Method for producing ergothioneine

Abstract

The present invention relates to a microbial factory for producing ergothioneine, in particular a yeast factory. Also provided are a method for producing ergothioneine in yeast cells, as well as useful nucleic acids, polypeptides, vectors and host cells.

Description

Technical Field

[0001] This invention relates to microbial factories for producing ergothioneine, particularly yeast factories. Methods for producing ergothioneine in yeast cells are also provided, along with useful nucleic acids, peptides, vectors, and host cells. Background Technology

[0002] Ergothioneine (ERG) (2-mercaptohistidine trimethyl betaine, (2S)-3-(2-thiooxo-2,3-dihydro-1H-imidazol-4-yl)-2-(trimethylammonium)propionate) is a naturally occurring antioxidant widely found in plants and mammals; it has a tautomeric structure but exists primarily as a thione at physiological pH. Ergothioneine exhibits antioxidant properties, including scavenging free radicals and reactive oxygen species, and chelating divalent metal ions. Ergothioneine has been shown to reduce oxidative damage in rats and humans.

[0003] To date, only a few bacteria and fungi have been identified as natural producers of ergothioneine. Ergothioneine was discovered in the ergot fungus *Claviceps purpurea* in 1909, and its structure was determined two years later. Subsequently, several other organisms were found to produce ergothioneine, including the filamentous fungus *Neurospora crassa*, the yeast *Schizosaccharomyces pombe*, and various actinomycetes, including *Mycobacterium smegmatis*.

[0004] Humans must obtain ergothioneine through their diet; some mushrooms and other foods contain up to 7 mg.g. -1 Dry weight. Due to its beneficial effects and potential involvement in disease prevention, ergothioneine is poised to secure a place in the global dietary supplement market.

[0005] Studies have shown that ergothioneine in the human body mainly accumulates in the liver, kidneys, red blood cells, bone marrow, lens, and seminal fluid. It is transported by SLC22A4 (formerly known as OCTN1, a transporter common to most animals). High abundance of ergothioneine in the body may indicate its role in maintaining health or alleviating disease. Ergothioneine has shown efficacy in in vivo models of various neurodegenerative diseases, ischemia-reperfusion injury, and several other diseases. It has been reported that ergothioneine can accumulate at sites of injury through the upregulation of SLC22A4 / OCTN1. The fact that ergothioneine is slowly metabolized and excreted in the human body further demonstrates its important role in vivo.

[0006] Ergothioneine is synthesized from one molecule of L-histidine, one molecule of cysteine, and three methyl groups provided by S-adenosyl-L-methionine. Figure 1 In *Mycobacterium smegmatis*, the reaction sequence is catalyzed by five enzymes encoded by the genes EgtA, EgtB, EgtC, EgtD, and EgtE, which are located together in a cluster. The four enzymes in the cluster EgtA, EgtB, EgtC, and EgtD catalyze four separate reactions to produce the intermediate S-(histidine trimethyl-2-yl)-L-cysteine ​​S-oxide (HCO). In fungi, the biosynthetic pathway is different because a single enzyme, Egt1, catalyzes the methylation of histidine to produce hercynine, which is then oxidized with cysteine ​​sulfide to produce HCO. HCO is converted to 2-(hydroxysulfanyl)hercynine by a β-lyase encoded by the genes EgtE in *Mycobacterium smegmatis* and Egt2 in fungi. This compound is apparently spontaneously reduced to ergothioneine.

[0007] Currently, ergothioneine production is primarily based on chemical synthesis. These methods are not cost-effective and have significant environmental impacts. Therefore, a cost-effective and environmentally friendly ergothioneine production method is needed. Invention Overview

[0009] This invention provides yeast cells capable of producing ergothioneine and a method for producing ergothioneine in yeast cells.

[0010] On the one hand, a yeast cell capable of producing ergothioneine is provided, the yeast cell expressing:

[0011] a) at least one first heterologous enzyme capable of converting L-histidine and / or L-cysteine ​​into S-(histidinetrimethyl-2-yl)-L-cysteine-S-oxide; and

[0012] b) At least one second heterozyme capable of converting S-(histidine trimethyl-2-yl)-L-cysteine-S-oxide into 2-(hydroxythioalkyl)-histidine trimethyl inner salt;

[0013] Yeast cells can also convert 2-(hydroxythioalkyl)-histidine trimethyl inner salt into ergothionein.

[0014] The present invention also provides a method for producing ergothionein in yeast cells, comprising the following steps:

[0015] i) Provide yeast cells capable of producing ergothioneine, said yeast cells expressing:

[0016] a) at least one first heterologous enzyme capable of converting L-histidine and / or L-cysteine ​​into S-(histidinetrimethyl-2-yl)-L-cysteine-S-oxide; and

[0017] b) At least one second heterozyme capable of converting S-(histidine trimethyl-2-yl)-L-cysteine-S-oxide into 2-(hydroxythioalkyl)-histidine trimethyl inner salt;

[0018] Yeast cells can also convert 2-(hydroxythioalkyl)-histidine trimethyl inner salt into ergothionein;

[0019] ii) Culture the yeast cells in a culture medium;

[0020] This allows the production of ergothioneine.

[0021] This article also provides:

[0022] • A polypeptide having the sequence shown in SEQ ID NO:6 (CpEgtl) or a functional variant thereof having at least 70% homology with SEQ ID NO:6, or a homolog having at least 70% homology with SEQ ID NO:6, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99% homology with SEQ ID NO:6;

[0023] • A polypeptide or a functional variant thereof having the sequence shown in SEQ ID NO:12 (CpEgt2), the functional variant having at least 70% homology with SEQ ID NO:12, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%.

[0024] This article also provides:

[0025] A nucleic acid having a sequence as shown in SEQ ID NO:5 or SEQ ID NO:16, or having at least 70% homology with SEQ ID NO:5 or SEQ ID NO:16, for example having at least 71%, such as at least 72%, such as at least 73%, such as at least 74%, such as at least 75%, such as at least 76%, such as at least 77%, such as at least 78%, such as at least 79%, such as at least 80%, such as at least 81%, such as at least 82%, such as at least 83%, such as at least 84%, such as at least 85%, such as at least 86%, such as at least 87%, such as at least 88%, such as at least 89%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% homology with SEQ ID NO:5 or SEQ ID NO:16;

[0026] A nucleic acid having a sequence as shown in SEQ ID NO:11 or SEQ ID NO:18, or having at least 70% homology with SEQ ID NO:11 or SEQ ID NO:18, for example having at least 71%, such as at least 72%, such as at least 73%, such as at least 74%, such as at least 75%, such as at least 76%, such as at least 77%, such as at least 78%, such as at least 79%, such as at least 80%, such as at least 81%, such as at least 82%, such as at least 83%, such as at least 84%, such as at least 85%, such as at least 86%, such as at least 87%, such as at least 88%, such as at least 89%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%.

[0027] A vector containing the aforementioned nucleic acid is also provided, as well as a host cell containing the vector and / or the nucleic acid or polypeptide.

[0028] It also provides the use of the aforementioned peptides, nucleic acids, vectors, or host cells for the production of ergothioneine. Attached Figure Description

[0029] Figure 1 The pathway of ergothioneine biosynthesis in bacteria and fungi. SAM = S-adenosyl-L-methionine, SAH = S-adenosyl-L-homocysteine, γ-GC = γ-L-glutamyl-L-cysteine, γ-GHCO = γ-L-glutamyl-S-(histidine trimethyl-2-yl)-L-cysteine ​​S-oxide, HCO = S-(histidine trimethyl-2-yl)-L-cysteine ​​S-oxide, 2-HSH = 2-(hydroxythioalkyl)histidine trimethyl inner salt.

[0030] Figure 2 Ergothioneine was produced in strains using an integrated ergothioneine biosynthetic pathway. As shown in the figure, these strains possess various combinations of genes from different organisms. Black box: Intracellular ergothioneine; White box: Extracellular ergothioneine. The Y-axis represents ergothioneine yield in mg / L. 1: SC + 20 g / L glucose + 1 g / L His / Cys / Met (batch medium), 48 hours; 2: SC + 40 g / L glucose (batch medium), 72 hours; 3: SC + 60 g / L EnPump substrate, 0.6% reagent A (feed-batch medium), 72 hours. SC = Synthesis complete.

[0031] Figure 3Ergothioneine production over time in the producing strain under different conditions, with or without the transporter protein MsErgT or HsSCL22A4 (Hs.SCL22A4X in the figure). Black box: Intracellular ergothioneine; White box: Extracellular ergothioneine. 1: SC + 20 g / L glucose + 1 g / L His / Cys / Met (batch medium), 48 hours; 2: SC + 40 g / L glucose (batch medium), 72 hours; 3: SC + 60 g / L EnPump substrate, 0.6% reagent A (feed-batch medium), 72 hours. SC = Synthesis complete.

[0032] Figure 4 Striped box: Intracellular ergothioneine; Black box: Extracellular ergothioneine; Black line: OD. (A): ST8461 in SC + 40 g / L glucose. (B): ST8461 in SC + 40 g / L glucose + 1 g / L aa. (C): ST8461 in SC + 40 g / L glucose + 2 g / L aa. (D): ST8654 in SC + 40 g / L glucose. (E) ST8654 in SC + 40 g / L glucose + 1 g / L aa. (F): ST8654 in SC + 40 g / L glucose + 2 g / L aa. SC = Synthesis complete.

[0033] Figure 5 Percentage of PI-stained cells (Y-axis) in the specified strain containing transporter proteins in medium without 1 g / L histidine, cysteine, and methionine (striped box) and medium containing 1 g / L histidine, cysteine, and methionine (black box). (A): ST7574. (B): ST8654. (C): ST8461. SC = Synthesis complete.

[0034] Figure 6 ST8927 produces ergothioneine under carbon-limited conditions during fed-batch culture. N = (NH4)2SO4, Mg = MgSO4, tm = trace metals, vit = vitamins.

[0035] Figure 7 Ergothioneine production in strains with an integrated ergothioneine biosynthetic pathway (two copies of NcEgt1 and SpEgt2). In addition to the integrated ergothioneine biosynthetic pathway, the strains also carry additional genetic modifications, as shown in the figure. The Y-axis represents total ergothioneine production (in mg / L).

[0036] Figure 8Ergothioneine production in strains with integrated ergothioneine biosynthetic pathways (two copies of NcEgt1 and SpEgt2). As shown in the figure, these strains possess various combinations of modified genes. The Y-axis represents total ergothioneine yield (in mg / L). TRA res. = TRA resistance.

[0037] Figure 9 Ergothioneine production in strains with integrated ergothioneine biosynthetic pathways (two copies of NcEgt1 and SpEgt2). As shown in the figure, these strains possess various combinations of modified genes. The Y-axis represents total ergothioneine yield (in mg / L). TRA res. = TRA resistance.

[0038] Figure 10 Ergothioneine production in strains possessing an integrated ergothioneine biosynthetic pathway (two copies of NcEgt1 and SpEgt2). In addition to the integrated ergothioneine biosynthetic pathway, the strains also carry additional genetic modifications, as shown in the figure. Black box: intracellular ergothioneine; white box: extracellular ergothioneine. Therefore, the Y-axis represents the production of intracellular and extracellular ergothioneine (in mg / L).

[0039] Figure 11 Ergothioneine production in strains possessing an integrated ergothioneine biosynthetic pathway (one copy of NcEgt1 and SpEgt2). In addition to the integrated ergothioneine biosynthetic pathway, the strains also carry additional genetic modifications, as shown in the figure. The Y-axis represents total ergothioneine production (in mg / L). TRA res. = TRA resistance.

[0040] Figure 12 Ergothioneine production in *Saccharomyces cerevisiae* strain ST8460, *Yersinia lipolytica* strain ST9584, and *Yersinia lipolytica* strain ST9703. Black bars: Glucose: Ergothioneine yield under batch conditions (SC medium containing 20 g / L glucose); White bars: FiT: Ergothioneine yield under simulated fed-batch conditions (SC medium containing 60 g / L Enpump substrate + 0.6% reagent A). The Y-axis represents total ergothioneine yield (in mg / L). SC = Complete synthesis.

[0041] Figure 13 Ergothioneine production using different starting cell dry weight concentrations and different concentrations of reagent A, as shown on the X-axis. The Y-axis represents the total ergothioneine yield (in mg / L).

[0042] Figure 14Production of ergothioneine and histidine in the selected strain. The strain was grown in a medium containing 0.25 mM β-(1,2,4-triazol-3-yl)-DL-alanine. Black box: histidine; white box: ergothioneine. The Y-axis represents the total yield of ergothioneine and histidine (in mg / L). Invention Details

[0044] This disclosure relates to yeast cells and methods for producing ergothioneine.

[0045] yeast cells

[0046] This disclosure relates to yeast cells capable of producing ergothioneine. Therefore, this document provides yeast cells capable of producing ergothioneine, said yeast cells expressing:

[0047] a) at least one first heterologous enzyme capable of converting L-histidine and / or L-cysteine ​​into S-(histidinetrimethyl-2-yl)-L-cysteine-S-oxide; and

[0048] b) At least one second heterozyme capable of converting S-(histidine trimethyl-2-yl)-L-cysteine-S-oxide into 2-(hydroxythioalkyl)-histidine trimethyl inner salt;

[0049] Yeast cells can also convert 2-(hydroxythioalkyl)-histidine trimethyl inner salt into ergothionein.

[0050] Therefore, the yeast cells disclosed herein are all capable of converting 2-(hydroxythioalkyl)-histidine trimethyl endosalate into ergothioneine. This may be because yeast cells naturally (i.e., unmodified) possess the ability to convert 2-(hydroxythioalkyl)-histidine trimethyl endosalate into ergothioneine, or because yeast cells have been engineered to acquire this ability, as is known in the art. Typically, cells, including yeast cells, have the ability to spontaneously convert 2-(hydroxythioalkyl)-histidine trimethyl endosalate into ergothioneine, particularly in the thiol form, which can then spontaneously convert into the thione form of ergothioneine, and vice versa. Spontaneous conversion of 2-(hydroxythioalkyl)-histidine trimethyl endosalate into ergothioneine requires an electron donor and releases an electron acceptor and H₂O (…). Figure 1 ).

[0051] The yeast cells disclosed herein are preferably capable of synthesizing L-histidine and L-cysteine.

[0052] In some implementations, yeast cells are cells derived from GRAS (Generally Recognized As Safe) organisms or non-pathogenic organisms or strains.

[0053] In some embodiments, the yeast genus is selected from *Saccharomyces*, *Pichia*, *Yarrowia*, *Kluyveromyces*, *Candida*, *Rhodotorula*, *Rhodosporidium*, *Cryptococcus*, *Schizosaccharomyces*, *Trichosporon*, and *Lipomyces*. In some preferred embodiments, the yeast genus is *Saccharomyces*, *Pichia*, *Kluyveromyces*, or *Yarrowia*.

[0054] The yeast cells can be selected from: *Saccharomyces cerevisiae*, *Pichia pastoris*, *Komagataella phaffii*, *Kluyveromyces marxianus*, *Kluyveromyces lactis*, *Schizosaccharomyces pombe*, *Cryptococcus albidus*, *Lipomyces lipofera*, *Lipomyces starkeyi*, *Rhodosporidium toruloides*, *Rhodotorula glutinis*, *Trichosporon pullulan*, and *Yarrowia lipolytica*. In a preferred embodiment, the yeast cells are *Kluyveromyces cerevisiae* cells, *Saccharomyces cerevisiae* cells, or *Yarrowia lipolytica* cells; preferably, the yeast cells are *Saccharomyces cerevisiae* cells.

[0055] First heterozyme

[0056] The first heterozyme expressed in yeast cells converts L-histidine and / or L-cysteine ​​into S-(histidine trimethyl-2-yl)-L-cysteine-S-oxide. This first heterozyme is not naturally expressed in yeast cells. It can be derived from eukaryotes or prokaryotes, as detailed below.

[0057] The enzymes capable of catalyzing the above reactions are: L-histidine Nα-methyltransferase (EC 2.1.1.44), histidine trimethylcysteine ​​S-oxide synthase (EC 1.14.99.51), glutamate-cysteine ​​ligase (EC 6.3.2.2), γ-glutamylhistidine trimethylcysteine ​​S-oxide synthase (EC 1.14.99.50), and γ-glutamylhistidine trimethylcysteine ​​S-oxide hydrolase (EC 3.5.1.118). In some embodiments, the first heterozyme is an enzyme with an EC number selected from EC 2.1.1.44, EC 1.14.99.51, EC 6.3.2.2, EC 1.14.99.50, and EC 3.5.1.118. In one embodiment, the EC number is 2.1.1.44. In another implementation, the EC number is EC 1.14.99.51.

[0058] L-histidine Nα-methyltransferase (EC 2.1.1.44), also known as dimethylhistidine N-methyltransferase, catalyzes the following reaction:

[0059] 3S-adenosine-L-methionine + L-histidine <=> 3S-adenosine-L-homocysteine ​​+ histidine trimethyl inner salt.

[0060] Using Fe 2+ As a cofactor, this type of enzyme requires L-histidine as a substrate.

[0061] Histidine trimethylcysteine ​​S-oxide synthase (EC 1.14.99.51) catalyzes the following reaction:

[0062] Histidine trimethyl inner salt + L-cysteine ​​+ O2 <=> S-histidine trimethyl-2-yl-L-cysteine ​​S-oxide + H2O

[0063] Using Fe 2+ As a cofactor, this type of enzyme requires L-cysteine ​​as a substrate.

[0064] Glutamate-cysteine ​​ligase (EC 6.3.2.2) catalyzes the following reaction:

[0065] Histidine trimethyl inner salt + L-cysteine ​​+ O2 <=> S-histidine trimethyl-2-yl-L-cysteine ​​S-oxide + H2O

[0066] Using Fe 2+ As a cofactor, this type of enzyme requires L-cysteine ​​as a substrate.

[0067] γ-Glutamylhistidine trimethylcysteine ​​S-oxide synthase (EC 1.14.99.50) catalyzes the following reaction:

[0068] Histidine trimethyl inner salt + L-cysteine ​​+ O2 <=> S-histidine trimethyl-2-yl-L-cysteine ​​S-oxide + H2O

[0069] Using Fe 2+ As a cofactor, this type of enzyme requires L-cysteine ​​as a substrate.

[0070] γ-Glutamylhistidine trimethylcysteine ​​S-oxide hydrolase (EC 3.5.1.118) catalyzes the following reaction:

[0071] Histidine trimethyl inner salt + L-cysteine ​​+ O2 <=> S-histidine trimethyl-2-yl-L-cysteine ​​S-oxide + H2O

[0072] Using Fe 2+ As a cofactor, this type of enzyme requires L-cysteine ​​as a substrate.

[0073] Throughout this disclosure, it should be understood that if the first heterozyme is histidine trimethylcysteine ​​S-oxide synthase (EC 1.14.99.51), glutamate-cysteine ​​ligase (EC 6.3.2.2), γ-glutamylhistidine trimethylcysteine ​​S-oxide synthase (EC 1.14.99.50), or γ-glutamylhistidine trimethylcysteine ​​S-oxide hydrolase (EC 3.5.1.118), then yeast cells require L-cysteine ​​as a substrate. If the first heterozyme is L-histidine Nα-methyltransferase (EC 2.1.1.44), also known as dimethylhistidine N-methyltransferase, then yeast cells require L-histidine as a substrate.

[0074] In some embodiments, the first heterozyme is Egt1, which is derived from a eukaryote, such as a fungus, for example, yeast. In addition to the first heterozyme, the yeast cells of this disclosure may also naturally express an enzyme capable of catalyzing the same reaction as the first heterozyme, or the yeast cells may not have an enzyme capable of catalyzing the reaction. The enzyme, particularly the first heterozyme, is derived from the organism if it is naturally present therein.

[0075] In some implementations, the first heterozyme is derived from eukaryotes and is classified as EC 2.1.1.44 and / or EC.1.14.99.51.

[0076] In some embodiments, the first heterologous enzyme is Egt1 or a functional variant thereof from the following organisms: *Neurospora crassa*, *Cervidae*, *Schizosaccharomyces cerevisiae*, *Rhizopus stolonifera*, *Aspergillus nidulans*, *Aspergillus niger*, *Penicillium roqueforti*, *Penicillium notatum*, *Sporobolomyces salmonicolor*, *Aspergillus oryzae*, *Aspergillus carbonarius*, *Neurosporatetrasperma*, *Agaricus bisporus*, *Pleurotus ostreatus*, *Lentinula edodes*, or *Grifola frondosa*. The functional variant has at least 70% homology with Egt1, for example, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology with Egt1. The term "functional variant" refers to a variant that retains all or part of the activity and is still able to convert L-histidine and / or L-cysteine ​​to S-(histidine trimethyl-2-yl)-L-cysteine-S-oxide, such as a mutant. Those skilled in the art know how to determine whether a functional variant retains said activity, for example by detecting the product using liquid chromatography optionally coupled with mass spectrometry.

[0077] The registry numbers for the Egt1 enzymes listed above are listed in Table A below.

[0078] Table A. Egt1 and GenBank accession numbers from fungal organisms.

[0079] Organism (fungus) GenBank Registration Number Neurospora crassa (Ncas) XP_956324.3 Cpur (ergot) CCE33591.1 Spom NP_596639.2 Rhizopus sto RCH97401.1 Aspergillus nidus XP_680889.1 Aspergillus niger XP_001397117.2 Rockfordia penicillin (Proq) CDM31097.1 Specific Penicillium (Pnot) KZN88090.1 Ssal (Ochre-colored Spores) CEQ42739.1 Aspergillus oryzae XP_001727309.1 Aspergillus charcoalis (Acar) OOF91620.1 Neurospora tetraspora (Ntet) XP_009849693.1 Abis mushroom XP_006462499.1 Oyster mushroom (Post) KDQ26018.1 Shiitake mushrooms (Ledo) GAW05586.1 Grifola frondosa (Gfro) OBZ71212.1

[0080] In some embodiments, the first heterologous enzyme is derived from Neurospora crassa, Schizosoma micranthum, or Ergot. The sequences of the corresponding Egt1 enzymes are shown in SEQ ID NO:2 (Neurospora crassa), SEQ ID NO:4 (Schizosoma micranthum), and SEQ ID NO:6 (Ergot).

[0081] In a particular embodiment, the first heterozyme is selected from NcEgt1 (SEQ ID NO:2), SpEgt1 (SEQ ID NO:4), and CpEgt1 (SEQ ID NO:6), and functional variants thereof, said functional variants having at least 70% homology with SEQ ID NO:2, SEQ ID NO:4, or SEQ ID NO:6, for example having homology with SEQ ID NO:2, SEQ ID NO:4, or SEQ ID NO:6. NO:6 at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 8%, for example at least 99% homology.

[0082] Second heterozyme

[0083] A second heterozyme expressed in yeast cells can convert S-(histidine trimethyl-2-yl)-L-cysteine ​​S-oxide into 2-(hydroxythioalkyl)-histidine trimethyl inner salt. Specifically, the second heterozyme can convert S-(histidine trimethyl-2-yl)-L-cysteine ​​S-oxide produced by the first heterozyme into 2-(hydroxythioalkyl)-histidine trimethyl inner salt.

[0084] The enzymes capable of catalyzing the above reactions are β-lyase and histidine trimethylcysteine ​​sulfoxide lyase, also known as histidine trimethylcysteine ​​S-oxide synthase (EC 4.4.1). Therefore, in some embodiments, the second heterologous enzyme is β-lyase or histidine trimethylcysteine ​​sulfoxide lyase (EC 4.4.1).

[0085] These enzymes can catalyze the following reactions:

[0086] Histidine trimethyl inner salt + L-cysteine ​​+ O2 <=> S-histidine trimethyl-2-yl-L-cysteine ​​S-oxide + H2O

[0087] Using Fe 2+ As a cofactor.

[0088] In some embodiments, the second heterozyme is Egt2, which is derived from eukaryotes, such as fungi, for example, yeast. In addition to the first heterozyme, the yeast cells of this disclosure may also naturally express an enzyme capable of catalyzing the same reaction as the second heterozyme, or the yeast cells may not have an enzyme capable of catalyzing the reaction. In some embodiments, the second heterozyme is EgtE derived from bacteria. The enzyme, particularly the second heterozyme, is derived from the organism if it is naturally present therein.

[0089] In some embodiments, the second heterologous enzyme is Egt2 or a functional variant thereof from the following organisms: *Neurospora crassa*, *Cervidae*, *Schizosaccharomyces cerevisiae*, *Rhizopus spp.*, *Aspergillus nidus*, *Aspergillus niger*, *Penicillium rochfellii*, *Penicillium terrestris*, *Saccharomyces ochraceus*, *Aspergillus oryzae*, *Aspergillus charcoalii*, *Neurospora tetrasporium*, *Agaricus bisporus*, *Pleurotus ostreatus*, *Lentinula edodes*, *Grifola frondosa*, *Ganoderma lucidum*, or *Cantharellus*. (cibarius), the functional variant having at least 70% homology with Egt2, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%. The term "functional variant" refers to a variant that retains all or part of the activity and is still able to convert S-(histidine trimethyl-2-yl)-L-cysteine-S-oxide to 2-(hydroxythioalkyl)-histidine trimethyl inner salt, such as a mutant. Those skilled in the art know how to determine whether a functional variant retains the activity, for example by detecting the product using liquid chromatography optionally coupled with mass spectrometry.

[0090] In other embodiments, the second heterologous enzyme is a bacterial EgtE, such as EgtE from the following bacteria: Mycobacterium smegmatis, Nocardia asteroids, Streptomyces albus, Streptomyces fradiae, Streptomyces griseus, Actinobacter philippinensis, Aspergillus fumigatus, Mycobacterium tuberculosis, Mycobacterium kansasii, Mycobacterium intracellulare, Mycobacterium forfuitum, Mycobacterium ulcerans, Mycobacterium balnei, and Mycobacterium leprae. The following are listed: *Mycobacterium leprae*, *Mycobacterium avium*, *Mycobacterium bovis*, *Mycobacterium marinum*, *Mycobacterium microti*, *Mycobacterium paratuberculosis*, *Mycobacterium phlei*, *Rhodococcus rhodocrous* (*Mycobacterium rhodocrous*), *Arthrospira platensis*, *Arthrospira maxima*, *Aphanizomenon flos-aquae*, *Scytonemasp.*, *Oscillatoria sp.*, and *Rhodophyta sp.*(or a functional variant thereof) having at least 70% homology with the EgtE, for example having at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology with the EgtE. The term "functional variant" refers to a variant that retains all or part of the activity and is still able to convert S-(histidine trimethyl-2-yl)-L-cysteine-S-oxide to 2-(hydroxythioalkyl)-histidine trimethyl inner salt, such as a mutant. Those skilled in the art know how to determine whether a functional variant retains said activity, for example, by detecting the product using liquid chromatography optionally coupled with mass spectrometry.

[0091] The registry numbers for Egt2 and EgtE enzymes listed above are listed in Table B below.

[0092] Table B. Egt2 from fungal organisms, EgtE from bacterial organisms, and GenBank accession numbers.

[0093]

[0094]

[0095]

[0096] In some embodiments, the second heterologous enzyme is derived from Neurospora crassa, Schizosoma macrantha, Ergotia cambogia, or Mycobacterium smegmatis. The sequences of the corresponding Egt2 or EgtE enzymes are shown in SEQ ID NO:8 (Neurospora crassa), SEQ ID NO:10 (Schizosoma macrantha), SEQ ID NO:12 (Ergotia cambogia), and SEQ ID NO:14 (Mycobacterium smegmatis).

[0097] In a particular embodiment, the second heterozyme expressed in yeast cells may be selected from NcEgt2 (SEQ ID NO:8), SpEgt2 (SEQ ID NO:10), CpEgt2 (SEQ ID NO:12), and MsEgtE (SEQ ID NO:14), and functional variants thereof, said functional variants having the same characteristics as SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, or SEQ ID NO:14. NO:14 has at least 70% homology, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%.

[0098] Combination of first and second heterozymes

[0099] Although all combinations of the first and second heterozymes disclosed herein can be used to provide yeast factories for the production of ergothioneine, specific combinations of the first and second heterozymes may be of particular interest in the context of this invention.

[0100] In some implementations, the first and second heterozymes are:

[0101] i) NcEgt1 and CpEgt2;

[0102] ii) NcEgt1 and SpEgt2;

[0103] iii) NcEgt1 and NcEgt2;

[0104] iv) NcEgt1 and MsEgtE;

[0105] v)SpEgt1 and NcEgt2;

[0106] vi)SpEgt1 and SpEgt2;

[0107] vii)SpEgt1 and CpEgt2;

[0108] viii)SpEgt1 and MsEgtE;

[0109] ix)CpEgt1 and NcEgt2;

[0110] x)CpEgt1 and SpEgt2;

[0111] xi)CpEgt1 and CpEgt2;

[0112] xii)CpEgt1 and MsEgtE,

[0113] or a functional variant thereof, the functional variant having at least 70% homology with it, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%.

[0114] In a specific implementation scheme, yeast cells express the following first and second heterologous enzymes:

[0115] i) NcEgt1 and CpEgt2;

[0116] ii) NcEgt1 and SpEgt2;

[0117] iii) NcEgt1 and NcEgt2;

[0118] iv) NcEgt1 and MsEgtE;

[0119] xii)CpEgt1 and MsEgtE,

[0120] or a functional variant thereof, the functional variant having at least 70% homology with it, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%.

[0121] In some embodiments, the yeast cells of the present invention express first and second heterologous enzymes, which are not:

[0122] iii) NcEgt1 and NcEgt2; or

[0123] viii)SpEgt1 and MsEgtE; or

[0124] x)CpEgt1 and SpEgt2.

[0125] Nucleic acids encoding the first and second heterozymes

[0126] Yeast cells available in the context of this disclosure can be engineered as is known in the art. For example, the expression of first and second heterozymes can be achieved by introducing nucleic acids encoding them into yeast cells. As is known in the art, such nucleic acids can be codon-optimized to improve expression in yeast cells.

[0127] In some embodiments, the first heterologous enzyme is derived from *Neurospora crassa*, *Schizosaccharomyces cerevisiae*, or *Ergotae*. The sequences of the corresponding Egt1 enzymes are shown in SEQ ID NO:2 (*Neurospora crassa*), SEQ ID NO:4 (*Schizosaccharomyces cerevisiae*), and SEQ ID NO:6 (*Ergotae*). The corresponding nucleic acid sequences are shown in SEQ ID NO:1 or SEQ ID NO:15 (*Neurospora crassa*), SEQ ID NO:3 (*Schizosaccharomyces cerevisiae*), and SEQ ID NO:5 or SEQ ID NO:16 (*Ergotae*). Therefore, such nucleic acids or variants thereof can be appropriately introduced into yeast cells, either in the genome or as part of a suitable expression vector, as is known in the art, wherein the variants have at least 70% homology with the nucleic acid, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%.

[0128] In some embodiments, the second heterologous enzyme is derived from *Neurospora crassa*, *Schizosaccharomyces cerevisiae*, *Cervidia esculenta*, or *Mycobacterium smegmatis*. The sequences of the corresponding Egt2 or EgtE enzymes are shown in SEQ ID NO:8 (*Neurospora crassa*), SEQ ID NO:10 (*Schizosaccharomyces cerevisiae*), SEQ ID NO:12 (*Cervidia esculenta*), and SEQ ID NO:14 (*Mycobacterium smegmatis*). The corresponding nucleic acid sequences are shown in SEQ ID NO:7 or SEQ ID NO:17 (*Neurospora crassa*), SEQ ID NO:9 (*Schizosaccharomyces cerevisiae*), SEQ ID NO:11 or SEQ ID NO:18 (*Cervidia esculenta*), and SEQ ID NO:13 or SEQ ID NO:19 (*Mycobacterium smegmatis*). Therefore, such nucleic acids or variants thereof can be appropriately introduced into yeast cells, either in the genome or as part of a suitable expression vector, as is known in the art, wherein the variants have at least 70% homology with the nucleic acid, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%.

