246, pp.6655-6660

[0028] Non-Patent Document 4: Alton Meister et al., Journal of Biological Chemistry (1957) vol.229, pp.789-800

[0029] Non-Patent Document 5: Cecil W Payton et al., Journal of Bacteriology (1982) vol.149, pp.864-871 Summary of the Invention

[0030] Problems to be Solved by the Invention

[0031] The subject of the present invention is to provide a method for producing a highly pure L-cyclic amino acid from a cyclic amino acid having a double bond at the 1-position more inexpensively, efficiently and industrially. Another subject of the present invention is to provide a method for producing a highly pure L-cyclic amino acid more inexpensively, efficiently and industrially by obtaining a cyclic amino acid having a double bond at the 1-position as an intermediate from an inexpensive di-amino acid and reducing it by a biochemical method.

[0032] Method for Solving the Problems

[0033] It is considered that the above problems can be solved by using a sub-amino acid reductase having catalytic performance for reducing a cyclic amino acid having a double bond at the 1-position to generate an L-cyclic amino acid, being enzymatically stable and having high catalytic performance, and a highly pure L-cyclic amino acid can be produced more inexpensively, efficiently and industrially.

[0034] The present inventors conducted in-depth studies to solve the above problems, and as a result, found that sub-amino acid reductases derived from Arabidopsis thaliana, Lathyrus maritimus or Morus reductively convert a cyclic amino acid having a double bond at the 1-position with a catalytic efficiency higher than that of known enzymes.

[0035] In addition, a cyclic amino acid having a double bond at the 1-position can be efficiently produced from an inexpensive di-amino acid using a known enzyme. Therefore, it has been found that by combining a method for producing a cyclic amino acid having a double bond at the 1-position from a di-amino acid with a method for reducing a cyclic amino acid having a double bond at the 1-position with high catalytic efficiency, a high-purity L-type cyclic amino acid useful as a pharmaceutical intermediate raw material can be produced from an inexpensive di-amino acid more inexpensively, efficiently and industrially.

[0036] The present invention has been completed based on these insights.

[0037] That is, the present invention is as follows.

[0038] [1] A method for producing an L-type cyclic amino acid, characterized by contacting a polypeptide represented by the following (A), (B) or (C), a microorganism or cell having the ability to produce the above polypeptide or containing the above polypeptide, a processed product of the above microorganism or cell, and / or a culture solution containing the above polypeptide obtained by culturing the above microorganism or cell with a cyclic amino acid having a double bond at the 1-position represented by the following general formula (I) to generate an L-type cyclic amino acid represented by the following general formula (II).

[0039]

[0040] (In the formula, A represents an alkylene chain having a chain length of 1 to 4 atoms, which may contain at least one heteroatom selected from the group consisting of a sulfur atom, an oxygen atom and a nitrogen atom in the chain or at the terminal, and may have a substituent.)

[0041]

[0042] (In the formula, A has the same meaning as described above.)

[0043] (A) A polypeptide having the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8, 10 or 12;

[0044] (B) An amino acid sequence obtained by deleting, substituting and / or adding one to two or more amino acids in the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8, 10 or 12, and a polypeptide having the ability to produce an L-type cyclic amino acid that catalyzes the reaction represented by the following formula (1).

[0045] Formula (1):

[0046] (In the formula, A has the same meaning as described above.); or

[0047] (C) A polypeptide having an amino acid sequence with a sequence identity of 90% or more to the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8, 10, or 12, and having the ability to produce L-type cyclic amino acids that catalyze the reaction shown in the above formula (1).

[0048] [2] The production method according to [1], wherein the polypeptide is encoded by a nucleic acid shown in the following (D), (E), or (F):

[0049] (D) A nucleic acid containing the base sequence shown in SEQ ID NO: 1, 3, 5, 7, 9, or 11;

[0050] (E) A base sequence formed by substituting, deleting, and / or adding one or more bases in the base sequence shown in SEQ ID NO: 1, 3, 5, 7, 9, or 11, and encoding a polypeptide having the ability to produce L-type cyclic amino acids that catalyze the reaction shown in the above formula (1); or

[0051] (F) A base sequence that hybridizes with the complementary strand of the base sequence shown in SEQ ID NO: 1, 3, 5, 7, 9, or 11 under stringent conditions, and encodes a polypeptide having the ability to produce L-type cyclic amino acids that catalyze the reaction shown in the above formula (1).

[0052] [3] A method for producing L-type cyclic amino acids, characterized in that an enzyme capable of converting the amino group at the α-position of a di-amino acid into a keto group to produce an α-keto acid is reacted with a linear α,ω-di-amino acid shown in the following general formula (III) to produce a cyclic amino acid having a double bond at the 1-position shown in the following general formula (I), and then the cyclic amino acid having a double bond at the 1-position obtained is used to produce an L-type cyclic amino acid shown in the following general formula (II) by the method described in [1] or [2].

[0053]

[0054] (In the formula, A represents an alkylene chain having a chain length of 1 to 4 atoms, which may contain at least one heteroatom selected from the group consisting of a sulfur atom, an oxygen atom, and a nitrogen atom in the chain or at the terminal, and may have a substituent.)

[0055]

[0056] (In the formula, A has the same meaning as above.)

[0057]

[0058] (In the formula, A has the same meaning as above.)

[0059] [4] The method for producing an L-cyclic amino acid according to [3], wherein the enzyme capable of converting the amino group at the α-position of a di-amino acid into a keto group to produce an α-keto acid is one or more enzymes selected from the group consisting of D-amino acid oxidase, L-amino acid oxidase, D-amino acid dehydrogenase, L-amino acid dehydrogenase, D-amino acid transferase, and L-amino acid transferase.

[0060] [5] The method for producing an L-cyclic amino acid according to any one of [1] to [4], wherein the cyclic amino acid having a double bond at the 1-position represented by the above general formula (I) is Δ 1 -piperidine-2-carboxylic acid, and the L-cyclic amino acid represented by the above general formula (II) is L-pipecolic acid.

[0061] [6] A polypeptide, which is:

[0062] (a) A polypeptide having the amino acid sequence shown in SEQ ID NO: 4, 6, 8, 10, or 12;

[0063] (b) An amino acid sequence obtained by deleting, substituting, and / or adding one to two or more amino acids in the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8, 10, or 12, and a polypeptide having the ability to produce an L-cyclic amino acid that catalyzes the reaction represented by the following formula (1),

[0064] Formula (1):

[0065] (In the formula, A represents an alkylene chain having a chain length of 1 to 4 atoms, which may contain at least one heteroatom selected from the group consisting of a sulfur atom, an oxygen atom, and a nitrogen atom in the chain or at the terminal, and may have a substituent.); or

[0066] (c) A polypeptide having an amino acid sequence having 90% or more sequence identity with the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8, 10, or 12, and having the ability to produce an L-cyclic amino acid that catalyzes the reaction represented by the above formula (1).

[0067] [7] A nucleic acid encoding the polypeptide according to [6].

[0068] [8] The nucleic acid according to [7], wherein the nucleic acid is from a plant.

[0069] [9] The nucleic acid according to [8], wherein the plant is mulberry or Lathyrus maritimus.

[0070]

[10] The nucleic acid according to any one of [7] to [9], wherein the nucleic acid is the nucleic acid shown in the following (d), (e), or (f):

[0071] (d) A nucleic acid containing the base sequence shown in SEQ ID NO: 3, 5, 7, 9, or 11;

[0072] (e) a nucleic acid having a base sequence formed by substituting, deleting and / or adding one or more bases in the base sequence shown in SEQ ID NO: 1, 3, 5, 7, 9 or 11, and encoding a polypeptide having the ability to produce an L-type cyclic amino acid that catalyzes the reaction shown in the above formula (1); or

[0073] (f) a nucleic acid having a base sequence that hybridizes with the complementary strand of the base sequence shown in SEQ ID NO: 1, 3, 5, 7, 9 or 11 under stringent conditions, and encoding a polypeptide having the ability to produce an L-type cyclic amino acid that catalyzes the reaction shown in the above formula (1).

[0074]

[11] A recombinant vector comprising the nucleic acid according to any one of [7] to

[10] .

[0075]

[12] A transformant comprising the recombinant vector according to

[11] .

[0076]

[13] An enzyme preparation composition comprising: a polypeptide shown in the following (A), (B) or (C), a microorganism or cell having the ability to produce the above polypeptide or comprising the above polypeptide, a treated product of the above microorganism or cell, and / or a culture solution containing the above polypeptide obtained by culturing the above microorganism or cell,

[0077] having the ability to produce an L-type cyclic amino acid shown in the following general formula (II) from a cyclic amino acid having a double bond at the 1-position shown in the following general formula (I),

[0078]

[0079] (In the formula, A represents an alkylene chain having a chain length of 1 to 4 atoms, which may contain at least one heteroatom selected from the group consisting of a sulfur atom, an oxygen atom and a nitrogen atom in the chain or at the terminal, and may have a substituent.)

[0080]

[0081] (In the formula, A has the same meaning as described above.)

[0082] (A) A polypeptide having the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8, 10 or 12;

[0083] (B) A polypeptide having an amino acid sequence formed by deleting, substituting and / or adding one to two or more amino acids in the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8, 10 or 12, and having the ability to produce an L-type cyclic amino acid that catalyzes the reaction shown in the following formula (1),

[0084] Formula (1)

[0085] (wherein A has the same meaning as described above); or

[0086] (C) a polypeptide having an amino acid sequence having 90% or more sequence identity with the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8, 10 or 12, and having the ability to produce L-cyclic amino acids by catalyzing the reaction shown in the above formula (1).

[0087] Advantages of the Invention

[0088] According to the present invention, by using an enzyme having catalytic performance for reducing a cyclic amino acid having a double bond at the 1-position to produce an L-cyclic amino acid, which is enzymatically stable and has high catalytic performance, high-purity L-cyclic amino acids can be produced more inexpensively, efficiently and industrially. In addition, by combining a method for producing a cyclic amino acid having a double bond at the 1-position from a di-amino acid with a method for reducing a cyclic amino acid having a double bond at the 1-position with high catalytic efficiency, high-purity L-cyclic amino acids useful as pharmaceutical intermediate raw materials can be produced more inexpensively, efficiently and industrially from inexpensive di-amino acids. BRIEF DESCRIPTION OF THE DRAWINGS

[0089] Figure 1 A graph showing the HPLC analysis results of the generated pipecolic acid in the analysis of the enzyme reaction product of (2) in Example 2.

[0090] Figure 2 A graph showing the linear approximation line of the Hanes-Woolf plot in the analysis of the enzyme catalytic activity of (3) in Example 2.

[0091] Figure 3 A graph showing the Michaelis-Menten model based on ANEMONA in the analysis of the enzyme catalytic activity of (3) in Example 2. DETAILED DESCRIPTION OF THE INVENTION

[0092] The present invention will be described in detail below.

[0093] In the general formulas (I), (II) and (III) of the present invention, A represents an alkylene chain having a chain length of 1 to 4 atoms, which may contain at least one heteroatom selected from the group consisting of a sulfur atom, an oxygen atom and a nitrogen atom in the chain or at the end, and may have a substituent.

[0094] Examples of the alkylene chain include -CH 2 -, -C 2 H 4 -, -C 3 H 6 -, -C 2 H 3 CH3 -,-C 4 H 8 -,-C 3 H 5 CH 3 -,-CH 2 CHCH 3 CH 2 - and other linear or branched alkylene chains with 1 to 4 carbon atoms. Among these, a linear alkylene chain with 2 to 4 carbon atoms of an L-type cyclic amino acid capable of forming a 5-membered ring, 6-membered ring, or 7-membered ring is preferred. For example, when the number of carbon atoms of A is 2, a 5-membered ring amino acid such as L-proline is formed; when the number of carbon atoms is 3, a 6-membered ring amino acid such as L-pipecolic acid is formed; when the number of carbon atoms is 4, a 7-membered ring amino acid such as azepane-2-carboxylic acid is formed. The chemical formulas of these compounds are shown below.

[0095]

[0096] In addition, in the alkylene chain, heteroatoms such as sulfur atoms, oxygen atoms, and nitrogen atoms may be included in the chain or at the end. A heterocycle is formed by the alkylene chain containing these heteroatoms. In the alkylene chain, one or two or more sulfur atoms, oxygen atoms, nitrogen atoms, etc. may be included. The number of heteroatoms contained is preferably 1 to 3. Examples of the alkylene chain containing heteroatoms include -CHOHCH 2 -,-CH 2 CHOHCH 2 -,-SCH 2 -,-SC 2 H 4 -,-SC 3 H 6 -,-OCH 2 -,-OC 2 H 4 -,-OC 3 H 6 -,-NHCH 2 -,-NHC 2 H 4 -,-NHC 3 H 6 -,-NHCH 2 CHCOOH-,-C 2 H 4 NHCO-,-C 2 H 4 NHCN-,-C 2 H 4CHCOOH-, -SCH 2 CHCOOH-, -SC 2 H 4 CHCOOH-, -NHCHCOOHCH 2 - etc.

[0097] When A is an alkylene chain containing a sulfur atom, examples of the L-type cyclic amino acid include thioproline, 3-thiomorpholinecarboxylic acid, [1,4]thiazepane-3-carboxylic acid, etc. When A is an alkylene chain containing an oxygen atom, examples of the L-type cyclic amino acid include 4- oxazolidinecarboxylic acid, 3-morpholinecarboxylic acid, etc. When A is an alkylene chain containing two or more nitrogen atoms, examples of the L-type cyclic amino acid include piperazine-2-carboxylic acid, etc. The chemical formulas of these compounds are shown below.

[0098]

[0099] In addition, the above-mentioned alkylene chain or alkylene chain containing a heteroatom may have a substituent. As the substituent, there is no particular limitation as long as it does not have an adverse effect on the reaction. Specifically, although not limited, examples include an alkyl group having 1 to 4 carbon atoms, an aryl group having 6 to 12 carbon atoms, an alkoxy group having 1 to 4 carbon atoms, a carboxyl group, a halogen group, a cyano group, an amino group, a nitro group, a hydroxyl group, etc., and a hydroxyl group is preferred. Examples of the L-type cyclic amino acid containing a substituent include hydroxyproline, hydroxypipecolic acid, etc. The chemical formulas of these are shown below.

[0100]

[0101] Among these, as A, a straight-chain alkylene chain having 2 to 4 carbon atoms is preferred, and a straight-chain alkylene chain having 3 carbon atoms is particularly preferred.

[0102] 1. Subamino acid reductase

[0103] The subamino acid reductase used in the present invention is an enzyme that catalyzes the reaction shown in the following formula (1).

[0104] Formula (1):

[0105] (In the formula, A has the same meaning as above.)

[0106] The enzyme that catalyzes the reaction represented by the above formula (I) refers to an enzyme having the following properties: reducing an imino acid reductase (polypeptide), a microorganism or cell having the ability to produce the above polypeptide or containing the above polypeptide, a processed product of the above microorganism or cell, and / or a culture solution containing the above polypeptide obtained by culturing the above microorganism or cell, contacting with a cyclic amino acid having a double bond at the 1-position represented by the above general formula (I) to produce the L-cyclic amino acid represented by the above general formula (II).