[0129] In a specific implementation plan, nucleic acids or homologs having at least 70% homology with them are introduced into yeast cells as follows:

[0130] i) NcEgt1 and CpEgt2: SEQ ID NO: 1 or 15 and SEQ ID NO: 11 or 18;

[0131] ii) NcEgt1 and SpEgt2: SEQ ID NO:1 or 15 and SEQ ID NO:9;

[0132] iii) NcEgt1 and NcEgt2: SEQ ID NO: 1 or 15 and SEQ ID NO: 7 or 17;

[0133] iv) NcEgt1 and MsEgtE: SEQ ID NO: 1 or 15 and SEQ ID NO: 13 or 19;

[0134] v)SpEgt1 and NcEgt2: SEQ ID NO:3 and SEQ ID NO:7 or 17

[0135] vi)SpEgt1 and SpEgt2: SEQ ID NO:3 and SEQ ID NO:9;

[0136] vii)SpEgt1 and CpEgt2: SEQ ID NO:3 and SEQ ID NO:11 or 18;

[0137] viii)SpEgt1 and MsEgtE: SEQ ID NO:3 and SEQ ID NO:13 or 19;

[0138] ix)CpEgt1 and NcEgt2: SEQ ID NO:5 or 16 and SEQ ID NO:7 or 17;

[0139] x)CpEgt1 and SpEgt2: SEQ ID NO:5 or 16 and SEQ ID NO:9;

[0140] xi)CpEgt1 and CpEgt2: SEQ ID NO: 5 or 16 and SEQ ID NO: 11 or 18;

[0141] xii) CpEgt1 and MsEgtE: SEQ ID NO: 5 or 16 and SEQ ID NO: 13 or 19.

[0142] In specific implementations, nucleic acids as shown in i), ii), iv), or xii) above, or homologs having at least 70% homology with them, are introduced. In some implementations, the introduced nucleic acid is not one shown in iii), viii), or x) above.

[0143] Ergothionein transporter

[0144] In some implementations, yeast cells are able to secrete at least a portion of the ergothioneine they produce. Yeast cells may be naturally capable of doing this, or they may be further modified to improve secretion. This can be achieved through the expression or overexpression of ergothioneine transporters, particularly heterologous ergothioneine transporters.

[0145] Therefore, in some embodiments, the yeast cells further express the ergothioneine transporter protein of *Mycobacterium smegmatis* (MsErgT) as shown in SEQ ID NO:35 or the ergothioneine transporter protein of *Homo sapiens* (HsSLC22A4) as shown in SEQ ID NO:36, or a functional homology thereof, said functional homology having at least 70% homology with said ergothioneine transporter protein, for example having at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, or at least 79% homology with said ergothioneine transporter protein. Homology of at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%. A functional variant here refers to a variant that retains all or part of the ergothioneine transporter activity, such as a mutant. Those skilled in the art know how to determine whether a functional variant retains said activity.

[0146] In some embodiments, yeast cells express ergothioneine transporters, such as MsErgT as shown in SEQ ID NO:35 or as shown in SEQ ID NO:35. HsSLC22A4 as shown in NO:36, or a functional homolog thereof, said functional homolog having at least 70% homology with said ergothioneine transporter, for example having at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% homology with said ergothioneine transporter; and a first and second heterozyme selected from the following:

[0147] i) NcEgt1 and CpEgt2;

[0148] ii) NcEgt1 and SpEgt2;

[0149] iii) NcEgt1 and NcEgt2;

[0150] iv) NcEgt1 and MsEgtE;

[0151] v)SpEgt1 and NcEgt2;

[0152] vi)SpEgt1 and SpEgt2;

[0153] vii)SpEgt1 and CpEgt2;

[0154] viii)SpEgt1 and MsEgtE;

[0155] ix)CpEgt1 and NcEgt2;

[0156] x)CpEgt1 and SpEgt2;

[0157] xi)CpEgt1 and CpEgt2; and

[0158] xii)CpEgt1 and MsEgtE,

[0159] Or a functional variant thereof, the functional variant having at least 70% homology with the first and second heterozymes, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%.

[0160] In a specific implementation, yeast cells express ergothioneine transporters, such as MsErgT as shown in SEQ ID NO:35 or as shown in SEQ ID NO:35. HsSLC22A4 as shown in NO:36, or a functional homolog thereof, said functional homolog having at least 70% homology with said ergothioneine transporter, for example having at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% homology with said ergothioneine transporter; and a first and second heterozyme selected from the following:

[0161] i) NcEgt1 and CpEgt2;

[0162] ii) NcEgt1 and SpEgt2;

[0163] iii) NcEgt1 and NcEgt2;

[0164] iv) NcEgt1 and MsEgtE;

[0165] xii)CpEgt1 and MsEgtE,

[0166] Or a functional variant thereof, the functional variant having at least 70% homology with the first and second heterozymes, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%.

[0167] In some embodiments, yeast cells express ergothioneine transporters, such as MsErgT as shown in SEQ ID NO:35 or as shown in SEQ ID NO:35. HsSLC22A4 as shown in NO:36, or a functional homolog thereof, said functional homolog having at least 70% homology with said ergothioneine transporter, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99% homology; and first and second heterozymes, said first and second heterozymes are not:

[0168] iii) NcEgt1 and NcEgt2; or

[0169] viii)SpEgt1 and MsEgtE; or

[0170] x)CpEgt1 and SpEgt2.

[0171] In a specific implementation, yeast cells express ergothioneine transporters, such as MsErgT as shown in SEQ ID NO:35 and / or HsSLC22A4 as shown in SEQ ID NO:36, or functional homologs thereof, wherein the functional homologs have at least 70% homology with the ergothioneine transporters, for example, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, or at least 82%. For example, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% homology, and expressing two copies of NcEgt1 and two copies of CpEgt2.

[0172] In some embodiments, the yeast cells also express ergothioneine transporter AtOCT1 from Arabidopsis thaliana, as shown in SEQ ID NO:37, or ergothioneine transporter ScAQR1 from Saccharomyces cerevisiae, as shown in SEQ ID NO:39, or as shown in SEQ ID NO:41 (HsSLC22A16) or as shown in SEQ ID NO:37. The ergothioneine transporter protein of Homo sapiens shown in NO:43(HsSLC22A32), or a functional homolog thereof, wherein the functional homolog has at least 70% homology with the ergothioneine transporter protein, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%. The functional variant here refers to a variant that retains all or part of the ergothioneine transporter activity, such as a mutant. Those skilled in the art know how to determine whether a functional variant retains the aforementioned activity.

[0173] The gene encoding AtOCT1 is shown in SEQ ID NO:38.

[0174] The gene encoding ScAQR1 is shown in SEQ ID NO:40.

[0175] The gene encoding HsSLC22A16 is shown in SEQ ID NO:42.

[0176] The gene encoding HsSLC22A32 is shown in SEQ ID NO:44.

[0177] In some embodiments, yeast cells express ergothioneine transporters, such as AtOCT1 as shown in SEQ ID NO:37, ScAQR1 as shown in SEQ ID NO:39, HsSLC22A16 as shown in SEQ ID NO:41, or as shown in SEQ ID NO:49. HsSLC22A32 as described in IDNO:42, or a functional homolog thereof, said functional homolog having at least 70% homology with said ergothioneine transporter, for example having at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% homology; and first and second heterozymes, said first and second heterozymes being selected from:

[0178] i) NcEgt1 and CpEgt2;

[0179] ii) NcEgt1 and SpEgt2;

[0180] iii) NcEgt1 and NcEgt2;

[0181] iv) NcEgt1 and MsEgtE;

[0182] v)SpEgt1 and NcEgt2;

[0183] vi)SpEgt1 and SpEgt2;

[0184] vii)SpEgt1 and CpEgt2;

[0185] viii)SpEgt1 and MsEgtE;

[0186] ix)CpEgt1 and NcEgt2;

[0187] x)CpEgt1 and SpEgt2;

[0188] xi)CpEgt1 and CpEgt2; and

[0189] xii)CpEgt1 and MsEgtE,

[0190] Or a functional variant thereof, the functional variant having at least 70% homology with the first and second heterozymes, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%.

[0191] In a specific implementation scheme, yeast cells express ergothioneine transport proteins, such as AtOCT as shown in SEQ ID NO:37, ScAQR1 as shown in SEQ ID NO:39, HsSLC22A16 as shown in SEQ ID NO:41, or as shown in SEQ ID NO:41. HsSLC22A32 as shown in IDNO:43, or a functional homolog thereof, having at least 70% homology with the ergothioneine transporter, for example, having at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% homology; and first and second heterozymes, the first and second heterozymes being selected from:

[0192] i) NcEgt1 and CpEgt2;

[0193] ii) NcEgt1 and SpEgt2;

[0194] iii) NcEgt1 and NcEgt2;

[0195] iv) NcEgt1 and MsEgtE;

[0196] xii)CpEgt1 and MsEgtE,

[0197] Or a functional variant thereof, the functional variant having at least 70% homology with the first and second heterozymes, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%.

[0198] In some embodiments, yeast cells express ergothioneine transporters, such as AtOCT as shown in SEQ ID NO:37, ScAQR1 as shown in SEQ ID NO:39, HsSLC22A16 as shown in SEQ ID NO:41, or as shown in SEQ ID NO:49. HsSLC22A32 as shown in IDNO:43, or a functional homolog thereof, said functional homolog having at least 70% homology with said ergothioneine transporter, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99% homology; and first and second heterozymes, said first and second heterozymes are not:

[0199] iii) NcEgt1 and NcEgt2; or

[0200] viii)SpEgt1 and MsEgtE; or

[0201] x)CpEgt1 and SpEgt2.

[0202] In a specific implementation, yeast cells express ergothioneine transporters, such as AtOCT1 as shown in SEQ ID NO:37, ScAQR1 as shown in SEQ ID NO:39, HsSLC22A16 as shown in SEQ ID NO:41, or HsSLC22A32 as shown in SEQ ID NO:43, or functional homologs thereof, wherein the functional homologs have at least 70% homology with the ergothioneine transporter, for example, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, or at least 82%. For example, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% homology, and expressing two copies of NcEgt1 and two copies of CpEgt2.

[0203] In some embodiments, the yeast cells carry a deletion of a gene encoding an ergothioneine transporter in *Saccharomyces cerevisiae*, such as ScAGP2 (GenBank accession number JRIV01000019.1), ScTPO3 (GenBank accession number BK006949.2), ScTPO4 (GenBank accession number JRIV01000150.1), and / or ScTPO1 (GenBank accession number JRIV01000165.1), or a functional homolog thereof, wherein the functional homolog has at least 70% homology with the gene, for example, at least 71% homology with the gene, for example, up to Homology of at least 72%, for example, at least 73%, for example, at least 74%, for example, at least 75%, for example, at least 76%, for example, at least 77%, for example, at least 78%, for example, at least 79%, for example, at least 80%, for example, at least 81%, for example, at least 82%, for example, at least 83%, for example, at least 84%, for example, at least 85%, for example, at least 86%, for example, at least 87%, for example, at least 88%, for example, at least 89%, for example, at least 90%, for example, at least 91%, for example, at least 92%, for example, at least 93%, for example, at least 94%, for example, at least 95%, for example, at least 96%, for example, at least 97%, for example, at least 98%, for example, at least 99%. A functional variant here refers to a variant that retains all or part of the ergothioneine transporter activity, such as a mutant. Those skilled in the art know how to determine whether a functional variant retains said activity.

[0204] In some embodiments, the yeast cells carry a deletion of a gene encoding an ergothioneine transporter in *Saccharomyces cerevisiae*, such as ScAGP2 (GenBank accession number JRIV01000019.1), ScTPO3 (GenBank accession number BK006949.2), ScTPO4 (GenBank accession number JRIV01000150.1), and / or ScTPO1 (GenBank accession number JRIV01000165.1), or a functional homolog thereof, wherein the functional homolog has at least 70% homology with the gene, for example, at least 71%, at least 72%, or at least 73% homology with the gene. For example, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% homology; and first and second heterozymes, said first and second heterozymes being selected from:

[0205] i) NcEgt1 and CpEgt2;

[0206] ii) NcEgt1 and SpEgt2;

[0207] iii) NcEgt1 and NcEgt2;

[0208] iv) NcEgt1 and MsEgtE;

[0209] v)SpEgt1 and NcEgt2;

[0210] vi)SpEgt1 and SpEgt2;

[0211] vii)SpEgt1 and CpEgt2;

[0212] viii)SpEgt1 and MsEgtE;

[0213] ix)CpEgt1 and NcEgt2;

[0214] x)CpEgt1 and SpEgt2;

[0215] xi)CpEgt1 and CpEgt2; and

[0216] xii)CpEgt1 and MsEgtE,

[0217] Or a functional variant thereof, the functional variant having at least 70% homology with the first and second heterozymes, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%.

[0218] In a specific implementation, the yeast cell carries a deletion of the gene encoding the ergothioneine transporter protein of *Saccharomyces cerevisiae*, such as ScAGP2 (GenBank accession number JRIV01000019.1), ScTPO3 (GenBank accession number BK006949.2), ScTPO4 (GenBank accession number JRIV01000150.1), and / or ScTPO1 (GenBank accession number JRIV01000165.1), or a functional homolog thereof, wherein the functional homolog has at least 70% homology with the gene, for example, at least 71%, at least 72%, or at least 73% homology with the gene. For example, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% homology; and first and second heterozymes, said first and second heterozymes being selected from:

[0219] i) NcEgt1 and CpEgt2;

[0220] ii) NcEgt1 and SpEgt2;

[0221] iii) NcEgt1 and NcEgt2;

[0222] iv) NcEgt1 and MsEgtE;

[0223] xii)CpEgt1 and MsEgtE,

[0224] Or a functional variant thereof, the functional variant having at least 70% homology with the first and second heterozymes, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%.

[0225] In some embodiments, the yeast cells carry a deletion of a gene encoding an ergothioneine transporter in *Saccharomyces cerevisiae*, such as ScAGP2 (GenBank accession number JRIV01000019.1), ScTPO3 (GenBank accession number BK006949.2), ScTPO4 (GenBank accession number JRIV01000150.1), and / or ScTPO1 (GenBank accession number JRIV01000165.1), or a functional homolog thereof, wherein the functional homolog has at least 70% homology with the gene, for example, at least 71%, at least 72%, or at least 73% homology with the gene. For example, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% homology; and first and second heterozymes, wherein the first and second heterozymes are not:

[0226] iii) NcEgt1 and NcEgt2; or

[0227] viii)SpEgt1 and MsEgtE; or

[0228] x)CpEgt1 and SpEgt2.

[0229] In a specific implementation, the yeast cell carries a gene encoding an ergothioneine transporter in *Saccharomyces cerevisiae*, wherein the ergothioneine transporter is, for example, ScAGP2 (GenBank accession number JRIV01000019.1), ScTPO3 (GenBank accession number BK006949.2), ScTPO4 (GenBank accession number JRIV01000150.1), and / or ScTPO1 (GenBank accession number JRIV01000165.1), or a functional homolog thereof, wherein the functional homolog has at least 70% homology with the ergothioneine transporter, for example, at least 71%, for example, at least 72%. Homology of at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%; and expressing two copies of NcEgt1 and two copies of CpEgt2.

[0230] Yeast cells may have one or more of the above-mentioned genotypes, such as any combination of gene expression or gene deletion as described above.

[0231] In one embodiment, the yeast cells according to the invention further express MsErgt. In addition to expressing MsErgt, the yeast cells may also express one or more, two or more, three or more, four or more, or five or more of the genes HsSLC22A4, AtOCT1, ScAQR1, HsSLC22A16, and HsSLC22A32, and / or carry deletions of one or more, two or more, three or more, or four or more of the genes ScAGP2, ScTPO4, ScTPO3, and ScTPO1.

[0232] In one embodiment, the yeast cells according to the invention further express HsSLC22A4. In addition to expressing HsSLC22A4, the yeast cells may also express one or more, two or more, three or more, or four or more of the genes AtOCT1, ScAQR1, HsSLC22A16, and HsSLC22A32, and / or carry deletions of one or more, two or more, three or more, or four or more of the genes ScAGP2, ScTPO4, ScTPO3, and ScTPO1.

[0233] In one embodiment, the yeast cells according to the invention further express HsSLC22A4. In addition to expressing HsSLC22A4, the yeast cells may also express one or more, two or more, three or more, or four or more of the genes AtOCT1, ScAQR1, HsSLC22A16, and HsSLC22A32, and / or carry deletions of one or more, two or more, three or more, or four or more of the genes ScAGP2, ScTPO4, ScTPO3, and ScTPO1.

[0234] In one embodiment, the yeast cells according to the invention further express AtOCT1. In addition to expressing AtOCT1, the yeast cells may also express one or more, two or more, three or more of the genes ScAQR1, HsSLC22A16 and HsSLC22A32, and / or carry deletions of one or more, two or more, three or more or four or more of the genes ScAGP2, ScTPO4, ScTPO3 and ScTPO1.

[0235] In one embodiment, the yeast cells according to the invention further express HsSLC22A16. In addition to expressing HsSLC22A16, the yeast cells may also express one or more or two or more of the genes HsSLC22A16 and HsSLC22A32, and / or carry deletions of one or more, two or more, three or more, or four or more of the genes ScAGP2, ScTPO4, ScTPO3, and ScTPO1.

[0236] In one embodiment, the yeast cells according to the invention further express HsSLC22A32. In addition to expressing HsSLC22A32, the yeast cells may also express HsSLC22A32 and / or carry deletions of one, two or more, three or more, or four or more of the genes ScAGP2, ScTPO4, ScTPO3, and ScTPO1.

[0237] In one embodiment, the yeast cells according to the invention further carry a deletion of ScAGP2. In addition to carrying a deletion of ScAGP2, the yeast cells may also carry deletions of one or more, two or more, or three or more of the genes ScTPO4, ScTPO3, and ScTPO1.

[0238] In one embodiment, the yeast cells according to the invention further carry a deletion of ScTPO4. In addition to carrying a deletion of ScTPO4, the yeast cells may also carry deletions of one or more, two or more of the genes ScTPO3 and ScTPO1.

[0239] In one embodiment, the yeast cells according to the invention further carry a deletion of ScTPO3. In addition to carrying a deletion of ScTPO3, the yeast cells may also carry a deletion of ScTPO1.

[0240] Ergothioneine titer

[0241] The yeast cells disclosed herein are capable of producing total titers of at least 1 mg / L, for example, at least 2 mg / L, for example, at least 3 mg / L, for example, at least 4 mg / L, for example, at least 5 mg / L, for example, at least 6 mg / L, for example, at least 7 mg / L, for example, at least 8 mg / L, for example, at least 9 mg / L, for example, at least 10 mg / L, for example, at least 11 mg / L, for example, at least 12 mg / L, for example, at least 13 mg / L, for example, at least 14 mg / L, for example, at least 15 mg / L, for example, at least 20 mg / L, for example, at least 25 mg / L, for example, at least 30 mg / L, for example, up to Ergothioneine at concentrations of at least 35 mg / L, for example at least 40 mg / L, for example at least 45 mg / L, for example at least 50 mg / L, for example at least 100 mg / L, for example at least 150 mg / L, for example at least 200 mg / L, for example at least 300 mg / L, for example at least 400 mg / L, for example at least 500 mg / L, for example at least 600 mg / L, for example at least 700 mg / L, for example at least 800 mg / L, for example at least 900 mg / L, for example at least 1 g / L or more, wherein the total titer is the sum of the intracellular and extracellular ergothioneine titers. In fact, the ergothioneine produced may be secreted from the cells—extracellular ergothioneine—or it may be retained in the cells—intracellular ergothioneine.

[0242] Yeast cells can produce titers of at least 1 mg / L, for example, at least 2 mg / L, for example, at least 3 mg / L, for example, at least 4 mg / L, for example, at least 5 mg / L, for example, at least 6 mg / L, for example, at least 7 mg / L, for example, at least 8 mg / L, for example, at least 9 mg / L, for example, at least 10 mg / L, for example, at least 11 mg / L, for example, at least 12 mg / L, for example, at least 13 mg / L, for example, at least 14 mg / L, for example, at least 15 mg / L, for example, at least 20 mg / L, for example, at least 25 mg / L, for example, up to Extracellular ergothioneine at least 30 mg / L, for example at least 35 mg / L, for example at least 40 mg / L, for example at least 45 mg / L, for example at least 50 mg / L, for example at least 100 mg / L, for example at least 150 mg / L, for example at least 200 mg / L, for example at least 300 mg / L, for example at least 400 mg / L, for example at least 500 mg / L, for example at least 600 mg / L, for example at least 700 mg / L, for example at least 800 mg / L, for example at least 900 mg / L, for example at least 1 g / L or more.

[0243] Yeast cells can produce titers of at least 1 mg / L, for example, at least 2 mg / L, for example, at least 3 mg / L, for example, at least 4 mg / L, for example, at least 5 mg / L, for example, at least 6 mg / L, for example, at least 7 mg / L, for example, at least 8 mg / L, for example, at least 9 mg / L, for example, at least 10 mg / L, for example, at least 11 mg / L, for example, at least 12 mg / L, for example, at least 13 mg / L, for example, at least 14 mg / L, for example, at least 15 mg / L, for example, at least 20 mg / L, for example, at least 25 mg / L, for example, up to Less than 30 mg / L, for example at least 35 mg / L, for example at least 40 mg / L, for example at least 45 mg / L, for example at least 50 mg / L, for example at least 100 mg / L, for example at least 150 mg / L, for example at least 200 mg / L, for example at least 300 mg / L, for example at least 400 mg / L, for example at least 500 mg / L, for example at least 600 mg / L, for example at least 700 mg / L, for example at least 800 mg / L, for example at least 900 mg / L, for example at least 1 g / L or more of intracellular ergothioneine.

[0244] Methods for determining ergothioneine titers are known in the art. For example, intracellular ergothioneine titers can be determined by lysing cells and measuring the titer by HPLC (see Example 1). The titer can also be determined by HPLC in a supernatant fraction after cell removal.

[0245] In one embodiment, the yeast cell according to the invention is Yersinia lipolytica, which is capable of producing ergothioneine at a titer of at least 100 mg / L, such as at least 150 mg / L, at least 200 mg / L, at least 250 mg / L, at least 260 mg / L, or at least 270 mg / L.

[0246] Other modifications

[0247] The yeast cells according to the present invention are capable of producing ergothioneine, said yeast cells expressing at least one first heterozyme and at least one second heterozyme as described above. In some embodiments, the yeast cells according to the present invention express at least two copies of the gene encoding the first heterozyme and at least two copies of the gene encoding the second heterozyme.

[0248] Yeast cells carrying at least two or more copies of the same gene, such as at least three or more copies, or at least four or more copies of the same gene, are generally expected to produce a higher amount of the same protein encoded by that gene compared to yeast cells carrying only one copy of the gene.

[0249] In some embodiments of the present invention, the yeast cells may also contain one or more additional modifications, such as:

[0250] • Carrying one or more mutations in one or more genes, such as gene deletion; and / or

[0251] • Carrying at least one or more additional copies of one or more genes; in other words, expressing and / or overexpressing at least one or more additional genes.

[0252] As used herein, the term "mutation" includes insertions, deletions, substitutions, transversions, and point mutations in the coding and non-coding regions of a gene. A point mutation may involve a change of one base pair and may result in a premature stop codon, frameshift mutation, splice site mutation, or amino acid substitution. Mutations described herein can be mutations that lead to the linking of two proteins. A gene containing a mutation may be referred to as a "mutant gene." If the polypeptide encoded by the mutant gene has a sequence different from the wild-type sequence, the polypeptide may be referred to as a "mutant polypeptide" and / or a "mutant protein." When a mutant polypeptide contains an amino acid sequence different from the wild-type sequence, the mutant polypeptide may be described as carrying a mutation.

[0253] As described in this article, specific genes identified in *Saccharomyces cerevisiae* encode specific proteins. In other yeast species, these specific genes may have different annotations, but still encode similar proteins or functional homologs with similar functions. Therefore, knowledge from *Saccharomyces cerevisiae* can be transferred to other species, such as *Yarrowia lipolytica*. Those skilled in the art will know how to identify the corresponding proteins or genes to be modified, mutated, deleted, or overexpressed based on the information about *Saccharomyces cerevisiae* provided in this article.

[0254] Unbound by theory, modifying the following pathways in yeast cells may be advantageous:

[0255] • Increases nitrogen availability of ergothioneine precursors S-adenosylmethionine (SAM), histidine, and cysteine ​​by inhibiting nitrogen catabolites and / or transporting nitrogen-containing compounds.

[0256] • General amino acid control to improve the synthesis of all ergothioneine precursors

[0257] • Individual amino acid biosynthetic pathways, such as S-adenosylmethionine (SAM), histidine, cysteine, and arginine.

[0258] • Sulfur assimilation pathway

[0259] This modifies yeast cells by increasing ergothioneine synthesis through ergothioneine metabolism, thereby further increasing the ergothioneine titer.

[0260] Increased nitrogen availability for ergothionein precursors

[0261] In some implementations, yeast cells are able to increase nitrogen availability for S-adenosylmethionine (SAM), histidine, and cysteine. Yeast cells may be naturally capable of doing this, or they may be further modified to improve nitrogen availability by targeting precursors of SAM, histidine, and cysteine. This can be achieved by targeting nitrogen catabolite inhibition and / or nitrogen transport.

[0262] In one embodiment, the yeast cells carry one or more mutations that result in reduced inhibition of nitrogen catabolism. In other words, the yeast cells further contain one or more mutations that increase the availability of S-adenosylmethionine (SAM), histidine, and cysteine.

[0263] In specific implementations, reduction of nitrogen catabolite repression can be achieved by de-repressing genes that control nitrogen catabolite repression, such as transcriptional regulators. A non-limiting example is the deletion or inactivation of nitrogen catabolite repressor transcriptional regulator genes, leading to complete or partial loss of function of the corresponding protein. For example, in *Saccharomyces cerevisiae*, the transcription activator gene ScURE2 (GenBank accession number JRIV01000061.1) can be mutated or deleted. Therefore, in one implementation, the yeast cell carries one or more mutations in the ScURE2 gene.

[0264] In some embodiments, yeast cells carry a deletion of a gene encoding a transcriptional regulator that inhibits nitrogen catabolism, such as ScURE2 (GenBank accession number JRIV01000061.1), or a functional homolog thereof, said functional homolog having at least 70% homology to said gene, for example having at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, etc. Homology of at least 81%, for example, at least 82%, for example, at least 83%, for example, at least 84%, for example, at least 85%, for example, at least 86%, for example, at least 87%, for example, at least 88%, for example, at least 89%, for example, at least 90%, for example, at least 91%, for example, at least 92%, for example, at least 93%, for example, at least 94%, for example, at least 95%, for example, at least 96%, for example, at least 97%, for example, at least 98%, for example, at least 99%; and expressing at least one first heterozyme and at least one second heterozyme, wherein the first and second heterozymes are selected from:

[0265] i) NcEgt1 and CpEgt2;

[0266] ii) NcEgt1 and SpEgt2;

[0267] iii) NcEgt1 and NcEgt2;

[0268] iv) NcEgt1 and MsEgtE;

[0269] v)SpEgt1 and NcEgt2;

[0270] vi)SpEgt1 and SpEgt2;

[0271] vii)SpEgt1 and CpEgt2;

[0272] viii)SpEgt1 and MsEgtE;

[0273] ix)CpEgt1 and NcEgt2;

[0274] x)CpEgt1 and SpEgt2;

[0275] xi)CpEgt1 and CpEgt2; and

[0276] xii)CpEgt1 and MsEgtE,

[0277] Or a functional variant thereof, the functional variant having at least 70% homology with the first heterozyme and the second heterozyme, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%.

[0278] In one implementation, the yeast cell is *Saccharomyces cerevisiae*, carrying a deletion or mutation of ScURE2, and expressing two copies of NcEgt1 and two copies of CpEgt2.

[0279] In another embodiment, the yeast cell is Yersinia lipolytica, carrying a mutation that reduces Ure2 activity or a mutation that reduces the activity of at least one protein that has at least 70% sequence homology with Ure2.

[0280] Nitrogen availability can also be improved by expressing or overexpressing genes that regulate nitrogen response, thereby leading to the deinhibition of nitrogen catabolite inhibition. An example of such a gene in *Saccharomyces cerevisiae* is ScARG82 (GenBank accession number JRIV01000074.1). Therefore, in one embodiment, yeast cells, preferably *Saccharomyces cerevisiae*, are further expressed or overexpressed with ScARG82.

[0281] In some embodiments, the yeast cells further express or overexpress ScARG82. In one embodiment, the yeast cells carry at least one additional copy of ScARG82, such as at least two additional copies, such as at least three additional copies, such as at least four additional copies of ScARG82, or a functional homolog thereof, said functional homolog having at least 70% homology with ScARG82, such as having at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 95%.

[0282] In one implementation, yeast cells are able to reduce the translocation of basic amino acids such as histidine and / or SAM into vacuoles. Yeast cells may be naturally capable of doing this, or they may be further modified to reduce the translocation of basic amino acids, particularly histidine and / or SAM, into vacuoles. This can be achieved by introducing one or more mutations into one or more genes that result in a reduction in the translocation of histidine and / or SAM into vacuoles. In *Saccharomyces cerevisiae*, examples of such genes are ScVBA1 (GenBank accession number JRIV01000175.), ScVBA2 (GenBank accession number JRIV01000033.1), and / or ScVBA3 (GenBank accession number BK006937.2), or their functional homologs, which share at least 70%, for example, at least 75%, for example, at least 80%, for example, at least 85%, for example, at least 90%, for example, at least 95% homology with ScVBA1 (GenBank accession number JRIV01000175.), ScVBA2 (GenBank accession number JRIV01000033.1), and ScVBA3 (GenBank accession number BK006937.2). The gene encodes a permease involved in basic amino acid transport; and / or ScPET8 (GenBank accession number JRIV01000154.1) or a functional homolog thereof, said functional homolog sharing at least 70%, for example, at least 75%, for example, at least 80%, for example, at least 85%, for example, at least 90%, for example, at least 95% homology with ScPET8. In one embodiment, the yeast cell is *Saccharomyces cerevisiae*, carrying a deletion or mutation in the ScVBA2 gene. In one embodiment, the yeast cell is *Saccharomyces cerevisiae*, carrying a deletion or mutation in the ScVBA1 gene. In one embodiment, the yeast cell is *Saccharomyces cerevisiae*, carrying a deletion or mutation in the ScVBA3 gene. In one embodiment, the yeast cell is *Saccharomyces cerevisiae*, carrying a deletion or mutation in the ScPET8 gene.

[0283] In another embodiment, yeast cells are able to increase nitrogen transport into the cell. Yeast cells may be naturally capable of doing so, or they may be further modified to improve nitrogen transport into the cell. This can also be achieved by expressing or overexpressing genes that increase nitrogen transport into the cell, such as expressing or overexpressing ScSSY1 (GenBank accession number JRIV01000074.1), ScGRR1 (GenBank accession number JRIV01000227.1), ScYCK2 (GenBank accession number JRIV01000213.1), ScSTP1 (GenBank accession number JRIV01000080.1), ScSSY5 (GenBank accession number JRIV01000167.1), ScPTR3 (GenBank accession number JRIV01000088.1) and / or ScSTP2 (GenBank accession number JRIV01000156.1), or their functional homologs, said functional homologs. It shares at least 70%, for example, at least 75%, for example, at least 80%, for example, at least 85%, for example, at least 90%, for example, at least 95% homology with ScSSY1 (GenBank registration number JRIV01000074.1), ScGRR1 (GenBank registration number JRIV01000227.1), ScYCK2 (GenBank registration number JRIV01000213.1), ScSTP1 (GenBank registration number JRIV01000080.1), ScSSY5 (GenBank registration number JRIV01000167.1), ScPTR3 (GenBank registration number JRIV01000088.1) and / or ScSTP2 (GenBank registration number JRIV01000156.1).

[0284] In one embodiment, the yeast cells further express or overexpress ScSSY1. In one embodiment, the yeast cells further express or overexpress ScGRR1. In one embodiment, the yeast cells further express or overexpress ScYCK2. In one embodiment, the yeast cells further express or overexpress ScSSY5. In one embodiment, the yeast cells further express or overexpress ScPTR3. In one embodiment, the yeast cells further express or overexpress ScSTP2.

[0285] In some embodiments, the yeast cells further express or overexpress ScSSY1 or a functional homolog thereof having at least 70% homology with it. In one embodiment, the yeast cells carry at least one additional copy of ScSSY1, such as at least two additional copies, at least three additional copies, or at least four additional copies of ScSSY1.

[0286] In some embodiments, the yeast cells further express or overexpress ScGRR1 or a functional homolog thereof having at least 70% homology with it. In one embodiment, the yeast cells carry at least one additional copy of ScGRR1, such as at least two additional copies, at least three additional copies, or at least four additional copies of ScGRR1.

[0287] In some embodiments, the yeast cells further express or overexpress ScYCK2 or a functional homolog thereof having at least 70% homology with it. In one embodiment, the yeast cells carry at least one additional copy of ScYCK2, such as at least two additional copies, at least three additional copies, or at least four additional copies of ScYCK2.

[0288] In some embodiments, the yeast cells further express or overexpress ScSSY5 or a functional homolog thereof having at least 70% homology with it. In one embodiment, the yeast cells carry at least one additional copy of ScSSY1, such as at least two additional copies, at least three additional copies, or at least four additional copies of ScSSY1.

[0289] In some embodiments, the yeast cells further express or overexpress ScPTR3 or a functional homolog thereof having at least 70% homology with it. In one embodiment, the yeast cells carry at least one additional copy of ScSSY1, such as at least two additional copies, at least three additional copies, or at least four additional copies of ScSSY1.

[0290] In some embodiments, the yeast cells further express or overexpress ScSTP1 or a functional homolog thereof having at least 70% homology with it. In one embodiment, the yeast cells carry at least one additional copy of ScSSY1, such as at least two additional copies, at least three additional copies, or at least four additional copies of ScSSY1.

[0291] In some embodiments, the yeast cells further express or overexpress ScSTP1 or a functional homolog thereof having at least 70% homology with it. In one embodiment, the yeast cells carry at least one additional copy of ScSTP1, such as at least two additional copies, at least three additional copies, or at least four additional copies of ScSTP1.

[0292] In one embodiment, yeast cells further express or overexpress ScSTP1 as shown in SEQ ID NO:45 or a sequence having at least 70% homology with it, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%.

[0293] In some implementations, yeast cells express or overexpress transcription factors of nitrogen-containing compound transporters, such as SED ID. ScSTP1 or its functional homologs as shown in NO:45, wherein the functional homologs have at least 70% homology with ScSTP1, for example, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% homology with ScSTP1; and at least one first heterozyme and at least one second heterozyme selected from the following:

[0294] i) NcEgt1 and CpEgt2;

[0295] ii) NcEgt1 and SpEgt2;

[0296] iii) NcEgt1 and NcEgt2;

[0297] iv) NcEgt1 and MsEgtE;

[0298] v)SpEgt1 and NcEgt2;

[0299] vi)SpEgt1 and SpEgt2;

[0300] vii)SpEgt1 and CpEgt2;

[0301] viii)SpEgt1 and MsEgtE;

[0302] ix)CpEgt1 and NcEgt2;

[0303] x)CpEgt1 and SpEgt2;

[0304] xi)CpEgt1 and CpEgt2; and

[0305] xii)CpEgt1 and MsEgtE,

[0306] Or a functional variant thereof, the functional variant having at least 70% homology with the first heterozyme and the second heterozyme, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%.

[0307] In one embodiment, yeast cells express or overexpress ScSTP1 as shown in SED ID NO:45 or a sequence having at least 70% homology with it, for example, having at least 71%, for example, at least 72%, for example, at least 73%, for example, at least 74%, for example, at least 75%, for example, at least 76%, for example, at least 77%, for example, at least 78%, for example, at least 79%, for example, at least 80%, for example, at least 81%, for example, at least 82%, for example, at least 83%, for example, at least 84%, for example, at least 85%, for example, at least 86%, for example, at least 87%, for example, at least 88%, for example, at least 89%, for example, at least 90%, for example, at least 91%, for example, at least 92%, for example, at least 93%, for example, at least 94%, for example, at least 95%, for example, at least 96%, for example, at least 97%, for example, at least 98%, for example, at least 99% homology, as well as two copies of NcEgt1 and two copies of CpEgt2.

[0308] The gene encoding ScSTP1 is shown in SEQ ID NO:46.

[0309] In another embodiment, the yeast cell is Yersinia lipolytica, carrying a mutation that reduces the activity of Stp1 or a mutation that reduces the activity of at least one protein that has at least 70% sequence homology with Stp1.

[0310] General amino acid control and individual amino acid biosynthesis pathways

[0311] In some embodiments, yeast cells are able to increase amino acid biosynthesis, particularly the biosynthesis of ergothioneine precursors S-adenosylmethionine (SAM), histidine, and cysteine. Yeast cells may be naturally able to do this, or they may be further modified to improve amino acid biosynthesis. This can be accomplished through modifications to general amino acid controls and / or modifications to individual amino acid biosynthetic pathways. In one embodiment, the yeast cell further carries one or more mutations in one or more genes, resulting in increased amino acid biosynthesis. In some embodiments, the yeast cell carries one or more mutations in one or more genes, resulting in increased biosynthesis of arginine, histidine, cysteine, and / or S-adenosylmethionine.

[0312] In specific implementations, increased amino acid biosynthesis can be achieved by de-repressing amino acid biosynthesis genes, for example, by increasing and / or constitutively activating ScGCN2 (GenBank accession number JRIV01000117.1) and / or ScGCN4 (GenBank accession number JRIV01000017.1). In one implementation, the yeast cell carries one or more mutations that improve amino acid biosynthesis. In one implementation, the yeast cell carries a mutation in the ScGCN2 gene, resulting in increased Gcn2 activity. In another implementation, the yeast cell is *Saccharomyces cerevisiae*, carrying a deletion of the leader sequence preceding ScGCN4. In yet another implementation, the yeast cell is *Saccharomyces cerevisiae*, carrying a deletion of the upstream start codon of ScGCN4. It is generally known that four start codons precede the ORF of GCN4, which result in inactive GCN4 due to premature stop codons. Cells regulate the transcription of GCN4 by blocking / unblocking these upstream start codons. Constitutive activation of GCN4 can be achieved by deleting the upstream start codon and / or deleting the leader sequence preceding GCN4 containing the upstream start codon. In another implementation, the yeast cells carry a mutation in the ScPET18 gene.

[0313] In some embodiments, yeast cells carry one or more mutations in one or more upstream start codons and / or leader sequences of ScGCN4 or a functional homolog thereof, said functional homolog having at least 70% homology with ScGCN4, for example having at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, or at least 81% homology with ScGCN4. The enzyme exhibits at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% homology, and expresses at least one first heterozyme and at least one second heterozyme selected from the following:

[0314] i) NcEgt1 and CpEgt2;

[0315] ii) NcEgt1 and SpEgt2;

[0316] iii) NcEgt1 and NcEgt2;

[0317] iv) NcEgt1 and MsEgtE;

[0318] v)SpEgt1 and NcEgt2;

[0319] vi)SpEgt1 and SpEgt2;

[0320] vii)SpEgt1 and CpEgt2;

[0321] viii)SpEgt1 and MsEgtE;

[0322] ix)CpEgt1 and NcEgt2;

[0323] x)CpEgt1 and SpEgt2;

[0324] xi)CpEgt1 and CpEgt2; and

[0325] xii)CpEgt1 and MsEgtE,

[0326] Or a functional variant thereof, the functional variant having at least 70% homology with the first heterozyme and the second heterozyme, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%.

[0327] In one embodiment, the yeast cells, preferably Saccharomyces cerevisiae, carry one or more mutations in one or more upstream start codons and / or leader sequences of ScGCN4, and express two copies of NcEgt1 and two copies of CpEgt2.

[0328] Amino acid biosynthesis can also be improved by upregulating arginine biosynthesis. In one embodiment, the yeast cell is *Saccharomyces cerevisiae*, carrying a mutation in ScARG81, such as a deletion or mutation in ScARG81.

[0329] Amino acid biosynthesis can also be improved by upregulating histidine biosynthesis. In one embodiment, the yeast cell carries one or more mutations in a gene that improves histidine biosynthesis. In one embodiment, the yeast cell carries one or more mutations in one of the following genes: ScBAS1 (GenBank accession number JRIV01000108.1) and / or ScPHO2 (GenBank accession number JRIV01000173.1), or functional homologs thereof, said functional homologs having at least 70% homology with ScBAS1 and / or ScPHO2, resulting in linked or fused Bas1 and Pho2 proteins. As described in Pinson et al. 2000, the linking of Bas1 and Pho2 can be achieved. Therefore, chimerism between Bas1 and Pho2 can be achieved by linking the ScBAS1 and ScPHO2 genes to the BAS1 promoter.

[0330] In one embodiment, the yeast cell carries a fused ScBAS1 gene and ScPHO2 gene, as shown in SEQ ID NO:51, or a functional homology thereof, having at least 70%, at least 75%, at least 80%, or at least 85% homology with them.

[0331] In some implementations, the yeast cell carries one or more mutations in one or more genes encoding histidine, such as SCHIS1 (GenBank accession number JRIV01000173.1).

[0332] Therefore, in one implementation, the mutation in HIS1 is one of the following mutations:

[0333] a. Mutations that lead to frameshift mutations;

[0334] b. Mutations that lead to the formation of premature stop codons in the SCHIS1 gene;

[0335] c. Mutations at the splicing sites of the SCHIS1 gene;

[0336] Mutations in the promoter region of the d.ScHIS1 gene; and / or

[0337] Mutations in the introns of the e.ScHIS1 gene.

[0338] In one embodiment, the yeast cells according to the invention are capable of producing at least 100 mg / L, for example at least 150 mg / L, for example at least 200 mg / L, for example at least 250 mg / L of histidine.

[0339] Amino acid biosynthesis can also be improved by upregulating cysteine ​​biosynthesis. In one embodiment, the yeast cell carries one or more mutations in one or more genes that improve cysteine ​​biosynthesis. In one embodiment, the yeast cell carries one or more mutations resulting in increased cysteine ​​synthesis from homocysteine. In one embodiment, the yeast cell further expresses ScCYS3 (GenBank accession number JRIV01000001.1) or a functional homology thereof, said functional homology having at least 70%, for example, at least 75%, for example, at least 80%, for example, at least 85%, for example, at least 90%, for example, at least 95% homology with ScCYS3. In one embodiment, the yeast cell carries at least one additional copy of ScCYS3, for example, at least two additional copies, for example, at least three additional copies, for example, at least four additional copies of ScCYS3. In one embodiment, the yeast cells further express ScCYS4 (GenBank accession number JRIV01000163.1) or a functional homology thereof, said functional homology having at least 70%, for example, at least 75%, for example, at least 80%, for example, at least 85%, for example, at least 90%, for example, at least 95% homology with ScCYS4. In one embodiment, the yeast cells carry one additional copy of ScCYS4, for example, at least two additional copies, for example, at least three additional copies, for example, at least four additional copies of ScCYS4. In another embodiment, the yeast cells carry one or more mutations resulting in reduced conversion of cysteine ​​to homocysteine. In one embodiment, the yeast cells are *Saccharomyces cerevisiae*, carrying mutations or deletions in ScSTR2 (GenBank accession number JRIV01000227.1) or a functional homology thereof, said functional homology having at least 70%, for example, at least 75%, for example, at least 80%, for example, at least 85%, for example, at least 90%, for example, at least 95% homology with ScSTR2. In one embodiment, the yeast cell carries a mutation in ScSTR3, such as a deletion or mutation in ScSTR3 (GenBank accession number JRIV01000013.1) or its functional homolog, said functional homolog having at least 70%, for example, at least 75%, for example, at least 80%, for example, at least 85%, for example, at least 90%, for example, at least 95% homology with ScSTR3. In one embodiment, the yeast cell is *Saccharomyces cerevisiae*, carrying a mutation in ScGSH1, such as a deletion or mutation in ScGSH1 (GenBank accession number JRIV01000144.1).

[0340] In some embodiments, yeast cells, preferably *Saccharomyces cerevisiae*, carry a gene encoding cystathionine γ-synthase, such as ScSTR2, or a functional homolog thereof, with deletion or mutation, said functional homolog having at least 70% homology to said gene, for example, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, or at least 78%. Homology of at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%; and expressing at least one first heterozyme and at least one second heterozyme selected from the following:

[0341] i) NcEgt1 and CpEgt2;

[0342] ii) NcEgt1 and SpEgt2;

[0343] iii) NcEgt1 and NcEgt2;

[0344] iv) NcEgt1 and MsEgtE;

[0345] v)SpEgt1 and NcEgt2;

[0346] vi)SpEgt1 and SpEgt2;

[0347] vii)SpEgt1 and CpEgt2;

[0348] viii)SpEgt1 and MsEgtE;

[0349] ix)CpEgt1 and NcEgt2;

[0350] x)CpEgt1 and SpEgt2;

[0351] xi)CpEgt1 and CpEgt2; and

[0352] xii)CpEgt1 and MsEgtE,

[0353] Or a functional variant thereof, the functional variant having at least 70% homology with the first heterozyme and the second heterozyme, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%.

[0354] In one implementation, the yeast cell is *Saccharomyces cerevisiae*, carrying a deletion or mutation of ScSTR2, and expressing two copies of NcEgt1 and two copies of CpEgt2.

[0355] In another embodiment, the yeast cell is Yersinia lipolytica, carrying a mutation that reduces Str2 activity or a mutation that reduces the activity of at least one protein that has at least 70% sequence homology with Str2.

[0356] In some embodiments, the yeast cell carries one or more mutations in a gene encoding ATP phosphoribosyltransferase, an enzyme involved in histidine biosynthesis, such as SCHIS1 or a functional homolog thereof, said functional homolog having at least 70% homology with SCHIS1, for example having at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, etc. Homology of at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%; and expressing at least one first heterozyme and at least one second heterozyme selected from the following:

[0357] i) NcEgt1 and CpEgt2;

[0358] ii) NcEgt1 and SpEgt2;

[0359] iii) NcEgt1 and NcEgt2;

[0360] iv) NcEgt1 and MsEgtE;

[0361] v)SpEgt1 and NcEgt2;

[0362] vi)SpEgt1 and SpEgt2;

[0363] vii)SpEgt1 and CpEgt2;

[0364] viii)SpEgt1 and MsEgtE;

[0365] ix)CpEgt1 and NcEgt2;

[0366] x)CpEgt1 and SpEgt2;

[0367] xi)CpEgt1 and CpEgt2; and

[0368] xii)CpEgt1 and MsEgtE,

[0369] Or a functional variant thereof, the functional variant having at least 70% homology with the first heterozyme and the second heterozyme, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%.

[0370] In one implementation, the yeast cells carry one or more mutations in HIS1 and express two copies of NcEgt1 and two copies of CpEgt2.

[0371] In another embodiment, the yeast cells are capable of producing at least 100 mg / L, for example at least 150 mg / L, for example at least 200 mg / L, for example at least 250 mg / L, and expressing at least one first heterozyme and at least one second heterozyme selected from the following:

[0372] i) NcEgt1 and CpEgt2;

[0373] ii) NcEgt1 and SpEgt2;

[0374] iii) NcEgt1 and NcEgt2;

[0375] iv) NcEgt1 and MsEgtE;

[0376] v)SpEgt1 and NcEgt2;

[0377] vi)SpEgt1 and SpEgt2;

[0378] vii)SpEgt1 and CpEgt2;

[0379] viii)SpEgt1 and MsEgtE;

[0380] ix)CpEgt1 and NcEgt2;

[0381] x)CpEgt1 and SpEgt2;

[0382] xi)CpEgt1 and CpEgt2; and

[0383] xii)CpEgt1 and MsEgtE,

[0384] Or a functional variant thereof, the functional variant having at least 70% homology with the first heterozyme and the second heterozyme, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%.

[0385] In one embodiment, the yeast cells are capable of producing at least 100 mg / L, such as at least 150 mg / L, such as at least 200 mg / L, such as at least 250 mg / L, of histidine and expressing two copies of NcEgt1 and two copies of CpEgt2.

[0386] Yeast cells capable of increasing histidine production can be obtained as is known in the art, for example, by inducing yeast cell growth in the presence of β-(1,2,4-triazol-3-yl)-DL-alanine. To survive, yeast cells initiate overproduction of histidine by removing feedback inhibition in the pathway, and then the cells develop resistance to β-(1,2,4-triazol-3-yl)-DL-alanine (TRA). R And it produces excessive histidine. Regarding TRA R For the production of yeast cells, see Example 13 below.

[0387] Amino acid biosynthesis can also be improved by upregulating S-adenosylmethionine (SAM) biosynthesis. In one embodiment, the yeast cell carries one or more mutations in a gene that improves SAM biosynthesis. In one embodiment, the yeast cell carries one or more mutations that result in increased SAM production and / or pooling. In one embodiment, the yeast cell further expresses ScSAM2. In one embodiment, the yeast cell carries an additional copy of ScSAM2 (GenBank accession number JRIV01000080.1) or a functional homolog thereof, said functional homolog having at least 70% homology with ScSAM2 (GenBank accession number JRIV01000080.1), for example, having at least 75%, for example, at least 80%, for example, at least 85%, for example, at least 90%, for example, at least 95% homology with ScSAM2 (GenBank accession number JRIV01000080.1). In one embodiment, the yeast cell is *Saccharomyces cerevisiae*, carrying a mutation or deletion in ScGLC3 (GenBank accession number BK006939.2) or its functional homolog, said functional homolog having at least 70% homology with ScGLC3 (GenBank accession number BK006939.2), for example having at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% homology with ScGLC3 (GenBank accession number BK006939.2). In one embodiment, the yeast cell is *Saccharomyces cerevisiae*, carrying a mutation or deletion in ScSPE2 (GenBank accession number JRIV01000055.1) or its functional homologs, said functional homologs having at least 70% homology with ScSPE2 (GenBank accession number JRIV01000055.1), for example having at least 75%, for example at least 80%, for example at least 85%, for example at least 90%, for example at least 95% homology with ScSPE2 (GenBank accession number JRIV01000055.1). In one embodiment, the yeast cell is *Saccharomyces cerevisiae*, carrying a mutation or deletion in ScERG4 (GenBank accession number JRIV01000085.1) or its functional homologs, said functional homologs having at least 70% homology with ScERG4 (GenBank accession number JRIV01000085.1), for example having at least 75%, for example at least 80%, for example at least 85%, for example at least 90%, for example at least 95% homology with ScERG4 (GenBank accession number JRIV01000085.1).In one embodiment, the yeast cell carries one or more mutations that result in the removal of feedback resistance to ScMET13 (GenBank accession number JRIV01000134.1). In another embodiment, the yeast cell carries a mutation in ScMTHFR.

[0388] In some embodiments, the yeast cells are *Saccharomyces cerevisiae* carrying a deletion or mutation in the gene encoding S-adenosylmethionine decarboxylase, which encodes the biosynthesis of S-adenosylmethionine (SAM), such as ScSPE2, or a functional homolog thereof, said functional homolog having at least 70% homology with ScSPE2, for example having at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, or at least 79% homology with ScSPE2. Homology of at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%; and expressing at least one first heterozyme and at least one second heterozyme selected from the following:

[0389] i) NcEgt1 and CpEgt2;

[0390] ii) NcEgt1 and SpEgt2;

[0391] iii) NcEgt1 and NcEgt2;

[0392] iv) NcEgt1 and MsEgtE;

[0393] v)SpEgt1 and NcEgt2;

[0394] vi)SpEgt1 and SpEgt2;

[0395] vii)SpEgt1 and CpEgt2;

[0396] viii)SpEgt1 and MsEgtE;

[0397] ix)CpEgt1 and NcEgt2;

[0398] x)CpEgt1 and SpEgt2;

[0399] xi)CpEgt1 and CpEgt2; and

[0400] xii)CpEgt1 and MsEgtE,

[0401] Or a functional variant thereof, the functional variant having at least 70% homology with the first heterozyme and the second heterozyme, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%.

[0402] In one implementation, the yeast cell is *Saccharomyces cerevisiae*, carrying a deletion or mutation of ScSPE2, and expressing two copies of NcEgt1 and two copies of CpEgt2.

[0403] In some embodiments, the yeast cells are *Saccharomyces cerevisiae* carrying a deletion or mutation of the gene encoding δ(24(24(1)))-sterol reductase, which encodes the biosynthesis of S-adenosylmethionine (SAM), such as ScERG4, or a functional homolog thereof, said functional homolog having at least 70% homology with ScERG4, for example having at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, or at least 79% homology with ScERG4. For example, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% homology; and expressing at least one first heterozyme and at least one second heterozyme selected from the following:

[0404] i) NcEgt1 and CpEgt2;

[0405] ii) NcEgt1 and SpEgt2;

[0406] iii) NcEgt1 and NcEgt2;

[0407] iv) NcEgt1 and MsEgtE;

[0408] v)SpEgt1 and NcEgt2;

[0409] vi)SpEgt1 and SpEgt2;

[0410] vii)SpEgt1 and CpEgt2;

[0411] viii)SpEgt1 and MsEgtE;

[0412] ix)CpEgt1 and NcEgt2;

[0413] x)CpEgt1 and SpEgt2;

[0414] xi)CpEgt1 and CpEgt2; and

[0415] xii)CpEgt1 and MsEgtE,

[0416] Or a functional variant thereof, the functional variant having at least 70% homology with the first heterozyme and the second heterozyme, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%.

[0417] In one implementation, the yeast cell is *Saccharomyces cerevisiae*, carrying a deletion or mutation of ScERG4, and expressing two copies of NcEgt1 and two copies of CpEgt2.

[0418] Sulfur assimilation pathway

[0419] In some implementations, yeast cells are able to improve sulfur assimilation pathways. Yeast cells may be naturally able to do this, or they may be further modified to improve sulfur assimilation. This can be achieved by expressing or overexpressing enzymes that improve sulfur assimilation, particularly adenosine sulfate kinase and / or phosphate adenosine phosphate sulfate reductase.

[0420] In one embodiment, the yeast cells further express or overexpress ScMET4 (GenBank accession number JRIV01000213.1) or a functional homolog thereof, said functional homolog having at least 70% homology with ScMET4 (GenBank accession number JRIV01000213.1), for example having at least 75%, for example at least 80%, for example at least 85%, for example at least 90%, for example at least 95% homology with ScMET4 (GenBank accession number JRIV01000213.1). In one embodiment, the yeast cells carry at least one additional copy of ScMET4, for example at least two additional copies, for example at least three additional copies, for example at least four additional copies of ScMET4.

[0421] In one embodiment, the yeast cells further express or overexpress ScMET14 (GenBank accession number JRIV01000011.1) or a functional homolog thereof, said functional homolog having at least 70% homology with ScMET14 (GenBank accession number JRIV01000011.1), for example having at least 75%, for example at least 80%, for example at least 85%, for example at least 90%, for example at least 95% homology with ScMET14 (GenBank accession number JRIV01000011.1). In one embodiment, the yeast cells carry at least one additional copy of ScMET14, for example at least two additional copies, for example at least three additional copies, for example at least four additional copies of ScMET14.

[0422] In another embodiment, the yeast cells further express adenosine sulfate kinase (ScMET14) or a functional homolog thereof as shown in SEQ ID NO:47, for example having at least 70% identity with it, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99% homology.

[0423] The gene encoding ScMET14 is shown in SEQ ID NO:48.

[0424] In one embodiment, the yeast cells further express or overexpress ScMET16 (Genbank accession number JRIV01000176.1) or a functional homolog thereof, said functional homolog having at least 70% homology with ScMET16 (Genbank accession number JRIV01000176.1), for example having at least 75%, for example at least 80%, for example at least 85%, for example at least 90%, for example at least 95% homology with ScMET16 (Genbank accession number JRIV01000176.1). In one embodiment, the yeast cells carry at least one additional copy of ScMET16, for example at least three copies, for example at least four copies of ScMET16.

[0425] In yet another embodiment, the yeast cells further express phosphoadenosine phosphate reductase (ScMET16) or a functional homolog thereof as shown in SEQ ID NO:49, for example having at least 70% identity with it, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%.

[0426] The gene encoding ScMET16 is shown in SEQ ID NO:50.

[0427] In some embodiments, yeast cells express adenosine sulfate kinase (ScMET14) or a functional homolog thereof as shown in SEQ ID NO:47, for example having at least 70% identity with it, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99% homology; and at least one first heterozyme and at least one second heterozyme selected from the following:

[0428] i) NcEgt1 and CpEgt2;

[0429] ii) NcEgt1 and SpEgt2;

[0430] iii) NcEgt1 and NcEgt2;

[0431] iv) NcEgt1 and MsEgtE;

[0432] v)SpEgt1 and NcEgt2;

[0433] vi)SpEgt1 and SpEgt2;

[0434] vii)SpEgt1 and CpEgt2;

[0435] viii)SpEgt1 and MsEgtE;

[0436] ix)CpEgt1 and NcEgt2;

[0437] x)CpEgt1 and SpEgt2;

[0438] xi)CpEgt1 and CpEgt2; and

[0439] xii)CpEgt1 and MsEgtE,

[0440] Or a functional variant thereof, the functional variant having at least 70% homology with the first heterozyme and the second heterozyme, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%.

[0441] In one embodiment, yeast cells express adenosine sulfate kinase (ScMET14) as shown in SEQ ID NO:47 or its functional homology, for example, having at least 70% identity with it, for example, having at least 71%, for example, at least 72%, for example, at least 73%, for example, at least 74%, for example, at least 75%, for example, at least 76%, for example, at least 77%, for example, at least 78%, for example, at least 79%, for example, at least 80%, for example, at least 81%, for example, at least 82%, for example, at least 83%, for example, at least 84%, for example, at least 85%, for example, at least 86%, for example, at least 87%, for example, at least 88%, for example, at least 89%, for example, at least 90%, for example, at least 91%, for example, at least 92%, for example, at least 93%, for example, at least 94%, for example, at least 95%, for example, at least 96%, for example, at least 97%, for example, at least 98%, for example, at least 99% homology; and two copies of NcEgt1 and two copies of CpEgt2.

[0442] In some embodiments, yeast cells express phosphoadenosine phosphate reductase (ScMET16) as shown in SEQ ID NO:49 or a functional homolog thereof, for example having at least 70% identity with it, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99% homology; and at least one first heterozyme and at least one second heterozyme selected from the following:

[0443] i) NcEgt1 and CpEgt2;

[0444] ii) NcEgt1 and SpEgt2;

[0445] iii) NcEgt1 and NcEgt2;

[0446] iv) NcEgt1 and MsEgtE;

[0447] v)SpEgt1 and NcEgt2;

[0448] vi)SpEgt1 and SpEgt2;

[0449] vii)SpEgt1 and CpEgt2;

[0450] viii)SpEgt1 and MsEgtE;

[0451] ix)CpEgt1 and NcEgt2;

[0452] x)CpEgt1 and SpEgt2;

[0453] xi)CpEgt1 and CpEgt2; and

[0454] xii)CpEgt1 and MsEgtE,

[0455] Or a functional variant thereof, the functional variant having at least 70% homology with the first heterozyme and the second heterozyme, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%.

[0456] In one embodiment, yeast cells express phosphoadenosine phosphate reductase (ScMET16) as shown in SEQ ID NO:49 or a functional homolog thereof, for example having at least 70% identity with it, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99% homology; and two copies of NcEgt1 and two copies of CpEgt2.

[0457] In one embodiment, the yeast cell according to the invention further carries one or more mutations in SCHIS1. In addition to carrying one or more mutations in SCHIS1, the yeast cell may also express one or more or three or more of the genes ScSTP1, ScMET14 and ScMET16, and / or carry one or more, two or more, three or more or four or more deletions of the genes ScURE2, ScSTR2, ScSPE2 and ScERG4, and / or one or more mutations in one or more start codons of ScGCN4.

[0458] In one embodiment, the yeast cell according to the invention is capable of producing at least 100 mg / L, for example, at least 150 mg / L, for example, at least 200 mg / L, for example, at least 250 mg / L of histidine. In addition to being capable of producing at least 100 mg / L, for example, at least 150 mg / L, for example, at least 200 mg / L, for example, at least 250 mg / L of histidine, the yeast cell may also express one or more, two or more, three or more of the genes ScSTP1, ScMET14, and ScMET16, and / or carry one or more, two or more, three or more, or four or more deletions of the genes ScURE2, ScSTR2, ScSPE2, and ScERG4, and / or one or more mutations in one or more start codons of ScGCN4.

[0459] In one embodiment, the yeast cells according to the invention further express ScSTP1. In addition to expressing ScSTP1, the yeast cells may also express one or more, two or more of the genes ScMET14 and ScMET16, and / or carry one or more, two or more, three or more or four or more deletions of the genes ScURE2, ScSTR2, ScSPE2 and ScERG4, and / or one or more mutations in one or more start codons of ScGCN4.

[0460] In one embodiment, the yeast cells according to the invention further express ScMET14. In addition to expressing ScMET14, the yeast cells may also express ScMET16, and / or carry one or more, two or more, three or more, or four or more deletions of genes ScURE2, ScSTR2, ScSPE2, and ScERG4, and / or one or more mutations in one or more start codons of ScGCN4.

[0461] In one embodiment, the yeast cells according to the invention further express ScMET16. In addition to expressing ScMET16, the yeast cells may also carry one or more, two or more, three or more, or four or more deletions of the genes ScURE2, ScSTR2, ScSPE2, and ScERG4, and / or one or more mutations in one or more start codons of ScGCN4.

[0462] In one embodiment, the yeast cells according to the invention further carry a deletion of ScURE2. In addition to carrying a deletion of ScURE2, the yeast cells may also carry one or more, two or more, three or more deletions of genes ScSTR2, ScSPE2 and ScERG4, and / or one or more mutations in one or more start codons of ScGCN4.

[0463] In one embodiment, the yeast cells according to the invention further carry a deletion of ScSTR2. In addition to carrying a deletion of ScSTR2, the yeast cells may also carry deletions of one or more of the genes ScSPE2 and ScERG4, and / or mutations in one or more start codons of ScGCN4.

[0464] In one embodiment, the yeast cells according to the invention further carry a deletion of ScERG4. In addition to carrying a deletion of ScERG4, the yeast cells may also carry one or more mutations in one or more start codons of ScGCN4.

[0465] Any of the combinations described above can be combined with the modifications described in the "ergothionein transporter" section.

[0466] Ergothioneine production method

[0467] The present invention also provides a method for producing ergothionein in yeast cells, comprising the following steps:

[0468] i) Provide yeast cells capable of producing ergothioneine, said yeast cells expressing:

[0469] a) at least one first heterologous enzyme capable of converting L-histidine and / or L-cysteine ​​into S-(histidinetrimethyl-2-yl)-L-cysteine-S-oxide; and

[0470] b) At least one second heterozyme capable of converting S-(histidine trimethyl-2-yl)-L-cysteine-S-oxide into 2-(hydroxythioalkyl)-histidine trimethyl inner salt;

[0471] Furthermore, yeast cells are able to convert 2-(hydroxythioalkyl)-histidine trimethyl inner salt into ergothionein;

[0472] ii) Culture the yeast cells in a culture medium;

[0473] This allows the production of ergothioneine.