[0107] Whether it has the property of "generating the L-cyclic amino acid represented by the general formula (II) from the cyclic amino acid having a double bond at the 1-position represented by the general formula (I)" can be confirmed, for example, as follows: in a reaction system containing Δ 1 -piperidine-2-carboxylic acid as a substrate and containing NAD(P) + or NAD(P)H as a coenzyme, allowing the enzyme to be measured to act on Δ 1 -piperidine-2-carboxylic acid to reduce Δ 1 -piperidine-2-carboxylic acid, and directly measuring the amount of L-pipecolic acid produced to confirm.

[0108] The contact method is not particularly limited, and examples include adding the cyclic amino acid having a double bond at the 1-position represented by the above general formula (I) to a liquid containing an imino acid reductase, and reacting at an appropriate temperature (for example, about 10 °C to 45 °C) and pressure (for example, about atmospheric pressure). Regarding the reaction time, it is also within a range that can be appropriately set according to the enzyme type, target product, etc.

[0109] In the present invention, an enzyme that particularly preferably catalyzes the reaction represented by the following formula (2) (the reaction of reducing Δ 1 -piperidine-2-carboxylic acid (Δ 1 -piperidine-2-carboxylic acid) to produce L-pipecolic acid) is used.

[0110] Formula (2):

[0111] In addition, the imino acid reductase is preferably an enzyme that uses reduced nicotinamide adenine dinucleotide (NADH) or reduced nicotinamide adenine dinucleotide phosphate (NADPH) (hereinafter sometimes collectively referred to as "NAD(P)H") as a coenzyme to reduce the cyclic amino acid having a double bond at the 1-position represented by the general formula (I) to produce the L-cyclic amino acid represented by the general formula (II).

[0112] Such a sub-amino acid reductase can be obtained by extraction and purification from plants of the genus Arabidopsis such as Arabidopsis thaliana, Arabidopsis kamchatica subsp. kamchatica, Arabidopsis halleri subsp. gemmifera var. senanensis, plants of the genus Morus such as mulberry, Morus alba, Morus multicaulis, or plants of the genus Lathyrus such as Lathyrus japonicus, Lathyrus sativus, Lathyrus odoratus, etc. by known methods.

[0113] The sub-amino acid reductase is particularly preferably a sub-amino acid reductase from Arabidopsis thaliana, Morus alba or Lathyrus japonicus. For example, a sub-amino acid reductase preferably obtained by extraction and purification from Arabidopsis thaliana, Morus alba or Lathyrus japonicus. In addition, the sequences of the sub-amino acid reductases from Arabidopsis thaliana, Morus alba or Lathyrus japonicus have been clarified in the present invention, so a sub-amino acid reductase synthesized using the same sequence by known methods is also preferably used.

[0114] The extraction of the enzyme from plants can be carried out based on the usual methods for extracting plant enzymes (for example, Yuzo Uguaya, Kensuke Shimura, Michinori Nakamura, Katsu Funatsu eds., Biochemical Experiment Methods 14 Research Methods for Secondary Metabolism of Higher Plants (1981) The Chemical Society of Japan Press; Takeshi Horio, Jinpei Yamashita eds., Basic Experimental Methods for Proteins and Enzymes (1981) Nankodo).

[0115] In order to remove residues from the obtained extract, solid-liquid separation means such as filtration and centrifugation are applied to prepare a crude enzyme extract. The operation of purifying the target enzyme from the crude enzyme extract can apply known separation and purification methods. For example, crude enzyme protein is obtained from the crude enzyme extract by ammonium sulfate salting-out method, organic solvent precipitation method, etc., and then various chromatographies such as ion exchange chromatography, gel filtration chromatography, affinity chromatography are appropriately combined and used for it, whereby a purified enzyme can be obtained.

[0116] Specifically, the sub-amino acid reductase used in the present invention is: a sub-amino acid reductase comprising a polypeptide composed of the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8, 10 or 12; or a sub-amino acid reductase comprising a polypeptide composed of an amino acid sequence having a high degree of identity with this amino acid sequence (hereinafter sometimes referred to as "homolog of the amino acid sequence") and having the ability to generate L-type cyclic amino acids and catalyzing the reaction shown in the above formula (1) (hereinafter sometimes referred to as "homolog of the sub-amino acid reductase").

[0117] More specifically, it includes the polypeptides shown in (A), (B), or (C) below.

[0118] (A) A polypeptide having the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8, 10, or 12;

[0119] (B) An amino acid sequence formed by deleting, substituting, and / or adding one to two or more amino acids in the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8, 10, or 12, and having the ability to generate L-type cyclic amino acids and catalyze the reaction shown in the following formula (1),

[0120] Formula (1)

[0121] (In the formula, A has the same meaning as above.); or

[0122] (C) A polypeptide having an amino acid sequence with a sequence identity of 90% or more to the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8, 10, or 12, and having the ability to generate L-type cyclic amino acids and catalyze the reaction shown in the above formula (1).

[0123] In the present invention, homologs of the sub-amino acid reductase having the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8, 10, or 12 include the polypeptides shown in the above (B) or (C).

[0124] (B) The polypeptide shown is an amino acid sequence formed by deleting, substituting, and / or adding one to two or more amino acids in the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8, 10, or 12, and having the ability to generate L-type cyclic amino acids and catalyze the reaction shown in the above formula (1).

[0125] In the case of substitution, it is preferably a conservative substitution of one to two or more amino acids. In this specification, "performing a conservative substitution on an amino acid" refers to the substitution between amino acids with similar chemical properties, etc., and examples include substituting a basic amino acid with a basic amino acid, substituting an acidic amino acid with an acidic amino acid, etc.

[0126] "One to two or more amino acids" is usually one to 100, preferably one to 50, more preferably one to 20, further preferably one to 10, particularly preferably one to 5, and most preferably one to 3 amino acids.

[0127] The polypeptide shown in (C) is a polypeptide having an amino acid sequence with a sequence identity of 90% or more with the amino acid sequences shown in SEQ ID NOs: 2, 4, 6, 8, 10, or 12, and having the ability to generate L-type cyclic amino acids and catalyze the reaction shown in the above formula (1). Preferably, it is a polypeptide having an amino acid sequence with a sequence identity of 80% or more, more preferably 90% or more, still more preferably 95% or more, particularly preferably 98% or more, and most preferably 99% or more with the full length of the amino acid sequences shown in SEQ ID NOs: 2, 4, 6, 8, 10, or 12, and having the activity to catalyze the reaction shown in the above formula (1).

[0128] The homology (also referred to as identity or similarity) of the amino acid sequences in this specification can be calculated using the homology calculation algorithm NCBI BLAST (National Center for Biotechnology Information Basic Local Alignment Search Tool), for example, under the following conditions (expect value = 10; allowing gaps; matrix = BLOSUM62; filtering = OFF). As other algorithms for determining the homology of amino acid sequences, for example, the algorithms described in Karlin et al., Proc. Natl. Acad. Sci. USA, 90:5873-5877 (1993) [this algorithm is integrated into the NBLAST and XBLAST programs (version 2.0) (Altschul et al., Nucleic Acids Res., 25:3389-3402 (1997))]; the algorithm described in Needleman et al., J. Mol. Biol., 48:444-453 (1970) [this algorithm is integrated into the GAP program in the GCG software package]; the algorithm described in Myers and Miller, CABIOS, 4:11-17 (1988) [this algorithm is integrated into the ALIGN program (version 2.0) as part of the CGC sequence alignment software package]; the algorithm described in Pearson et al., Proc. Natl. Acad. Sci. USA, 85:2444-2448 (1988) [this algorithm is integrated into the FASTA program in the GCG software package], etc., and they can also be preferably used in the same way.

[0129] In addition, the imino acid reductase of the present invention can also be produced by the following method: culturing a transformant containing a nucleic acid encoding the imino acid reductase, and isolating and purifying the imino acid reductase from the obtained culture. The nucleic acid encoding the imino acid reductase of the present invention can be DNA, can be RNA, or can be a DNA / RNA chimera. DNA is preferably listed. In addition, the nucleic acid can be double-stranded or single-stranded. In the case of double-stranded, it can be double-stranded DNA, double-stranded RNA or a DNA:RNA hybrid. In the case of single-stranded, it can be a sense strand (i.e., a coding strand) or an antisense strand (i.e., a non-coding strand).

[0130] Examples of the DNA encoding the imino acid reductase of the present invention include synthetic DNA. For example, it can be obtained as follows: using total RNA or mRNA fraction prepared from cells or tissues of Arabidopsis thaliana, Morus alba (Morus australis Poir.) or Lathyrus maritimus as a template, directly amplifying by reverse transcriptase-PCR, and using a known kit, such as MutanTM-super Express Km (TAKARA BIO INC.), MutanTM-K (TAKARA BIO INC.), etc., to convert the obtained full-length imino acid reductase cDNA by a known method such as ODA-LA PCR method, gapped duplex method, Kunkel method or a method based on these, thereby obtaining it. Alternatively, it can also be cloned from a cDNA library prepared by inserting a fragment of the above total RNA or mRNA into an appropriate vector by methods such as colony or plaque hybridization method or PCR method, and the obtained cDNA is converted according to the above method to obtain it. The vector for the library can be any of phage, plasmid, cosmid, phagemid, etc.

[0131] In addition, for the purpose of easy purification and maintaining the properties in a more ideal state, the imino acid reductase of the present invention can be a fusion protein with an affinity polypeptide. Examples of such a fusion protein include fusion proteins with known affinity polypeptides such as glutathione-S-transferase (GST), histidine tag, maltose binding protein (MBP), HA tag, FLAG tag, biotinylated peptide, green fluorescent protein, etc. Such a fusion protein can be obtained by affinity purification, etc.

[0132] In the present invention, a fusion protein with GST is preferred. The polypeptides having the amino acid sequences shown in SEQ ID NO: 8, 10 or 12 are fusion proteins formed by fusing the polypeptides shown in the amino acid sequences described in SEQ ID NO: 2, 4 or 6 with GST, respectively.

[0133] As nucleic acids encoding polypeptides having the amino acid sequences shown in SEQ ID NOs: 2, 4, 6, 8, 10, or 12, nucleic acids containing the base sequences shown in SEQ ID NOs: 1, 3, 5, 7, 9, or 11 can be respectively exemplified. As long as they encode a polypeptide having the activity of catalyzing the reaction shown in formula (1), they can also be nucleic acids containing base sequences having a high degree of identity with the base sequences shown in SEQ ID NOs: 1, 3, 5, 7, 9, or 11 (hereinafter sometimes referred to as "homologs of nucleic acids"). That is, as nucleic acids encoding this polypeptide, nucleic acids having the base sequences shown in (D), (E), or (F) below can be exemplified.

[0134] (D) A nucleic acid containing the base sequence shown in SEQ ID NOs: 1, 3, 5, 7, 9, or 11;

[0135] (E) A nucleic acid which is a base sequence formed by substituting, deleting, and / or adding one or more than two bases in the base sequence shown in SEQ ID NOs: 1, 3, 5, 7, 9, or 11 and encodes a polypeptide having the ability to generate L-type cyclic amino acids and catalyzing the reaction shown in the above formula (1); or

[0136] (F) A nucleic acid which is a base sequence that hybridizes with the complementary strand of the base sequence shown in SEQ ID NOs: 1, 3, 5, 7, 9, or 11 under stringent conditions and encodes a polypeptide having the ability to generate L-type cyclic amino acids and catalyzing the reaction shown in the above formula (1).

[0137] As homologs of the nucleic acid shown in the above (E), nucleic acids containing base sequences formed by deleting, substituting, inserting, and / or adding one to more than two bases in the base sequences shown in SEQ ID NOs: 1, 3, 5, 7, 9, or 11 and encoding a polypeptide having the activity of catalyzing the reaction shown in the above formula (1) can be exemplified. In the case of substitution, insertion, or addition, it is preferred to substitute, insert, or add one to more than two bases. Here, "one to more than two bases" is, for example, 1 to 300 bases, preferably 1 to 150 bases, more preferably 1 to 60 bases, further preferably 1 to 30 bases, particularly preferably 1 to 15 bases, and most preferably 1 to 5 bases.

[0138] It should be noted that the base sequences shown in SEQ ID NOs: 1, 3, and 5 are base sequences obtained by optimizing the codons of the genes of sub-amino acid reductases from Arabidopsis thaliana, Morus australis Poir. (Morus australis), and Lathyrus maritimus for expression in Escherichia coli. Such DNAs with codons optimized according to the host to be transformed are of course included in the nucleic acids encoding polypeptides having the activity of catalyzing the reaction shown in the above formula (1) that can be used in the present invention.

[0139] As a homolog of the nucleic acid shown in the above (F), examples include a nucleic acid (F) that hybridizes under stringent conditions with a complementary strand of the base sequence shown in SEQ ID NO: 1, 3, 5, 7, 9, or 11 and encodes a polypeptide having the ability to generate an L-type cyclic amino acid and catalyze the reaction shown in the above formula (1). Preferably, it is a nucleic acid having a base sequence with a homology (also referred to as identity) of 80% or more, more preferably 90% or more, further preferably 95% or more, still further preferably 98% or more, and most preferably 99% or more with the base sequence shown in SEQ ID NO: 1, 3, 5, 7, 9, or 11 and encodes a polypeptide having the activity to catalyze the reaction shown in the above formula (1).

[0140] The homology (also referred to as identity) of the base sequences in this specification can be calculated using the homology calculation algorithm NCBI BLAST (National Center for Biotechnology Information Basic Local Alignment Search Tool) under, for example, the following conditions (expect value = 10; allowing gaps; filtering = ON; match score = 1; mismatch score = -3). As other algorithms for determining the homology of base sequences, the above-mentioned homology calculation algorithms for amino acid sequences can be similarly preferably exemplified.

[0141] As a homolog of the nucleic acid shown in the above (F), as long as it encodes a polypeptide having the activity to catalyze the reaction shown in the above formula (1), it can also be a nucleic acid that hybridizes under stringent conditions with a complementary strand of the base sequence shown in SEQ ID NO: 1, 3, 5, 7, 9, or 11. Herein, as the "stringent conditions", reference can be made to the reported conditions (e.g., Current Protocols in Molecular Biology, John Wiley & Sons, 6.3.16.3.6, 1999) and appropriately set. Specifically, examples include washing once, more preferably 2 to 3 times, under salt concentrations and temperatures equivalent to those of the washing conditions for ordinary Southern hybridization, i.e., 60°C, 1x SSC, 0.1% SDS, preferably 0.1x SSC, 0.1% SDS, further preferably 65°C, 0.1x SSC, 0.1% SDS, or 68°C, 0.1x SSC, 0.1% SDS, etc. (high stringency conditions).

[0142] Those skilled in the art can appropriately introduce desired mutations by using site-directed mutagenesis (Nucleic Acids Res. 10, pp. 6487 (1982), Methods in Enzymol. 100, pp. 448 (1983), Molecular Cloning, PCR A Practical Approach IRL Press pp. 200 (1991), etc.) to perform substitution, deletion, insertion, and / or addition in the nucleic acids shown in SEQ ID NOs: 1, 3, 5, 7, 9, or 11, thereby obtaining homologs of the above-mentioned nucleic acids.

[0143] The nucleic acids of the present invention can encode polypeptides having the activity of catalyzing the reaction shown in the above formula (1). When the nucleic acids of the present invention have the base sequences shown in SEQ ID NOs: 1, 3, 5, 7, 9, or 11, or base sequences having a high degree of identity with the base sequences shown in SEQ ID NOs: 1, 3, 5, 7, 9, or 11, the degree of the L-type cyclic amino acid generating ability of the sub-amino acid reductase containing the polypeptide encoded by the nucleic acid can be quantitatively equivalent to that of the sub-amino acid reductase containing the polypeptide having the amino acid sequence shown in SEQ ID NOs: 2, 4, 6, 8, 10, or 12, or the sub-amino acid reductase containing the homolog of the polypeptide having the amino acid sequence, but can be different within an acceptable range (for example, about 0.1-fold to about 5-fold, preferably about 0.3-fold to about 3-fold of the amino acid generating ability of the sub-amino acid reductase containing the polypeptide having the amino acid sequence shown in SEQ ID NOs: 2, 4, 6, 8, 10, or 12, or the sub-amino acid reductase containing the homolog of the polypeptide having the amino acid sequence).

[0144] In addition, homology searches can be performed on databases such as DNA Databank of JAPAN (DDBJ) based on the amino acid sequences shown in SEQ ID NOs: 2, 4, 6, 8, 10, or 12 or a part thereof, or the base sequences shown in SEQ ID NOs: 1, 3, 5, 7, 9, or 11 or a part thereof, to obtain amino acid sequence information of polypeptides having the activity of catalyzing the reaction shown in formula (1) or base sequence information of DNA encoding the amino acid sequence.

[0145] In the production method of the present invention described below, the sub-amino acid reductase can be directly used in the reaction shown in the above formula (1), but it is preferred to use a microorganism or cell having the ability to produce the enzyme, a processed product of the microorganism or cell, and / or a culture solution containing the enzyme obtained by culturing the microorganism or cell.

[0146] As the microorganism or cell having the ability to produce the sub-amino acid reductase of the present invention, a microorganism or cell originally having the ability to produce the sub-amino acid reductase can be used, or a microorganism or cell having been imparted with the above-mentioned production ability through breeding can also be used. As the microorganism or cell, it can be either alive or dead. For example, dormant cells and the like can be preferably used. As the types of microorganisms or cells having the ability to produce the sub-amino acid reductase of the present invention, the microorganisms or cells described later as "host microorganism" or "host cell" can be cited.

[0147] As the means for imparting the above-mentioned production ability through breeding, known methods such as genetic recombination treatment (transformation) and mutation treatment can be adopted. As the method of transformation, methods such as introducing the target DNA and modifying expression regulatory sequences such as promoters on the chromosome to enhance the expression of the target DNA can be cited.

[0148] Among these, it is preferable to use a microorganism or cell transformed with the DNA encoding the polypeptide of the present invention.

[0149] As described above, the nucleic acid (DNA) encoding the polypeptide (sub-amino acid reductase) of the present invention can be cloned, for example, by using the chromosomal DNA from Arabidopsis thaliana, Morus alba, or Lathyrus maritimus as a template and performing PCR with appropriate primers.

[0150] In addition, as described above, the nucleic acid (DNA) encoding the polypeptide (sub-amino acid reductase) of the present invention can be prepared, for example, by using the total RNA or mRNA from Arabidopsis thaliana, Morus australis, or Lathyrus maritimus as a template and directly amplifying it by the RT-PCR method to obtain the full-length sub-amino acid reductase cDNA, and then cloning it by performing PCR with appropriate primers.

[0151] For example, by inserting the DNA encoding the polypeptide of the present invention obtained as described above into a known expression vector in an expressible configuration, the polypeptide gene expression vector of the present invention can be provided. And by transforming a host microorganism or cell with this expression vector, a transformant into which the DNA encoding the polypeptide of the present invention has been introduced can be obtained. The transformant can also be obtained by integrating the DNA encoding the polypeptide of the present invention into the chromosomal DNA of the host in an expressible manner by using methods such as homologous recombination.

[0152] In this specification, an "expression vector" refers to a genetic factor used for replicating and expressing a protein having a desired function in a host microorganism or cell by integrating a polynucleotide encoding a protein having a desired function and introducing it into the host microorganism or cell. Examples include plasmids, viruses, phages, cosmids, etc., but are not limited to these. The expression vector is preferably a plasmid.

[0153] In this specification, "transformant" refers to: a microorganism or cell into which a target gene has been introduced using the above-described expression vector or the like, and which can exhibit an expected trait related to a protein having an expected function.

[0154] As a method for producing a transformant, there is no specific limitation, and examples thereof include a method of introducing an expression vector constructed by introducing DNA encoding the polypeptide of the present invention into a plasmid vector, a phage vector, or a viral vector stably present in a host microorganism or host cell into the host microorganism or host cell, and a method of directly introducing the DNA into the host genome and transcribing and translating its genetic information. In this case, it is preferable to ligate an appropriate promoter upstream of the DNA at the 5'-side in the host, and further, it is more preferable to ligate a terminator downstream at the 3'-side. As such a promoter and terminator, as long as they are promoters and terminators known to function in the cells used as the host, there is no particular limitation, and for example, the vectors, promoters, and terminators detailed in "Microbiology Basic Course 8 Genetic Engineering · Kyoritsu Shuppan" can be used.

[0155] As the host microorganism to be transformed for expressing the sub-amino acid reductase of the present invention, there is no particular limitation as long as the host itself does not have an adverse effect on raw materials and intermediate products, and examples thereof include the following microorganisms.

[0156] Bacteria belonging to the genera Escherichia, Bacillus, Pseudomonas, Serratia, Brevibacterium, Corynebacterium, Streptococcus, Lactobacillus, etc., for which a host-vector system has been established.

[0157] Actinomycetes belonging to the genera Rhodococcus, Streptomyces, etc., for which a host-vector system has been established.

[0158] Yeasts belonging to the genera Saccharomyces, Kluyveromyces, Schizosaccharomyces, Zygosaccharomyces, Yarrowia, Trichosporon, Rhodosporidium, Hansenula, Pichia, Candida, etc., for which a host-vector system has been established.

[0159] Molds that have established host-vector systems, belonging to the genus Neurospora, Aspergillus, Cephalosporium, Trichoderma, etc.

[0160] The steps for preparing a transformant, the construction of a recombinant vector suitable for the host, and the culturing method of the host can be carried out according to techniques commonly used in the fields of molecular biology, bioengineering, and genetic engineering (for example, the methods described in Molecular Cloning).

[0161] The following specifically lists examples of preferred host microorganisms, preferred transformation methods for each microorganism, vectors, promoters, terminators, etc., but the present invention is not limited by these examples.

[0162] In the genus Escherichia, especially Escherichia coli, as plasmid vectors, pBR, pUC series plasmids, etc. can be cited, and promoters such as lac (β-galactosidase), trp (tryptophan operon), tac, trc (fusion of lac and trp), PL and PR from λ phage, etc. can be cited. In addition, as terminators, terminators from trpA, from phages, from rrnB ribosomal RNA, etc. can be cited.

[0163] In the genus Bacillus, as vectors, pUB110 series plasmids, pC194 series plasmids, etc. can be cited, and in addition, they can also be integrated into the chromosome. As promoters and terminators, promoters and terminators of enzyme genes such as alkaline protease, neutral protease, α-amylase, etc. can be used.

[0164] In the genus Pseudomonas, as vectors, conventional host-vector systems established by Pseudomonas putida, Pseudomonas cepacia, etc. can be cited; and broad-host vectors (including genes required for autonomous replication from RSF1010, etc.) such as pKT240 (Gene, 26, 273 - 82 (1983)) based on plasmids involved in the decomposition of toluene compounds, the TOL plasmid.

[0165] In the genus Brevibacterium, especially Brevibacterium lactofermentum, as vectors, plasmid vectors such as pAJ43 (Gene 39, 281 (1985)) can be cited. As promoters and terminators, various promoters and terminators used in Escherichia coli can be used.

[0166] In the genus Corynebacterium, particularly Corynebacterium glutamicum, examples of vectors include plasmid vectors such as pCS11 (Japanese Unexamined Patent Publication No. 57-183799) and pCB101 (Mol. Gen. Genet. 196, 175 (1984)).

[0167] In the genus Saccharomyces, particularly Saccharomyces cerevisiae, examples of vectors include YRp series, YEp series, YCp series, YIp series plasmids, etc. In addition, promoters and terminators of various enzyme genes such as alcohol dehydrogenase, glyceraldehyde-3-phosphate dehydrogenase, acid phosphatase, β-galactosidase, phosphoglycerate kinase, and enolase can be utilized.

[0168] In the genus Schizosaccharomyces, examples of vectors include plasmid vectors from Schizosaccharomyces pombe described in Mol. Cell. Biol. 6, 80 (1986). In particular, pAUR224 is commercially available from Takara Bio Inc. and can be easily utilized.

[0169] In the genus Aspergillus, among molds, Aspergillus niger, Aspergillus oryzae, etc. have been most studied. Integration into plasmids and chromosomes can be utilized, and promoters from extracellular proteases and amylases (Trends in Biotechnology 7, 283-287 (1989)) can be used.

[0170] In addition to the above, host-vector systems corresponding to various microorganisms have also been established and can be appropriately used.

[0171] In addition to microorganisms, various host-vector systems have also been established in plants and animals. In particular, systems for highly expressing heterologous proteins in animals such as insects (e.g., silkworms) (Nature 315, 592-594 (1985)) or plants such as rapeseed, corn, and potato, and systems using cell-free protein synthesis systems such as Escherichia coli cell-free extracts and wheat germ can also be appropriately utilized.

[0172] Examples of treated products of microorganisms or cells having the ability to produce the sub-amino acid reductase of the present invention include: substances obtained by treating the microorganisms or cells with organic solvents such as acetone, dimethyl sulfoxide (DMSO), toluene, and surfactants; substances obtained by freeze-drying; cell preparations such as substances obtained by physically or enzymatically disrupting the cells; substances obtained by extracting the enzyme fraction in the microorganisms or cells in the form of a crude product or a purified product; and substances obtained by immobilizing these on carriers typified by polyacrylamide gel and carrageenan gel, etc.

[0173] Examples of the culture solution containing the enzyme obtained by culturing microorganisms or cells having the ability to produce the sub-amino acid reductase of the present invention include: a suspension of the microorganisms or cells in a liquid medium; when the cells are secretion-expressing cells, a supernatant or a concentrate thereof obtained by removing the cells by centrifugation or the like.

[0174] The sub-amino acid reductase of the present invention can be particularly preferably used in a method for producing L-pipecolic acid by reducing Δ 1 -piperidine-2-carboxylic acid.

[0175] When the transformant used in the present invention is a prokaryote such as Escherichia coli or a eukaryote such as yeast, as long as the medium for culturing these microorganisms contains a carbon source, a nitrogen source, inorganic salts, etc. that can be assimilated by the microorganisms and can efficiently culture the transformant, a natural medium or a synthetic medium can be used. The culture is preferably carried out under aerobic conditions such as shaking culture or deep aeration stirring culture. The culture temperature is usually 15 to 40 °C, and the culture time is usually 16 hours to 7 days. During the culture, the pH is maintained at 3.0 to 9.0. The pH is adjusted using inorganic or organic acid or base solutions, urea, calcium carbonate, ammonia, etc. In addition, antibiotics such as ampicillin and tetracycline can be added to the medium as needed during the culture.

[0176] When isolating and purifying the above sub-amino acid reductase from the culture of the transformant, ordinary protein isolation and purification methods can be used.

[0177] For example, when the above-mentioned imino acid reductase is expressed in a soluble state in cells, after the culture is completed, the cells are recovered by centrifugation and suspended in an aqueous buffer, and then the cells are disrupted using an ultrasonic disruptor, French press, MANTON GAULIN homogenizer, Dyno mill, etc. to obtain a cell-free extract. From the supernatant obtained by centrifuging the cell-free extract, the usual methods for isolating and purifying proteins, i.e., solvent extraction method, salting-out method using ammonium sulfate, etc., desalting method, precipitation method using organic solvents, anion exchange chromatography using resins such as diethylaminoethyl (DEAE) agarose, DIAION HPA-75 (manufactured by Mitsubishi Chemical Corporation), cation exchange chromatography using resins such as S-Sepharose FF (manufactured by Pharmacia), hydrophobic chromatography using resins such as butyl agarose, phenyl agarose, gel filtration using molecular sieves, affinity chromatography, focusing chromatography, electrophoresis methods such as isoelectric focusing electrophoresis, etc., can be used alone or in combination to obtain a purified sample.

[0178] In addition, when the above-mentioned imino acid reductase is expressed as an insoluble body in cells, the cells can be recovered and disrupted in the same manner, followed by centrifugation. The imino acid reductase can be recovered from the resulting precipitate fraction using a conventional method. Then, the insoluble body of the N-methyl-L-amino acid dehydrogenase is solubilized with a protein denaturant. The solubilized solution is diluted or dialyzed in a solution containing no protein denaturant or with the concentration of the protein denaturant diluted to a level where the N-methyl-L-amino acid dehydrogenase will not be denatured, so that the imino acid reductase forms a normal three-dimensional structure. Then, a purified sample is obtained using the same isolation and purification methods as described above.

[0179] 2. Composition of the present invention

[0180] The composition (enzyme preparation) of the present invention contains the imino acid reductase of the present invention, a microorganism or cell having the ability to produce the enzyme, a treated product of the microorganism or cell, and / or a culture solution containing the above enzyme obtained by culturing the microorganism or cell, and has the above-mentioned L-type cyclic amino acid production performance. The composition of the present invention can be used as a catalyst to more inexpensively, efficiently and industrially produce high-purity L-type cyclic amino acids, and is therefore useful.

[0181] In addition to the active ingredient (such as enzymes), the composition of the present invention may also contain excipients, buffers, suspending agents, stabilizers, preservatives, antiseptics, physiological saline, etc. As excipients, lactose, sorbitol, D-mannitol, sucrose, etc. can be used. As buffers, phosphates, citrates, acetates, etc. can be used. As stabilizers, propylene glycol, ascorbic acid, etc. can be used. As preservatives, phenol, benzalkonium chloride, benzyl alcohol, chlorobutanol, methyl p-hydroxybenzoate, etc. can be used. As antiseptics, benzalkonium chloride, p-hydroxybenzoic acid, chlorobutanol, etc. can be used.

[0182] 3. Method for producing L-cyclic amino acid

[0183] According to the present invention, there is provided a method for producing an L-cyclic amino acid represented by the following general formula (II) by contacting the imino acid reductase of the present invention with a cyclic amino acid having a double bond at the 1-position represented by the following general formula (I).

[0184]

[0185] (In the formula, A has the same meaning as described above.)

[0186]

[0187] (In the formula, A has the same meaning as described above.)

[0188] When contacting the imino acid reductase of the present invention with a cyclic amino acid having a double bond at the 1-position represented by the general formula (I), by contacting the purified or crudely purified imino acid reductase of the present invention, a microorganism or cell having the ability to produce the imino acid reductase of the present invention (such as a transformant having a DNA encoding the polypeptide of the present invention, etc.), a treated product of the microorganism or cell, and / or a culture solution containing the enzyme obtained by culturing the microorganism or cell with the cyclic amino acid having a double bond at the 1-position represented by the general formula (I), the cyclic amino acid can be reduced to produce the L-cyclic amino acid represented by the general formula (II).

[0189] The imino acid reductase of the present invention can be directly used in the reaction, but it is preferably to use a microorganism or cell having the ability to produce the enzyme, a treated product of the microorganism or cell, and / or a culture solution containing the enzyme obtained by culturing the microorganism or cell. Among these, a transformant having a DNA encoding the polypeptide of the present invention is preferably used.