[0474] Any yeast cell described herein, particularly in the “Yeast Cells” section, can be used in such methods. Specifically, the yeast cell can express a first heterozyme as described herein, for example, in the “First Heteroenzyme” section above, and a second heterozyme as described herein, for example, in the “Second Heteroenzyme” section above. In a particular embodiment, the yeast cell expresses the combination listed under the “Combination of First and Second Heteroenzymes” section. Therefore, such cells can be used to produce ergothioneine by incubating the yeast cells disclosed herein in a culture medium under conditions that allow the yeast cells to produce ergothioneine.

[0475] Suitable culture media are known to the technicians. Optimization of culture media and incubation conditions is also advocated for to achieve optimal ergothioneine production.

[0476] To produce ergothioneine, yeast cells require suitable substrates. Ergothioneine is produced from L-histidine and / or L-cysteine. Yeast cells are capable of synthesizing L-histidine and / or L-cysteine, which can then be used as substrates. Therefore, the culture medium does not necessarily contain these amino acids. However, in some cases, supplementing the culture medium with amino acids may be useful, particularly histidine, preferably L-histidine; cysteine, preferably L-cysteine; or methionine, preferably L-methionine. Without being bound by theory, supplementing the culture medium with amino acids, especially those previously listed, can increase ergothioneine titers.

[0477] In some embodiments, the culture medium contains at least one amino acid, such as histidine, preferably L-histidine, cysteine, preferably L-cysteine, or methionine, preferably L-methionine, at a concentration of at least 0.1 g / L, such as at least 0.2 g / L, at least 0.3 g / L, at least 0.4 g / L, at least 0.5 g / L, at least 0.75 g / L, at least 1 g / L, or at least 2 g / L.

[0478] In some embodiments of this method, yeast cells express a first heterozyme selected from the following: L-histidine Nα-methyltransferase (EC 2.1.1.44), histidine trimethylcysteine ​​S-oxide synthase (EC 1.14.99.51), glutamate-cysteine ​​ligase (EC 6.3.2.2), γ-glutamylhistidine trimethylcysteine ​​S-oxide synthase (EC 1.14.99.50), and γ-glutamylhistidine trimethylcysteine ​​S-oxide hydrolase (EC 3.5.1.118). In some embodiments, the first heterozyme is an enzyme with an EC number selected from EC 2.1.1.44, EC 1.14.99.51, EC 6.3.2.2, EC 1.14.99.50, and EC 3.5.1.118. In one embodiment, the EC number is 2.1.1.44. In another implementation, the EC number is EC 1.14.99.51.

[0479] In some embodiments, the method includes providing yeast cells expressing a first heterozyme and a second heterozyme, wherein the first heterozyme is Egt1, which is derived from a eukaryote, such as a fungus, like yeast. In addition to the first heterozyme, the yeast cells of this disclosure may naturally express an enzyme capable of catalyzing the same reaction as the first heterozyme, or the yeast cells may not have an enzyme capable of catalyzing the reaction.

[0480] In some implementations, the first heterozyme is derived from eukaryotes and is classified as EC 2.1.1.44 and / or EC.1.14.99.51.

[0481] In some embodiments, the first heterologous enzyme is Egt1 or a functional variant thereof from the following organisms: *Neurospora crassa*, *Cervidae*, *Schizosaccharomyces cerevisiae*, *Rhizopus spp.*, *Aspergillus nidus*, *Aspergillus niger*, *Penicillium rochfellii*, *Penicillium terrestris*, *Saccharomyces ochraceus*, *Aspergillus oryzae*, *Aspergillus carbonisata*, *Neurospora tetrasporium*, *Agaricus bisporus*, *Pleurotus ostreatus*, *Lentinula edodes*, or *Grifola frondosa*, wherein the functional variant has at least 70% homology with said Egt1, for example, having at least 71%, at least 72%, at least 73%, at least 74%, to 75%, or at least [missing information]. Homology of 76%, for example, at least 77%, for example, at least 78%, for example, at least 79%, for example, at least 80%, for example, at least 81%, for example, at least 82%, for example, at least 83%, for example, at least 84%, for example, at least 85%, for example, at least 86%, for example, at least 87%, for example, at least 88%, for example, at least 89%, for example, at least 90%, for example, at least 91%, for example, at least 92%, for example, at least 93%, for example, at least 94%, for example, at least 95%, for example, at least 96%, for example, at least 97%, for example, at least 98%, for example, at least 99%. The term "functional variant" refers to a variant, such as a mutant, that retains all or part of the activity and is still able to convert L-histidine and / or L-cysteine ​​to S-(histidine trimethyl-2-yl)-L-cysteine-S-oxide. Those skilled in the art know how to determine whether a functional variant retains said activity, for example, by detecting the product using liquid chromatography optionally coupled with mass spectrometry.

[0482] In some embodiments, the first heterologous enzyme expressed in the yeast cells provided in the first step of this method is derived from *Neurospora crassa*, *Schizosaccharomyces cerevisiae*, or *Ergotae*. The sequences of the corresponding Egt1 enzymes are shown in SEQ ID NO:2 (*Neurospora crassa*), SEQ ID NO:4 (*Schizosaccharomyces cerevisiae*), and SEQ ID NO:6 (*Ergotae*).

[0483] In a particular embodiment, the first heterozyme is selected from NcEgt1 (SEQ ID NO:2), SpEgt1 (SEQ ID NO:4), and CpEgt1 (SEQ ID NO:6), and functional variants thereof, said functional variants having at least 70% homology with SEQ ID NO:2, SEQ ID NO:4, or SEQ ID NO:6, for example having homology with SEQ ID NO:2, SEQ ID NO:4, or SEQ ID NO:6. NO:6 at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99% homology.

[0484] In some embodiments, the method includes providing yeast cells expressing a second heterologous enzyme, which in some embodiments is a β-lyase or histidine trimethylcysteine ​​sulfoxide lyase (EC 4.4.1-).

[0485] In some embodiments, the second heterozyme expressed in the yeast cells provided in this method is Egt2, which is derived from eukaryotes, such as fungi, like yeast. In addition to the first heterozyme, the yeast cells of this disclosure may also naturally express an enzyme capable of catalyzing the same reaction as the second heterozyme, or the yeast cells may not have an enzyme capable of catalyzing the reaction. In some embodiments, the second heterozyme is EgtE derived from bacteria.

[0486] In some embodiments, the second heterologous enzyme is Egt2 or a functional variant thereof derived from organisms such as *Neurospora crassa*, *Ergotae*, *Schizosaccharomyces cerevisiae*, *Rhizopus stolonifer*, *Aspergillus nidus*, *Aspergillus niger*, *Penicillium rochfellii*, *Penicillium terrestris*, *Saccharomyces ochraceus*, *Aspergillus oryzae*, *Aspergillus carbonisata*, *Neurospora tetrasporium*, *Agaricus bisporus*, *Pleurotus ostreatus*, *Lentinula edodes*, *Grifola frondosa*, *Ganoderma lucidum*, or *Candida albicans*, wherein the functional variant has at least 70% homology with Egt2, for example, at least 71%, at least 72%, at least 73%, at least 74%, or at least 75% homology with Egt2. For example, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology. The term "functional variant" refers to a variant, such as a mutant, that retains all or part of the activity and is still able to convert S-(histidine trimethyl-2-yl)-L-cysteine-S-oxide to 2-(hydroxythioalkyl)-histidine trimethyl inner salt. Those skilled in the art know how to determine whether a functional variant retains said activity, for example by detecting the product using liquid chromatography optionally coupled with mass spectrometry.

[0487] In other embodiments, the second heterozyme is a bacterial EgtE or a functional variant thereof, such as EgtE from the following bacteria: *Mycobacterium smegmatis*, *Nocardia asteroides*, *Streptomyces albopictus*, *Streptomyces flexneri*, *Streptomyces griseus*, *Actinomyces hygroscopicus*, *Aspergillus fumigatus*, *Mycobacterium tuberculosis*, *Mycobacterium kansasense*, *Mycobacterium intracellulare*, *Mycobacterium occulta*, *Mycobacterium ulcerans*, *Mycobacterium pasteurellosis*, *Mycobacterium leprae*, *Mycobacterium avium*, *Mycobacterium bovis*, *Mycobacterium marineum*, *Mycobacterium vulnificus*, *Mycobacterium paratuberculosis*, *Mycobacterium gracilis*, *Rhodococcus roseum* (*Mycobacterium roseum*), *Spirulina obtusifolia*, *Spirulina maxima*, *Spirulina algae*, *Pseudocystaphylococcus*, *Oscillatoria*, and *Rhodophyta*, said functional variant having at least 70% homology with said EgtE. The homology, for example, having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%. The term "functional variant" refers to a variant that retains all or part of its activity and is still able to convert S-(histidine trimethyl-2-yl)-L-cysteine-S-oxide to 2-(hydroxythioalkyl)-histidine trimethyl inner salt, such as a mutant. Those skilled in the art know how to determine whether a functional variant retains the activity.

[0488] In some embodiments of this method, the second heterologous enzyme is derived from *Neurospora crassa*, *Schizosaccharomyces cerevisiae*, *Cervidia esculenta*, or *Mycobacterium smegmatis*. The sequences of the corresponding Egt2 or EgtE enzymes are shown in SEQ ID NO:8 (*Neurospora crassa*), SEQ ID NO:10 (*Schizosaccharomyces cerevisiae*), SEQ ID NO:12 (*Cervidia esculenta*), and SEQ ID NO:14 (*Mycobacterium smegmatis*).

[0489] In a particular embodiment, the second heterozyme expressed in yeast cells may be selected from NcEgt2 (SEQ ID NO:8), SpEgt2 (SEQ ID NO:10), CpEgt2 (SEQ ID NO:12), and MsEgtE (SEQ ID NO:14), and functional variants thereof, said functional variants having at least 70% homology with SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, or SEQ ID NO:14, for example having homology with SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, or SEQ ID NO:14. NO:14 Homology of at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%.

[0490] Therefore, in some embodiments, the method includes providing yeast cells expressing a first heterozyme and a second heterozyme, wherein:

[0491] - The first heterologous enzyme is Egt1 or a functional variant thereof from the following organisms: *Neurospora crassa*, *Ergotae*, *Schizosaccharomyces cerevisiae*, *Rhizopus stolonifer*, *Aspergillus nidus*, *Aspergillus niger*, *Penicillium rochfellii*, *Penicillium terrestris*, *Saccharomyces ochraceus*, *Aspergillus oryzae*, *Aspergillus carbonisata*, *Neurospora tetrasporium*, *Agaricus bisporus*, *Pleurotus ostreatus*, *Lentinula edodes*, or *Grifola frondosa*, wherein the functional variant has at least 70% homology with said Egt1, for example, at least 71%, at least 72%, at least 73%, at least 74%, to 75%, or at least 76% homology with said Egt1. For example, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% homology; and

[0492] - The second heterologous enzyme is Egt2 or a functional variant thereof from the following organisms: *Neurospora crassa*, *Cervidae*, *Schizosaccharomyces cerevisiae*, *Rhizopus stolonifer*, *Aspergillus nidus*, *Aspergillus niger*, *Penicillium rochfellii*, *Penicillium terrestris*, *Saccharomyces ochraceus*, *Aspergillus oryzae*, *Aspergillus charcoalii*, *Neurospora tetrasporium*, *Agaricus bisporus*, *Pleurotus ostreatus*, *Lentinula edodes*, *Grifola frondosa*, *Ganoderma lucidum*, or *Candida albicans*, or the second heterologous enzyme is a bacterial EgtE, such as EgtE from the following bacteria: *Mycobacterium smegmatis*. Nocardia asteroides, Streptomyces albopictus, Streptomyces flexneri, Streptomyces griseus, Actinobacillus pilaris, Aspergillus fumigatus, Mycobacterium tuberculosis, Mycobacterium kansasii, Mycobacterium intracellularis, Mycobacterium occulta, Mycobacterium ulcerans, Mycobacterium pasteurellosis, Mycobacterium leprae, Mycobacterium avium, Mycobacterium bovis, Mycobacterium marineum, Mycobacterium vulnificus, Mycobacterium paratuberculosis, Mycobacterium spp., Rhodococcus roseum (Mycobacterium roseum), Spirulina obtuseum The functional variants of *Spiralella maxima*, *Hypericum floribundum*, *Pseudobranchia*, *Oscillatoria*, and *Rhodophyta* have at least 70% homology with the second heterozyme, for example, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology with the second heterozyme.

[0493] In a specific embodiment, the first heterozyme is an enzyme as shown in SEQ ID NO:2 (Neurospora crassa), SEQ ID NO:4 (Schizophyte sacchariformis), and SEQ ID NO:6 (Ergotae), and the second heterozyme is an enzyme as shown in SEQ ID NO:8 (Neurospora crassa), SEQ ID NO:10 (Schizophyte sacchariformis), SEQ ID NO:12 (Ergotae), and SEQ ID NO:6 (Ergotae). The enzyme represented by NO:14 (Mycobacterium smegmatis), or a functional variant thereof, having at least 70% homology with the first and second heterozymes, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%.

[0494] In some implementations, the first and second heterozymes are:

[0495] i) NcEgt1 and CpEgt2;

[0496] ii) NcEgt1 and SpEgt2;

[0497] iii) NcEgt1 and NcEgt2;

[0498] iv) NcEgt1 and MsEgtE;

[0499] v)SpEgt1 and NcEgt2;

[0500] vi)SpEgt1 and SpEgt2;

[0501] vii)SpEgt1 and CpEgt2;

[0502] viii)SpEgt1 and MsEgtE;

[0503] ix)CpEgt1 and NcEgt2;

[0504] x)CpEgt1 and SpEgt2;

[0505] xi)CpEgt1 and CpEgt2;

[0506] xii)CpEgt1 and MsEgtE,

[0507] Or a functional variant thereof, the functional variant having at least 70% homology with the first and second heterozymes, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%.

[0508] In a specific implementation, yeast cells express the following first and second heterologous enzymes:

[0509] i) NcEgt1 and NcEgt2;

[0510] ii) NcEgt1 and SpEgt2;

[0511] iii) NcEgt1 and CpEgt2;

[0512] iv) NcEgt1 and MsEgtE;

[0513] xii)CpEgt1 and MsEgtE,

[0514] Or a functional variant thereof, the functional variant having at least 70% homology with the first and second heterozymes, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%.

[0515] In some embodiments, the yeast cells of the present invention express first and second heterologous enzymes, wherein the first and second heterologous enzymes are not:

[0516] i) NcEgt1 and NcEgt2; or

[0517] viii)SpEgt1 and MsEgtE; or

[0518] x)CpEgt1 and SpEgt2.

[0519] The expression of the enzyme can be achieved as is known in the art, for example by introducing nucleic acids encoding the first and second heterozymes as described above in the "Nucleic Acids Encoding the First and Second Heterozymes" section into yeast cells.

[0520] In some embodiments, the yeast cells used in this method may further express ergothioneine transporters, such as heterologous ergothioneine transporters, such as the ergothioneine transporter (MsErgT) of Mycobacterium smegmatis as shown in SEQ ID NO:35, or as shown in SEQ ID NO:35. The ergothioneine transporter protein (HsSLC22A4) of Homo sapiens shown in NO:36, or a functional homolog thereof, wherein the functional homolog has at least 70% homology with the ergothioneine transporter protein, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%.

[0521] In some embodiments, the method therefore includes the step of providing and incubating yeast cells expressing ergothioneine transporters, such as MsErgT as shown in SEQ ID NO:35 or as shown in SEQ ID NO:35. HsSLC22A4 as shown in NO:36, or a functional homolog thereof, wherein the functional homolog has at least 70% homology with the ergothioneine transporter, for example, having at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology with the ergothioneine transporter; and a first or second heterozyme selected from the following:

[0522] i) NcEgt1 and CpEgt2;

[0523] ii) NcEgt1 and SpEgt2;

[0524] iii) NcEgt1 and NcEgt2;

[0525] iv) NcEgt1 and MsEgtE;

[0526] v)SpEgt1 and NcEgt2;

[0527] vi)SpEgt1 and SpEgt2;

[0528] vii)SpEgt1 and CpEgt2;

[0529] viii)SpEgt1 and MsEgtE;

[0530] ix)CpEgt1 and NcEgt2;

[0531] x)CpEgt1 and SpEgt2;

[0532] xi)CpEgt1 and CpEgt2; and

[0533] xii)CpEgt1 and MsEgtE,

[0534] Or a functional variant thereof, the functional variant having at least 70% homology with the first and second heterozymes, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%.

[0535] In a specific implementation, the yeast cells used in this method express ergothioneine transporters, such as MsErgT as shown in SEQ ID NO:35 or as shown in SEQ ID NO:35. HsSLC22A4 as shown in NO:36, or a functional homolog thereof, said functional homolog having at least 70% homology with said ergothioneine transporter, for example having at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, and selected from the first and second heterozymes:

[0536] i) NcEgt1 and CpEgt2;

[0537] ii) NcEgt1 and SpEgt2;

[0538] iii) NcEgt1 and NcEgt2;

[0539] iv) NcEgt1 and MsEgtE;

[0540] xii)CpEgt1 and MsEgtE,

[0541] Or a functional variant thereof, the functional variant having at least 70% homology with the first and second heterozymes, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%.

[0542] In some embodiments, the yeast cells used in this method express ergothioneine transporters, such as MsErgT as shown in SEQ ID NO:35 or as shown in SEQ ID NO:35. HsSLC22A4 as shown in NO:36, or a functional homolog thereof, said functional homolog having at least 70% homology with said ergothioneine transporter, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%, and a first and second heterozyme, said first and second heterozymes are not:

[0543] iii) NcEgt1 and NcEgt2; or

[0544] viii)SpEgt1 and MsEgtE; or

[0545] x)CpEgt1 and SpEgt2.

[0546] In some embodiments, the yeast cells used in this method may further comprise one or more additional modifications as described herein in the sections entitled "Ergothioneine Transporter" and "Other Modifications," particularly:

[0547] • Increases nitrogen availability of ergothioneine precursors S-adenosylmethionine (SAM), histidine, and cysteine ​​by inhibiting nitrogen catabolites and / or transporting nitrogen-containing compounds.

[0548] • General amino acid control to improve the synthesis of all ergothioneine precursors

[0549] • Individual amino acid biosynthetic pathways, such as S-adenosylmethionine (SAM), histidine, cysteine, and arginine.

[0550] • Sulfur assimilation pathway

[0551] • The yeast cell according to any one of the preceding items, wherein the yeast cell is capable of producing at least 100 mg / L, for example at least 150 mg / L, for example at least 200 mg / L, for example at least 250 mg / L of histidine.

[0552] In some implementations, the yeast cells used in this method further express or overexpress one or more of the following:

[0553] o Ergothionein transporter, such as MsErgT (SEQ ID NO:35) or its variants having at least 70% homology with it;

[0554] o Ergothioneine transporter protein, such as HsSLC22A4 (SEQ ID NO:36) or its variants having at least 70% homology with it;

[0555] o Ergothionein transporter, such as AtOCT1 (SEQ ID NO:37) or its variants having at least 70% homology;

[0556] o Ergothionein transporter, such as ScAQR1 (SEQ ID NO:39) or its variants having at least 70% homology with it;

[0557] o Ergothioneine transporter protein, such as HsSLC22A16 (SEQ ID NO:41) or its variants having at least 70% homology with it;

[0558] o Ergothionein transporter, such as HsSLC22A32 (SEQ ID NO:43) or its variants having at least 70% homology;

[0559] o-adenosyl-sulfate kinase, such as ScMET14 (SEQ ID NO:47) or its variants having at least 70% homology with it;

[0560] o-adenosine monophosphate phosphate reductase, such as ScMET16 (SEQ ID NO:49) or a variant thereof having at least 70% homology with it; and / or

[0561] transcription factors of nitrogen-containing compound transporters, such as STP1 (SEQ ID NO:45) or its variants having at least 70% homology with it.

[0562] In some embodiments, the yeast cells used in this method further contain mutations in one or more of the following genes:

[0563] οScAGP2;

[0564] οScTPO4;

[0565] οScTPO3;

[0566] οScTPO1;

[0567] οScURE2;

[0568] οScSTR2;

[0569] οScERG4;

[0570] οScSPE2; and / or

[0571] οScGCN4, for example, one or more mutations in the upstream start codon of GCN4.

[0572] This method allows the production of total titers of at least 1 mg / L, for example, at least 2 mg / L, for example, at least 3 mg / L, for example, at least 4 mg / L, for example, at least 5 mg / L, for example, at least 6 mg / L, for example, at least 7 mg / L, for example, at least 8 mg / L, for example, at least 9 mg / L, for example, at least 10 mg / L, for example, at least 11 mg / L, for example, at least 12 mg / L, for example, at least 13 mg / L, for example, at least 14 mg / L, for example, at least 15 mg / L, for example, at least 20 mg / L, for example, at least 25 mg / L, for example, at least 30 mg / L, for example, at least 35 mg / L, for example, at least 40 mg / L, for example, at least 45 mg / L. For example, at least 50 mg / L, at least 100 mg / L, at least 150 mg / L, at least 200 mg / L, at least 300 mg / L, at least 400 mg / L, at least 500 mg / L, at least 600 mg / L, at least 700 mg / L, at least 800 mg / L, at least 900 mg / L, at least 1 g / L, at least 1.1 g / L, at least 1.2 g / L, at least 1.3 g / L, at least 1.4 g / L, at least 1.5 g / L or more of ergothioneine, wherein the total titer is the sum of the intracellular and extracellular ergothioneine titers. In fact, the ergothioneine produced can be secreted from the cells—extracellular ergothioneine—or it can be retained in the cells—intracellular ergothioneine.

[0573] Specifically, this method can result in the production of extracellular ergothioneine at a titer of at least 1 mg / L, for example at least 2 mg / L, for example at least 3 mg / L, for example at least 4 mg / L, for example at least 5 mg / L, for example at least 6 mg / L, for example at least 7 mg / L, for example at least 8 mg / L, for example at least 9 mg / L, for example at least 10 mg / L, for example at least 11 mg / L, for example at least 12 mg / L, for example at least 13 mg / L, for example at least 14 mg / L, for example at least 15 mg / L, for example at least 20 mg / L, for example at least 25 mg / L, for example at least 30 mg / L, for example at least 35 mg / L. For example, at least 40 mg / L, at least 45 mg / L, at least 50 mg / L, at least 100 mg / L, at least 150 mg / L, at least 200 mg / L, at least 300 mg / L, at least 400 mg / L, at least 500 mg / L, at least 600 mg / L, at least 700 mg / L, at least 800 mg / L, at least 900 mg / L, at least 1 g / L, at least 1.1 g / L, at least 1.2 g / L, at least 1.3 g / L, at least 1.4 g / L, at least 1.5 g / L, or more.

[0574] This method can lead to the production of intracellular ergothioneine at a titer of at least 1 mg / L, for example, at least 2 mg / L, for example, at least 3 mg / L, for example, at least 4 mg / L, for example, at least 5 mg / L, for example, at least 6 mg / L, for example, at least 7 mg / L, for example, at least 8 mg / L, for example, at least 9 mg / L, for example, at least 10 mg / L, for example, at least 11 mg / L, for example, at least 12 mg / L, for example, at least 13 mg / L, for example, at least 14 mg / L, for example, at least 15 mg / L, for example, at least 20 mg / L, for example, at least 25 mg / L, for example, at least 30 mg / L, for example, at least 35 mg / L, for example, For example, at least 40 mg / L, for example, at least 45 mg / L, for example, at least 50 mg / L, for example, at least 100 mg / L, for example, at least 150 mg / L, for example, at least 200 mg / L, for example, at least 300 mg / L, for example, at least 400 mg / L, for example, at least 500 mg / L, for example, at least 600 mg / L, for example, at least 700 mg / L, for example, at least 800 mg / L, for example, at least 900 mg / L, for example, at least 1 g / L, for example, at least 1.1 g / L, for example, at least 1.2 g / L, for example, at least 1.3 g / L, for example, at least 1.4 g / L, for example, at least 1.5 g / L, or more.

[0575] The method may also include a step of recovering the generated ergothioneine. This may include a heating step to precipitate cellular material and release intracellular ergothioneine, a centrifugation or filtration step to remove cell debris and precipitated material, pH adjustment and chromatographic steps (optionally including solvents) to alter the solubility of ergothioneine and purify it from other components. In some embodiments, the recovered ergothioneine can be used directly with its natural or processed host cells as a nutritional supplement.

[0576] polypeptide

[0577] The inventors have identified several polypeptides that can be used to engineer yeast cells capable of producing ergothioneine. In particular, Egt1 and Egt2 from ergot have been identified and found to be suitable for heterologous expression in yeast cells, thus providing a microbial platform for ergothioneine production.

[0578] Specifically, this document provides polypeptides having the sequence shown in SEQ ID NO:6 (CpEgt1) or functional variants thereof having at least 70% homology with SEQ ID NO:6, and homologs having at least 70% homology with it, such as having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%.

[0579] Also provided are polypeptides or functional variants thereof having the sequence shown in SEQ ID NO:12 (CpEgt2), said functional variant having at least 70% homology with SEQ ID NO:12, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%.

[0580] A host cell expressing the polypeptide is also provided.

[0581] The use of the aforementioned peptides or host cells for the production of ergothioneine is also provided.

[0582] Nucleic acids, vectors, and host cells

[0583] This article also provides the nucleic acids encoding the aforementioned polypeptides, namely Egt1 and Egt2 from ergot. As is known in the art, such nucleic acids may have been codon-optimized for expression in yeast cells.

[0584] In one embodiment, the nucleic acid has a sequence as shown in SEQ ID NO:5 or SEQ ID NO:16, or has at least 70% homology with SEQ ID NO:5 or SEQ ID NO:16, for example, having at least 71%, for example, at least 72%, for example, at least 73%, for example, at least 74%, for example, at least 75%, for example, at least 76%, for example, at least 77%, for example, at least 78%, for example, at least 79%, for example, at least 80%, for example, at least 81%, for example, at least 82%, for example, at least 83%, for example, at least 84%, for example, at least 85%, for example, at least 86%, for example, at least 87%, for example, at least 88%, for example, at least 89%, for example, at least 90%, for example, at least 91%, for example, at least 92%, for example, at least 93%, for example, at least 94%, for example, at least 95%, for example, at least 96%, for example, at least 97%, for example, at least 98%, for example, at least 99%.

[0585] In some embodiments, the nucleic acid has a sequence as shown in SEQ ID NO:11 or SEQ ID NO:18, or has at least 70% homology with SEQ ID NO:11 or SEQ ID NO:18, for example, having at least 71%, for example, at least 72%, for example, at least 73%, for example, at least 74%, for example, at least 75%, for example, at least 76%, for example, at least 77%, for example, at least 78%, for example, at least 79%, for example, at least 80%, for example, at least 81%, for example, at least 82%, for example, at least 83%, for example, at least 84%, for example, at least 85%, for example, at least 86%, for example, at least 87%, for example, at least 88%, for example, at least 89%, for example, at least 90%, for example, at least 91%, for example, at least 92%, for example, at least 93%, for example, at least 94%, for example, at least 95%, for example, at least 96%, for example, at least 97%, for example, at least 98%, for example, at least 99%.

[0586] Nucleic acids used for the purposes of this disclosure can be codon-optimized as is known in the art to improve the expression of the proteins they encode in yeast cells to be modified.

[0587] In some implementations, the nucleic acids encoding the first and second heterologous enzymes can be independently integrated into the genome of yeast cells through genome engineering or genome editing or by hybridizing yeast cells of different conjugation types, or they can be expressed from a vector in the cells.

[0588] Methods involving the integration of nucleic acids are well known in the art. Therefore, in some embodiments, first and / or second heteroenzymes are expressed in cells by introducing heteronucleic acids encoding first and / or second heteroenzymes into yeast cells. The heteronucleic acids can be codon-optimized for any purpose, or they can contain features that contribute to improved activity. For example, the heteronucleic acids can be modified to encode modified proteins. Such modifications include, but are not limited to, the introduction of localization signals, gain- or loss-of-function mutations, fusion of the protein with a marker or tag (e.g., a fluorescent tag), insertion of an inducible promoter, and the introduction of modifications that confer greater stability and / or half-life.

[0589] The introduction of heterologous nucleic acids encoding desired activities can be performed using methods known in the art. Those skilled in the art will recognize that such methods include, but are not limited to, cloning-based and homologous recombination-based methods. Cloning methods may involve the design and construction of plasmids in an organism (e.g., *Escherichia coli*). Plasmids can be integrative or non-integrative vectors. Cloning-free methods include homologous recombination-based methods, such as aptamer-mediated PCR or nick repair. Such methods often result in the integration of heterologous nucleic acids into the genome of yeast cells.

[0590] Nucleic acids can exist in high copy numbers.

[0591] As is known in the art, nucleic acids can be controlled by inducible or constitutive promoters. Nucleic acids can also be controlled by strong promoters, as is known in the art.

[0592] A vector containing the aforementioned nucleic acid is also provided, as well as a host cell containing the vector and / or the nucleic acid.

[0593] In the context of this disclosure, a useful carrier may include:

[0594] • Nucleic acid encoding the first heterozyme as described herein; and / or

[0595] • Nucleic acid encoding the second heterozyme as described in this article;

[0596] • And optionally, nucleic acids encoding ergothionein transporters as described herein.

[0597] It also provides the uses of the aforementioned nucleic acids, vectors, or host cells for the production of ergothioneine.

[0598] A kit for constructing yeast cells capable of producing ergothioneine as described herein is also provided, wherein the kit comprises:

[0599] • As described in this article, yeast cells and instructions for use;

[0600] • Parental yeast cells to be modified and nucleic acids or vectors suitable for modifying said yeast cells to obtain yeast cells as described herein, and instructions for use.

[0601] Sequence Overview

[0602]

[0603]

[0604]

[0605]

[0606]

[0607] Example

[0608] Example 1 – Materials and Methods

[0609] Strains, chemicals, synthetic genes, services

[0610] In this study, *Saccharomyces cerevisiae* strain ST7574 (a CEN.PK113-7D strain transformed with a plasmid carrying a Cas9 expression cassette and G418 resistance) was used as the background strain for metabolic engineering. *Yersinia lipolytica* strain ST6512 (a W29 strain integrating an integrated Cas9 gene and D-serine resistance) was used as the background strain for *Yersinia lipolytica* engineering. All cloning procedures, plasmid propagation, and storage were performed using *E. coli* DH5α. Ergothioneine (catalog #E7521-25MG, purity ≥98%) was purchased from Sigma-Aldrich, and histidine trimethylolpropionate (catalog #H288900, 100mg, purity ≥95%) was purchased from Toronto Research Chemicals Inc. Gene synthesis was ordered through Thermo Fisher Scientific's GeneArt GeneSynthesis service or IDT's custom gene synthesis service. Sequencing results were obtained through Eurofins Genomics (Ebersberg, Germany) using their Mix2Seq kit. The Enpump 200 was purchased from Enpresso (Berlin, Germany).

[0611] Cloning strategy

[0612] All genes required for the ergothioneine biosynthesis pathway were codon-optimized, except for those from *Schizosaccharomyces cerevisiae*, and were isolated from genomic DNA using PCR and appropriate primers. Strains for the biosynthesis pathway were constructed using the EasyClone MarkerFree method (Jessop-Fabre et al., 2016), followed by integration into *Saccharomyces cerevisiae*. Strains for the ergothioneine biosynthesis pathway in *Yersinia lipolytica* were constructed using the EasyCloneYALI method (Holkenbrink et al., 2018). For deletions in ST9553 to ST9564, genes were deleted using a kanamycin resistance cassette. For others, deletions were performed using the CRISPR / Cas9 method from Stovicek et al., 2015. Colony PCR was used to verify correct integration. A list of the resulting strains is shown in Table 1.

[0613] Table 1.

[0614]

[0615]

[0616]

[0617]

[0618]

[0619]

[0620]

[0621]

[0622] Culture medium and yeast culture conditions

[0623] After plasmid transformation, *E. coli* was grown on LB agar plates containing 100 mg / L ampicillin. For yeast strain selection, YPD agar plates supplemented with 200 mg / L G418 and / or norsinolate (100 mg / L) were used after Cas9 gRNA modification. For Examples 1-3, yeast strains selected for ergothioneine production were grown at 30°C and 250 rpm for 48 hours in fully synthetic (SC) medium containing 20 g / L glucose and 1 g / L histidine, cysteine, and methionine, for 72 hours in SC medium containing 40 g / L glucose, or for 72 hours in SC medium containing 60 g / L EnPump substrate and 0.6% reagent A. Cells were cultured at OD... 600=0.5g seeded in a 24-well plate. For Example 4, it was also seeded using OD... 600 =0.5 μL of the strain was inoculated and culture samples were collected at set time intervals (every 8 and 24 hours of the day) to study the synthesis of ergothioneine by *Saccharomyces cerevisiae* over time. The culture medium used was SC medium containing 40 g / L glucose, supplemented with different concentrations of histidine, cysteine, and methionine to analyze the effect of precursor supplementation on ergothioneine titers. For Examples 6-10, the *Saccharomyces cerevisiae* strains selected for ergothioneine production were grown for 72 hours at 30°C and 250 rpm in SC medium containing 7.5 g / L (NH4)2SO4, 14.4 g / L KH2PO4, 0.5 g / L MgSO4·7H2O, appropriate growth factors, 60 g / L EnPump 200 substrate, and 0.6% reagent A. For Examples 6 and 10, cells were grown at OD... 600 =0.1 was seeded in 96-well plates. For Examples 7-9, cells were seeded at OD... 600 =0.1 was inoculated into 24-well plates. For Example 11, *Saccharomyces cerevisiae* and *Yersinia lipolytica*, which were selected for ergothioneine production, were grown for 72 hours at 30°C and 250 rpm in SC medium containing 20 g / L glucose or SC medium containing 60 g / L Enpump substrate and 0.6% reagent A. Cells were cultured at OD... 600 =0.1 inoculated in a 96-well plate.

[0624] Create a β-(1,2,4-triazol-3-yl)-DL-alanine resistant strain (HIS1 mutant strain).

[0625] To produce strains that overproduce histidine, 10 OD 600 ST8927 cells were plated on agar plates containing YNB–amino acid–(NH4)2SO4 + proline + 0.25 mM β-(1,2,4-triazol-3-yl)-DL-alanine. After 5-7 days, 30 colonies were picked and screened in mineral medium containing 7.5 g / L (NH4)2SO4, 14.4 g / L KH2PO4, 0.5 g / L MgSO4·7H2O, appropriate growth factors, 20 g / L glucose, and 30 mM histidine. Ungrown colonies were screened for histidine and ergothioneine production in mineral medium containing 7.5 g / L (NH4)2SO4, 14.4 g / L KH2PO4, 0.5 g / L MgSO4·7H2O, and 20 g / L glucose. Cells were then cultured at OD200. 600 =0.1g was inoculated into 24-well plates and incubated at 30°C and 250rpm for 72 hours. Colony 3 was selected as ST9687.

[0626] HPLC analysis

[0627] Ergothioneine and histidine were quantified by HPLC. Following the method of Alamgir et al., 2015, intracellular and extracellular ergothioneine concentrations were determined by measuring ergothioneine in the supernatant and by extracting ergothioneine from cells. A 1 mL fermentation broth sample was centrifuged at 3000 x g for 5 min, the supernatant was removed and stored at -4 °C until extracellular ergothioneine analysis. The remaining cell pellet was washed twice with MilliQ water and then resuspended in 1 mL of water. Cells were boiled at 94 °C for 10 min, followed by vortexing at 1600 rpm for 30 min using a DVX-2500 Multi-Tube Vortexer from VWR. After centrifugation at 10,000 × g for 5 min, the supernatant was collected and intracellular ERG concentration was analyzed by HPLC. The total ergothioneine concentration was determined by not separating cells from the fermentation broth before boiling the sample. Intact samples (fermentation broth and cells) were processed as described above for boiling, vortexing, and centrifugation. After centrifugation, the supernatant was collected and the total ergothioneine concentration was analyzed by HPLC. For HPLC analysis, a Dionex Ultimate 3000 HPLC system with Chromeleon analytical software was used. Samples were loaded onto a Cortects UPLC T3 reversed-phase column (particle size 1.6 μm, pore size...). The solution was run on a 2.1 × 150 mm plate. The flow rate was 0.3 ml / min, starting with 0.1% formic acid for 2.5 minutes, increasing to 70% acetonitrile and 30% 0.1% formic acid for 3 minutes, held for 0.5 minutes, and then running with 100% 0.1% formic acid from 4 to 9 minutes. Ergothioneine was detected at a wavelength of 254 nm.

[0628] Propidium iodide staining and flow cytometry analysis

[0629] One ml of cell culture sample was taken from the yeast culture. These were washed twice with phosphate-buffered saline (PBS), then resuspended in PBS containing 0.5 μg / ml propidium iodide and incubated at room temperature for 20 minutes. After incubation, the cells were washed twice with PBS, and the percentage of PI-stained cells was determined using the MACSQuant VYB system. Analysis was performed using FlowJo software.

[0630] Simulated feed-in production of ergothionein

[0631] Solutions and culture media: The trace metal solution contains: 4.5 g / L CaCl₂·2H₂O, 4.5 g / L ZnSO₄·7H₂O, 3 g / L FeSO₄·7H₂O, 1 g / L H₃BO₃, 1 g / L MnCl₂·4H₂O, 0.4 g / L Na₂MoO₄·2H₂O, 0.3 g / L CoCl₂·6H₂O, 0.1 g / L CuSO₄·5H₂O, 0.1 g / L KI, and 15 g / L EDTA. The vitamin solution contains: 50 mg / L biotin, 200 mg / L para-aminobenzoic acid, 1 g / L nicotinic acid, 1 g / L pantothenic acid (Ca), 1 g / L pyridoxine hydrochloride, 1 g / L thiamine-HCl, and 25 g / L inositol. The simulated fed-batch culture medium consisted of 7.5 g / L (NH₄)₂SO₄, 14.4 g / L KH₂PO₄, 0.5 g / L MgSO₄, 1 g / L yeast extract, 2 mL / L trace metal solution, 1 mL / L vitamin solution, and 200 g / L Enpump substrate. All components were weighed, dissolved in water, and then aseptically filtered before use.

[0632] Simulated fed-batch production of ergothionein: using feedstock from ST10165 (NcEgt1x2+CpEgt2x2+TRA) RSingle colonies of cells from a YPD plate (+MET14+Δspe2) were inoculated into 5 mL of mineral medium containing 7.5 g / L (NH4)2SO4, 14.4 g / L KH2PO4, 0.5 g / L MgSO4·7H2O, appropriate growth factors, and 20 g / L glucose in a 13 mL pre-culture tube. The tube was incubated overnight at 30 °C and 250 rpm. The overnight culture was transferred twice to 50 mL of mineral medium in a 500 mL shake flask with baffles. The shake flask was then incubated overnight at 30 °C and 250 rpm. The culture was then centrifuged at 3,000 × g for 5 min. The cells were resuspended in 25 mL of sterile MilliQ water and subsequently pooled. Sufficient cells with a dry weight of 5, 10, 20, and 40 g / L in 7 mL of the solution were transferred to 15 mL Falcon tubes and centrifuged at 3,000 × g for 5 min. Cells were then resuspended in 7 mL of simulated fed-batch medium. Twenty different conditions were set in 24-well plates. Starting cell dry weights were 5, 10, 20, or 40 g / L, and reagent A concentrations were 0.4%, 0.6%, 0.8%, 1.0%, or 1.2%. For each of these conditions, 1 mL of simulated fed-batch medium with the correct starting cell dry weight was added to the well, followed by the appropriate concentration of reagent A. Cells were then incubated at 30 °C and 250 rpm for 188 hours. After 68 and 140 hours, the same amount of reagent A as the initial concentration was added to the well to avoid loss of enzyme activity. After 188 hours, the total ergothioneine yield under each condition was analyzed by HPLC.

[0633] Example 2 – Results: Integration of the ergothioneine biosynthetic pathway in yeast

[0634] By using the Egt1 sequence from *Neurospora crassa* (Genbank accession number: XP_956324.3) in a BLAST search, we have identified Egt1 homologs in *Neurospora crassa* and *Schizosacchariformis* (Genbank accession numbers: CCE33591.1 and NP_596639.2). Similarly, using Egt2 from *Schizosacchariformis* (Genbank accession number: NP_595091.1), we found Egt2 homologs in *Neurospora crassa* and *Neurospora crassa* (Genbank accession numbers: XP_001728131.1 and CCE33140.1). The amino acid sequences of *Mycobacterium smegmatis* genes EgtA, EgtB, EgtC, EgtD, and EgtE were also obtained from GenBank (GenBank accession numbers: AFP42520.1, WP_011731158.1, WP_011731157.1, WP_011731156.1, ABK70212.1). All genes were generated as synthetic DNA strings and codon-optimized for *Saccharomyces cerevisiae*, except for Egt1 and Egt2 from *Schizosaccharomyces cerevisiae*, as they were amplified from genomic DNA extracts. A total of 16 pathway variants were assembled, including 9 fungal, 1 bacterial, and 6 fungal-bacterial hybrids (Table 2). Sixteen yeast strains were cultured in deep-well plates under different conditions, and the intracellular and extracellular concentrations of ergothionein were measured. Figure 2 ).

[0635] Overall, ergothioneine yields varied from 0 to 57 mg / L in yeast cultures depending on the combination. Strain ST8461, expressing Egt1 from Neurospora crassa and Egt2 from ergot (both enzymes originating from the eukaryotic ERG biosynthetic pathway), was one of the best-performing strains under all three conditions and was selected for further investigation.

[0636] Example 3 – Results: Ergothioneine Transporter

[0637] Since approximately half of the produced ERG is retained within the cells, we investigated whether exporting ERG from yeast cells could at least partially limit production. With a wet weight concentration of 0.37 mg / g yeast cells (from SC + 20 g / L glucose + 1 g / L His / Cys / Met), the estimated intracellular ERG concentration was 1.75 mM, or 120 times higher than in the culture medium. Given that *Mycobacterium smegmatis* is known to secrete ergothioneine at levels up to four times the intracellular concentration, at pg / 10... 5Based on the CFU, we hypothesized that an ERG transporter must exist in its genome. Therefore, we investigated the biosynthetic ERG cluster in this organism. In addition to five known biosynthetic Egt genes, this cluster also contained a transmembrane protein, which we hypothesized to be an ERG transporter. To test the effect of this gene's product on ERG production in yeast, the high-producing strain ST8461 was engineered to express this hypothesized transporter or the known human ergothioneine transporter SLC22A4 (SCL22A4X) (Grundemann et al., 2005). Both transporters showed a slight increase in titer when using a simulated fed-batch medium. Figure 3 However, no change in the ratio of intracellular to extracellular ergothioneine was observed. An important note is that the human ergothioneine transporter SLC22A4X acts as an importer in human cells, but showed a slight effect on production titers in the simulated fed-batch medium used here.

[0638] Example 4 – Supplementing Amino Acids

[0639] To further improve ergothioneine titers, the effects of supplementing the culture medium with three amino acids that serve as ergothioneine precursors were investigated. Three strains were tested: a non-producing strain (ST7574), a producing strain (ST8461), and a producing strain (ST8654) containing ergothioneine transporters from *Mycobacterium smegmatis*. Experiments were conducted in shake flasks with a fully synthetic medium supplemented with 1 g / L or 2 g / L of each of L-methionine, L-cysteine, and L-histidine. Biomass growth and ERG production were monitored over 72 hours. Figure 3 Ergothioneine accumulated primarily within the first 24 hours of culture, corresponding to an exponential increase in glucose, reaching approximately 16 mg / L in both production strains, independent of any amino acid supplementation. However, supplementation affected cell growth, with final OD decreasing by approximately 46% and 52% when 1 g / L or 2 g / L amino acids were added accordingly. No degradation of ergothioneine was observed; however, surprisingly, there was a significant difference in intracellular and extracellular distribution of ERG depending on amino acid addition. Specifically, amino acid addition promoted ergothioneine excretion during the stationary phase. We hypothesize this is due to cell death. Indeed, when amino acids were added at a concentration of 1 g / L, propidium iodide staining of cells sampled at 24 hours showed an increase in the proportion of dead cells from 9% to 70%. Figure 4 and 5 ).

[0640] Example 5 – Production of Ergothionein from Diploid Brewer's Yeast

[0641] Solutions and culture media

[0642] The trace metal solution contains: 4.5 g / L CaCl₂·2H₂O, 4.5 g / L ZnSO₄·7H₂O, 3 g / L FeSO₄·7H₂O, 1 g / L H₃BO₃, 1 g / L MnCl₂·4H₂O, 0.4 g / L Na₂MoO₄·2H₂O, 0.3 g / L CoCl₂·6H₂O, 0.1 g / L CuSO₄·5H₂O, 0.1 g / L KI, and 15 g / L EDTA. The vitamin solution contains: 50 mg / L biotin, 200 mg / L para-aminobenzoic acid, 1 g / L nicotinic acid, 1 g Ca-pantothenic acid, 1 g / L pyridoxine-HCl, 1 g / L thiamine-HCl, and 25 g / L inositol. The mineral culture medium consisted of 4.4 g / L (NH4)2SO4, 14.4 g / L KH2PO4, 0.5 g / L MgSO4, 20 g / L glucose, 400 mg / L arginine, 400 mg / L histidine, 400 mg / L methionine, 4 mg / L pyridoxine, 2 ml / L trace metal solution, and 1 ml / L vitamin solution. All components were weighed, dissolved in water, and then aseptically filtered before use. The fed culture medium consisted of 415 g / L glucose, 7.5 g / L (NH4)2SO4, 14.4 g / L KH2PO4, 0.5 g / L MgSO4, 7.5 g / L arginine, 7.5 g / L histidine, 7.5 g / L methionine, 0.5 g / L pyridoxine, 4 ml / L trace metal solution, 2 ml / L vitamin solution, and 1 ml / L antifoaming agent. Weigh all components, dissolve them in slightly heated water, and then sterile filter them before use.

[0643] Controlled fermentation

[0644] A single colony from a YPD plate containing ST8927 was inoculated into 5 ml of basal medium in a 13-ml tube. The tube was incubated overnight at 30°C and 250 rpm. This overnight culture was transferred to 95 ml of mineral medium in a 500 ml baffled shake flask. The shake flask was then incubated overnight at 30°C and 250 rpm. 40 ml of this dense culture was used to inoculate 60 ml of mineral medium into a new 500 ml baffled shake flask. Two shake flasks were prepared in this manner. These shake flasks were incubated at 30°C and 250 rpm for 4 hours. The contents of the two shake flasks were combined and centrifuged at 3,000 x g for 5 minutes. The supernatant was discarded, the precipitate was washed with 25 ml of sterile water, resuspended, and centrifuged as before. The supernatant was discarded, and the precipitate was resuspended in 10 ml of mineral medium. This was then used to inoculate 0.5 ml of mineral medium into a 1 L Sartorius bioreactor. Initial OD 600The pH was 0.85. The stirring rate was set to 500 rpm, the temperature was maintained at 30°C, and the pH was maintained at 5.0 using 2M KOH and 2M H₂SO₄. Feeding began once the CO₂ in the off-gas was reduced by 50%. The initial feed rate was set at 0.6 g glucose h⁻¹, linearly increasing to 2.5 g glucose h⁻¹ over a 25.5-hour span. Afterward, the feed rate was set constant at 1.4 g glucose h⁻¹, and after 17.8 hours, the feed rate was set constant at 2.9 g glucose h⁻¹. -1 Stop feeding at 84 hours. At 60.5 and 75.5 hours, add 2 g of (NH4)2SO4 in a sterile 100 g / L solution. At 60.5 and 73.5 hours, add 0.5 g of MgSO4 in a sterile 50 g / L solution, along with 4 ml of sterile trace metal solution and 2 ml of sterile vitamin solution.

[0645] result

[0646] Ergothioneine was quantified by HPLC as described in Example 1. Cell dry weight and glucose concentration were measured as described in Borodina et al., 2015. Average data from the multiple bioreactor showed that... Figure 6 The final total concentration of ergothioneine was 0.63 g / L.

[0647] Example 6 – Further metabolic engineering in ST8927 via single-target modification – target screening

[0648] Examples 1 through 5 relate to the metabolic engineering of the ergothioneine biosynthetic pathway. Further metabolic engineering was then performed to further increase ergothioneine production. From this point onward, experiments in the examples were conducted using mineral culture media (as described in Materials and Methods) instead of SC medium, except in Example 11.

[0649] The inventors rationally selected targets that could further improve ergothioneine production. Targets within nitrogen catabolite inhibition and background nitrogen transport were chosen to increase the nitrogen availability of precursors S-adenosylmethionine (SAM), histidine, and cysteine. Furthermore, targets for general amino acid control were selected to improve the synthesis of all precursors. Activation of individual amino acid biosynthetic pathways was also chosen. Finally, since both SAM and cysteine ​​contain sulfur, targets within sulfur assimilation pathways were also selected.

[0650] Therefore, the following approach has been modified:

[0651] Nitrogen catabolite inhibition

[0652] Transport of nitrogen-containing compounds

[0653] General amino acid control

[0654] Individual amino acid biosynthesis pathway

[0655] • Sulfur assimilation pathway

[0656] Gene editing for each target in Table 2 was inserted into strain ST8927 (two copies of NcEgt1 and two copies of CpEgt2) and screened in 96-well plates using mineral medium.

[0657] Table 2:

[0658]

[0659]

[0660] result

[0661] Nine of the 29 targets improved ergothioneine production. Figure 7 These targets include the deletion of upstream start codons for URE2, STR2, SPE2, ERG4, and GCN4; the integration of extra copies of STP1, MET14, and MET16; and the overproduction of histidine using β-(1,2,4-triazol-3-yl)-DL-alanine. Deletions of ERG4 and SPE2 are particularly effective. These deletions increase S-adenosylmethionine (SAM) pooling and can also be used to produce other compounds requiring SAM in cell factories.

[0662] Example 7 – Combination Gene Modification – Histidine Overproduction Combined with STP1, MET14 and / or MET16 Expression or Overexpression

[0663] Example 6 demonstrates that some gene edits that improve ergothioneine production originate from similar and / or interrelated target modulatory pathways (e.g., homocysteine ​​is a precursor to SAM and cysteine). Therefore, the next step is to investigate whether the gene edits identified in Example 6, when combined, can further increase ergothioneine production.

[0664] Different combinations of the STP1, MET14, and MET16 genes were integrated using the ergothionein-producing strain ST9687 (which has two copies of NcEgt1 and two copies of CpEgt2 and overproduces histidine due to β-(1,2,4-triazol-3-yl)-DL-alanine resistance).

[0665] result

[0666] Figure 8The results are shown. Compared to ST8927, ST9687, which overproduces histidine, showed significantly higher ergothioneine yield. ST8927 was able to produce at least 43 mg / L of ergothioneine. ST9687 was able to produce at least 59 mg / L of ergothioneine. The increased ergothioneine yield (ST9929) was greatest when histidine overproduction was combined with MET14 integration. However, additional combinations (based on histidine overproduction and MET14 integration) did not further increase yield.

[0667] Example 8 – Combination Genetic Modification – Histidine Overproduction and MET14 Combined with the Deletion of ERG4, SPE2, STR2 and URE2

[0668] Example 7 showed increased ergothioneine production in strain ST9929, which exhibited histidine overproduction and MET14 integration. Subsequently, ERG4, SPE2, STR2, and URE2 deletions were added to strain ST9929.

[0669] result

[0670] The results are as follows Figure 9 As shown. When combined with histidine overproduction and MET14 integration, both ERG4 and SPE2 further increased ergothioneine production. Examples 7 and 9 clearly demonstrate that the gene editing discovered in Example 6 can further increase ergothioneine production in strain ST8927 by simultaneously increasing the supply of several precursors.

[0671] Example 9 – Further testing of the effect of transporter proteins on ergothioneine production

[0672] Ten additional transporter protein edits were tested to improve ergothioneine production. These transporters were integrated into the ST8927 strain (two copies of NcEgt1 and CpEgt2).

[0673] The transport proteins Agp2, Tpo3, Tpo4 and Aqr1 from Saccharomyces cerevisiae were deleted; the transport protein Tpo1 from Saccharomyces cerevisiae, OCT1 and OCT7 from Arabidopsis thaliana, and SLC22A12, SLC22A16 and SLC22A32 from Homo sapiens were integrated into each strain respectively.

[0674] result

[0675] The absence of TPO4 in *Saccharomyces cerevisiae* increases ergothioneine production. ST9691 is capable of producing at least 51 mg / L of ergothioneine. See also Figure 10This most likely leads to the accumulation of spermine and spermidine, thus reducing the demand for SAM in pantothenic acid production. Conversely, the absence of AQR1 and the integration of TPO1 reduce ergothioneine yield (see [link to relevant documentation]). Figure 10 Therefore, it can be concluded that the deletion of TPO1 increases ergothioneine production for the same reason as the deletion of TPO4. AQR1 is a transport protein involved in the excretion of excess amino acids. Therefore, the reduced ergothioneine production caused by AQR1 deletion can be explained by a decrease in the outward transport of ergothioneine from the cell. Thus, the integration of AQR1 can increase the ergothioneine productivity of the strain.

[0676] Example 10 – Target Identification in Other Enzyme Combinations for Ergothioneine Production

[0677] To confirm the effects of gene editing on ergothioneine production, the gene editing discovered in Example 6 was also introduced into other strains with different ergothioneine-producing enzymes. All gene edits were introduced into strain ST8460 (one copy of NcEgt1 and SpEgt2), while a subset of edits (Δerg4, Δspe2, Δstr2, Δure2, MET14, and MET16) were introduced into strain ST8474 (one copy of CpEgt1 and SpEgt1).

[0678] result

[0679] Although all gene editing showed increased ergothioneine production in strain ST8460 ( Figure 11 A), but the absence of URE2 and the integration of MET14 did not increase the yield of ergothionein in ST8474, such as Figure 11 As shown in B. This may potentially be due to the different activities of CpEgt1+MsEgtE, leading to different requirements for precursor supply.

[0680] Example 11 – Production of Ergothioneine from Other Yeasts

[0681] We wanted to demonstrate that the optimal enzyme combination for ergothioneine production discovered in Example 2 could also efficiently produce ergothioneine in other yeasts. To this end, we expressed NcEgt1 and CpEgt2 in *Yersinia lipolytica* with strong constitutive promoters TEFintron and GDP (both variants were prepared and tested). To compare *Saccharomyces cerevisiae* and *Yersinia lipolytica*, ST8461 (one copy of NcEgt1 and CpEgt2) and two *Yersinia lipolytica* strains were cultured in SC medium containing 20 g / L glucose (batch conditions) and SC medium containing 60 g / L Enpump substrate + 0.6% reagent A (simulated fed-batch conditions).

[0682] result

[0683] Figure 12 The results showed that *Yarrowia lipolytica* could produce up to 278 mg / L of ergothioneine under batch conditions and up to 236 mg / L under simulated fed-batch conditions, while *Saccharomyces cerevisiae* produced 34 mg / L and 78 mg / L under these conditions, respectively. This indicates that ergothioneine production is feasible in various yeasts, and *Yarrowia lipolytica* is a promising host for ergothioneine production.

[0684] Example 12 – Simulated Feed-in Production of Ergothionein

[0685] To investigate our strain ST10165(NcEgt1x2+CpEgt2x2+TRA) R To assess the ergothioneine production capacity of the strain (+MET14+Δspe2), we inoculated the strain at different starting cell dry weight concentrations into simulated fed-batch medium (mineral medium containing 1 g / L yeast extract and 200 g / L Enpump substrate). By varying the concentration of the enzyme (reagent A) at each of these starting cell dry weight conditions, we could screen for optimal combinations of starting cell dry weight and reagent A concentration to obtain ergothioneine production. Figure 13 As shown, a starting cell dry weight of 40 g / L and 0.4% reagent A resulted in an ergothioneine yield of 1.1 g / L.

[0686] Example 13 – Histidine Overproduction Strains

[0687] To increase ergothioneine production, β-(1,2,4-triazol-3-yl)-DL-alanine (TRA) was used to produce strains with increased histidine production. TRA is a cellularly toxic amino acid analog. When 0.25 mM TRA is added to a plate made from yeast nitrogen bases (with amino acids and ammonium sulfate and proline as the main nitrogen sources), the cells must (i) initiate overproduction of histidine by removing feedback inhibition in this pathway, or (ii) the cells need to remove the uptake of TRA via histidine transporters to grow. When either of these two selections occurs, the cells develop resistance to β-(1,2,4-triazol-3-yl)-DL-alanine (TRA). RThen, the resulting strains must be screened using a medium containing a toxic amount of histidine (30 mM) to distinguish between strains with histidine transporter mutations or strains that overproduce histidine. Strains with mutated histidine transporters can be discarded. Overproduction in strains that do not grow in a medium containing 30 mM histidine is attributed to changes in the HIS1 locus, as described by Rasse-Messenguy et al. 1973, which induces TRA... R Haploid and his1 - Temperature-sensitive haploid conjugation is shown.

[0688] To this end, ST8927 was plated on plates containing TRA to generate various TRA-resistant mutants. After screening in 30 mM histidine, colonies 1, 2, 3, 4, 5, 10, 14, 25, and 28 were found to be free of mutations in histidine transport and could be screened for histidine and ergothioneine production in mineral medium.

[0689] result

[0690] Figure 14 The ergothioneine and histidine production of the selected colonies is shown. Colony 3 of ST9687 was able to produce 283 mg / L of histidine. Colony 3 was selected for further engineering work.

[0691] References

[0692] Alamgir, KM, Masuda, S., Fujitani, Y., Fukuda, F. & Tani, A. Production of ergothioneine by Methylobacterium species. Front. Microbiol. 6, (2015).

[0693] Borodina,I.Kildegaard,KR,Jensen,NB,Blicher,TH,Maury,J.,Sherstyk,S.,Schneider,K.,Lamosa,P., MJ, Rosenstand, I., F.,Forster,J.,Nielsen,J.Metab.Eng.27,57-64(2015).

[0694] Grundemann,D.et al.Discovery of the ergothioneine transporter.Proc.Natl.Acad.Sci.102,5256–5261(2005).

[0695] Holkenbrink,C.,Dam,M.I.,Kildegaard,K.R.,Beder,J.,Dahlin,J.,Belda,D.D.,Borodina,I.(2018).EasyCloneYALI:CRISPR / Cas9-Based Synthetic Toolbox forEngineering of the Yeast Yarrowia lipolytica.Biotech.J.,13(9),1-8,doi:10.1002 / biot.201700543.

[0696] Jessop-Fabre,M.M.et al.EasyClone-MarkerFree:Avector toolkit formarker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9.Biotechnol.J.11,1110–1117(2016).

[0697] Pinson,B.,Kongsrud,T.L.,Ording,E.,Johansen,L.,Daignan-Fornier,B.,Gabrielsen,O.S.(2000).Signaling through regulated transcription factorinteraction:mapping of a regulatory interaction domain in the Myb1-relatedBas1p.Nucl.Acids Res.,28(23),4665-4673,doi:10.1093 / nar / 28.23.4665

[0698] Rasse-Messenguy, F., Fink, GR, (1973). Feedback-Resistant Mutants ofHistidine Biosynthesis in Yeast. Basic Life Sci., 2, 85-95, doi:10.1007 / 978-1-4684-2880-3_7.

[0699] Stovicek,V.,Borodina,I.,and Forster,J.(2015).CRISPR–Cas system enables fast and simple genome editing of industrial Saccharomyces cerevisiaestrains.Metab.Eng.Commun.2,13–22.doi:10.1016 / j.meteno.2015.03.001.

[0700] project

[0701] 1. A yeast cell capable of producing ergothioneine, said yeast cell expressing:

[0702] a) at least one first heterologous enzyme capable of converting L-histidine and / or L-cysteine ​​into S-(histidinetrimethyl-2-yl)-L-cysteine-S-oxide; and

[0703] b) At least one second heterozyme capable of converting S-(histidine trimethyl-2-yl)-L-cysteine-S-oxide into 2-(hydroxythioalkyl)-histidine trimethyl inner salt;

[0704] Yeast cells are further able to convert 2-(hydroxythioalkyl)-histidine trimethyl inner salt into ergothionein.

[0705] 2. The yeast cell according to Project 1, wherein the yeast cell is a GRAS organism.

[0706] 3. The yeast cell according to any one of the preceding items, wherein the yeast cell contains at least two copies of a gene encoding a first heterozyme.

[0707] 4. The yeast cell according to any one of the preceding items, wherein the yeast cell contains at least two copies of a second heterozyme.

[0708] 5. The yeast cell according to any one of the preceding items, wherein the yeast cell is capable of producing at least 100 mg / L, for example at least 150 mg / L, for example at least 200 mg / L, for example at least 250 mg / L of histidine.

[0709] 6. The yeast cell according to any one of the preceding items, wherein the yeast cell further expresses or overexpresses one or more of the following:

[0710] a. Ergothioneine transporter, such as MsErgT (SEQ ID NO:35) or its variants having at least 70% homology with it;

[0711] b. Ergothioneine transporter, such as HsSLC22A4 (SEQ ID NO:36) or its variants having at least 70% homology with it;

[0712] c. Ergothioneine transporter proteins, such as AtOCT1 (SEQ ID NO:37) or its variants having at least 70% homology with it;

[0713] d. Ergothioneine transporter proteins, such as ScAQR1 (SEQ ID NO:39) or its variants having at least 70% homology with it;

[0714] e. Ergothionein transporter, such as HsSLC22A16 (SEQ ID NO:41) or its variants having at least 70% homology with it;

[0715] f. Ergothioneine transporter proteins, such as HsSLC22A32 (SEQ ID NO:43) or its variants having at least 70% homology with it;

[0716] g. Adenosyl-sulfate kinase, such as ScMET14 (SEQ ID NO:47) or its variants having at least 70% homology with it;

[0717] h. phosphate adenosine monophosphate reductase, such as ScMET16 (SEQ ID NO:49) or a variant thereof having at least 70% homology with it; and / or

[0718] i. Transcription factors of nitrogen-containing compound transporters, such as STP1 (SEQ ID NO:45) or variants thereof that have at least 70% homology with it.

[0719] 7. The yeast cell according to any one of the foregoing items, wherein the yeast cell further comprises one or more mutations in one or more of the following genes:

[0720] a.ScAGP2;

[0721] b.ScTPO4;

[0722] c.ScTPO3;

[0723] d.ScTPO1;

[0724] e.ScURE2;

[0725] f.ScSTR2;

[0726] g.ScERG4;

[0727] h.ScSPE2; and / or

[0728] i.ScGCN4, for example, one or more mutations in the upstream start codon of GCN4.

[0729] 8. The yeast cell according to any one of the preceding items, wherein the yeast cell does not naturally produce ergothioneine.

[0730] 9. The yeast cell according to any one of the preceding items, wherein the genus of the yeast cell is selected from the genera *Saccharomyces*, *Pichia pastoris*, *Yersinia*, *Kluyveromyces*, *Candida*, *Rhodotorula*, *Rhodotorula*, *Cryptococcus*, *Schizosaccharomyces*, *Hydrospora*, and *Oleoma*, preferably, the genus is *Saccharomyces*, *Pichia pastoris*, *Yersinia*, or *Kluyveromyces*.