[0190] Regarding the amount of the microorganism or cell added to the reaction solution, the treated product of the microorganism or cell, and / or the culture solution containing the enzyme obtained by culturing the microorganism or cell, in the case of adding the microorganism or cell, it is added to the reaction solution in such a manner that the concentration of the microorganism or cell generally reaches about 0.1 w / v% to 50 w / v%, preferably 0.1 w / v% to 10 w / v% in terms of wet cell weight. In the case of using the treated product or the culture solution, the specific activity of the enzyme is determined, and the amount reaching the above-mentioned microorganism or cell concentration is added during the addition. Here, w / v% represents weight / volume%.

[0191] The contact method (reaction method) is not particularly limited. The cyclic amino acid having a double bond at the 1-position represented by the general formula (I) which serves as a substrate can be added to the liquid containing the sub-amino acid reductase of the present invention, and the reaction can be carried out at an appropriate temperature and pressure (for example, around atmospheric pressure). Regarding the reaction time, it can also be appropriately set according to the enzyme type, target product, etc.

[0192] The cyclic amino acid having a double bond at the 1-position represented by the general formula (I) which serves as the reaction substrate is generally used in a range where the substrate concentration in the reaction solution reaches 0.0001 w / v% to 90 w / v%, preferably 0.01 w / v% to 30 w / v%. The reaction substrate can be added all at once at the start of the reaction, but from the viewpoints of reducing the influence when there is substrate inhibition of the enzyme and increasing the accumulation concentration of the product, it is preferably added continuously or intermittently.

[0193] In addition, the above reaction (reduction reaction) is preferably carried out in the presence of a coenzyme. As the coenzyme, NAD(P) + or NAD(P)H is preferred. Here, NAD(P) + represents oxidized nicotinamide adenine dinucleotide (NAD + ) or oxidized nicotinamide adenine dinucleotide phosphate (NADP + ).

[0194] The coenzyme is added in such a manner that the concentration in the reaction solution generally reaches 0.001 mmol / L to 100 mmol / L, preferably 0.01 mmol / L to 10 mmol / L.

[0195] In the case of adding coenzymes, in order to improve production efficiency, it is preferable to regenerate NAD(P)+ generated from NAD(P)H into NAD(P)H. As the regeneration methods, the following can be cited: <1> a method using the NAD(P)+ reducing ability of the host microorganism itself; <2> a method of adding to the reaction system a microorganism having the ability to generate NAD(P)H from NAD(P)+ or a processed product thereof, or an enzyme (regeneration enzyme) such as glucose dehydrogenase, formate dehydrogenase, alcohol dehydrogenase, amino acid dehydrogenase, organic acid dehydrogenase (such as malate dehydrogenase), etc. that can be used for the regeneration of NAD(P)H; <3> a method of simultaneously introducing into the host the gene of the enzyme that can be used for the regeneration of NAD(P)H, i.e., the above-mentioned regeneration enzymes, when producing a transformant; etc.

[0196] Among them, in the method of <1> above, it is preferable to add glucose, ethanol, formic acid, etc. to the reaction system. In the method of <2> above, the following can be used: a microorganism containing the above-mentioned regeneration enzymes; a microorganism transformed with the DNA encoding the above-mentioned regeneration enzymes; a processed product of the microorganism cells such as a substance obtained by treating the microorganism cells with acetone, a substance obtained by freeze-drying, a substance obtained by physical disruption or enzymatic disruption; a substance obtained by extracting the enzyme fraction in the form of a crude product or a purified product; and a substance obtained by immobilizing these on a carrier represented by polyacrylamide gel, carrageenan gel, etc. In addition, commercially available enzymes can also be used.

[0197] In this case, as the usage amount of the above-mentioned regeneration enzyme, specifically, it is added in a manner that is generally 0.01 to 100 times, preferably about 0.01 to 10 times, in terms of enzyme activity compared to sub-amino acid reductase.

[0198] In addition, it is also necessary to add a compound that is the substrate of the above-mentioned regeneration enzyme, such as glucose when using glucose dehydrogenase, formic acid when using formate dehydrogenase, ethanol or isopropanol when using alcohol dehydrogenase, etc. As its addition amount, relative to the dicarbonyl compound as the reaction raw material, it is generally added in an amount of 1 to 10 molar equivalents, preferably 1.0 to 1.5 molar equivalents.

[0199] In addition, in the method of <3> above, a method of integrating the DNA of sub-amino acid reductase and the DNA of the above-mentioned regeneration enzymes into the chromosome, a method of introducing the two DNAs into a single vector and transforming the host, and a method of introducing the two DNAs into respective vectors and then transforming the host can be used. In the case of the method of introducing the two DNAs into respective vectors and then transforming the host, it is necessary to select vectors considering the incompatibility between the two vectors.

[0200] In the case of introducing two or more genes into a single vector, it is also possible to use a method of linking expression regulation-related regions such as promoters and terminators to each gene and express them in the form of an operon containing two or more cistrons such as the lactose operon.

[0201] The above reaction (reduction reaction) is preferably carried out in an aqueous medium containing the reaction substrate and the transformant, and various coenzymes and their regeneration systems added as required, or in a mixture of an aqueous medium and an organic solvent.

[0202] Examples of the aqueous medium include water or a buffer solution. As the organic solvent, water-soluble organic solvents with high solubility for the cyclic amino acid having a double bond at the 1-position represented by the general formula (I) as the reaction substrate, such as methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, tert-butanol, tetrahydrofuran, acetone, and dimethyl sulfoxide, can be used. In addition, water-insoluble organic solvents effective for removing reaction by-products, such as ethyl acetate, butyl acetate, toluene, chloroform, and n-hexane, can also be used.

[0203] The above reaction (reduction reaction) can be appropriately adjusted according to the enzyme used, the target product, etc., and is usually carried out at a reaction temperature of 4 to 60 °C, preferably 10 to 50 °C, and usually at a pH of 4 to 11, preferably pH 5 to 10. The reaction time is usually about 1 hour to 72 hours.

[0204] The above reaction (reduction reaction) can also be carried out using a membrane reactor or the like.

[0205] For the L-type cyclic amino acid represented by the general formula (II) generated by the above reaction (reduction reaction), after the reaction is completed, the cells and proteins in the reaction solution can be separated by separation or purification methods well known to those skilled in the art, such as centrifugation and membrane treatment, and then purified by appropriately combining extraction with organic solvents such as ethyl acetate and toluene, distillation, column chromatography using an ion exchange resin or silica gel, crystallization at the isoelectric point, and crystallization based on monohydrochloride, dihydrochloride, calcium salt, etc.

[0206] In addition, the cyclic amino acid having a double bond at the 1-position represented by the general formula (I) as the substrate can be produced by organic synthesis methods or biochemical methods from di-amino acids or racemic cyclic amino acids using known methods. From the perspective of cost and processability, production from di-amino acids is preferably used industrially. As the di-amino acid, linear α,ω-diamino acids are preferred.

[0207] In the case of production from linear α,ω-diamino acids, if the amino group at the α-position of the α,ω-diamino acid is converted to a keto group to generate an α-keto acid as shown in the following reaction formula, then the α-keto acid undergoes non-enzymatic dehydration cyclization to become a cyclic amino acid having a double bond at the 1-position.

[0208]

[0209] (In the formula, A has the same meaning as described above.)

[0210] Here, the α-keto acid formed by oxidizing the amino group at the α-position of the α,ω-diamino acid and the cyclic amino acid having a double bond at the 1-position usually exist in the form of an equilibrium mixture in an aqueous medium, and thus these are regarded as equivalents. Therefore, in the reaction (reduction reaction) system of the present invention, a cyclic amino acid having a double bond at the 1-position, Δ 1 -piperidine-2-carboxylic acid, the α-keto acid formed by oxidizing the amino group at the α-position of the α,ω-diamino acid and the cyclic amino acid having a double bond at the 1-position, or the α-keto acid formed by oxidizing the amino group at the α-position of the α,ω-diamino acid, any of these modes is included in the present invention.

[0211] When producing a cyclic amino acid having a double bond at the 1-position from an α,ω-diamino acid by a biochemical method, any enzyme capable of converting the amino group at the α-position of the α,ω-diamino acid into a keto group to form an α-keto acid may be used, and there is no particular limitation. Examples include amino acid oxidases such as D-aminoacid oxidase and L-aminoacid oxidase, amino acid dehydrogenases such as D-aminoacid dehydrogenase and L-aminoacid dehydrogenase, and amino acid transferases such as D-aminoacid aminotransferase and L-aminoacid aminotransferase.

[0212] Among these, enzymes with a broad substrate specificity are preferred. Specifically, L-amino acid oxidase described in Enzyme and Microbial Technology vol.31 (2002) p77-87, D-amino acid oxidase manufactured by Sigma-Aldrich, etc. are preferred.

[0213] When the above amino acid oxidase, amino acid dehydrogenase or amino acid transferase reacts only with the diamino acid and corresponds to the coenzyme that can be used in the reduction reaction of the present invention, it can be an alternative system for the coenzyme regeneration system, and thus is preferred. That is, when NAD(P)H is used as the coenzyme in the reduction reaction of the present invention, NAD(P)H will become NAD(P) as the reaction is reduced + On the other hand, this NAD(P) can be utilized when producing a cyclic amino acid having a double bond at the 1-position from the diamino acid +Conversion to NAD(P)H, and thus is preferred.

[0214] In addition, when various amino acid oxidases are used in the production of cyclic amino acids having a double bond at the 1-position from di-amino acids, hydrogen peroxide is generated during the reaction, and it is considered that this will have an adverse effect on the reaction such as reducing enzyme activity. Therefore, it is preferable to combine other enzymes to remove hydrogen peroxide. As the enzyme for removing hydrogen peroxide, there is no particular limitation as long as it is an enzyme that reacts with hydrogen peroxide. Specifically, catalase and peroxidase are preferred. The amount of the enzyme that reacts with hydrogen peroxide is not particularly limited as long as it is in a range that can efficiently remove the generated hydrogen peroxide. Specifically, it is used in a range of usually 0.01-fold activity to 1,000,000-fold activity, preferably 0.1-fold activity to 100,000-fold activity, relative to the amino acid oxidase.

[0215] In addition, when using amino acid oxidase, the activity can be improved by using flavin adenine dinucleotide (FAD) as a coenzyme. FAD is used in such a way that the concentration in the reaction solution reaches a range of usually 0.00001 mmol / L to 100 mmol / L, preferably 0.001 mmol / L to 10 mmol / L.

[0216] When the reaction substrate is a di-amino acid, the substrate concentration is usually in the range of 0.01 to 90% w / v, preferably 0.1 to 30% w / v.

[0217] The method for biochemically producing a cyclic amino acid having a double bond at the 1-position from a di-amino acid is not particularly limited, and it can be produced by a known method.

[0218] For example, a di-amino acid as a reaction substrate can be added to a liquid containing the above enzyme, and the reaction can be carried out at an appropriate temperature and pressure (for example, around atmospheric pressure).

[0219] The di-amino acid as the reaction substrate is usually used in a range where the substrate concentration in the reaction solution is 0.01 w / v% to 90 w / v%, preferably 0.1 w / v% to 30 w / v%. The reaction substrate can be added all at once at the start of the reaction, but from the viewpoints of reducing the influence when there is substrate inhibition of the enzyme and increasing the accumulation concentration of the product, it is preferably added continuously or intermittently.

[0220] The above reaction is carried out at a reaction temperature of usually 4 to 60 °C, preferably 10 to 50 °C, and usually at a pH of 4 to 11, preferably pH 5 to 10. The reaction time is usually about 1 hour to 72 hours.

[0221] When using amino acid oxidase, in order to supply the oxygen required for the reaction, the reaction is carried out under the condition of sufficient mixing with oxygen or air. For example, the oscillation or rotation speed of the reaction vessel can be increased, or oxygen and air can be aerated in the liquid. Generally, the aeration rate is preferably 0.1 vvm to 5.0 vvm, and it is preferably used in the range of 0.1 vvm to 1.0 vvm.

[0222] The above reaction can also be carried out using a membrane reactor or the like.

[0223] For the cyclic amino acid having a double bond at the 1-position represented by the general formula (I) generated by the above reaction, after the reaction is completed, the cells and proteins in the reaction solution can be separated by separation or purification methods well-known to those skilled in the art such as centrifugation and membrane treatment, and then extraction with organic solvents such as ethyl acetate and toluene, distillation, column chromatography using ion exchange resin or silica gel, crystallization at the isoelectric point, and crystallization based on monohydrochloride, dihydrochloride, calcium salt, etc. are appropriately combined for purification.

[0224] In the present invention, after obtaining the cyclic amino acid having a double bond at the 1-position, it can be separated and purified and supplied to the subsequent process for obtaining the L-type cyclic amino acid, or it can be directly supplied to the subsequent process for obtaining the L-type cyclic amino acid without separation and purification. In addition, the process for obtaining the cyclic amino acid having a double bond at the 1-position and the process for obtaining the L-type cyclic amino acid can be carried out in different reactors, or the two processes can be carried out in the same reactor.

[0225] Examples

[0226] The present invention will be further described in detail below by way of examples, but the present invention is not limited thereto.

[0227] It should be noted that in the following examples and reference examples, M represents mol / L, w / v represents weight / volume, DMSO represents dimethyl sulfoxide, ETDA represents ethylenediaminetetraacetic acid, IPTG represents isopropyl-β-thiogalactopyranoside, and PipC2 represents Δ 1 -piperidine-2-carboxylic acid, and PipA represents pipecolic acid.

[0228] <Example 1> (Cloning of imine reductase gene from plants)

[0229] (1) Amplification of the target gene from plants

[0230] Total RNA was extracted from Arabidopsis thaliana and Lathyrus maritimus that had grown for about 1 month since germination. Total RNA was extracted from the leaves of Morus alba that had grown for about 1 month since germination. During the extraction, an RNeasy Plant MiniKit (manufactured by QIAGEN) was used. The operation was carried out at room temperature with reference to the protocol described in this kit. From the obtained total RNA, cDNA was synthesized using a ReverTra Ace (registered trademark) qPCR RT Master Mix with gDNA Remover (manufactured by TOYOBO). Based on the obtained cDNA library, a database of genes expressed in each plant body was constructed.

[0231] PCR reaction was carried out using the obtained cDNA as a template. Primers for PCR were prepared as described in the following table. As restriction enzyme recognition sites for insertion into an Escherichia coli expression vector, restriction enzymes were added to the N-terminus and C-terminus of the primers.

[0232] [Table 1]

[0233] Table 1

[0234]

[0235] The PCR was carried out according to the protocol of TaKaRa Ex Taq (registered trademark) Hot Start Version (manufactured by TaKaRa). The composition was set as follows: 0.1 μL of Ex Taq HS, 2 μL of 10× Ex Taq buffer, 1.6 μL of dNTP mixture (each 2.5 mM), 2 μL of cDNA, 1 μL of 10 μM forward primer, 1 μL of 10 μM reverse primer, and 12.3 μL of Milli-Q (registered trademark), with a total volume of 20 μL. As the primers for amplifying the imine reductase gene AtP2CR, the sequence described in SEQ ID NO: 13 was used as the forward primer, and the sequence described in SEQ ID NO: 14 was used as the reverse primer. For the MaP2CR gene, the sequence described in SEQ ID NO: 15 was used as the forward primer, and the sequence described in SEQ ID NO: 16 was used as the reverse primer. For the LjP2CR gene, the sequence described in SEQ ID NO: 17 was used as the forward primer, and the sequence described in SEQ ID NO: 18 was used as the reverse primer. Regarding the reaction conditions, initial denaturation was carried out at 95°C for 2 minutes, followed by denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and extension reaction at 72°C for 1 minute and 10 seconds. The above was repeated 30 cycles, and finally, an extension reaction was carried out at 72°C for 5 minutes. The reaction product was subjected to electrophoresis using a 2% (w / v) agarose gel prepared with 1× TAE buffer (Tris-acetate-EDTA buffer) and stained with GelRed (trademark) nucleic acid gel staining solution (×10,000) DMSO solution. After electrophoresis, a single band near the target 1100 bp was cut out from the agarose gel with a scalpel, and cDNA was extracted using Wizard (registered trademark) SV Gel and PCR Clean-UP System (manufactured by Promega). The operation was carried out according to the protocol attached to this system.

[0236] 4 μL of each purified DNA fragment obtained, 1 μL of T-Vector pMD19 (manufactured by TaKaRa Bio), and 5 μL of DNA Ligation Kit Mighty Mix (manufactured by TaKaRa) were mixed, and a ligation reaction was carried out at a reaction temperature of 16°C for 30 minutes. Escherichia coli DH5α was transformed using this ligation solution.

[0237] In order to obtain the base sequence of the inserted DNA fragment, approximately 100 ng of the obtained plasmid was used, and a sequencing reaction was carried out using BigDye (registered trademark) Terminator v3.1 / 1 Cycle Sequencing Kit (manufactured by Applied Biosystems). The obtained sample was subjected to ABI PRISM (trademark) genetic analyzer, and thus each gene sequence was confirmed.

[0238] As a result of confirming the inserted gene sequences, it was confirmed that the gene sequence of AtP2CR was the sequence shown in SEQ ID NO: 1, and the encoded amino acid sequence was the sequence shown in SEQ ID NO: 2. In addition, it was confirmed that the gene sequence of MaP2CR was the sequence shown in SEQ ID NO: 3, the encoded amino acid sequence was SEQ ID NO: 4, the gene sequence of LjP2CR was the sequence shown in SEQ ID NO: 5, and the encoded amino acid sequence was SEQ ID NO: 6.

[0239] (2) Preparation of expression vectors

[0240] The candidate genes AtP2CR, MaP2CR, and LjP2CR subcloned into pMD19 in (1) above were treated with respective restriction enzymes and cut from the multiple cloning site. After confirming digestion by electrophoresis, the target DNA fragment was excised, purified, and the purified cloned DNA fragment was ligated and transformed into the pGEX 4T-1 vector (manufactured by TaKaRa) for E. coli expression vector that had been similarly treated with restriction enzymes as in (1) above. After about 18 hours, the formed colonies were grown in 2 mL of LB liquid medium (100 μg / mL ampicillin), and plasmid extraction, restriction enzyme treatment, and confirmation of the inserted sequence were performed in the same manner as in (1) above. The constructed expression vectors were named pGEX-AtP2CR, pGEX-MaP2CR, and pGEX-LjP2CR, respectively. The enzymes expressed by each vector were GST-fusion proteins. It was confirmed that: the gene sequence of GST-fusion AtP2CR was the sequence shown in SEQ ID NO: 7, the encoded amino acid sequence was SEQ ID NO: 8, the gene sequence of GST-fusion MaP2CR was the sequence shown in SEQ ID NO: 9, the encoded amino acid sequence was SEQ ID NO: 10, the gene sequence of GST-fusion LjP2CR was the sequence shown in SEQ ID NO: 11, and the encoded amino acid sequence was SEQ ID NO: 12.

[0241] (3) Cultivation of recombinant bacteria

[0242] E. coli BL21(DE3) was transformed with the expression vectors prepared in (2) above. After about 18 hours, the formed colonies were picked up with toothpicks and placed in 2 mL of LB liquid medium (100 μL / mL ampicillin) and cultured overnight as a pre-culture solution. 500 μL of the pre-culture solution was added to 50 mL of LB liquid medium (100 μg / mL ampicillin) and cultured at a culture temperature of 37 °C and 225 rpm until the turbidity (OD600) reached about 0.5, and then IPTG was added to a final concentration of 0.1 mM. It was cultured at a culture temperature of 18 °C and 150 rpm for about 18 hours. As a negative control, the same expression operation was performed using a vector without an inserted foreign gene.

[0243] (4) Confirmation of gene expression

[0244] Each soluble protein fraction obtained in the above (3) was purified by a GST-Tagged protein purification kit (manufactured by Clontech Laboratories, Inc.) (GST-tag purification) to obtain an enzyme solution. The operation was carried out according to the protocol attached to the kit.

[0245] The enzyme solution (soluble protein) obtained by GST-tag purification was subjected to SDS-PAGE to confirm the expression of the target protein. As a result, it was confirmed that the molecular weights of the respective recombinant enzymes were approximately 60 kDa with a tag of approximately 25 kDa added.

[0246] <Example 2> (Confirmation of the activity of imine reductase derived from plants)

[0247] (1) Enzyme reaction

[0248] The enzyme reactions were carried out using each enzyme solution (P2CR purified recombinant enzyme solution) obtained in Example 1. As the reaction vessel, a 1.5 mL Eppendorf tube was used, and the volume of the enzyme reaction solution was 100 μL. Since commercially available PipC2 was not available as a substrate, PipC2 obtained by enzymatic synthesis from L-lysine using the aminotransferase MaALD1 obtained in Reference Example 1 described below was used. Table 2 shows the composition of the PipC2 enzyme reaction solution.

[0249] [Table 2]

[0250] Table 2

[0251]

[0252] The enzyme reactions were carried out using an oscillating thermostat (manufactured by AS ONE Corporation) with oscillation at a reaction temperature of 30 °C and 1000 rpm. The reaction time was set to 120 minutes. The reaction was stopped by heating at 98 °C for 5 minutes to inactivate the enzyme. Then, centrifugation was carried out at room temperature and 15,000 rpm for 10 minutes, and the resulting supernatant was used as the PipC2 enzyme synthesis solution.

[0253] *NADPH was added to the PipC2 enzyme synthesis solution to a final concentration of 10 mM, and 20 μL of each P2CR purified recombinant enzyme obtained in Example 1 was added, and the reaction was carried out under the same conditions as the reaction using the above enzyme MaALD1 to obtain an enzyme reaction product.

[0254] (2) Analysis of the enzyme reaction product

[0255] The analysis of the enzyme reaction products was carried out by liquid chromatography - mass spectrometry (LCMS). First, derivatization of each sample (enzyme reaction product) was performed. Using the AccQ·Tag Ultra Derivatization Kit (Derivatization Kit) (manufactured by Waters Corporation), it was mixed in the formulation shown in Table 3. It should be noted that the derivatizing reagent solution was added last. After mixing, it was incubated at 55 °C for 10 minutes.

[0256] [Table 3]

[0257] Table 3

[0258]

[0259] The substance obtained by derivatization was diluted 2-fold with pure water to obtain a sample for LCMS analysis. The analysis conditions for HPLC-MS are shown in Table 4.

[0260] [Table 4]

[0261] Table 4

[0262]

[0263] When the enzyme reaction product was subjected to LCMS analysis to confirm the activity, a new peak with the same retention time as the standard L-PipA and an MS pattern was confirmed. In addition, PipA could not be detected in the control.

[0264] This result indicates that AtP2CR, MaP2CR, and LjP2CR have the ability to reduce PipC2 and convert it to PipA.

[0265] To determine whether the generated PipA is of the D-type or L-type, it was subjected to HPLC analysis using a chiral column Astec CLC-D4.6×150mm (5μm) (manufactured by Sigma-Aldrich Corporation). The results are shown in Figure 1 . It was clarified that the enzyme reaction products of P2CR obtained from three plants, Arabidopsis thaliana, Lathyrus maritimus, and Morus alba, were all L-pipecolic acid.

[0266] (3) Analysis of enzyme catalytic activity

[0267] A PipC2 enzyme reaction solution was prepared with the same composition as in Example 2(1). *NADPH was added to the PipC2 enzyme reaction solution at final concentrations of 500 μM, 300 μM, 150 μM, 80 μM, 40 μM, 20 μM, and 10 μM in a total volume of 1 mL after adding the enzyme solution. Finally, 50 mM Tris-HCl (pH 7.2) was added to each enzyme reaction solution to bring the total volume to 900 μL. This was used as the reaction solution.

[0268] To these reaction solutions, 100 μL of the purified recombinant enzyme solution of AtP2CR obtained in Example 1 was added separately to start the reaction. The absorbance at 340 nm was measured from the start of the reaction for 10 minutes. The same experiment was carried out 3 times and the average value was calculated.

[0269] The reaction rate was calculated from the measured values obtained. Using the calculated reaction rate, various kinetic parameters (Michaelis constant Km and maximum reaction rate Vmax) were calculated from the Hanes-Woolf plot (Hanes CS., (1932), vol.26,5,1406, Biochemical Journal).

[0270] For LjP2CR, the reaction, measurement, and calculation were carried out in the same manner as for AtP2CR.

[0271] For MaP2CR, the reaction was carried out under the conditions where the above *NADPH concentrations were 80 μM, 40 μM, 20 μM, 10 μM, 2 μM, 1 μΜ, and 0.5 μM, and the measurement and calculation were carried out in the same manner as for AtP2CR except for this.

[0272] The change in absorbance measured was converted to the change in *NADPH concentration using the molar extinction coefficient of *NADPH of 6.3×10 (1 / mmol·cm). The reaction rate (μM / s) in the decrease of *NADPH was calculated from this value. It should be noted that the value of the decrease in absorbance used was the value during the period of linear decrease from the start of the measurement.

[0273] By plotting the values of substrate concentration / reaction rate at each *NADPH concentration, the linear approximation line of the Hanes-Woolf plot was obtained. The results are shown in Figure 2 . Figure 2Among them, (1) is AtP2CR, (2) is MaP2CR, and (3) is LjP2CR. In the results of the three P2CRs, R2 is 0.99 for all, so it is considered that highly reliable results are obtained. In the Hanes-Woolf plot, the slope is 1 / Vmax, and the intersection with the x-axis is Km. Then, the maximum reaction rate Vmax and Km are calculated by the Hanes-Woolf formula. The Vmax of AtP2CR is 208.73 nmol / min / mg, and the Km is 33.42 μM. The Vmax of MaP2CR is 24.00 nmol / min / mg, and the Km is 6.16 μM. The Vmax of LjP2CR is 199.55 nmol / min / mg, and the Km is 170.24 μM.

[0274] In addition, non-linear regression analysis was performed using ANEMONA (Hernandez and Ruiz, (1998) 14, 2, 227, Bioinformatics), and Vmax and Km were calculated in the same way. The Michaelis-Menten model using ANEMONA is shown in Figure 3 . Figure 3 Among them, (1) is AtP2CR, (2) is MaP2CR, and (3) is LjP2CR. The Vmax of AtP2CR is 215.5 nmol / min / mg, and the Km is 34.29 μM. The Vmax of MaP2CR is 21.2 nmol / min / mg, and the Km is 3.57 μM. The Vmax of LjP2CR is 187.3 nmol / min / mg, and the Km is 155.03 μM.

[0275] The values of Vmax and Km obtained by the two methods of Hanes-Woolf plot and ANEMONA are similar. Therefore, it is considered that the values obtained by non-linear regression are close to the true values of Vmax and Km, and the Vmax and Km obtained by ANEMONA are adopted.

[0276] [Table 5]

[0277] Table 5

[0278]

[0279] (km: mM)

[0280] *AtP2CR, MaP2CR, and LiP2CR are all GST fusion proteins

[0281] The literature (Muramatsu et al., (2005), vol. 280, 7, 5329 THE JOURNAL OF BIOLOGICAL CHEMISTRY) reported that the Vmax of PipC2 reductase dpkA from the microorganism Pseudomonas putida, which is used as an industrial enzyme catalyst for PipA production, is 220 nmol / minute / mg and the Km is 140 μM.

[0282] As shown in Table 5, the Kcat / km value, which is an index of catalytic activity calculated from this literature, is 56, but the Kcat / km values of the enzymes of the present invention are all values exceeding this value. Therefore, it can be known that AtP2CR, MaP2CR, and LjP2CR all have excellent ability to reduce PipC2 and convert it into PipA, and are also stable enzymatically and are excellent enzyme catalysts.

[0283] <Reference Example 1> (Preparation of Lysine Aminotransferase MaALD1 from Plants)

[0284] (a) Cloning of the Lysine Aminotransferase Gene MaALD1 from Plants

[0285] RNA was extracted from the leaves of Morus alba that had grown for about 1 month since germination using the RNeasy Plant Mini Kit (manufactured by QIAGEN). From the obtained total RNA, cDNA was synthesized using the ReverTra Ace (registered trademark) qPCR RT reaction mixture containing gDNA remover (manufactured by TOYOBO).

[0286] PCR reaction was carried out using the obtained cDNA as a template. Regarding the primers, MaALD1-FW (GGATCCATGACGCATAATTATTCTCAG) (SEQ ID NO: 20) and MaALD1-RV (GTCGACTCATTTGTAAAGAGATTTTAGTC) (SEQ ID NO: 21) were used. The reaction was carried out based on the protocol of TaKaRa Ex Taq (registered trademark) hot start version (manufactured by TaKaRa).

[0287] The purified DNA was cloned into T-Vector pMD19 (manufactured by TaKaRa Bio Inc.). As a result of sequence analysis, it was confirmed to be the gene encoding aminotransferase MaALD1 (Accession No. 19). The gene region of MaALD1 subcloned into pMD19 was treated with restriction enzymes BamHI and SalI and cut out from the multiple cloning site. After confirmation of digestion by electrophoresis, the target DNA fragment was excised, and the purified DNA fragment was ligated into the Escherichia coli expression vector pCold ProS2 vector (manufactured by TaKaRa Bio Inc.) that had been similarly treated with restriction enzymes after purification. Escherichia coli DH5α was transformed using this solution, and the target plasmid was thus constructed. The obtained plasmid was named pCold-MaALD1.

[0288] (b) Expression of the recombinant enzyme

[0289] Escherichia coli (BL21 strain) was transformed using the expression vector pCold-MaALD1 prepared in (a) above. Approximately 18 hours later, the formed colonies were picked up with a toothpick and placed into 2 mL of LB liquid medium (100 μL / mL ampicillin) and cultured overnight as a pre-culture solution. 500 μL of the pre-culture solution was added to 50 mL of LB liquid medium (100 μg / mL ampicillin) and cultured at a culture temperature of 37 °C and 225 rpm until the turbidity (OD600) reached approximately 0.5. Next, the pCold-MaALD1 transformant was allowed to stand on ice for 30 minutes, and IPTG was added to a final concentration of 0.1 mM. It was then cultured at a culture temperature of 15 °C and 150 rpm for approximately 18 hours.

[0290] (c) Purification of the recombinant enzyme

[0291] The culture solution obtained in (b) above was transferred to a 50 mL Falcon (registered trademark) tube and centrifuged at 2330×g and 4 °C for 10 minutes.

[0292] The supernatant was discarded, 5 mL of 1×PBS (phosphate buffer solution) was added to the cells, and they were resuspended using a vortex mixer. Then, they were centrifuged under the same conditions as the previous centrifugation to wash the cells. This operation was repeated 2 times.