[0731] 10. The yeast cell according to any one of the preceding items, wherein the yeast is selected from Saccharomyces cerevisiae, Pichia pastoris, Saccharomyces phagnum, Kluyveromyces martensii, Kluyveromyces lactis, Saccharomyces cerevisiae, Cryptococcus syringae, oleophilic yeast, Saccharomyces dauricum, Rhodotorula spp., Rhodotorula glutinis, Saccharomyces buddingus, and Yersinia lipolytica, preferably, the yeast is a Saccharomyces cerevisiae cell, a Kluyveromyces martensii cell, or a Yersinia lipolytica cell.

[0732] 11. The yeast cell according to any one of the preceding items, wherein the first heterozyme has an EC number selected from EC2.1.1.44, EC 1.14.99.51, EC 6.3.2.2, EC 1.14.99.50 and EC 3.5.1.118, preferably, the EC number is EC 2.1.1.44 or EC 1.14.99.51.

[0733] 12. The yeast cell according to any one of the preceding items, wherein the first heterologous enzyme is an enzyme derived from a eukaryote, such as a fungus.

[0734] 13. The yeast cell according to any one of the preceding items, wherein the second heterologous enzyme is an enzyme derived from prokaryotes or eukaryotes, preferably prokaryotes.

[0735] 14. The yeast cell according to any one of the preceding items, wherein the second heterologous enzyme is a β-lyase or histidine trimethylcysteine ​​sulfoxide lyase (EC 4.4.1-).

[0736] 15. The yeast cell according to any one of the preceding items, wherein the first heterologous enzyme is Egt1 from *Neurospora crassa*, *Ceratophyllum demersum*, *Schizosaccharomyces cerevisiae*, *Rhizopus stolonifer*, *Aspergillus nidus*, *Aspergillus niger*, *Penicillium rochfellii*, *Penicillium terrestris*, *Saccharomyces ochraceus*, *Aspergillus oryzae*, *Aspergillus charcoal*, *Neurospora tetrasporium*, *Agaricus bisporus*, *Pleurotus ostreatus*, *Lentinula edodes*, or *Grifola frondosa*, or a functional variant thereof having at least 70% homology with it.

[0737] 16. The yeast cell according to any one of the preceding items, wherein the first heterozyme is selected from: NcEgt1 (SEQ ID NO:2), SpEgt1 (SEQ ID NO:4) and CpEgt1 (SEQ ID NO:6), and functional variants thereof having at least 70% homology with SEQ ID NO:2, SEQ ID NO:4 or SEQ ID NO:6.

[0738] 17. The yeast cell according to any one of the preceding items, wherein the second heterozyme is:

[0739] -Egt2, which comes from *Neurospora crassa*, *Ergotae*, *Schizosaccharomyces cerevisiae*, *Rhizopus stolonifer*, *Aspergillus nidus*, *Aspergillus niger*, *Penicillium rochfellii*, *Penicillium terrestris*, *Saccharomyces ochraceus*, *Aspergillus oryzae*, *Aspergillus charcoalii*, *Neurospora tetrasporium*, *Agaricus bisporus*, *Pleurotus ostreatus*, *Lentinula edodes*, *Grifola frondosa*, *Ganoderma lucidum*, *Candida albicans*, or

[0740] -EgtE, which comes from Mycobacterium smegmatis, Nocardia asteroides, Streptomyces albus, Streptomyces freundii, Streptomyces griseus, Actinobacter hygroscopicus hainanensis, Aspergillus fumigatus, Mycobacterium tuberculosis, Mycobacterium kansasii, Mycobacterium intracellulare, Mycobacterium occulta, Mycobacterium ulcerans, Mycobacterium pasteurellosis, Mycobacterium leprae, Mycobacterium avium, Mycobacterium bovis, Mycobacterium marineum, Mycobacterium vulgareum, Mycobacterium paratuberculosis, Mycobacterium spp., Rhodococcus roseum (Mycobacterium roseum), Spirulina obtusifolia, Spirulina macrophylla, Alternaria floscens, Pseudocystaphylococcus, Oscillatoria, and Rhodophyta.

[0741] Or its functional variants that are at least 70% homologous to it.

[0742] 18. The yeast cell according to any one of the preceding items, wherein the second heterozyme is selected from: NcEgt2 (SEQ ID NO:8), SpEgt2 (SEQ ID NO:10), CpEgt2 (SEQ ID NO:12) and MsEgtE (SEQ ID NO:14), or a variant thereof having at least 70% homology with SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12 or SEQ ID NO:14.

[0743] 19. The yeast cell according to any one of the preceding items, wherein the first and second heterozymes are:

[0744] i) NcEgt1 and CpEgt2;

[0745] ii) NcEgt1 and SpEgt2;

[0746] iii) NcEgt1 and NcEgt2;

[0747] iv) NcEgt1 and MsEgtE;

[0748] v)SpEgt1 and NcEgt2;

[0749] vi)SpEgt1 and SpEgt2;

[0750] vii)SpEgt1 and CpEgt2;

[0751] viii)SpEgt1 and MsEgtE;

[0752] ix)CpEgt1 and NcEgt2;

[0753] x)CpEgt1 and SpEgt2;

[0754] xi)CpEgt1 and CpEgt2;

[0755] xii)CpEgt1 and MsEgtE,

[0756] Or its functional variants that are at least 70% homologous to it.

[0757] 20. The yeast cell according to any one of the preceding items, wherein the first and second heterozymes are:

[0758] i) NcEgt1 and CpEgt2;

[0759] ii) NcEgt1 and SpEgt2;

[0760] iii) NcEgt1 and NcEgt2;

[0761] iv) NcEgt1 and MsEgtE;

[0762] xii)CpEgt1 and MsEgtE,

[0763] Or its functional variants that are at least 70% homologous to it.

[0764] 21. The yeast cell according to any one of the preceding items, wherein the first and second heterozymes are not:

[0765] iii) NcEgt1 and NcEgt2; or

[0766] viii)SpEgt1 and MsEgtE; or

[0767] x)CpEgt1 and SpEgt2.

[0768] 22. A yeast cell according to any one of the preceding items, wherein the yeast cell further expresses or overexpresses an ergothioneine transporter, optionally a heterologous ergothioneine transporter, such as MsErgT (SEQ ID NO:35) or HsSLC22A4 (SEQ ID NO:36), or a variant thereof having at least 70% homology with it.

[0769] 23. The yeast cell according to any one of the preceding items, wherein the yeast cell is capable of secreting at least a portion of ergothioneine.

[0770] 24. A yeast cell according to any one of the preceding items, wherein the yeast cell expresses or overexpresses an ergothioneine transporter protein, such as AtOCT1 as shown in SEQ ID NO:37, ScAQR1 as shown in SEQ ID NO:39, HsSLC22A16 as shown in SEQ ID NO:41, or as shown in SEQ ID NO:37. HsSLC22A32 as shown in NO:43, or a functional homolog thereof, said functional homolog having at least 70% homology with said ergothioneine transporter, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%, and selected from the first and second heterozymes:

[0771] i) NcEgt1 and CpEgt2;

[0772] ii) NcEgt1 and SpEgt2;

[0773] iii) NcEgt1 and NcEgt2;

[0774] iv) NcEgt1 and MsEgtE;

[0775] v)SpEgt1 and NcEgt2;

[0776] vi)SpEgt1 and SpEgt2;

[0777] vii)SpEgt1 and CpEgt2;

[0778] viii)SpEgt1 and MsEgtE;

[0779] ix)CpEgt1 and NcEgt2;

[0780] x)CpEgt1 and SpEgt2;

[0781] xi)CpEgt1 and CpEgt2; and

[0782] xii)CpEgt1 and MsEgtE,

[0783] Or a functional variant thereof, the functional variant having at least 70% homology with the first and second heterozymes, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%.

[0784] 25. A yeast cell according to any one of the preceding items, wherein the yeast cell carries a deletion of a gene encoding an ergothioneine transporter protein of *Saccharomyces cerevisiae*, such as ScAGP2, ScTPO3, ScTPO4 and / or ScTPO1 or a functional homolog thereof, said functional homolog having at least 70% homology with said gene, for example having at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, or at least 78% homology with said gene. For example, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% homology; and first and second heterozymes selected from the following:

[0785] i) NcEgt1 and CpEgt2;

[0786] ii) NcEgt1 and SpEgt2;

[0787] iii) NcEgt1 and NcEgt2;

[0788] iv) NcEgt1 and MsEgtE;

[0789] v)SpEgt1 and NcEgt2;

[0790] vi)SpEgt1 and SpEgt2;

[0791] vii)SpEgt1 and CpEgt2;

[0792] viii)SpEgt1 and MsEgtE;

[0793] ix)CpEgt1 and NcEgt2;

[0794] x)CpEgt1 and SpEgt2;

[0795] xi)CpEgt1 and CpEgt2; and

[0796] xii)CpEgt1 and MsEgtE,

[0797] Or its functional variants that are at least 70% homologous to it.

[0798] 26. A yeast cell according to any one of the preceding items, wherein the yeast cell expresses a transcription factor of a nitrogen-containing compound transporter, such as SED ID. ScSTP1 or a functional homolog thereof as shown in NO:45, wherein the functional homolog has at least 70% homology with ScSTP1, for example, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology with ScSTP1, and expresses at least one first heterozyme and at least one second heterozyme selected from the following:

[0799] i) NcEgt1 and CpEgt2;

[0800] ii) NcEgt1 and SpEgt2;

[0801] iii) NcEgt1 and NcEgt2;

[0802] iv) NcEgt1 and MsEgtE;

[0803] v)SpEgt1 and NcEgt2;

[0804] vi)SpEgt1 and SpEgt2;

[0805] vii)SpEgt1 and CpEgt2;

[0806] viii)SpEgt1 and MsEgtE;

[0807] ix)CpEgt1 and NcEgt2;

[0808] x)CpEgt1 and SpEgt2;

[0809] xi)CpEgt1 and CpEgt2; and

[0810] xii)CpEgt1 and MsEgtE,

[0811] Or a functional variant thereof, the functional variant having at least 70% homology with the at least one first heterozyme and at least one second heterozyme, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%.

[0812] 27. A yeast cell according to any one of the preceding items, wherein the yeast cell carries a deletion of the upstream start codon and / or leader sequence of ScGCN4, or a deletion of the upstream start codon and / or leader sequence of a functional homolog thereof, said functional homolog having at least 70% homology with ScGCN4, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79 ... The homology is at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example as at least 98%, for example at least 99%, and the expression is selected from at least one first heterozyme and at least one second heterozyme:

[0813] i) NcEgt1 and CpEgt2;

[0814] ii) NcEgt1 and SpEgt2;

[0815] iii) NcEgt1 and NcEgt2;

[0816] iv) NcEgt1 and MsEgtE;

[0817] v)SpEgt1 and NcEgt2;

[0818] vi)SpEgt1 and SpEgt2;

[0819] vii)SpEgt1 and CpEgt2;

[0820] viii)SpEgt1 and MsEgtE;

[0821] ix)CpEgt1 and NcEgt2;

[0822] x)CpEgt1 and SpEgt2;

[0823] xi)CpEgt1 and CpEgt2; and

[0824] xii)CpEgt1 and MsEgtE,

[0825] Or a functional variant thereof, the functional variant having at least 70% homology with the at least one first heterozyme and at least one second heterozyme, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%.

[0826] 28. A yeast cell according to any one of the preceding items, wherein the yeast cell carries a deletion of a gene encoding a transcription activator, such as ScURE2 or a functional homolog thereof, said functional homolog having at least 70% homology with ScURE2, for example having at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, or at least Homology of 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%, and expressing at least one first heterozyme and at least one second heterozyme selected from the following:

[0827] i) NcEgt1 and CpEgt2;

[0828] ii) NcEgt1 and SpEgt2;

[0829] iii) NcEgt1 and NcEgt2;

[0830] iv) NcEgt1 and MsEgtE;

[0831] v)SpEgt1 and NcEgt2;

[0832] vi)SpEgt1 and SpEgt2;

[0833] vii)SpEgt1 and CpEgt2;

[0834] viii)SpEgt1 and MsEgtE;

[0835] ix)CpEgt1 and NcEgt2;

[0836] x)CpEgt1 and SpEgt2;

[0837] xi)CpEgt1 and CpEgt2; and

[0838] xii)CpEgt1 and MsEgtE,

[0839] Or a functional variant thereof, the functional variant having at least 70% homology with the at least one first heterozyme and at least one second heterozyme, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%.

[0840] 29. A yeast cell according to any one of the preceding items, wherein the yeast cell carries a deletion of a gene encoding cystathionine γ-synthase for cysteine ​​biosynthesis, such as ScSTR2 or a functional homolog thereof, said functional homolog having at least 70% homology with ScSTR2, for example having at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, or at least 80% homology with ScSTR2. The enzyme exhibits at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% homology, and expresses at least one first heterozyme and at least one second heterozyme selected from the following:

[0841] xiii) NcEgt1 and CpEgt2;

[0842] xiv)NcEgt1 and SpEgt2;

[0843] xv)NcEgt1 and NcEgt2;

[0844] xvi)NcEgt1 and MsEgtE;

[0845] xvii)SpEgt1 and NcEgt2;

[0846] xviii)SpEgt1 and SpEgt2;

[0847] xix)SpEgt1 and CpEgt2;

[0848] xx)SpEgt1 and MsEgtE;

[0849] xxi)CpEgt1 and NcEgt2;

[0850] xxii)CpEgt1 and SpEgt2;

[0851] xxiii) CpEgt1 and CpEgt2; and

[0852] xxiv)CpEgt1 and MsEgtE,

[0853] Or a functional variant thereof, the functional variant having at least 70% homology with the at least one first heterozyme and at least one second heterozyme, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%.

[0854] 30. A yeast cell according to any one of the preceding items, wherein the yeast cell carries one or more mutations in one or more genes encoding histidine, such as SchIS1 or a functional homolog thereof, said functional homolog having at least 70% homology with SchIS1, for example having at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, or at least 80% homology with SchIS1. For example, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% homology, and expressing at least one first heterozyme and at least one second heterozyme selected from the following:

[0855] i) NcEgt1 and CpEgt2;

[0856] ii) NcEgt1 and SpEgt2;

[0857] iii) NcEgt1 and NcEgt2;

[0858] iv) NcEgt1 and MsEgtE;

[0859] v)SpEgt1 and NcEgt2;

[0860] vi)SpEgt1 and SpEgt2;

[0861] vii)SpEgt1 and CpEgt2;

[0862] viii)SpEgt1 and MsEgtE;

[0863] ix)CpEgt1 and NcEgt2;

[0864] x)CpEgt1 and SpEgt2;

[0865] xi)CpEgt1 and CpEgt2; and

[0866] xii)CpEgt1 and MsEgtE,

[0867] Or a functional variant thereof, the functional variant having at least 70% homology with the at least one first heterozyme and at least one second heterozyme, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%.

[0868] 31. A yeast cell according to any one of the preceding items, wherein the yeast cell carries a deletion of a gene encoding S-adenosylmethionine decarboxylase and / or δ(24(24(1)))-sterol reductase in the biosynthesis of S-adenosylmethionine (SAM), such as ScSPE2 and / or ScERG4, or a functional homolog thereof, said functional homolog having at least 70% homology with ScSPE2 and / or ScERG4, for example having at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, or at least 71% homology with ScSPE2 and / or ScERG4. For example, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% homology, and expressing at least one first heterozyme and at least one second heterozyme selected from the following:

[0869] i) NcEgt1 and CpEgt2;

[0870] ii) NcEgt1 and SpEgt2;

[0871] iii) NcEgt1 and NcEgt2;

[0872] iv) NcEgt1 and MsEgtE;

[0873] v)SpEgt1 and NcEgt2;

[0874] vi)SpEgt1 and SpEgt2;

[0875] vii)SpEgt1 and CpEgt2;

[0876] viii)SpEgt1 and MsEgtE;

[0877] ix)CpEgt1 and NcEgt2;

[0878] x)CpEgt1 and SpEgt2;

[0879] xi)CpEgt1 and CpEgt2; and

[0880] xii)CpEgt1 and MsEgtE,

[0881] Or a functional variant thereof, the functional variant having at least 70% homology with the at least one first heterozyme and at least one second heterozyme, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%.

[0882] 32. A yeast cell according to any one of the preceding items, wherein the yeast cell further expresses or overexpresses adenosine sulfate kinase (ScMET14) as shown in SEQ ID NO:47 or a functional homolog thereof, said functional homolog having at least 70% homology with ScMET14, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, etc. Homology of at least 83%, for example, at least 84%, for example, at least 85%, for example, at least 86%, for example, at least 87%, for example, at least 88%, for example, at least 89%, for example, at least 90%, for example, at least 91%, for example, at least 92%, for example, at least 93%, for example, at least 94%, for example, at least 95%, for example, at least 96%, for example, at least 97%, for example, at least 98%, for example, at least 99%, and expressing at least one first heterozyme and at least one second heterozyme selected from the following:

[0883] i) NcEgt1 and CpEgt2;

[0884] ii) NcEgt1 and SpEgt2;

[0885] iii) NcEgt1 and NcEgt2;

[0886] iv) NcEgt1 and MsEgtE;

[0887] v)SpEgt1 and NcEgt2;

[0888] vi)SpEgt1 and SpEgt2;

[0889] vii)SpEgt1 and CpEgt2;

[0890] viii)SpEgt1 and MsEgtE;

[0891] ix)CpEgt1 and NcEgt2;

[0892] x)CpEgt1 and SpEgt2;

[0893] xi)CpEgt1 and CpEgt2; and

[0894] xii)CpEgt1 and MsEgtE,

[0895] Or a functional variant thereof, the functional variant having at least 70% homology with the at least one first heterozyme and at least one second heterozyme, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%.

[0896] 33. A yeast cell according to any one of the preceding items, wherein the yeast cell expresses or overexpresses phosphoadenosine phosphate reductase (ScMET16) as shown in SEQ ID NO:49 or a functional homolog thereof, said functional homolog having at least 70% homology with ScMET16, for example having at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, or at least 82% homology with ScMET16. For example, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% homology, and expressing at least one first heterozyme and at least one second heterozyme selected from the following:

[0897] i) NcEgt1 and CpEgt2;

[0898] ii) NcEgt1 and SpEgt2;

[0899] iii) NcEgt1 and NcEgt2;

[0900] iv) NcEgt1 and MsEgtE;

[0901] v)SpEgt1 and NcEgt2;

[0902] vi)SpEgt1 and SpEgt2;

[0903] vii)SpEgt1 and CpEgt2;

[0904] viii)SpEgt1 and MsEgtE;

[0905] ix)CpEgt1 and NcEgt2;

[0906] x)CpEgt1 and SpEgt2;

[0907] xi)CpEgt1 and CpEgt2; and

[0908] xii)CpEgt1 and MsEgtE,

[0909] Or a functional variant thereof, the functional variant having at least 70% homology with the at least one first heterozyme and at least one second heterozyme, for example having at least 71%, for example at least 72%, for example at least 73%, for example at least 74%, for example at least 75%, for example at least 76%, for example at least 77%, for example at least 78%, for example at least 79%, for example at least 80%, for example at least 81%, for example at least 82%, for example at least 83%, for example at least 84%, for example at least 85%, for example at least 86%, for example at least 87%, for example at least 88%, for example at least 89%, for example at least 90%, for example at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, for example at least 99%.

[0910] 34. The yeast cell according to any one of the preceding items, wherein the yeast cell is capable of producing ergothioneine in total titers of at least 1 mg / L, for example at least 2 mg / L, for example at least 3 mg / L, for example at least 4 mg / L, for example at least 5 mg / L, for example at least 6 mg / L, for example at least 7 mg / L, for example at least 8 mg / L, for example at least 9 mg / L, for example at least 10 mg / L, for example at least 11 mg / L, for example at least 12 mg / L, for example at least 13 mg / L, for example at least 14 mg / L, for example at least 15 mg / L, for example at least 20 mg / L, for example at least 25 mg / L. L, for example at least 30 mg / L, for example at least 35 mg / L, for example at least 40 mg / L, for example at least 45 mg / L, for example at least 50 mg / L, for example at least 100 mg / L, for example at least 150 mg / L, for example at least 200 mg / L, for example at least 300 mg / L, for example at least 400 mg / L, for example at least 500 mg / L, for example at least 600 mg / L, for example at least 700 mg / L, for example at least 800 mg / L, for example at least 900 mg / L, for example at least 1 g / L, or more, wherein the total titer is the sum of the intracellular ergothioneine titer and the extracellular ergothioneine titer.

[0911] 35. A yeast cell according to any one of the preceding items, wherein the yeast cell is capable of producing extracellular ergothioneine at titers of: at least 1 mg / L, for example at least 2 mg / L, for example at least 3 mg / L, for example at least 4 mg / L, for example at least 5 mg / L, for example at least 6 mg / L, for example at least 7 mg / L, for example at least 8 mg / L, for example at least 9 mg / L, for example at least 10 mg / L, for example at least 11 mg / L, for example at least 12 mg / L, for example at least 13 mg / L, for example at least 14 mg / L, for example at least 15 mg / L, for example at least 2 mg / L, or at least 1 mg / L. 0 mg / L, for example at least 25 mg / L, for example at least 30 mg / L, for example at least 35 mg / L, for example at least 40 mg / L, for example at least 45 mg / L, for example at least 50 mg / L, for example at least 100 mg / L, for example at least 150 mg / L, for example at least 200 mg / L, for example at least 300 mg / L, for example at least 400 mg / L, for example at least 500 mg / L, for example at least 600 mg / L, for example at least 700 mg / L, for example at least 800 mg / L, for example at least 900 mg / L, for example at least 1 g / L, or more.

[0912] 36. A yeast cell according to any one of the preceding items, wherein the yeast cell is capable of producing intracellular ergothioneine at titers of: at least 1 mg / L, for example at least 2 mg / L, for example at least 3 mg / L, for example at least 4 mg / L, for example at least 5 mg / L, for example at least 6 mg / L, for example at least 7 mg / L, for example at least 8 mg / L, for example at least 9 mg / L, for example at least 10 mg / L, for example at least 11 mg / L, for example at least 12 mg / L, for example at least 13 mg / L, for example at least 14 mg / L, for example at least 15 mg / L, for example at least 2 ...10 mg / L, for example at least 10 mg / L, for example at least 10 mg / L, for example at least 10 mg / L, for example at least 10 mg / L, for example at least 10 0 mg / L, for example at least 25 mg / L, for example at least 30 mg / L, for example at least 35 mg / L, for example at least 40 mg / L, for example at least 45 mg / L, for example at least 50 mg / L, for example at least 100 mg / L, for example at least 150 mg / L, for example at least 200 mg / L, for example at least 300 mg / L, for example at least 400 mg / L, for example at least 500 mg / L, for example at least 600 mg / L, for example at least 700 mg / L, for example at least 800 mg / L, for example at least 900 mg / L, for example at least 1 g / L, or more.

[0913] 37. The yeast cell according to any one of the preceding items, wherein the yeast cell is capable of synthesizing L-histidine and / or L-cysteine.

[0914] 38. A method for producing ergothioneine in yeast cells, comprising the following steps:

[0915] i) Provide yeast cells capable of producing ergothioneine, said yeast cells expressing:

[0916] a) at least one first heterologous enzyme capable of converting L-histidine and / or L-cysteine ​​into S-(histidinetrimethyl-2-yl)-L-cysteine-S-oxide; and

[0917] b) At least one second heterozyme capable of converting S-(histidine trimethyl-2-yl)-L-cysteine-S-oxide into 2-(hydroxythioalkyl)-histidine trimethyl inner salt;

[0918] Furthermore, yeast cells are able to convert 2-(hydroxythioalkyl)-histidine trimethyl inner salt into ergothionein;

[0919] ii) Culture the yeast cells in a culture medium;

[0920] This allows the production of ergothioneine.

[0921] 39. The method according to item 38, wherein the yeast cell is as defined in any one of items 1 to 37.

[0922] 40. The method according to any one of items 38 to 39, wherein ergothioneine is obtained at total titers of at least 1 mg / L, for example at least 2 mg / L, for example at least 3 mg / L, for example at least 4 mg / L, for example at least 5 mg / L, for example at least 6 mg / L, for example at least 7 mg / L, for example at least 8 mg / L, for example at least 9 mg / L, for example at least 10 mg / L, for example at least 11 mg / L, for example at least 12 mg / L, for example at least 13 mg / L, for example at least 14 mg / L, for example at least 15 mg / L, for example at least 20 mg / L, for example at least 25 ...0 mg / L, for example at least 10 mg / L, for example at least 10 mg / L, for example at least 10 mg / L, for example at least 10 mg / L, for example at least 10 mg / L, for example at least 10 mg / L, for example at least 10 mg / L, for example at least 10 mg / L, for example at least 10 mg / L, for example at least At least 30 mg / L, for example at least 35 mg / L, for example at least 40 mg / L, for example at least 45 mg / L, for example at least 50 mg / L, for example at least 100 mg / L, for example at least 150 mg / L, for example at least 200 mg / L, for example at least 300 mg / L, for example at least 400 mg / L, for example at least 500 mg / L, for example at least 600 mg / L, for example at least 700 mg / L, for example at least 800 mg / L, for example at least 900 mg / L, for example at least 1 g / L, or more, wherein the total titer is the sum of the intracellular ergothioneine titer and the extracellular ergothioneine titer.

[0923] 41. The method according to any one of items 38 to 40, wherein the yeast cell is a GRAS organism.

[0924] 42. The method according to any one of items 38 to 41, wherein the yeast cells do not naturally produce ergothioneine.

[0925] 43. The method according to any one of items 38 to 42, wherein the yeast cell genus is selected from: yeast, Pichia pastoris, Yersinia, Kluyveromyces, Candida, Rhodotorula, Rhodotorula rubrum, Cryptococcus, Mycosaccharomyces and Lipidobacterium.

[0926] 44. The method according to any one of items 38 to 43, wherein the yeast is selected from: Saccharomyces cerevisiae, Pichia pastoris, Kluyveromyces martensii, Cryptococcus syriacus, oleophytes, Saccharomyces davidii, Rhodotorula spp., Rhodotorula glutinis, Saccharomyces buddingus, and Yersinia lipolytica.

[0927] 45. The method according to any one of items 38 to 44, wherein the yeast cell contains a first nucleic acid encoding a first heterozyme and / or a second nucleic acid encoding a second heterozyme.

[0928] 46. ​​The method according to any one of items 38 to 45, wherein the first nucleic acid is contained within the genome of a yeast cell or on a vector contained within a yeast cell.

[0929] 47. The method according to any one of items 38 to 46, wherein the second nucleic acid is contained within the genome of a yeast cell or on a vector contained within a yeast cell.

[0930] 48. The method according to any one of items 38 to 47, wherein the first and / or second nucleic acids are present in a high copy number.

[0931] 49. The method according to any one of items 38 to 48, wherein the first and / or second nucleic acid is under the control of an inducible promoter.

[0932] 50. The method according to any one of items 38 to 49, wherein the first and / or second nucleic acid is codon-optimized for expression in yeast cells.

[0933] 51. The method according to any one of items 38 to 50, wherein the yeast cells are capable of secreting ergothioneine into the culture medium.

[0934] 52. The method according to any one of items 38 to 51, wherein the culture medium comprises at least one amino acid, such as histidine, preferably L-histidine, cysteine, preferably L-cysteine, or methionine, preferably L-methionine, preferably at a concentration of at least 0.1 g / L, for example at least 0.2 g / L, for example at least 0.3 g / L, for example at least 0.4 g / L, for example at least 0.5 g / L, for example at least 0.75 g / L, for example at least 1 g / L, for example at least 2 g / L.

[0935] 53. The method according to any one of items 38 to 52 further includes the step of recovering ergothioneine from the culture medium.

[0936] 54. The method according to any one of items 38 to 52, wherein the yeast cells are capable of synthesizing L-histidine and / or L-cysteine.

[0937] 55. A polypeptide having the sequence shown in SEQ ID NO:6 (CpEgtl) or a variant thereof having at least 70% homology with SEQ ID NO:6.

[0938] 56. A polypeptide having the sequence shown in SEQ ID NO:12 (CpEgt2) or a variant thereof having at least 70% homology with SEQ ID NO:12.

[0939] 57. A nucleic acid encoding the polypeptide of item 55 and / or the polypeptide of item 56.

[0940] 58. The nucleic acid according to item 57, which is codon-optimized for expression in yeast cells such as Saccharomyces cerevisiae or Yeastra lipolytica.

[0941] 59. The nucleic acid according to any one of items 57 to 58, having a sequence as shown in SEQ ID NO:7 or SEQ ID NO:17, or having at least 70% homology with SEQ ID NO:7 or SEQ ID NO:17.

[0942] 60. The nucleic acid according to any one of items 57 to 58, having a sequence as shown in SEQ ID NO:5 or SEQ ID NO:16, or having at least 70% homology with SEQ ID NO:5 or SEQ ID NO:16.

[0943] 61. The nucleic acid according to any one of items 57 to 58, having a sequence as shown in SEQ ID NO:11 or SEQ ID NO:18, or having at least 70% homology with SEQ ID NO:11 or SEQ ID NO:18.

[0944] 62. A vector comprising a nucleic acid sequence as defined in any one of items 57 to 58.

[0945] 63. A host cell that expresses at least one of the polypeptides according to any one of items 55 or 56 or comprises a nucleic acid according to any one of items 57 to 61 or a vector according to item 62.

[0946] 64. The host cell according to item 63, which expresses the polypeptides described in items 55 and 56.

[0947] 65. Use of the polypeptide described in any one of items 55 or 56, the nucleic acid described in any one of items 57 to 61, the host cell described in any one of items 63 to 64, or the vector described in item 62 for the production of ergothioneine.