[0293] Add 4 mL of sonication buffer {50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 10% (v / v) glycerol, 5 mM dithiothreitol (DTT)} to the recovered cells, and disrupt the cells by sonication (50% duty, output 2, 30 seconds × 2 times). Centrifuge at 15,000 rpm and 4 °C for 10 minutes to obtain the supernatant as the soluble protein fraction and the precipitate as the insoluble protein fraction.

[0294] Purify the obtained soluble protein fraction using a His-Tagged Purification Miniprep Kit (manufactured by Clontech Laboratories, Inc.) to obtain MaALD1. Sequence Listing <110> API Co., Ltd. <120> Method for Producing L-Type Cyclic Amino Acid <130> AP360-200759 <150> JP2019-084234 <151> 2019-04-25 <160> 21 <170> PatentIn version 3.5 <210> 1 <211> 978 <212> DNA <213> Arabidopsis thaliana <400> 1 atggctgcat taccagtatt cataccagca gagtcatttc catcgatcct ctcacatgaa 60 accttgatca atcactttcg gaccaatctt ccgaaacatt catcaacaat cacaagccct 120 gtccggcaaa actacaccgt ttcatcacct tcctctctcc tcctcatgcc ttcttggtca 180 tcttcttctt ctctccctta catgggcgtc aagctcgtga cctatttccc tcataactct 240 tctcagaact tacctggcat ccatggatcc tacacactct ttagctccac tacaggccaa 300 accttagcta caatggatgg tactgtttta accctttacc gtacttcctc tgtttcaggc 360 ttaggatcca aaatcctagc tagagacgat agtcaagtgc tgatcatggt tggttccggt 420 gctctcgcac cacacctgat caaatcccat ctagctgcga gaccaagctt gagaagagtg 480 atcatatgga acagaactcc acaaagggct caggagttag ctgaaaccct ctccaaggat 540 cctcaacaca aggagatttc attcgatagc cacgattcgc tagatcaaat cattcctcta 600 ggagatatta taagctgtgc aacaaactca actgttccat tggtcaaagg tgagttcttg 660 aaacccggaa cccatcttga ccttgctgga tcgtttagcc atgaaatgaa ggaatgtgac 720 gacaatgcga tacagagagg gagtgtgttt gtcgataatg acactgcgat gatagaagca 780 ggagagctcg cgggagcgtt tgagagagga gtgattaaga gagaagacat ttgtgggaat 840 ttggtggagt tgatcaaagg tgacaaagaa gggagaaaga gttcaacaga cataacagtg 900 tttaagtccg tcggttcggg taccgtagat ctcttaaccg cacaacttgt tcacgagact 960 tacctcagcc gttgttaa 978 <210> 2 <211> 325 <212> PRT <213> Arabidopsis thaliana <400> 2 Met Ala Ala Leu Pro Val Phe Ile Pro Ala Glu Ser Phe Pro Ser Ile 1 5 10 15 Leu Ser His Glu Thr Leu Ile Asn His Phe Arg Thr Asn Leu Pro Lys 20 25 30 His Ser Ser Thr Ile Thr Ser Pro Val Arg Gln Asn Tyr Thr Val Ser 35 40 45 Ser Pro Ser Ser Leu Leu Leu Met Pro Ser Trp Ser Ser Ser Ser Ser 50 55 60 Leu Pro Tyr Met Gly Val Lys Leu Val Thr Tyr Phe Pro His Asn Ser 65 70 75 80 Ser Gln Asn Leu Pro Gly Ile His Gly Ser Tyr Thr Leu Phe Ser Ser 85 90 95 Thr Thr Gly Gln Thr Leu Ala Thr Met Asp Gly Thr Val Leu Thr Leu 100 105 110 Tyr Arg Thr Ser Ser Val Ser Gly Leu Gly Ser Lys Ile Leu Ala Arg 115 120 125 Asp Asp Ser Gln Val Leu Ile Met Val Gly Ser Gly Ala Leu Ala Pro 130 135 140 His Leu Ile Lys Ser His Leu Ala Ala Arg Pro Ser Leu Arg Arg Val 145 150 155 160 Ile Ile Trp Asn Arg Thr Pro Gln Arg Ala Gln Glu Leu Ala Glu Thr 165 170 175 Leu Ser Lys Asp Pro Gln His Lys Glu Ile Ser Phe Asp Ser His Asp 180 185 190 Ser Leu Asp Gln Ile Ile Pro Leu Gly Asp Ile Ile Ser Cys Ala Thr 195 200 205 Asn Ser Thr Val Pro Leu Val Lys Gly Glu Phe Leu Lys Pro Gly Thr 210 215 220 His Leu Asp Leu Ala Gly Ser Phe Ser His Glu Met Lys Glu Cys Asp 225 230 235 240 Asp Asn Ala Ile Gln Arg Gly Ser Val Phe Val Asp Asn Asp Thr Ala 245 250 255 Met Ile Glu Ala Gly Glu Leu Ala Gly Ala Phe Glu Arg Gly Val Ile 260 265 270 Lys Arg Glu Asp Ile Cys Gly Asn Leu Val Glu Leu Ile Lys Gly Asp 275 280 285 Lys Glu Gly Arg Lys Ser Ser Thr Asp Ile Thr Val Phe Lys Ser Val 290 295 300 Gly Ser Gly Thr Val Asp Leu Leu Thr Ala Gln Leu Val His Glu Thr 305 310 315 320 Tyr Leu Ser Arg Cys 325 <210> 3 <211> 999 <212> DNA <213> Morus alba <400> 3 atggcttcca caaccaccgc cataacatcc ccaatcttca tcaccactca atcctttcac 60 accatcctct ctcgccaaac tcttatggac cacttccatt cgtctctccc cacagtctct 120 gcttctctct ctaccccact ccgccaaaac cacgccgttt cacccacctc ctctctcctc 180 ctcatgccct cttggtccac ctctccttct ctcccttaca ttggcgtcaa gctagtcact 240 tacttccctc aaagctccac cttaagttta cccggcattc acgccagtta cgtcctcttc 300 agctccgcaa ctgggcagac cttggcttcc atggacggaa ctgcactgac ccttttcaga 360 acttcatgtg tttctggctt ggcttcccgg attttggcca gagacgacag caaagtcctc 420 gtcatgatcg gtgcgggcgc cttggcgccg catttgatca aggcccatct caccgcgaga 480 cccggtttgg agagagttgt catctggaac cgcacggtgg agaaagctag aaacttggct 540 gagcaactgc aacaaagttc ggggcttgac ggggtttgtt tcgagagtaa tgggtgcttg 600 gaggaagttg ttgggatggg agatattgtg agctgcgcaa cgaactcgga ggcgcctctt 660 gtgaagggcc agaagctgaa gccaggggca catcttgact tggttgggtc attcaagcac 720 tcaatgaggg agtgtgatga cgaggcgatt cagagaggta gaatttttgt ggacaatgag 780 gctgcgttgg tggaggcagg agagttggtg ggcgcttttg agagaggtgt gattacgaaa 840 gaagacattg gagggaattt ggtggaactt ataatggggg agaaggttgg aagaagagat 900 tctgaggagg tcactgtgtt taagtccgtt ggatccgcag cggtggatat tcttgctgca 960 caattggtgt atgagaccta tttgcagcaa aataactag 999 <210> 4 <211> 332 <212> PRT <213> Mulberry (Morus alba) <400> 4 Met Ala Ser Thr Thr Thr Ala Ile Thr Ser Pro Ile Phe Ile Thr Thr 1 5 10 15 Gln Ser Phe His Thr Ile Leu Ser Arg Gln Thr Leu Met Asp His Phe 20 25 30 His Ser Ser Leu Pro Thr Val Ser Ala Ser Leu Ser Thr Pro Leu Arg 35 40 45 Gln Asn His Ala Val Ser Pro Thr Ser Ser Leu Leu Leu Met Pro Ser 50 55 60 Trp Ser Thr Ser Pro Ser Leu Pro Tyr Ile Gly Val Lys Leu Val Thr 65 70 75 80 Tyr Phe Pro Gln Ser Ser Thr Leu Ser Leu Pro Gly Ile His Ala Ser 85 90 95 Tyr Val Leu Phe Ser Ser Ala Thr Gly Gln Thr Leu Ala Ser Met Asp 100 105 110 Gly Thr Ala Leu Thr Leu Phe Arg Thr Ser Cys Val Ser Gly Leu Ala 115 120 125 Ser Arg Ile Leu Ala Arg Asp Asp Ser Lys Val Leu Val Met Ile Gly 130 135 140 Ala Gly Ala Leu Ala Pro His Leu Ile Lys Ala His Leu Thr Ala Arg 145 150 155 160 Pro Gly Leu Glu Arg Val Val Ile Trp Asn Arg Thr Val Glu Lys Ala 165 170 175 Arg Asn Leu Ala Glu Gln Leu Gln Gln Ser Ser Gly Leu Asp Gly Val 180 185 190 Cys Phe Glu Ser Asn Gly Cys Leu Glu Glu Val Val Gly Met Gly Asp 195 200 205 Ile Val Ser Cys Ala Thr Asn Ser Glu Ala Pro Leu Val Lys Gly Gln 210 215 220 Lys Leu Lys Pro Gly Ala His Leu Asp Leu Val Gly Ser Phe Lys His 225 230 235 240 Ser Met Arg Glu Cys Asp Asp Glu Ala Ile Gln Arg Gly Arg Ile Phe 245 250 255 Val Asp Asn Glu Ala Ala Leu Val Glu Ala Gly Glu Leu Val Gly Ala 260 265 270 Phe Glu Arg Gly Val Ile Thr Lys Glu Asp Ile Gly Gly Asn Leu Val 275 280 285 Glu Leu Ile Met Gly Glu Lys Val Gly Arg Arg Asp Ser Glu Glu Val 290 295 300 Thr Val Phe Lys Ser Val Gly Ser Ala Ala Val Asp Ile Leu Ala Ala 305 310 315 320 Gln Leu Val Tyr Glu Thr Tyr Leu Gln Gln Asn Asn 325 330 <210> 5 <211> 1035 <212> DNA <213> Lathyrus japonicus <400> 5 atggcttccg caaacaaaga ccaaaaaacc acaaacaccg tgtcgtcttc ttcttcttct 60 tcttctccaa tcttcatttc cactgagaat ttacaaacta tcctcaccca tcaaactcta 120 atgaagcaca tcgactccaa tctccccaaa gtttcaacct ttctccaaac cccaattcgc 180 caacactata gtctctctcc ttcctcttct ctcctcctca tgccttcatg gtcttcttct 240 tcctccttcc cttacgttgg tgtcaaactt gtgacccatt tccctcaaaa ttcctcaatc 300 aatttacctg gtgttcaagg tagctatgtc ctcttcaatt caaccacggg tcaaaccctt 360 gcttctatgg attccacgga acttacgctt tacagaacct cttgtgtctc tggtttggct 420 tctagatatt tatctagaga tgatagtgag gttcttgtta tggttggtgc tggtcccctt 480 gcacctcatt tgatcagagc tcatttttca gctagaccca gtttgagaaa agtgttgatt 540 tggaatagga ctgttgaaaa ggcagaagct ttggctaaga atctgagaga aagtgatgag 600 ttttcactct cagggttgag ttttgagggt tgtgggtgtt tgaatgaggt tgttggactt 660 ggggatattg tgagctgtgc tacaaattcc gagatggcgc ttgtgaaagg tgagaggttg 720 aaggttggag ctcatttgga tttggtgggt tcttttaagc cttcaatgaa ggaatgtgat 780 gatgaggctt tgaaaagggg gaaagtgttt gtggacaatg aggctgcatt ggttgaagca 840 ggggagctgg tgggtgcttt tgaaagggga gtgatcaagg aagatgaaat tgaggcaaat 900 ttggtggagc ttattagagg tgataaagtt gggagaagaa gttcagagga aattactgtt 960 tttaagtctg ttggttctgc tgttgttgat atgctggctg cacagtttgt ttatgagtca 1020 tacataggaa aatag 1035 <210> 6 <211> 344 <212> PRT <213> Lathyrus japonicus <400> 6 Met Ala Ser Ala Asn Lys Asp Gln Lys Thr Thr Asn Thr Val Ser Ser 1 5 10 15 Ser Ser Ser Ser Ser Ser Pro Ile Phe Ile Ser Thr Glu Asn Leu Gln 20 25 30 Thr Ile Leu Thr His Gln Thr Leu Met Lys His Ile Asp Ser Asn Leu 35 40 45 Pro Lys Val Ser Thr Phe Leu Gln Thr Pro Ile Arg Gln His Tyr Ser 50 55 60 Leu Ser Pro Ser Ser Ser Leu Leu Leu Met Pro Ser Trp Ser Ser Ser 65 70 75 80 Ser Ser Phe Pro Tyr Val Gly Val Lys Leu Val Thr His Phe Pro Gln 85 90 95 Asn Ser Ser Ile Asn Leu Pro Gly Val Gln Gly Ser Tyr Val Leu Phe 100 105 110 Asn Ser Thr Thr Gly Gln Thr Leu Ala Ser Met Asp Ser Thr Glu Leu 115 120 125 Thr Leu Tyr Arg Thr Ser Cys Val Ser Gly Leu Ala Ser Arg Tyr Leu 130 135 140 Ser Arg Asp Asp Ser Glu Val Leu Val Met Val Gly Ala Gly Pro Leu 145 150 155 160 Ala Pro His Leu Ile Arg Ala His Phe Ser Ala Arg Pro Ser Leu Arg 165 170 175 Lys Val Leu Ile Trp Asn Arg Thr Val Glu Lys Ala Glu Ala Leu Ala 180 185 190 Lys Asn Leu Arg Glu Ser Asp Glu Phe Ser Leu Ser Gly Leu Ser Phe 195 200 205 Glu Gly Cys Gly Cys Leu Asn Glu Val Val Gly Leu Gly Asp Ile Val 210 215 220 Ser Cys Ala Thr Asn Ser Glu Met Ala Leu Val Lys Gly Glu Arg Leu 225 230 235 240 Lys Val Gly Ala His Leu Asp Leu Val Gly Ser Phe Lys Pro Ser Met 245 250 255 Lys Glu Cys Asp Asp Glu Ala Leu Lys Arg Gly Lys Val Phe Val Asp 260 265 270 Asn Glu Ala Ala Leu Val Glu Ala Gly Glu Leu Val Gly Ala Phe Glu 275 280 285 Arg Gly Val Ile Lys Glu Asp Glu Ile Glu Ala Asn Leu Val Glu Leu 290 295 300 Ile Arg Gly Asp Lys Val Gly Arg Arg Ser Ser Glu Glu Ile Thr Val 305 310 315 320 Phe Lys Ser Val Gly Ser Ala Val Val Asp Met Leu Ala Ala Gln Phe 325 330 335 Val Tyr Glu Ser Tyr Ile Gly Lys 340 <210> 7 <211> 1665 <212> DNA <213> Artificial Sequence <220> <223> Fusion protein <400> 7 atgtccccta tactaggtta ttggaaaatt aagggccttg tgcaacccac tcgacttctt 60 ttggaatatc ttgaagaaaa atatgaagag catttgtatg agcgcgatga aggtgataaa 120 tggcgaaaca aaaagtttga attgggtttg gagtttccca atcttcctta ttatattgat 180 ggtgatgtta aattaacaca gtctatggcc atcatacgtt atatagctga caagcacaac 240 atgttgggtg gttgtccaaa agagcgtgca gagatttcaa tgcttgaagg agcggttttg 300 gatattagat acggtgtttc gagaattgca tatagtaaag actttgaaac tctcaaagtt 360 gattttctta gcaagctacc tgaaatgctg aaaatgttcg aagatcgttt atgtcataaa 420 acatatttaa atggtgatca tgtaacccat cctgacttca tgttgtatga cgctcttgat 480 gttgttttat acatggaccc aatgtgcctg gatgcgttcc caaaattagt ttgttttaaa 540 aaacgtattg aagctatccc acaaattgat aagtacttga aatccagcaa gtatatagca 600 tggcctttgc agggctggca agccacgttt ggtggtggcg accatcctcc aaaatcggat 660 ctggttccgc gtggatcccc ggaattcatg gctgcattac cagtattcat accagcagag 720 tcatttccat cgatcctctc acatgaaacc ttgatcaatc actttcggac caatcttccg 780 aaacattcat caacaatcac aagccctgtc cggcaaaact acaccgtttc atcaccttcc 840 tctctcctcc tcatgccttc ttggtcatct tcttcttctc tcccttacat gggcgtcaag 900 ctcgtgacct atttccctca taactcttct cagaacttac ctggcatcca tggatcctac 960 acactcttta gctccactac aggccaaacc ttagctacaa tggatggtac tgttttaacc 1020 ctttaccgta cttcctctgt ttcaggctta ggatccaaaa tcctagctag agacgatagt 1080 caagtgctga tcatggttgg ttccggtgct ctcgcaccac acctgatcaa atcccatcta 1140 gctgcgagac caagcttgag aagagtgatc atatggaaca gaactccaca aagggctcag 1200 gagttagctg aaaccctctc caaggatcct caacacaagg agatttcatt cgatagccac 1260 gattcgctag atcaaatcat tcctctagga gatattataa gctgtgcaac aaactcaact 1320 gttccattgg tcaaaggtga gttcttgaaa cccggaaccc atcttgacct tgctggatcg 1380 tttagccatg aaatgaagga atgtgacgac aatgcgatac agagagggag tgtgtttgtc 1440 gataatgaca ctgcgatgat agaagcagga gagctcgcgg gagcgtttga gagaggagtg 1500 attaagagag aagacatttg tgggaatttg gtggagttga tcaaaggtga caaagaaggg 1560 agaaagagtt caacagacat aacagtgttt aagtccgtcg gttcgggtac cgtagatctc 1620 ttaaccgcac aacttgttca cgagacttac ctcagccgtt gttaa 1665 <210> 8 <211> 554 <212> PRT <213> Artificial Sequence <220> <223> Fusion Protein <400> 8 Met Ser Pro Ile Leu Gly Tyr Trp Lys Ile Lys Gly Leu Val Gln Pro 1 5 10 15 Thr Arg Leu Leu Leu Glu Tyr Leu Glu Glu Lys Tyr Glu Glu His Leu 20 25 30 Tyr Glu Arg Asp Glu Gly Asp Lys Trp Arg Asn Lys Lys Phe Glu Leu 35 40 45 Gly Leu Glu Phe Pro Asn Leu Pro Tyr Tyr Ile Asp Gly Asp Val Lys 50 55 60 Leu Thr Gln Ser Met Ala Ile Ile Arg Tyr Ile Ala Asp Lys His Asn 65 70 75 80 Met Leu Gly Gly Cys Pro Lys Glu Arg Ala Glu Ile Ser Met Leu Glu 85 90 95 Gly Ala Val Leu Asp Ile Arg Tyr Gly Val Ser Arg Ile Ala Tyr Ser 100 105 110 Lys Asp Phe Glu Thr Leu Lys Val Asp Phe Leu Ser Lys Leu Pro Glu 115 120 125 Met Leu Lys Met Phe Glu Asp Arg Leu Cys His Lys Thr Tyr Leu Asn 130 135 140 Gly Asp His Val Thr His Pro Asp Phe Met Leu Tyr Asp Ala Leu Asp 145 150 155 160 Val Val Leu Tyr Met Asp Pro Met Cys Leu Asp Ala Phe Pro Lys Leu 165 170 175 Val Cys Phe Lys Lys Arg Ile Glu Ala Ile Pro Gln Ile Asp Lys Tyr 180 185 190 Leu Lys Ser Ser Lys Tyr Ile Ala Trp Pro Leu Gln Gly Trp Gln Ala 195 200 205 Thr Phe Gly Gly Gly Asp His Pro Pro Lys Ser Asp Leu Val Pro Arg 210 215 220 Gly Ser Pro Glu Phe Met Ala Ala Leu Pro Val Phe Ile Pro Ala Glu 225 230 235 240 Ser Phe Pro Ser Ile Leu Ser His Glu Thr Leu Ile Asn His Phe Arg 245 250 255 Thr Asn Leu Pro Lys His Ser Ser Thr Ile Thr Ser Pro Val Arg Gln 260 265 270 Asn Tyr Thr Val Ser Ser Pro Ser Ser Leu Leu Leu Met Pro Ser Trp 275 280 285 Ser Ser Ser Ser Ser Leu Pro Tyr Met Gly Val Lys Leu Val Thr Tyr 290 295 300 Phe Pro His Asn Ser Ser Gln Asn Leu Pro Gly Ile His Gly Ser Tyr 305 310 315 320 Thr Leu Phe Ser Ser Thr Thr Gly Gln Thr Leu Ala Thr Met Asp Gly 325 330 335 Thr Val Leu Thr Leu Tyr Arg Thr Ser Ser Val Ser Gly Leu Gly Ser 340 345 350 Lys Ile Leu Ala Arg Asp Asp Ser Gln Val Leu Ile Met Val Gly Ser 355 360 365 Gly Ala Leu Ala Pro His Leu Ile Lys Ser His Leu Ala Ala Arg Pro 370 375 380 Ser Leu Arg Arg Val Ile Ile Trp Asn Arg Thr Pro Gln Arg Ala Gln 385 390 395 400 Glu Leu Ala Glu Thr Leu Ser Lys Asp Pro Gln His Lys Glu Ile Ser 405 410 415 Phe Asp Ser His Asp Ser Leu Asp Gln Ile Ile Pro Leu Gly Asp Ile 420 425 430 Ile Ser Cys Ala Thr Asn Ser Thr Val Pro Leu Val Lys Gly Glu Phe 435 440 445 Leu Lys Pro Gly Thr His Leu Asp Leu Ala Gly Ser Phe Ser His Glu 450 455 460 Met Lys Glu Cys Asp Asp Asn Ala Ile Gln Arg Gly Ser Val Phe Val 465 470 475 480 Asp Asn Asp Thr Ala Met Ile Glu Ala Gly Glu Leu Ala Gly Ala Phe 485 490 495 Glu Arg Gly Val Ile Lys Arg Glu Asp Ile Cys Gly Asn Leu Val Glu 500 505 510 Leu Ile Lys Gly Asp Lys Glu Gly Arg Lys Ser Ser Thr Asp Ile Thr 515 520 525 Val Phe Lys Ser Val Gly Ser Gly Thr Val Asp Leu Leu Thr Ala Gln 530 535 540 Leu Val His Glu Thr Tyr Leu Ser Arg Cys 545 550 <210> 9 <211> 1677 <212> DNA <213> Artificial Sequence <220> <223> Fusion Protein <400> 9 atgtccccta tactaggtta ttggaaaatt aagggccttg tgcaacccac tcgacttctt 60 ttggaatatc ttgaagaaaa atatgaagag catttgtatg agcgcgatga aggtgataaa 120 tggcgaaaca aaaagtttga attgggtttg gagtttccca atcttcctta ttatattgat 180 ggtgatgtta aattaacaca gtctatggcc atcatacgtt atatagctga caagcacaac 240 atgttgggtg gttgtccaaa agagcgtgca gagatttcaa tgcttgaagg agcggttttg 300 gatattagat acggtgtttc gagaattgca tatagtaaag actttgaaac tctcaaagtt 360 gattttctta gcaagctacc tgaaatgctg aaaatgttcg aagatcgttt atgtcataaa 420 acatatttaa atggtgatca tgtaacccat cctgacttca tgttgtatga cgctcttgat 480 gttgttttat acatggaccc aatgtgcctg gatgcgttcc caaaattagt ttgttttaaa 540 aaacgtattg aagctatccc acaaattgat aagtacttga aatccagcaa gtatatagca 600 tggcctttgc agggctggca agccacgttt ggtggtggcg accatcctcc aaaatcggat 660 ctggttccgc gtggatccat ggcttccaca accaccgcca taacatcccc aatcttcatc 720 accactcaat cctttcacac catcctctct cgccaaactc ttatggacca cttccattcg 780 tctctcccca cagtctctgc ttctctctct accccactcc gccaaaacca cgccgtttca 840 cccacctcct ctctcctcct catgccctct tggtccacct ctccttctct cccttacatt 900 ggcgtcaagc tagtcactta cttccctcaa agctccacct taagtttacc cggcattcac 960 gccagttacg tcctcttcag ctccgcaact gggcagacct tggcttccat ggacggaact 1020 gcactgaccc ttttcagaac ttcatgtgtt tctggcttgg cttcccggat tttggccaga 1080 gacgacagca aagtcctcgt catgatcggt gcgggcgcct tggcgccgca tttgatcaag 1140 gcccatctca ccgcgagacc cggtttggag agagttgtca tctggaaccg cacggtggag 1200 aaagctagaa acttggctga gcaactgcaa caaagttcgg ggcttgacgg ggtttgtttc 1260 gagagtaatg ggtgcttgga ggaagttgtt gggatgggag atattgtgag ctgcgcaacg 1320 aactcggagg cgcctcttgt gaagggccag aagctgaagc caggggcaca tcttgacttg 1380 gttgggtcat tcaagcactc aatgagggag tgtgatgacg aggcgattca gagaggtaga 1440 atttttgtgg acaatgaggc tgcgttggtg gaggcaggag agttggtggg cgcttttgag 1500 agaggtgtga ttacgaaaga agacattgga gggaatttgg tggaacttat aatgggggag 1560 aaggttggaa gaagagattc tgaggaggtc actgtgttta agtccgttgg atccgcagcg 1620 gtggatattc ttgctgcaca attggtgtat gagacctatt tgcagcaaaa taactag 1677 <210> 10 <211> 558 <212> PRT <213> Artificial Sequence <220> <223> Fusion Protein <400> 10 Met Ser Pro Ile Leu Gly Tyr Trp Lys Ile Lys Gly Leu Val Gln Pro 1 5 10 15 Thr Arg Leu Leu Leu Glu Tyr Leu Glu Glu Lys Tyr Glu Glu His Leu 20 25 30 Tyr Glu Arg Asp Glu Gly Asp Lys Trp Arg Asn Lys Lys Phe Glu Leu 35 40 45 Gly Leu Glu Phe Pro Asn Leu Pro Tyr Tyr Ile Asp Gly Asp Val Lys 50 55 60 Leu Thr Gln Ser Met Ala Ile Ile Arg Tyr Ile Ala Asp Lys His Asn 65 70 75 80 Met Leu Gly Gly Cys Pro Lys Glu Arg Ala Glu Ile Ser Met Leu Glu 85 90 95 Gly Ala Val Leu Asp Ile Arg Tyr Gly Val Ser Arg Ile Ala Tyr Ser 100 105 110 Lys Asp Phe Glu Thr Leu Lys Val Asp Phe Leu Ser Lys Leu Pro Glu 115 120 125 Met Leu Lys Met Phe Glu Asp Arg Leu Cys His Lys Thr Tyr Leu Asn 130 135 140 Gly Asp His Val Thr His Pro Asp Phe Met Leu Tyr Asp Ala Leu Asp 145 150 155 160 Val Val Leu Tyr Met Asp Pro Met Cys Leu Asp Ala Phe Pro Lys Leu 165 170 175 Val Cys Phe Lys Lys Arg Ile Glu Ala Ile Pro Gln Ile Asp Lys Tyr 180 185 190 Leu Lys Ser Ser Lys Tyr Ile Ala Trp Pro Leu Gln Gly Trp Gln Ala 195 200 205 Thr Phe Gly Gly Gly Asp His Pro Pro Lys Ser Asp Leu Val Pro Arg 210 215 220 Gly Ser Met Ala Ser Thr Thr Thr Ala Ile Thr Ser Pro Ile Phe Ile 225 230 235 240 Thr Thr Gln Ser Phe His Thr Ile Leu Ser Arg Gln Thr Leu Met Asp 245 250 255 His Phe His Ser Ser Leu Pro Thr Val Ser Ala Ser Leu Ser Thr Pro 260 265 270 Leu Arg Gln Asn His Ala Val Ser Pro Thr Ser Ser Leu Leu Leu Met 275 280 285 Pro Ser Trp Ser Thr Ser Pro Ser Leu Pro Tyr Ile Gly Val Lys Leu 290 295 300 Val Thr Tyr Phe Pro Gln Ser Ser Thr Leu Ser Leu Pro Gly Ile His 305 310 315 320 Ala Ser Tyr Val Leu Phe Ser Ser Ala Thr Gly Gln Thr Leu Ala Ser 325 330 335 Met Asp Gly Thr Ala Leu Thr Leu Phe Arg Thr Ser Cys Val Ser Gly 340 345 350 Leu Ala Ser Arg Ile Leu Ala Arg Asp Asp Ser Lys Val Leu Val Met 355 360 365 Ile Gly Ala Gly Ala Leu Ala Pro His Leu Ile Lys Ala His Leu Thr 370 375 380 Ala Arg Pro Gly Leu Glu Arg Val Val Ile Trp Asn Arg Thr Val Glu 385 390 395 400 Lys Ala Arg Asn Leu Ala Glu Gln Leu Gln Gln Ser Ser Gly Leu Asp 405 410 415 Gly Val Cys Phe Glu Ser Asn Gly Cys Leu Glu Glu Val Val Gly Met 420 425 430 Gly Asp Ile Val Ser Cys Ala Thr Asn Ser Glu Ala Pro Leu Val Lys 435 440 445 Gly Gln Lys Leu Lys Pro Gly Ala His Leu Asp Leu Val Gly Ser Phe 450 455 460 Lys His Ser Met Arg Glu Cys Asp Asp Glu Ala Ile Gln Arg Gly Arg 465 470 475 480 Ile Phe Val Asp Asn Glu Ala Ala Leu Val Glu Ala Gly Glu Leu Val 485 490 495 Gly Ala Phe Glu Arg Gly Val Ile Thr Lys Glu Asp Ile Gly Gly Asn 500 505 510 Leu Val Glu Leu Ile Met Gly Glu Lys Val Gly Arg Arg Asp Ser Glu 515 520 525 Glu Val Thr Val Phe Lys Ser Val Gly Ser Ala Ala Val Asp Ile Leu 530 535 540 Ala Ala Gln Leu Val Tyr Glu Thr Tyr Leu Gln Gln Asn Asn 545 550 555 <210> 11 <211> 1713 <212> DNA <213> Artificial Sequence <220> <223> Fusion Protein <400> 11 atgtccccta tactaggtta ttggaaaatt aagggccttg tgcaacccac tcgacttctt 60 ttggaatatc ttgaagaaaa atatgaagag catttgtatg agcgcgatga aggtgataaa 120 tggcgaaaca aaaagtttga attgggtttg gagtttccca atcttcctta ttatattgat 180 ggtgatgtta aattaacaca gtctatggcc atcatacgtt atatagctga caagcacaac 240 atgttgggtg gttgtccaaa agagcgtgca gagatttcaa tgcttgaagg agcggttttg 300 gatattagat acggtgtttc gagaattgca tatagtaaag actttgaaac tctcaaagtt 360 gattttctta gcaagctacc tgaaatgctg aaaatgttcg aagatcgttt atgtcataaa 420 acatatttaa atggtgatca tgtaacccat cctgacttca tgttgtatga cgctcttgat 480 gttgttttat acatggaccc aatgtgcctg gatgcgttcc caaaattagt ttgttttaaa 540 aaacgtattg aagctatccc acaaattgat aagtacttga aatccagcaa gtatatagca 600 tggcctttgc agggctggca agccacgttt ggtggtggcg accatcctcc aaaatcggat 660 ctggttccgc gtggatccat ggcttccgca aacaaagacc aaaaaaccac aaacaccgtg 720 tcgtcttctt cttcttcttc ttctccaatc ttcatttcca ctgagaattt acaaactatc 780 ctcacccatc aaactctaat gaagcacatc gactccaatc tccccaaagt ttcaaccttt 840 ctccaaaccc caattcgcca acactatagt ctctctcctt cctcttctct cctcctcatg 900 ccttcatggt cttcttcttc ctccttccct tacgttggtg tcaaacttgt gacccatttc 960 cctcaaaatt cctcaatcaa tttacctggt gttcaaggta gctatgtcct cttcaattca 1020 accacgggtc aaacccttgc ttctatggat tccacggaac ttacgcttta cagaacctct 1080 tgtgtctctg gtttggcttc tagatattta tctagagatg atagtgaggt tcttgttatg 1140 gttggtgctg gtccccttgc acctcatttg atcagagctc atttttcagc tagacccagt 1200 ttgagaaaag tgttgatttg gaataggact gttgaaaagg cagaagcttt ggctaagaat 1260 ctgagagaaa gtgatgagtt ttcactctca gggttgagtt ttgagggttg tgggtgtttg 1320 aatgaggttg ttggacttgg ggatattgtg agctgtgcta caaattccga gatggcgctt 1380 gtgaaaggtg agaggttgaa ggttggagct catttggatt tggtgggttc ttttaagcct 1440 tcaatgaagg aatgtgatga tgaggctttg aaaaggggga aagtgtttgt ggacaatgag 1500 gctgcattgg ttgaagcagg ggagctggtg ggtgcttttg aaaggggagt gatcaaggaa 1560 gatgaaattg aggcaaattt ggtggagctt attagaggtg ataaagttgg gagaagaagt 1620 tcagaggaaa ttactgtttt taagtctgtt ggttctgctg ttgttgatat gctggctgca 1680 cagtttgttt atgagtcata cataggaaaa tag 1713 <210> 12 <211> 570 <212> PRT <213> Artificial Sequence <220> <223> Fusion Protein <400> 12 Met Ser Pro Ile Leu Gly Tyr Trp Lys Ile Lys Gly Leu Val Gln Pro 1 5 10 15 Thr Arg Leu Leu Leu Glu Tyr Leu Glu Glu Lys Tyr Glu Glu His Leu 20 25 30 Tyr Glu Arg Asp Glu Gly Asp Lys Trp Arg Asn Lys Lys Phe Glu Leu 35 40 45 Gly Leu Glu Phe Pro Asn Leu Pro Tyr Tyr Ile Asp Gly Asp Val Lys 50 55 60 Leu Thr Gln Ser Met Ala Ile Ile Arg Tyr Ile Ala Asp Lys His Asn 65 70 75 80 Met Leu Gly Gly Cys Pro Lys Glu Arg Ala Glu Ile Ser Met Leu Glu 85 90 95 Gly Ala Val Leu Asp Ile Arg Tyr Gly Val Ser Arg Ile Ala Tyr Ser 100 105 110 Lys Asp Phe Glu Thr Leu Lys Val Asp Phe Leu Ser Lys Leu Pro Glu 115 120 125 Met Leu Lys Met Phe Glu Asp Arg Leu Cys His Lys Thr Tyr Leu Asn 130 135 140 Gly Asp His Val Thr His Pro Asp Phe Met Leu Tyr Asp Ala Leu Asp 145 150 155 160 Val Val Leu Tyr Met Asp Pro Met Cys Leu Asp Ala Phe Pro Lys Leu 165 170 175 Val Cys Phe Lys Lys Arg Ile Glu Ala Ile Pro Gln Ile Asp Lys Tyr 180 185 190 Leu Lys Ser Ser Lys Tyr Ile Ala Trp Pro Leu Gln Gly Trp Gln Ala 195 200 205 Thr Phe Gly Gly Gly Asp His Pro Pro Lys Ser Asp Leu Val Pro Arg 210 215 220 Gly Ser Met Ala Ser Ala Asn Lys Asp Gln Lys Thr Thr Asn Thr Val 225 230 235 240 Ser Ser Ser Ser Ser Ser Ser Ser Pro Ile Phe Ile Ser Thr Glu Asn 245 250 255 Leu Gln Thr Ile Leu Thr His Gln Thr Leu Met Lys His Ile Asp Ser 260 265 270 Asn Leu Pro Lys Val Ser Thr Phe Leu Gln Thr Pro Ile Arg Gln His 275 280 285 Tyr Ser Leu Ser Pro Ser Ser Ser Leu Leu Leu Met Pro Ser Trp Ser 290 295 300 Ser Ser Ser Ser Phe Pro Tyr Val Gly Val Lys Leu Val Thr His Phe 305 310 315 320 Pro Gln Asn Ser Ser Ile Asn Leu Pro Gly Val Gln Gly Ser Tyr Val 325 330 335 Leu Phe Asn Ser Thr Thr Gly Gln Thr Leu Ala Ser Met Asp Ser Thr 340 345 350 Glu Leu Thr Leu Tyr Arg Thr Ser Cys Val Ser Gly Leu Ala Ser Arg 355 360 365 Tyr Leu Ser Arg Asp Asp Ser Glu Val Leu Val Met Val Gly Ala Gly 370 375 380 Pro Leu Ala Pro His Leu Ile Arg Ala His Phe Ser Ala Arg Pro Ser 385 390 395 400 Leu Arg Lys Val Leu Ile Trp Asn Arg Thr Val Glu Lys Ala Glu Ala 405 410 415 Leu Ala Lys Asn Leu Arg Glu Ser Asp Glu Phe Ser Leu Ser Gly Leu 420 425 430 Ser Phe Glu Gly Cys Gly Cys Leu Asn Glu Val Val Gly Leu Gly Asp 435 440 445 Ile Val Ser Cys Ala Thr Asn Ser Glu Met Ala Leu Val Lys Gly Glu 450 455 460 Arg Leu Lys Val Gly Ala His Leu Asp Leu Val Gly Ser Phe Lys Pro 465 470 475 480 Ser Met Lys Glu Cys Asp Asp Glu Ala Leu Lys Arg Gly Lys Val Phe 485 490 495 Val Asp Asn Glu Ala Ala Leu Val Glu Ala Gly Glu Leu Val Gly Ala 500 505 510 Phe Glu Arg Gly Val Ile Lys Glu Asp Glu Ile Glu Ala Asn Leu Val 515 520 525 Glu Leu Ile Arg Gly Asp Lys Val Gly Arg Arg Ser Ser Glu Glu Ile 530 535 540 Thr Val Phe Lys Ser Val Gly Ser Ala Val Val Asp Met Leu Ala Ala 545 550 555 560 Gln Phe Val Tyr Glu Ser Tyr Ile Gly Lys 565 570 <210> 13 <211> 39 <212> DNA <213> Artificial sequence <220> <223> PCR primer <400> 13 ggatccgaat tcatggctgc attaccagta ttcatacca 39 <210> 14 <211> 33 <212> DNA <213> Artificial sequence <220> <223> PCR primer <400> 14 gtcgacttaa caacggctga ggtaagtctc gtg 33 <210> 15 <211> 34 <212> DNA <213> Artificial sequence <220> <223> PCR primer <400> 15 gaattcatgg cttccacaac caccgccata acat 34 <210> 16 <211> 34 <212> DNA <213> Artificial sequence <220> <223> PCR primer <400> 16 gtcgacctag ttattttgct gcaaataggt ctca 34 <210> 17 <211> 37 <212> DNA <213> Artificial sequence <220> <223> PCR primer <400> 17 ggatccatgg cttccgcaaa caaagaccaa aaaacca 37 <210> 18 <211> 37 <212> DNA <213> Artificial sequence <220> <223> PCR primer <400> 18 gtcgacctat tttcctatgt atgactcata aacaaac 37 <210> 19 <211> 449 <212> PRT <213> Mulberry (Morus alba) <400> 19 Met Thr His Asn Tyr Ser Gln Leu Pro Phe Ser Ile Cys Arg Pro His 1 5 10 15 Ala Val Ser Leu Gln Pro Lys Thr Ile Phe Pro Ser Ser Pro Ser Thr 20 25 30 Ser Ser Asp Asn Glu Ile Lys Arg Leu Gly His Phe Thr Lys Val Pro 35 40 45 Arg Ser Val Asn Met Glu Asn Leu Arg Asn Gly Tyr Leu Phe Pro Glu 50 55 60 Ile Ser Lys Ala Ala Phe Asp His Thr Gln Lys His Pro Asp Ala Arg 65 70 75 80 Leu Ile Arg Leu Gly Ile Gly Asp Thr Thr Glu Pro Ile Pro Asp Ile 85 90 95 Ile Thr Ser Ala Met Ala Glu Tyr Ala Lys Ala Leu Ser Thr Ile Glu 100 105 110 Gly Tyr Lys Gly Tyr Gly Asp Glu Gln Gly Asn Met Ala Leu Arg Val 115 120 125 Ala Ile Ala Glu Thr Leu Tyr Arg Asn Met Gly Ile Lys Gly Asn Glu 130 135 140 Val Phe Val Ser Asp Gly Ala Gln Cys Asp Ile Ser Arg Leu Gln Met 145 150 155 160 Leu Leu Gly Ser Asp Val Thr Val Ala Val Gln Asp Pro Ser Phe Pro 165 170 175 Ala Tyr Ile Asp Ser Ser Val Ile Phe Gly Arg Ala Gly Lys Phe Glu 180 185 190 Glu Glu Thr Gly Lys Tyr Gly Asn Ile Val Tyr Met Lys Cys Ser Pro 195 200 205 Glu Asn Asn Phe Phe Pro Asn Leu Ser Ile Thr Arg Lys Thr Asp Val 210 215 220 Ile Phe Phe Cys Cys Pro Asn Asn Pro Thr Gly Asn Ala Ala Thr Lys 225 230 235 240 Leu Gln Leu Gln Gln Leu Val Glu Phe Ala Lys Ala Asn Gly Ser Ile 245 250 255 Ile Ile Tyr Asp Ser Ser Tyr Ala Ala Tyr Ile Ser Asp Glu Ser Pro 260 265 270 Arg Ser Ile Tyr Glu Ile Pro Gly Ala Lys Glu Val Ala Ile Glu Val 275 280 285 Ser Ser Phe Ser Lys Phe Ala Gly Phe Thr Gly Val Arg Leu Gly Trp 290 295 300 Thr Val Val Pro Glu Glu Leu Lys Tyr Thr Asn Gly Phe Pro Val Ile 305 310 315 320 Lys Asp Tyr Asp Arg Ile Val Cys Thr Ser Phe Asn Gly Ala Pro Ser 325 330 335 Ile Ser Gln Ala Gly Gly Leu Ala Cys Leu Ser Pro Gln Gly Tyr Glu 340 345 350 Ala Thr Thr Ala Val Ile Asp Tyr Tyr Lys Glu Asn Ala Lys Ile Ile 355 360 365 Ala Asp Thr Phe Arg Ser Val Gly Leu Lys Val Tyr Gly Gly Glu Asn 370 375 380 Ala Pro Tyr Ile Trp Val His Phe Pro Gly Gln Arg Ser Trp Asp Val 385 390 395 400 Phe Asn Glu Ile Leu Ala Lys Thr His Ile Val Thr Ile Pro Gly Ser 405 410 415 Gly Phe Gly Pro Ala Gly Glu Glu Tyr Met Arg Phe Ser Ala Phe Gly 420 425 430 Arg Arg Glu Asn Ile Leu Glu Ala Ser Arg Arg Leu Lys Ser Leu Tyr 435 440 445 Lys <210> 20 <211> 27 <212> DNA <213> Artificial sequence <220> <223> PCR primer <400> 20 ggatccatga cgcataatta ttctcag 27 <210> 21 <211> 29 <212> DNA <213> Artificial sequence <220> <223> PCR primer <400> 21 gtcgactcat ttgtaaagag attttagtc 29