[0948] 66. Ergothionein obtained by any one of items 38 to 54. sequence list <110> Technical University of Denmark <120> Methods for producing ergothioneine <130> P5051PC00 <160> 51 <170> PatentIn version 3.5 <210> 1 <211> 2631 <212> DNA <213> Antibiotic(Neurospora crassa) <400> 1 atgccgagtg ccgaatccat gaccccaagc agtgccctcg gacagctcaa agcaactgga 120. caacatgtgc tatccaagct tcagcagcag acatcaaacg ccgatatcat cgacatccgc cgcgttgctg taggatcaa cctcaagacc gagataacct ccatgttccg acctaaagat ggccctagac agctacccac cttgcttctc tacaacgaga gaggcctgca gctgttcgag cgtatcacat accttgaaga gtactatctt accaatgacg agatcaaaat cctcaccaaa 360. catgcgaccg aaatggctag cttcatcccg tcaggtgcca tgatcattga gctcggaagc ggaaatctgc gcaaagtaaa ccttctattg gaagccctag acaacgccgg caaggcaatt gactattatg cccttgacct gtctcgggag gagctggagc gcactctcgc tcaggtacca 480 tcctacaagc acgtcaagtg ccacggtctt ctgggtacat atgacgatgg acgtgactgg 540 ctcaaggccc cagagacat caataacag aaatgcatct tgcacctcgg gtcaagcatt ggcaacttta accgcagtga cgccgctacc tttctcaagg gctttacgga cgtccttgga 660 cccaatgaca agatgctcat tggggttgac gcttgcaatg acccggcgag ggtataccac 720 gcttacaacg acaaggttgg tattactcac gagttcatct tgaatggtct tcgcaacgcc 780 aatgaaatta tcggagagac ggccttcatc gagggcgatt ggagagtcat tggcgaatat 840 gtgtatgacg aagagggcgg cagacaccag gccttttacg cccccactcg cgacaccatg 900 960 tcgaaagagg agtcagagag gctctggagc acggcgggat tggaacaagt ctcggaatgg 1020 acgtacggca acgaatatgg actccatctg cttgccaagt caaggatgtc tttcagtctc 1080 atcccttcgg tgtacgctcg cagcgcactc ccaactctgg acgactggga ggccctttgg 1140 gcgacatggg atgtcgtcac acgtcagatg cttccccagg aagagcttct ggagaagccc 1200 atcaagctcc gaaacgcctg catcttttac ctcggtcaca tcccgacctt cctcgacatc 1260 cagctcacaa agaccaccaa gcaggctccg tcagagcccg ctcacttttg caagatcttc 1320 gagcgaggca ttgatcctga tgtcgacaac ccggagctgt gtcatgcgca ctcggagatt 1380 cctgatgaat ggccgccggt ggaagaatc ctgacctacc aggagacggt acggtcccgg ttacgcggcc tctatgcgca tggcatcgcg aatattccgc ggaatgtggg tcgggccatt tgggttgggt ttgagcacga gcttatgcat atcgagacgc tgttgtacat gatgctacag 1560 agcgacaaga cgctgatccc aacccatatt ccacggcccg actttgacaa gctcgcgagg aaggcagagt ccgagagggt tcccaatcag tggtttaaga ttccggcaca ggagatcacc 1680. atcggtttgg atgatcctga ggatggatct gatatcaaca agcattatgg ctgggacaac gagaagcctc caaggcgcgt tcaagttgct gcctttcagg ctcaagggag gccgatcacc aacgaagagt acgcgcaata tctgcttgaa aagaacatcg acaagctccc tgcctcttgg gcccgcctgg acaacgaga cattagcaat ggaacaaca acagcgtgag cggtcaccac agcaacagaa cctccaagca gcagctccct tcatctttcc tcgaagac agcagtccgc acagtctacg gtctcgtgcc tctcaagcac gctctcgact ggcccgtgtt tgcctcttac gacgaacttg ccggttgcgc agcttacatg ggcggccgta ttcccacctt cgaagagacc cggagcattt acgcttacgc cgatgctctc aagaagaaga aggaagctga gagacaattg 2160 ggaaggacgg ttccggctgt taatgcccac ctaaccaaca acggcgtgga aatcactccc 2220 ccatcctctc cctctccga gaccccgcc gagtcttcct ccccctccga cagcaacacc 2280 accctcatca ccaccgaaga cctcttctt gacctagacg gtgccaatgt cggttttcac 2340 aactggcacc ctatgcccat cacctccaaa ggcaacaccc ttgtcgggca aggcgagctc 2400 ggcggcgtgt gggaatggac ttcatcggtc ctccgcaagt gggaggggtt cgagccgatg 2460 gagctgtacc ccggctatac ggcggatttt ttcgatgaga agcacaacat tgtgctggga 2520 gggagctggg ctacgcatcc gaggattgcg gggaggaaga gctttgtgaa ttggtaccag 2580 aggaattatc cttatgcttg ggtgggggcg agagttgtta gggatttgtg a 2631 <210> 2 <211> 876 <212> PRT <213> Neurospora crassa <400> 2 Master Pro Sister Here Glu Sister Master Thr Pro Sister Sister Ala Leu Gly Gln Leu 1 5 10 15 Lys Ala Thr Gly Gln His Val Leu Ser Lys Leu Gln Gln Gln Thr Ser 20 25 30 Asn Ala Asp Ile Ile Asp Ile Arg Arg Val Ala Val Glu Ile Asn Leu 35 40 45 Lys Thr Glu Ile Thr Ser Met Phe Arg Pro Lys Asp Gly Pro Arg Gln 50 55 60 Leu Pro Thr Leu Leu Leu Tyr Asn Glu Arg Gly Leu Gln Leu Phe Glu 65 70 75 80 Arg Ile Thr Tyr Leu Glu Glu Tyr Tyr Leu Thr Asn Asp Glu Ile Lys 85 90 95 Ile Leu Thr Lys His Ala Thr Glu Met Ala Ser Phe Ile Pro Ser Gly 100 105 110 Ala Met Ile Ile Glu Leu Gly Ser Gly Asn Leu Arg Lys Val Asn Leu 115 120 125 Leu Leu Glu Ala Leu Asp Asn Ala Gly Lys Ala Ile Asp Tyr Tyr Ala 130 135 140 Leu Asp Leu Ser Arg Glu Glu Leu Glu Arg Thr Leu Ala Gln Val Pro 145 150 155 160 Ser Tyr Lys His Val Lys Cys His Gly Leu Leu Gly Thr Tyr Asp Asp 165 170 175 Gly Arg Asp Trp Leu Lys Ala Pro Glu Asn Ile Asn Lys Gln Lys Cys 180 185 190 Ile Leu His Leu Gly Ser Ser Ile Gly Asn Phe Asn Arg Ser Asp Ala 195 200 205 Ala Thr Phe Leu Lys Gly Phe Thr Asp Val Leu Gly Pro Asn Asp Lys 210 215 220 Met Leu Ile Gly Val Asp Ala Cys Asn Asp Pro Ala Arg Val Tyr His 225 230 235 240 Ala Tyr Asn Asp Lys Val Gly Ile Thr His Glu Phe Ile Leu Asn Gly 245 250 255 Leu Arg Asn Ala Asn Glu Ile Ile Gly Glu Thr Ala Phe Ile Glu Gly 260 265 270 Asp Trp Arg Val Ile Gly Glu Tyr Val Tyr Asp Glu Glu Gly Gly Arg 275 280 285 His Gln Ala Phe Tyr Ala Pro Thr Arg Asp Thr Met Val Met Gly Glu 290 295 300 Leu Ile Arg Ser His Asp Arg Ile Gln Ile Glu Gln Ser Leu Lys Tyr 305 310 315 320 Ser Lys Glu Glu Ser Glu Arg Leu Trp Ser Thr Ala Gly Leu Glu Gln 325 330 335 Val Ser Glu Trp Thr Tyr Gly Asn Glu Tyr Gly Leu His Leu Leu Ala 340 345 350 Lys Ser Arg Met Ser Phe Ser Leu Ile Pro Ser Val Tyr Ala Arg Ser 355 360 365 Ala Leu Pro Thr Leu Asp Asp Trp Glu Ala Leu Trp Ala Thr Trp Asp 370 375 380 Val Val Thr Arg Gln Met Leu Pro Gln Glu Glu Leu Leu Glu Lys Pro 385 390 395 400 Ile Lys Leu Arg Asn Ala Cys Ile Phe Tyr Leu Gly His Ile Pro Thr 405 410 415 Phe Leu Asp Ile Gln Leu Thr Lys Thr Thr Lys Gln Ala Pro Ser Glu 420 425 430 Pro Ala His Phe Cys Lys Ile Phe Glu Arg Gly Ile Asp Pro Asp Val 435 440 445 Asp Asn Pro Glu Leu Cys His Ala His Ser Glu Ile Pro Asp Glu Trp 450 455 460 Pro Pro Val Glu Glu Ile Leu Thr Tyr Gln Glu Thr Val Arg Ser Arg 465 470 475 480 Leu Arg Gly Leu Tyr Ala His Gly Ile Ala Asn Ile Pro Arg Asn Val 485 490 495 Gly Arg Ala Ile Trp Val Gly Phe Glu His Glu Leu Met His Ile Glu 500 505 510 Thr Leu Leu Tyr Met Met Leu Gln Ser Asp Lys Thr Leu Ile Pro Thr 515 520 525 His Ile Pro Arg Pro Asp Phe Asp Lys Leu Ala Arg Lys Ala Glu Ser 530 535 540 Glu Arg Val Pro Asn Gln Trp Phe Lys Ile Pro Ala Gln Glu Ile Thr 545 550 555 560 Ile Gly Leu Asp Asp Pro Glu Asp Gly Ser Asp Ile Asn Lys His Tyr 565 570 575 Gly Trp Asp Asn Glu Lys Pro Pro Arg Arg Val Gln Val Ala Ala Phe 580 585 590 Gln Ala Gln Gly Arg Pro Ile Thr Asn Glu Glu Tyr Ala Gln Tyr Leu 595 600 605 Leu Glu Lys Asn Ile Asp Lys Leu Pro Ala Ser Trp Ala Arg Leu Asp 610 615 620 Asn Glu Asn Ile Ser Asn Gly Thr Thr Asn Ser Val Ser Gly His His 625 630 635 640 Ser Asn Arg Thr Ser Lys Gln Gln Leu Pro Ser Ser Phe Leu Glu Lys 645 650 655 Thr Ala Val Arg Thr Val Tyr Gly Leu Val Pro Leu Lys His Ala Leu 660 665 670 Asp Trp Pro Val Phe Ala Ser Tyr Asp Glu Leu Ala Gly Cys Ala Ala 675 680 685 Tyr Met Gly Gly Arg Ile Pro Thr Phe Glu Glu Thr Arg Ser Ile Tyr 690 695 700 Ala Tyr Ala Asp Ala Leu Lys Lys Lys Lys Glu Ala Glu Arg Gln Leu 705 710 715 720 Gly Arg Thr Val Pro Ala Val Asn Ala His Leu Thr Asn Asn Gly Val 725 730 735 Glu Ile Thr Pro Pro Ser Ser Pro Ser Ser Glu Thr Pro Ala Glu Ser 740 745 750 Ser Ser Pro Ser Asp Ser Asn Thr Thr Leu Ile Thr Thr Glu Asp Leu 755 760 765 Phe Ser Asp Leu Asp Gly Ala Asn Val Gly Phe His Asn Trp His Pro 770 775 780 Met Pro Ile Thr Ser Lys Gly Asn Thr Leu Val Gly Gln Gly Glu Leu 785 790 795 800 Gly Gly Val Trp Glu Trp Thr Ser Ser Val Leu Arg Lys Trp Glu Gly 805 810 815 Phe Glu Pro Met Glu Leu Tyr Pro Gly Tyr Thr Ala Asp Phe Phe Asp 820 825 830 Glu Lys His Asn Ile Val Leu Gly Gly Ser Trp Ala Thr His Pro Arg 835 840 845 Ile Ala Gly Arg Lys Ser Phe Val Asn Trp Tyr Gln Arg Asn Tyr Pro 850 855 860 Tyr Ala Trp Val Gly Ala Arg Val Val Arg Asp Leu 865 870 875 <210> 3 <211> 2322 <212> DNA <213> Schizosaccharomyces pombe <400> 3 atgacagaaa tagaaaacat tggcgcatta gaagttctct tctctcctga atccatcgag 60 cagagcctca aacggtgtca actcccctcc actttattat acgatgaaaa aggtttacga 120 ctgtttgatg agattacgaa tttaaaagaa tactacctgt atgaaagtga gcttgatatt 180 ctgaagaagt tcagcgattc cattgccaac cagttactgt ctccagatct tcctaacacg 240 gttatagaat tagggtgtgg aaatatgcgc aaaacaaaac ttcttttaga tgcgtttgaa 300 aagaagggct gtgatgtgca tttttacgcc cttgacctta atgaagccga gttgcaaaaa 360 ggactgcagg agcttcgtca gactaccaat tatcagcatg ttaaggtgtc tggtatttgc 420 ggttgctttg aaagattgct acaatgtttg gacaggtttc gtagtgagcc caatagtcga 480 attagcatgt tgtacttggg tgcttcgatt ggtaattttg ataggaaatc cgcagcatca 540 tttttacgtt cgtttgccag tcgtttgaat attcatgaca accttttaat ctccttcgat 600 catagaaaca aggctgagct agtccaacta gcttacgatg atccttatcg tattactgaa 660 aaatttgaaa agaatatttt ggctagtgtc aatgcggttt ttggtgaaaa ccttttcgac 720 gaaaatgatt gggaatataa aagtgtctac gatgaagatc tcggtgttca tagggcctac 780 ttacaagcca aaaatgaagt tactgttat aagggtccaa tgtttttca atttaaaacct 840 agtcatttaa ttttgatcga agaaagttgg aagaatagcg atcaagaatg tcgtcaaatc 900 attgagaaag gtgattttaa attagtctct aagtatgaaa gtacgattgc agattactcg 960 acctatgtta ttaccaaaca atttcctgct atgcttcaac tccctcttca gccttgtcct 1020 tcgttagcag aatgggatgc tctacgcaaa gtatggcttt ttattacaaa taaattgctt 1080 aacaaagata acatgtacac cgcatggatt cctttgagac accctccaat tttttacatc 1140 ggacatgtcc ctgtttttaa tgatatttat ctcacaaaga ttgtcaaaaa caaagcaact 1200 gctaacaaaa aacatttttg ggagtggttt caacgtggta tagatccgga cattgaagat 1260 ccctccaagt gccattggca ttctgaagtt cctgaaagct ggccttctcc tgaccaactt 1320 cgtgaatacg agaaagagtc ttgggaatat catattgtaa agttgtgcaa agcaatggat 1380 gaattgtcta cttctgaaaa gagaattctc tggctttgtt acgaacatgt agccatgcat 1440 gtggagacaa ctctttacat ctacgtacag tcatttcaaa atgcaaacca gactgtatca 1500 atttgcggat cacttcctga accagctgaa aaacttacga aagctccgtt atgggtgaat 1560 gtacctgaaa cggaaattgc agttggtatg cccttgacaa cacaatacac gagtgttgga 1620 tcaaatttgc aatcatccga tcttagtgcc catgaaaata cagatgaact tttttatttt 1680 gcgtgggata atgagaacc aatgaggaag aactggttt ctagcttttc tattgccaat 1740 cgtccaattt ctaacggtga atatttagat tttacaata aaagtcaa aacagaaagg 1800 gtgtatccaa agcaatgggc ggagatgat ggaacgcttt acatacgaac catgtacggc 1860 ttattacccc ttgacgacta cttgggttgg cctgttatga cttcatacga cgatctaac 1920 aattatgcga gctcccagg atgcagacta ccaactgagg atgactga ctgttttac 1980 gatcggggttc tcgagagaac tgatgagcct tatgttagta ccgaaggaaa ggcaactggt 2040 ttcaacaat tgcacccttt agccttaagt gataattca gtaatcaaat attcacagga 2100 gcatgggaat ggacaagtac agttctggag agcacgagg atttgacc tgagagctt 2160 tatccagatt atacacgaga tttctgat ggaaagcata atgtcgtttt gggtggtagc 2220 tttgctacgg ctacgcgcat ttcaataga agaagcttca ggaactttta ccaagctggc 2280 tataaatatg catggattgg agctagacta gtcaaaact aa 2322 <210> 4 <211> 773 <212> PRT <213> Schizosaccharomyces pombe <400> 4 Met Thr Glu Ile Glu Asn Ile Gly Ala Leu Glu Val Leu Phe Ser Pro 1 5 10 15 Glu Ser Ile Glu Gln Ser Leu Lys Arg Cys Gln Leu Pro Ser Thr Leu 20 25 30 Leu Tyr Asp Glu Lys Gly Leu Arg Leu Phe Asp Glu Ile Thr Asn Leu 35 40 45 Lys Glu Tyr Tyr Leu Tyr Glu Ser Glu Leu Asp Ile Leu Lys Lys Phe 50 55 60 Ser Asp Ser Ile Ala Asn Gln Leu Leu Ser Pro Asp Leu Pro Asn Thr 65 70 75 80 Val Ile Glu Leu Gly Cys Gly Asn Met Arg Lys Thr Lys Leu Leu Leu 85 90 95 Asp Ala Phe Glu Lys Lys Gly Cys Asp Val His Phe Tyr Ala Leu Asp 100 105 110 Leu Asn Glu Ala Glu Leu Gln Lys Gly Leu Gln Glu Leu Arg Gln Thr 115 120 125 Thr Asn Tyr Gln His Val Lys Val Ser Gly Ile Cys Gly Cys Phe Glu 130 135 140 Arg Leu Leu Gln Cys Leu Asp Arg Phe Arg Ser Glu Pro Asn Ser Arg 145 150 155 160 Ile Ser Met Leu Tyr Leu Gly Ala Ser Ile Gly Asn Phe Asp Arg Lys 165 170 175 Ser Ala Ala Ser Phe Leu Arg Ser Phe Ala Ser Arg Leu Asn Ile His 180 185 190 Asp Asn Leu Leu Ile Ser Phe Asp His Arg Asn Lys Ala Glu Leu Val 195 200 205 Gln Leu Ala Tyr Asp Asp Pro Tyr Arg Ile Thr Glu Lys Phe Glu Lys 210 215 220 Asn Ile Leu Ala Ser Val Asn Ala Val Phe Gly Glu Asn Leu Phe Asp 225 230 235 240 Glu Asn Asp Trp Glu Tyr Lys Ser Val Tyr Asp Glu Asp Leu Gly Val 245 250 255 His Arg Ala Tyr Leu Gln Ala Lys Asn Glu Val Thr Val Ile Lys Gly 260 265 270 Pro Met Phe Phe Gln Phe Lys Pro Ser His Leu Ile Leu Ile Glu Glu 275 280 285 Ser Trp Lys Asn Ser Asp Gln Glu Cys Arg Gln Ile Ile Glu Lys Gly 290 295 300 Asp Phe Lys Leu Val Ser Lys Tyr Glu Ser Thr Ile Ala Asp Tyr Ser 305 310 315 320 Thr Tyr Val Ile Thr Lys Gln Phe Pro Ala Met Leu Gln Leu Pro Leu 325 330 335 Gln Pro Cys Pro Ser Leu Ala Glu Trp Asp Ala Leu Arg Lys Val Trp 340 345 350 Leu Phe Ile Thr Asn Lys Leu Leu Asn Lys Asp Asn Met Tyr Thr Ala 355 360 365 Trp Ile Pro Leu Arg His Pro Pro Ile Phe Tyr Ile Gly His Val Pro 370 375 380 Val Phe Asn Asp Ile Tyr Leu Thr Lys Ile Val Lys Asn Lys Ala Thr 385 390 395 400 Ala Asn Lys Lys His Phe Trp Glu Trp Phe Gln Arg Gly Ile Asp Pro 405 410 415 Asp Ile Glu Asp Pro Ser Lys Cys His Trp His Ser Glu Val Pro Glu 420 425 430 Ser Trp Pro Ser Pro Asp Gln Leu Arg Glu Tyr Glu Lys Glu Ser Trp 435 440 445 Glu Tyr His Ile Val Lys Leu Cys Lys Ala Met Asp Glu Leu Ser Thr 450 455 460 Ser Glu Lys Arg Ile Leu Trp Leu Cys Tyr Glu His Val Ala Met His 465 470 475 480 Val Glu Thr Thr Leu Tyr Ile Tyr Val Gln Ser Phe Gln Asn Ala Asn 485 490 495 Gln Thr Val Ser Ile Cys Gly Ser Leu Pro Glu Pro Ala Glu Lys Leu 500 505 510 Thr Lys Ala Pro Leu Trp Val Asn Val Pro Glu Thr Glu Ile Ala Val 515 520 525 Gly Met Pro Leu Thr Thr Gln Tyr Thr Ser Val Gly Ser Asn Leu Gln 530 535 540 Ser Ser Asp Leu Ser Ala His Glu Asn Thr Asp Glu Leu Phe Tyr Phe 545 550 555 560 Ala Trp Asp Asn Glu Lys Pro Met Arg Lys Lys Leu Val Ser Ser Phe 565 570 575 Ser Ile Ala Asn Arg Pro Ile Ser Asn Gly Glu Tyr Leu Asp Phe Ile 580 585 590 Asn Lys Lys Ser Lys Thr Glu Arg Val Tyr Pro Lys Gln Trp Ala Glu 595 600 605 Ile Asp Gly Thr Leu Tyr Ile Arg Thr Met Tyr Gly Leu Leu Pro Leu 610 615 620 Asp Asp Tyr Leu Gly Trp Pro Val Met Thr Ser Tyr Asp Asp Leu Asn 625 630 635 640 Asn Tyr Ala Ser Ser Gln Gly Cys Arg Leu Pro Thr Glu Asp Glu Leu 645 650 655 Asn Cys Phe Tyr Asp Arg Val Leu Glu Arg Thr Asp Glu Pro Tyr Val 660 665 670 Ser Thr Glu Gly Lys Ala Thr Gly Phe Gln Gln Leu His Pro Leu Ala 675 680 685 Leu Ser Asp Asn Ser Ser Asn Gln Ile Phe Thr Gly Ala Trp Glu Trp 690 695 700 Thr Ser Thr Val Leu Glu Lys His Glu Asp Phe Glu Pro Glu Glu Leu 705 710 715 720 Tyr Pro Asp Tyr Thr Arg Asp Phe Phe Asp Gly Lys His Asn Val Val 725 730 735 Leu Gly Gly Ser Phe Ala Thr Ala Thr Arg Ile Ser Asn Arg Arg Ser 740 745 750 Phe Arg Asn Phe Tyr Gln Ala Gly Tyr Lys Tyr Ala Trp Ile Gly Ala 755 760 765 Arg Leu Val Lys Asn 770 <210> 5 <211> 2529 <212> DNA <213> Claviceps purpurea <400> 5 atgacagccg tcaagcagat ccccgaaagg aaggtcctca tcgactcgaa ccacaaatca 60 ccctcgaaac ccggcaacaaca cccaaatagt gttatcgaca ttcgtagcaa caaggacgat 120 ctaaacctca gacatgcact tgtatcgtcg ttcaatcctc acgatggtaa gccccgctgg 180 ctgcctacca tgctgctata cgatgagaag ggtctgcaat tattcgagga tattacgtat 240 ctggacgagt attacttgac tggctacgaa atcgagctgc tgaagaagca ctccgccgaa 300 attgccgccg caatccctga tggctctatg gtaattgaac taggaagtgg aaaccttcga 360 aagatttgtc tccttctcca agccttggaa gattcacaca agtcgattga ctactacgcc 420 ctcgatctgt cgcaaaagga gctggagcgt accctctcgc atgttcctga ctttaagtac 480 gtctcttgcc atggtcttct gggcacctac gacgacggag tgacgtggtt gaagcagcct 540 ggcattgtga acaaaaccaa atgcattatt catttgggtt cgagcattgg aaattttcat 600 agaaacgagg ctgccgactt tctgcaaacc ttcgcggacg ttatgaagcc cgacgatagt 660 atggtcattg gcctagactc gtgtgggaat ccagaaatgt cacgcataca acgattcatt 720 ctgaacggac tcagcaatgc caatagcgtc tacggcaagg aaatattcta cgtccctgac 780 tggcgtgtca tcggcgaata cgtctacgat gacgaaggcg gtcgccacca ggccttcatc 840 tctccgctca aagaggtcac cgccctaggg tctgtgatca aagctcacga gcgtatcaag 900 atcgagcaga gtctcaaata ctccaaggct agtgcggatg acctatggcg aaacgcaggt 960 tttcgcgaaa ctcagacctg gactcggaat ggcgagtatg gccttcatat gctccaaaga 1020 gcagacccgc ccttcagcaa agctccctct ctctacgccg ccaatactct cccttccctc 1080 tccgactggc gagccctctg gtgcgcttgg gatatcgtca ccagggccat gctccctcag 1140 caggaactca ccgagaagcc catcgagctt cgacacgcat atattttcta cctcggccat 1200 atcccgacct tcctcgatat acagcttaca aagacaagcg cctgggcccc cactagccca 1260 gtctcctacc acgccatatt cgagcgcggc atcgacccag acgttgataa ccccgagaaa 1320 tgccacgacc attctgaaat tccagatgag tggccgcccg tggaaaaat tatcgcgtac 1380 caagatcgtg tgcgggtccg tctgaccgag ctctacaagc agggcgtgca cacgattacg 1440 cgaaaagcag ctagggccat ctgggtcagt ttcgagcatg aggcgatgca cctcgagact 1500 ctattgtaca tgatgctgca gagcgataag gtcttgccac cgccacacac gggtgtgcct 1560 gattttgaga gaatggctac gaaggcgttt gaggctcgca cgcagaatat gtggttcgaa 1620 attcccgagc agactatttc tctggggacg gacgacccgg aggacggga cgaagatgtg 1680 cactttggat gggacaatga aaagccagtg cgaagagtca aagttcatgc gcttcaggca 1740 caaggtcggc ctatcaccaa tgaagagtat gccttgtaca tctaccacac gaactcctct 1800 aaactacccg cctcttggtc gtcgtcccca tcctcttctc tttcgaatgg tgtatcccac 1860 cccagcagtc aataaaca cattcccaca gatcttccgc actctcttcct ccaaggaaag 1920 tttgtccgga cagtttacgg ccttatccct ctcagcctag ctctcgactg gcctgtccaa 1980 gcatcttacg atgaactcgc cgactgtgcg ctatggatgg gcggccgcat cccgactctg 2040 gaaagccc gcagcatcta cgcctttgta gagtccaaaa cccaaatcgc cacgggaaat 2100 actctggtca agaaagtccc cgccgtgaac ggccatcttg taaacaacgg cgtcgaagag 2160 actctggtca agaaagtccc cgccgtgaac ggccatcttg taaacaacgg cgtcgaagag 2160 acaccccccc acgagtcgtc ctctgcggtc gagaacagcc tgttcatcga ccttgccggc 2220 acaccccccc acgagtcgtc ctctgcggtc gagaacagcc tgttcatcga ccttgccggc 2220 ctgaatgttg gcttcaagag ctggaatccg gagccagtaa cttcgagtgg cacctctctg 2280 ctgaatgttg gcttcaagag ctggaatccg gagccagtaa cttcgagtgg cacctctctg 2280 gccggacagt cctctatggg aggagtttgg gagtggacgt cctccgtttt gcgcccccat 2340 gccggacagt cctctatggg aggagtttgg gagtggacgt cctccgtttt gcgcccccat 2340 gaaggtttcc accccatgga gctgtaccct ggctacacag cagacttttt tgacgaaaag 2400 gaaggtttcc accccatgga gctgtaccct ggctacacag cagacttttt tgacgaaaag 2400 cacaatattg tgctgggcgg gtcatgggca actcatccaa ggattgctgg acgcaagagc 2460 cacaatattg tgctgggcgg gtcatgggca actcatccaa ggattgctgg acgcaagagc 2460 ttcgtgaatt ggtatcagag gaattatcca tatgcgtggg ctggagcgag gctggtaaaa 2520 ttcgtgaatt ggtatcagag gaattatcca tatgcgtggg ctggagcgag gctggtaaaa 2520 gatgcgtga 2529 gatgcgtga 2529 <210> 6<210> 6 <211> 842<211> 842 <212> PRT<212> PRT <213> 麦角菌(Claviceps purpurea) <213> Ergot fungus (Claviceps purpurea) <400> 6 <400> 6 Met Thr Ala Val Lys Gln Ile Pro Glu Arg Lys Val Leu Ile Asp Ser Met Thr Ala Val Lys Gln Ile Pro Glu Arg Lys Val Leu Ile Asp Ser 1 5 10 15 1 5 10 15 Asn His Lys Ser Pro Ser Lys Pro Gly Lys His Pro Asn Ser Val Ile Asn His Lys Ser Pro Ser Lys Pro Gly Lys His Pro Asn Ser Val Ile 20 25 30 20 25 30 Asp Ile Arg Ser Asn Lys Asp Asp Leu Asn Leu Arg His Ala Leu Val Asp Ile Arg Ser Asn Lys Asp Asp Leu Asn Leu Arg His Ala Leu Val 35 40 45 Ser Ser Phe Asn Pro His Asp Gly Lys Pro Arg Trp Leu Pro Thr Met 50 55 60 Leu Leu Tyr Asp Glu Lys Gly Leu Gln Leu Phe Glu Asp Ile Thr Tyr 65 70 75 80 Leu Asp Glu Tyr Tyr Leu Thr Gly Tyr Glu Ile Glu Leu Leu Lys Lys 85 90 95 His Ser Ala Glu Ile Ala Ala Ala Ile Pro Asp Gly Ser Met Val Ile 100 105 110 Glu Leu Gly Ser Gly Asn Leu Arg Lys Ile Cys Leu Leu Leu Gln Ala 115 120 125 Phe Glu Asp Ser His Lys Ser Ile Asp Tyr Tyr Ala Leu Asp Leu Ser 130 135 140 Gln Lys Glu Leu Glu Arg Thr Leu Ser His Val Pro Asp Phe Lys Tyr 145 150 155 160 Val Ser Cys His Gly Leu Leu Gly Thr Tyr Asp Asp Gly Val Thr Trp 165 170 175 Leu Lys Gln Pro Gly Ile Val Asn Lys Thr Lys Cys Ile Ile His Leu 180 185 190 Gly Ser Ser Ile Gly Asn Phe His Arg Asn Glu Ala Ala Asp Phe Leu 195 200 205 Gln Thr Phe Ala Asp Val Met Lys Pro Asp Asp Ser Met Val Ile Gly 210 215 220 Leu Asp Ser Cys Gly Asn Pro Glu Met Ser Arg Ile Gln Arg Phe Ile 225 230 235 240 Leu Asn Gly Leu Ser Asn Ala Asn Ser Val Tyr Gly Lys Glu Ile Phe 245 250 255 Tyr Val Pro Asp Trp Arg Val Ile Gly Glu Tyr Val Tyr Asp Asp Glu 260 265 270 Gly Gly Arg His Gln Ala Phe Ile Ser Pro Leu Lys Glu Val Thr Ala 275 280 285 Leu Gly Ser Val Ile Lys Ala His Glu Arg Ile Lys Ile Glu Gln Ser 290 295 300 Leu Lys Tyr Ser Lys Ala Ser Ala Asp Asp Leu Trp Arg Asn Ala Gly 305 310 315 320 Phe Arg Glu Thr Gln Thr Trp Thr Arg Asn Gly Glu Tyr Gly Leu His 325 330 335 Met Leu Gln Arg Ala Asp Pro Pro Phe Ser Lys Ala Pro Ser Leu Tyr 340 345 350 Ala Ala Asn Thr Leu Pro Ser Leu Ser Asp Trp Arg Ala Leu Trp Cys 355 360 365 Ala Trp Asp Ile Val Thr Arg Ala Met Leu Pro Gln Gln Glu Leu Thr 370 375 380 Glu Lys Pro Ile Glu Leu Arg His Ala Tyr Ile Phe Tyr Leu Gly His 385 390 395 400 Ile Pro Thr Phe Leu Asp Ile Gln Leu Thr Lys Thr Ser Ala Trp Ala 405 410 415 Pro Thr Ser Pro Val Ser Tyr His Ala Ile Phe Glu Arg Gly Ile Asp 420 425 430 Pro Asp Val Asp Asn Pro Glu Lys Cys His Asp His Ser Glu Ile Pro 435 440 445 Asp Glu Trp Pro Pro Val Glu Glu Ile Ile Ala Tyr Gln Asp Arg Val 450 455 460 Arg Val Arg Leu Thr Glu Leu Tyr Lys Gln Gly Val His Thr Ile Thr 465 470 475 480 Arg Lys Ala Ala Arg Ala Ile Trp Val Ser Phe Glu His Glu Ala Met 485 490 495 His Leu Glu Thr Leu Leu Tyr Met Met Leu Gln Ser Asp Lys Val Leu 500 505 510 Pro Pro Pro His Thr Gly Val Pro Asp Phe Glu Arg Met Ala Thr Lys 515 520 525 Ala Phe Glu Ala Arg Thr Gln Asn Met Trp Phe