Claims

1. A method for producing an L-cyclic amino acid, characterized in that: The polypeptide represented by (A) below, a microorganism or cell having the ability to produce the polypeptide or containing the polypeptide, a processed product of the microorganism or cell, and / or a culture solution containing the polypeptide obtained by culturing the microorganism or cell is contacted with a cyclic amino acid having a double bond at position 1 represented by the following formula, The L-type cyclic amino acid shown in the following formula is generated: (A) A polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8, 10 or 12.

2. The manufacturing method according to claim 1, wherein: The polypeptide is encoded by the nucleic acid shown in the following (D): (D) A nucleic acid consisting of the base sequence shown in SEQ ID NO: 1, 3, 5, 7, 9 or 11.

3. A method for producing an L-cyclic amino acid, characterized in that: An enzyme capable of converting the amino group at the α-position of a diamino acid into a keto group to generate an α-keto acid is reacted with a chain α,ω-diamino acid represented by the following formula: A cyclic amino acid having a double bond at position 1 shown in the following formula is generated, Then, the obtained cyclic amino acid having a double bond at position 1 is converted into an L-type cyclic amino acid represented by the following formula using the method of claim 1:

4. The method for producing an L-cyclic amino acid according to claim 3, wherein The enzyme capable of converting the amino group at the α-position of a diamino acid into a keto group to generate an α-keto acid is one or more enzymes selected from the group consisting of D-amino acid oxidase, L-amino acid oxidase, D-amino acid dehydrogenase, L-amino acid dehydrogenase, D-amino acid transferase and L-amino acid transferase.

5. A polypeptide, which is: (a) A polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 4, 6, 8, 10 or 12. A nucleic acid encoding the polypeptide according to claim 5.

7. The nucleic acid according to claim 6, wherein Nucleic acids come from plants.

8. The nucleic acid according to claim 7, wherein The plant is mulberry or seaside Lathyrus.

9. The nucleic acid according to any one of claims 6 to 8, wherein The nucleic acid is the nucleic acid shown in the following (d): (d) A nucleic acid consisting of the base sequence shown in SEQ ID NO: 3, 5, 7, 9 or 11. 10 . A recombinant vector comprising the nucleic acid according to claim 6 . A transformant comprising the recombinant vector according to claim 10 .

12. An enzyme preparation composition comprising: a polypeptide as shown in (A) below, a microorganism or cell capable of producing the polypeptide or containing the polypeptide, a processed product of the microorganism or cell, and / or a culture solution containing the polypeptide obtained by culturing the microorganism or cell, A cyclic amino acid having a double bond at position 1 represented by the following formula The ability to generate L-type cyclic amino acids represented by the following formula, (A) A polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8, 10 or 12.

Images