Glu Ile Pro Glu Gln 530 535 540 Thr Ile Ser Leu Gly Thr Asp Asp Pro Glu Asp Gly Asp Glu Asp Val 545 550 555 560 His Phe Gly Trp Asp Asn Glu Lys Pro Val Arg Arg Val Lys Val His 565 570 575 Ala Leu Gln Ala Gln Gly Arg Pro Ile Thr Asn Glu Glu Tyr Ala Leu 580 585 590 Tyr Ile Tyr His Thr Asn Ser Ser Lys Leu Pro Ala Ser Trp Ser Ser 595 600 605 Ser Pro Ser Ser Ser Leu Ser Asn Gly Val Ser His Pro Ser Ser His 610 615 620 Asn Lys His Ile Pro Thr Asp Leu Pro His Ser Phe Leu Gln Gly Lys 625 630 635 640 Phe Val Arg Thr Val Tyr Gly Leu Ile Pro Leu Ser Leu Ala Leu Asp 645 650 655 Trp Pro Val Gln Ala Ser Tyr Asp Glu Leu Ala Asp Cys Ala Leu Trp 660 665 670 Met Gly Gly Arg Ile Pro Thr Leu Glu Glu Ala Arg Ser Ile Tyr Ala 675 680 685 Phe Val Glu Ser Lys Thr Gln Ile Ala Thr Gly Asn Thr Leu Val Lys 690 695 700 Lys Val Pro Ala Val Asn Gly His Leu Val Asn Asn Gly Val Glu Glu 705 710 715 720 Thr Pro Pro His Glu Ser Ser Ser Ala Val Glu Asn Ser Leu Phe Ile 725 730 735 Asp Leu Ala Gly Leu Asn Val Gly Phe Lys Ser Trp Asn Pro Glu Pro 740 745 750 Val Thr Ser Ser Gly Thr Ser Leu Ala Gly Gln Ser Ser Met Gly Gly 755 760 765 Val Trp Glu Trp Thr Ser Ser Val Leu Arg Pro His Glu Gly Phe His 770 775 780 Pro Met Glu Leu Tyr Pro Gly Tyr Thr Ala Asp Phe Phe Asp Glu Lys 785 790 795 800 His Asn Ile Val Leu Gly Gly Ser Trp Ala Thr His Pro Arg Ile Ala 805 810 815 Gly Arg Lys Ser Phe Val Asn Trp Tyr Gln Arg Asn Tyr Pro Tyr Ala 820 825 830 Trp Ala Gly Ala Arg Leu Val Lys Asp Ala 835 840 <210> 7 <211> 1422 <212> DNA <213> Neurospora crassa <400> 7 atggtcgcca ccaccgtcga gctgcctctg cagcaaaagg ccgacgccgc ccaaactgtt 60 actggcccccc tcccattcgg caattccctc ctcaaggaat tcgtcctcga ccctgcctac 120 cggaacctca accatggctc cttcggcacc atcccctcg ccatccaaca aaactccgc 180 agttaccaaa ccgccgccga agcccgcccc tgccccttcc tccgctacca aacccccgta 240 ctcctcgacg aatcccgcg cgccgtcgcc aacctcctca aagtccccgt cgaaaccgtc 300 gtcttcgtcg ccaacgccac tatgggcgtc aactgtcc tgcgcaacat cgtctggtc 360 gccgacggca aggacgagat cctctacttc gacaccatct acggcgcctg cggcaagacc 420 atcgactacg tcatcgaaga caagcgaggg atcgtttctt ctcgctgtat cccattgatc 480 taccccgccg aagacgacga tgtcgtcgct gccttccggg acgccatcaa gaagagccgc 540 gaagaaggca agcgaccccg tctggctgtt atcgacgtcg tctcctccat gcctggcgta 600 cggttcccgt tcgaggacat cgtcaagatc tgcaaagaag aagagatcat ctcgtgcgtg 660 gacggcgccc aaggcatcgg catggtggac ctcaagatca ccgagaccga cccggatttt 720 ttgattagta actgccacaa gtggctgttt actccgcgcg gatgtgccgt gttctacgtg 780 cctgtgcgta accagcactt gatccgctcg acgctgccta ctagccatgg gttcgtgccg 840 caggtcggga ataggttcaa cccgctggtg ccggcgggga acaagtcagc gtttgttagc 900 aactttgagt ttgtgggcac ggtggataac tcgccgttct tttgtgttaa ggacgcgatc 960 aagtggcgcg aggaggtgct cggtggggag gagaggatca tggagtacat gactaaattg 1020 gcgagggaag gtggacagaa agtggcggag attctgggga cgagggtgtt ggagaatagc 1080 acgggaacgc tgatcaggtg cgccatggtc aatattgcgt tgccgttcgt tgtgggagag 1140 gatcccaagg cgccggtcaa gttgacggag aaggaggaga aggatgttga agggttgtat 1200 gagattcccc atgaggaggc aaacatggcg ttcaagtgga tgtacaacgt gctgcaggac 1260 gagttaaca cgtttgtacc catgaccttc cacaggagga ggttctgggc cagattgagc 1320 gcgcaggtgt atttggagat gagcgatttc gagtgggcgg ggaagacgtt gaaggagttg 1380 tgtgagaggg tggctaaggg ggagtacaag gagagcgcct ga 1422 <210> 8 <211> 473 <212> PRT <213> Neurospora crassa <400> 8 Put Val Wing Thr Thr Val Glu Leu Pro Leu Gln Gln Lys Wing Asp Wing 1 5 10 15 Ala Gln Thr Val Thr Gly Pro Leu Pro Phe Gly Asn Ser Leu Leu Lys 20 25 30 Glu Phe Val Leu Asp Pro Ala Tyr Arg Asn Leu Asn His Gly Ser Phe 35 40 45 Gly Thr Ile Pro Ser Ala Ile Gln Gln Lys Leu Arg Ser Tyr Gln Thr 50 55 60 Ala Ala Glu Ala Arg Pro Cys Pro Phe Leu Arg Tyr Gln Thr Pro Val 65 70 75 80 Leu Leu Asp Glu Ser Arg Ala Ala Val Ala Donkey Leu Leu Lys Val Pro 85 90 95 Val Glu Thr Val Val Phe Val Ala Asn Ala Thr Met Gly Val Asn Thr 100 105 110 Val Leu Arg Asn Ile Val Trp Ser Ala Asp Gly Lys Asp Glu Ile Leu 115 120 125 Tyr Phe Asp Thr Ile Tyr Gly Ala Cys Gly Lys Thr Ile Asp Tyr Val 130 135 140 Ile Glu Asp Lys Arg Gly Ile Val Ser Ser Arg Cys Ile Pro Leu Ile 145 150 155 160 Tyr Pro Ala Glu Asp Asp Asp Val Val Ala Ala Phe Arg Asp Ala Ile 165 170 175 Lys Lys Ser Arg Glu Glu Gly Lys Arg Pro Arg Leu Ala Val Ile Asp 180 185 190 Val Val Ser Ser Met Pro Gly Val Arg Phe Pro Phe Glu Asp Ile Val 195 200 205 Lys Ile Cys Lys Glu Glu Glu Ile Ile Ser Cys Val Asp Gly Ala Gln 210 215 220 Gly Ile Gly Met Val Asp Leu Lys Ile Thr Glu Thr Asp Pro Asp Phe 225 230 235 240 Leu Ile Ser Asn Cys His Lys Trp Leu Phe Thr Pro Arg Gly Cys Ala 245 250 255 Val Phe Tyr Val Pro Val Arg Asn Gln His Leu Ile Arg Ser Thr Leu 260 265 270 Pro Thr Ser His Gly Phe Val Pro Gln Val Gly Asn Arg Phe Asn Pro 275 280 285 Leu Val Pro Ala Gly Asn Lys Ser Ala Phe Val Ser Asn Phe Glu Phe 290 295 300 Val Gly Thr Val Asp Asn Ser Pro Phe Phe Cys Val Lys Asp Ala Ile 305 310 315 320 Lys Trp Arg Glu Glu Val Leu Gly Gly Glu Glu Arg Ile Met Glu Tyr 325 330 335 Met Thr Lys Leu Ala Arg Glu Gly Gly Gln Lys Val Ala Glu Ile Leu 340 345 350 Gly Thr Arg Val Leu Glu Asn Ser Thr Gly Thr Leu Ile Arg Cys Ala 355 360 365 Met Val Asn Ile Ala Leu Pro Phe Val Val Gly Glu Asp Pro Lys Ala 370 375 380 Pro Val Lys Leu Thr Glu Lys Glu Glu Lys Asp Val Glu Gly Leu Tyr 385 390 395 400 Glu Ile Pro His Glu Glu Ala Asn Met Ala Phe Lys Trp Met Tyr Asn 405 410 415 Val Leu Gln Asp Glu Phe Asn Thr Phe Val Pro Met Thr Phe His Arg 420 425 430 Arg Arg Phe Trp Ala Arg Leu Ser Ala Gln Val Tyr Leu Glu Met Ser 435 440 445 Asp Phe Glu Trp Ala Gly Lys Thr Leu Lys Glu Leu Cys Glu Arg Val 450 455 460 Ala Lys Gly Glu Tyr Lys Glu Ser Ala 465 470 <210> 9 <211> 1179 <212> DNA <213> Schizosaccharomyces pombe <400> 9 atggctgaaa acaacgtcta cggccatgaa atgaaaaagc attttatgct tgatcccgat 60 tacgtgaatg taaataacgg aagttgtgga acagaatctc ttgctgttta caataaacat 120 gtccaacttt taaaggaagc tcagagcaag ccagatttta tgtgcaatgc ctatatgccg 180 atgtacatgg aggctactcg aaatgaagtt gccaagctga taggcgcgga ttcaagtaat 240 atagtttttt gcaattccgc tacagatggg attagtacgg ttttgttgac atttccgtgg 300 gaacagaatg atgagatatt gatgctaaat gttgcctatc ctacttgtac atatgccgct 360 gattttgcaa agaatcagca taatttacga ttagacgtta tcgatgttgg ggtggaaatt 420 gatgaagatc tattccttaa agaagtagaa cagcgttttt tgcagtccaa gccgagagca 480 tttatctgtg atattttaag ttctatgccc gttatcttgt ttccttggga aaaagtcgta 540 aagctttgta aaaagtataa tattgttagc attattgatg gtgctcatgc cataggtcat 600 attcctatga atttggctaa tgttgatcct gattttttgt ttaccaatgc tcataaatgg 660 ttaaactcac cagctgcatg cactgtactc tatgtctcag ctaaaaatca caatctcatc 720 gaagcacttc ctctctcata cggttatgga ttaagagaaa aggaatcaat tgccgcagat 780 actcttacca atcggtttgt caattctttc aagcaagatt tacctaagtt tatagccgtt 840 ggtgaggcta ttaagtttcg aaaatccatt ggaggggaag aaaagattca acaatattgt 900 catgaaatag ctttaaaggg agccgaaatt atttctaaag aactgggcac ttcctttatc 960 aaacctccat acccagttgc aatggtaaac gtcgaagttc ccttacgcaa cattccctcc 1020 atagaacac agaaagtatt ttggcctaaa tataatacat tccttcgatt tatggaattt 1080 aaaggaaaat tttacactag acttagcggt gcggtgtatt tagacaatc agatttctat 1140 tatattgcta aagttattaa agactctgc tctctttga 1179 <210> 10 <211> 392 <212> PRT <213> Schizosaccharomyces pombe <400> 10 Met Ala Glu Asn Asn Val Tyr Gly His Glu Met Lys Lys His Phe Met 1 5 10 15 Leu Asp Pro Asp Tyr Val Asn Val Asn Asn Gly Ser Cys Gly Thr Glu 20 25 30 Ser Lion Wing Val Tyr Asn Lys His Val Gln Lion Wing Lys Glu Wing Gln 35 40 45 Ser Lys Pro Asp Phe Met Cys Asn Ala Tyr Met Pro Met Tyr Met Glu 50 55 60 Only Thr Arg Asn Glu Val Only Lys Leu Ile Gly Only Asp Ser Ser Asn 65 70 75 80 Ile Val Phe Cys Asn Ser Ala Thr Asp Gly Ile Ser Thr Val Leu Leu 85 90 95 Thr Phe Pro Trp Glu Gln Asn Asp Glu Ile Leu Met Leu Asn Val Ala 100 105 110 Tyr Pro Thr Cys Thr Tyr Ala Ala Asp Phe Ala Lys Asn Gln His Asn 115 120 125 Leu Arg Leu Asp Val Ile Asp Val Gly Val Glu Ile Asp Glu Asp Leu 130 135 140 Phe Leu Lys Glu Val Glu Gln Arg Phe Leu Gln Ser Lys Pro Arg Ala 145 150 155 160 Phe Ile Cys Asp Ile Leu Ser Ser Met Pro Val Ile Leu Phe Pro Trp 165 170 175 Glu Lys Val Val Lys Leu Cys Lys Lys Tyr Asn Ile Val Ser Ile Ile 180 185 190 Asp Gly Ala His Ala Ile Gly His Ile Pro Met Asn Leu Ala Asn Val 195 200 205 Asp Pro Asp Phe Leu Phe Thr Asn Ala His Lys Trp Leu Asn Ser Pro 210 215 220 Ala Ala Cys Thr Val Leu Tyr Val Ser Ala Lys Asn His Asn Leu Ile 225 230 235 240 Glu Ala Leu Pro Leu Ser Tyr Gly Tyr Gly Leu Arg Glu Lys Glu Ser 245 250 255 Ile Ala Val Asp Thr Leu Thr Asn Arg Phe Val Asn Ser Phe Lys Gln 260 265 270 Asp Leu Pro Lys Phe Ile Ala Val Gly Glu Ala Ile Lys Phe Arg Lys 275 280 285 Ser Ile Gly Gly Glu Glu Lys Ile Gln Gln Tyr Cys His Glu Ile Ala 290,295,300 Lys Gly Ala Glu Ile Serves as Lys Glu Gly Thr Ser Phe Ile 305 310 315 320 Lys Pro Pro Tyr Pro Val Ala Met Val Asn Val Glu Val Pro Leu Arg 325 330 335 Asn Ile Pro Ser Ile Glu Thr Gln Lys Val Phe Trp Pro Lys Tyr Asn 340 345 350 Thr Phe Leu Arg Phe Met Glu Phe Lys Gly Lys Phe Tyr Thr Arg Leu 355 360 365 Ser Gly Ala Val Tyr Leu Glu Glu Ser Asp Phe Tyr Tyr Ile Ala Lys 370 375 380 Val Ile Lys Asp Phe Cys Ser Leu 385,390 <210> 11 <211> 1581 <212> DNA <213> Claviceps purpurea <400> 11 atgggtttgt tggaaggtga agaattggtt ttgagaggta gaggtcaagg tggtgaacct 60 agaccagaaa gagaaccaga attgaagttg gaacacgttc cagaaagggc tccagatggt 120 gaaccagaaa ctgaaggtca attgggtcca agaaaagaac ctgaacataa gttggaagct 180 gaatccgaac cattgcaaga aactccacaa agaagaagttt tggcttttgg tagagcttgg 240 aagtccgaat ttttgtttga tccagcttgg agaaacttga accatggtag ttttggtact 300 taccccttgt acatcagaga taagttgaga gcttatcaag atcaagctga agctagacct 360 gatcacttca ttagatacga agagtccaag ttgttgcata gatctagagc tgctgttgct 420 aagatagtta atgctccatt ggataccgtt gttttcgttg gtaatgctac tgaaggtgtc 480 aacactgtct tgagaaattt gagatgggac tccttggaaa aaggtggtca aaaggatgtt 540 atcctgtctt tctctactgt ttacgaagct tgtggtaacg ctgctgatta tatcgttgaa 600 tactttgccg gtaaggttga acatagaacc atcgaattgg aatacccagt tgaagatgct 660 gatgttattg ctgctttaag aggtgctgct actcaagttg ctagagaagg taaaagggct 720 agattggcta tgatggatgt tgttacttct agaccaggtg ttgtttttcc atgggaagct 780 gcagttagag tatgtagaga attgggtatc ttgtccttgg ttgatggtgc tcaaggtgtt 840 ggtatggtta gattggattt gactgctgct gatccagatt tcttcgtttc taactgtcat 900 aagtggttgt tggttccaag aggttgtgct atgttgtata ctccagctag aactcaatgt 960 ttgttgagaa ctgctttggc tacttctcat ggttatgttc caccatctgc tgctccagct 1020 ccaccaggtt ctaaatctag atatgttgct aacttcgaat tcgttggcac tagagataat 1080 ggtccatatt tgtgtgttgc tgatgcaatt gcttggagag aacgtgtttg tggtggtgaa 1140 gaaaacatct tgagatactt gtgggctttg aacaagaagg gtattagaat tgtcgctaga 1200 gctttgggta ctacccattt ggataacgaa actgaaactt tgaccaactg tgctatgggt 1260 aatgttgctt tgccaatgag agttgatgat gaagatgcct ctactgcttt agatgctgct 1320 ccttctgctg ctattgctgc accagatgtt gttgttgcaa gagaaaatgt tgcattggtt 1380 gacaagtgga tgagagaaag attattcgat gactacaaga ccttcatgac cttgttcgtt 1440 atgcaagata gatactgggt tagactgtct gctcaaatct acttggatga acaagattat 1500 gaagccgccg gtgatatttt gaaagctttg tgtgaaagaa tcaggcgtag agaatatttg 1560 gttccacaac cagttgagta a 1581 <210> 12 <211> 526 <212> PRT <213> Claviceps purpurea <400> 12 Met Gly Leu Leu Glu Gly Glu Glu Leu Val Leu Arg Gly Arg Gly Gln 1 5 10 15 Gly Gly Glu Pro Arg Pro Glu Arg Glu Pro Glu Leu Lys Leu Glu His 20 25 30 Val Pro Glu Arg Ala Pro Asp Gly Glu Pro Glu Thr Glu Gly Gln Leu 35 40 45 Gly Pro Arg Lys Glu Pro Glu His Lys Leu Glu Ala Glu Ser Glu Pro 50 55 60 Leu Gln Glu Thr Pro Gln Arg Glu Val Leu Ala Phe Gly Arg Ala Trp 65 70 75 80 Lys Ser Glu Phe Leu Phe Asp Pro Ala Trp Arg Asn Leu Asn His Gly 85 90 95 Ser Phe Gly Thr Tyr Pro Leu Tyr Ile Arg Asp Lys Leu Arg Ala Tyr 100 105 110 Gln Asp Gln Ala Glu Ala Arg Pro Asp His Phe Ile Arg Tyr Glu Glu 115 120 125 Ser Lys Leu Leu His Arg Ser Arg Ala Ala Val Ala Lys Ile Val Asn 130 135 140 Ala Pro Leu Asp Thr Val Val Phe Val Gly Asn Ala Thr Glu Gly Val 145 150 155 160 Asn Thr Val Leu Arg Asn Leu Arg Trp Asp Ser Leu Glu Lys Gly Gly 165 170 175 Gln Lys Asp Val Ile Leu Ser Phe Ser Thr Val Tyr Glu Ala Cys Gly 180 185 190 Asn Ala Ala Asp Tyr Ile Val Glu Tyr Phe Ala Gly Lys Val Glu His 195 200 205 Arg Thr Ile Glu Leu Glu Tyr Pro Val Glu Asp Ala Asp Val Ile Ala 210 215 220 Ala Leu Arg Gly Ala Ala Thr Gln Val Ala Arg Glu Gly Lys Arg Ala 225 230 235 240 Arg Leu Ala Met Met Asp Val Val Thr Ser Arg Pro Gly Val Val Phe 245 250 255 Pro Trp Glu Ala Ala Val Arg Val Cys Arg Glu Leu Gly Ile Leu Ser 260 265 270 Leu Val Asp Gly Ala Gln Gly Val Gly Met Val Arg Leu Asp Leu Thr 275 280 285 Ala Ala Asp Pro Asp Phe Phe Val Ser Asn Cys His Lys Trp Leu Leu 290 295 300 Val Pro Arg Gly Cys Ala Met Leu Tyr Thr Pro Ala Arg Thr Gln Cys 305 310 315 320 Leu Leu Arg Thr Ala Leu Ala Thr Ser His Gly Tyr Val Pro Pro Ser 325 330 335 Ala Ala Pro Ala Pro Pro Gly Ser Lys Ser Arg Tyr Val Ala Asn Phe 340 345 350 Glu Phe Val Gly Thr Arg Asp Asn Gly Pro Tyr Leu Cys Val Ala Asp 355 360 365 Ala Ile Ala Trp Arg Glu Arg Val Cys Gly Gly Glu Glu Asn Ile Leu 370 375 380 Arg Tyr Leu Trp Ala Leu Asn Lys Lys Gly Ile Arg Ile Val Ala Arg 385 390 395 400 Ala Leu Gly Thr Thr His Leu Asp Asn Glu Thr Glu Thr Leu Thr Asn 405 410 415 Cys Ala Met Gly Asn Val Ala Leu Pro Met Arg Val Asp Asp Glu Asp 420 425 430 Ala Ser Thr Ala Leu Asp Ala Ala Pro Ser Ala Ala Ile Ala Ala Pro 435 440 445 Asp Val Val Val Ala Arg Glu Asn Val Ala Leu Val Asp Lys Trp Met 450 455 460 Arg Glu Arg Leu Phe Asp Asp Tyr Lys Thr Phe Met Thr Leu Phe Val 465 470 475 480 Met Gln Asp Arg Tyr Trp Val Arg Leu Ser Ala Gln Ile Tyr Leu Asp 485 490 495 Glu Gln Asp Tyr Glu Ala Ala Gly Asp Ile Leu Lys Ala Leu Cys Glu 500 505 510 Arg Ile Arg Arg Arg Glu Tyr Leu Val Pro Gln Pro Val Glu 515 520 525 <210> 13 [[ID=३०]]<211> 1113 <212> DNA <213> Mycobacterium smegmatis <400> 13 atgctcgcgc agcagtggcg tgacgcccgt cccaaggttg ccgggttgca cctggacagc 60 ggggcatgtt cgcggcagag cttcgcggtg atcgacgcga ccaccgcaca cgcacgccac 120 gaggccgagg tgggtggtta tgtggcggcc gaggctgcga cgccggcgct cgacgccggg 180 cgggccgcgg tcgcgtcgct catcggtttt gcggcgtcgg acgtggtgta caccagcgga 240 tccaaccacg ccatcgacct gttgctgtcg agctggccgg ggaagcgcac gctggcctgc 300 ctgcccggcg agtacgggcc gaatctgtct gccatggcgg ccaacggttt ccaggtgcgt 360 gcgctaccgg tcgacgacga cgggcgggtg ctggtcgacg aggcgtcgca cgaactgtcg 420 gcccatcccg tcgcgctcgt acacctcacc gcattggcaa gccatcgcgg gatcgcgcaa 480 cccgcggcag aactcgtcga ggcctgccac aatgcgggga tccccgtggt gatcgacgcc 540 gcgcaggcgc tggggcatct ggactgcaat gtcggggccg acgcggtgta ctcatcgtcg 600 cgcaagtggc tcgccggccc gcgtggtgtc ggggtgctcg cggtgcggcc cgaactcgcc 660 gagcgtctgc aaccgcggat ccccccgtcc gactggccaa ttccgatgag cgtcttggag 720 aagctcgaac taggtgagca caacgcggcg gcgcgtgtgg gattctccgt cgcggttggt 780 gagcatctcg cagcagggcc cacggcggtg cgcgaacgac tcgccgaggt ggggcgtctc 840 tctcggcagg tgctggcaga ggtcgacggg tggcgcgtcg tcgaacccgt cgaccaaccc 900 accgcgatca ccacccttga gtccaccgat ggtgccgatc ccgcgtcggt gcgctcgtgg 960 ctgatcgcgg agcgtggcat cgtgaccacc gcgtgtgaac tcgcgcgggc accgttcgag 1020 atgcgcacgc cggtgctgcg aatctcgccg cacgtcgacg tgacggtcga cgaactggag 1080 cagttcgccg cagcgttgcg tgaggcgccc tga 1113 <210> 14 <211> 371 <212> PRT <213> Mycobacterium smegmatis <400> 14 Met Met Leu Ala Gln Gln Trp Arg Asp Ala Arg Pro Lys Val Ala Gly 1 5 10 15 Leu His Leu Asp Ser Gly Ala Cys Ser Arg Gln Ser Phe Ala Val Ile 20 25 30 Asp Ala Thr Thr Ala His Ala Arg His Glu Ala Glu Val Gly Gly Tyr 35 40 45 Val Ala Ala Glu Ala Ala Thr Pro Ala Leu Asp Ala Gly Arg Ala Ala 50 55 60 Val Ala Ser Leu Ile Gly Phe Ala Ala Ser Asp Val Val Tyr Thr Ser 65 70 75 80 Gly Ser Asn His Ala Ile Asp Leu Leu Leu Ser Ser Trp Pro Gly Lys 85 90 95 Arg Thr Leu Ala Cys Leu Pro Gly Glu Tyr Gly Pro Asn Leu Ser Ala 100 105 110 Met Ala Ala Asn Gly Phe Gln Val Arg Ala Leu Pro Val Asp Asp Asp 115 120 125 Gly Arg Val Leu Val Asp Glu Ala Ser His Glu Leu Ser Ala His Pro 130 135 140 Val Ala Leu Val His Leu Thr Ala Leu Ala Ser His Arg Gly Ile Ala 145 150 155 160 Gln Pro Ala Ala Glu Leu Val Glu Ala Cys His Asn Ala Gly Ile Pro 165 170 175 Val Val Ile Asp Ala Ala Gln Ala Leu Gly His Leu Asp Cys Asn Val 180 185 190 Gly Ala Asp Ala Val Tyr Ser Ser Ser Arg Lys Trp Leu Ala Gly Pro 195 200 205 Arg Gly Val Gly Val Leu Ala Val Arg Pro Glu Leu Ala Glu Arg Leu 210 215 220 Gln Pro Arg Ile Pro Pro Ser Asp Trp Pro Ile Pro Met Ser Val Leu 225 230 235 240 Glu Lys Leu Glu Leu Gly Glu His Asn Ala Ala Ala Arg Val Gly Phe 245 250 255 Ser Val Ala Val Gly Glu His Leu Ala Ala Gly Pro Thr Ala Val Arg 260 265 270 Glu Arg Leu Ala Glu Val Gly Arg Leu Ser Arg Gln Val Leu Ala Glu 275 280 285 Val Asp Gly Trp Arg Val Val Glu Pro Val Asp Gln Pro Thr Ala Ile 290 295 300 Thr Thr Leu Glu Ser Thr Asp Gly Ala Asp Pro Ala Ser Val Arg Ser 305 310 315 320 Trp Leu Ile Ala Glu Arg Gly Ile Val Thr Thr Ala Cys Glu Leu Ala 325 330 335 Arg Ala Pro Phe Glu Met Arg Thr Pro Val Leu Arg Ile Ser Pro His 340 345 350 Val Asp Val Thr Val Asp Glu Leu Glu Gln Phe Ala Ala Ala Leu Arg 355 360 365 Glu Ala Pro 370 <210> 15 <211> 2631 <212> Ms <213> Artificial sequence <220> <223> DNA sequences for codon optimization targeting Saccharomyces cerevisiae <220> <221> misc_feature <222> (1)..(2631) <223> NcEgt1 DNA sequence codon-optimized for Saccharomyces cerevisiae <400> 15 atgccatctg ctgaatctat gactccatct tctgctttgg gtcaattgaa agctactggt 60 caacatgtct tgtccaagtt gcaacaacaa acttccaacg ccgatatcat cgatattaga 120 agagttgccg ttgagatcaa cttgaaaacc gaaattacct ccatgttcag accaaaagat 180 ggtccaagac aattgccaac cttgttgttg tataacgaaa gaggcttgca gttgttcgaa 240 agaattactt acttggaaga gtactacttg accaacgacg agattaagattttgactaag 300 cacgctactg aaatggcctc ttttatattcca tctggtgcca tgattatcga actaggttct 360 ggtaatttga ggaaggtcaa cttgttgtta gaagctttgg ataatgctgg taaggccatt 420 gattattacg ccttggattt gtccagagaa gaattggaaa gaaccttggc tcaagtccca 480 tcttacaaac atgttaagtg tcatggtttg ttgggtactt acgatgatgg tagagatgg 540 ttgaaagctc cagaaaacat caacaagcaa aagtgcatac tgcatctggg ttcttctatt 600 ggtaacttca atagatctga tgctgccact ttttgaagg gtttcactga tgttttgggt 660 ccaaacgata agatgttgat tggtgttgat gcttgtaacg atccagctag agtttaccat 720 gcttacaatg ataaggttgg tatcacccac gaattcatct tgaatggtttt gagaaacgcc 780 aacgaaatta ttggtgaaac cgctttcatt gaaggtgatt ggagagttat cggtgaatac 840 gtttatgatg aagaaggtgg tagacatcaa gctttttatg ctccaactag agataccatg 900 gttatgggtg aattgatcag atcccatgac agaatccaaa tcgaacagtc tctgaagtac 960 tccaaagagg aatctgaaag attgtggtct actgctggtt tggaacaagt ttctgaatgg 1020 acttacggta atgaatacgg tttacatttg ttggccaagt ccagaatgtc cttctcattg 1080 attccatcag tttacgctag atctgctttg ccaactttgg atgattggga agctttgtgg 1140 gctacttggg atgttgttac tagacaaatg ttgccacaag aggaattatt ggagaagcca 1200 atcaagttga gaaatgcctg cattttctac ttgggtcata tcccaacttt cttggatatt 1260 cagttgacta agactaccaa gcaagctcca tctgaaccag ctcatttctg taagatttc 1320 gaaaggggta tcgatccaga tgttgacaat ccagaattgt gtcatgccca ttctgaaatt 1380 ccagatgaat ggccaccagt tgaagaaatt ttgacttacc aagaaaccgt cagatctaga 1440 ttgagaggtc tatatgctca tggtattgcc aacattccaa gaaatgtcgg tagagctatt 1500 tgggttggtt tcgaacatga attgatgcac atcgagactc tgttgtacat gatgttgcaa 1560 tctgacaaga ccttgattcc aactcatatt ccaagaccag atttcgataa gttggctaga 1620 aaagccgaat cagaaagggt tccaaatcaa tggtttaaga tcccagctca agaaatcact 1680 attggtttgg atgaccctga agatggttcc gatattaaca aacattacgg ttgggataac 1740 gagaagccac caagaagagt tcaagttgct gcttttcaag ctcaaggtag accaattaca 1800 aacgaagaat acgcccaata cttgttggaa aagaacattg ataagttgcc agcttcttgg 1860 gctagattgg ataacgaaaa catttctaac ggcaccacca attctgtttc tggtcatcat 1920 tctaacagaa cctccaaaca acaactgcca tcttcattct tggaaaaaac tgctgttaga 1980 accgtttacg gtttggttcc attgaaacat gctttggatt ggccagtttt tgcttcctat 2040 gatgaattgg ctggttgtgc tgcttatatg ggtggtagaa ttccaacttt cgaagaaacc 2100 agatctatct acgctttatgc tgatgctctg aagaagaaga aagaagctga aagacaactg 2160 ggtagaactg ttccagctgt taatgctcat ttgactaaca acggtgttga aattactcct 2220 ccatcatcac catcatctga aactccagca gaatcttctt caccatctga ttctaacact 2280 accttgatta ccaccgagga tttgttctct gatttggatg gtgctaatgt tggtttccat 2340 aattggcatc caatgcctat tacttctaag ggtaatacct tggtcggtca aggtgaatta 2400 ggtggtgttt gggaatggac atcttccgtt ttgagaaaat gggaaggttt tgagccaatg 2460 gaattatacc caggttacac tgctgatttc tttgacgaaa agcacaacat cgttttaggt 2520 ggttcatggg ctactcatcc aagaattgct ggtagaaagt cttttgtcaa ctggtatcaa 2580 agaaactacc catatgcatg ggttggtgct agagttgtta gagatttgtg a 2631 <210> 16 <211> 2529 <212> DNA <213> Artificial sequence <220> <223> DNA sequences for codon optimization targeting Saccharomyces cerevisiae <220> <221> misc_feature <222> (1)..(2529) <223> The CpEgt1 DNA sequences are not available <400> 16 atgactgccg ttaagcaaat tcctgaaaga aaggtgttga tagattcaaa tcataagtct 60 ccatcaaaac cgggtaaaca tcctaattct gtcattgata tcaggtctaa taaggacgat 120 ttaaatttac gtcatgccct agtctcatct tttaatccac acgatggaaa acctaggtgg 180 ctacctacta tgttattgta cgacgaaaaa ggtttacaat tgtttgaaga tataacttac 240 ttagatgagt attatttgac tggctacgaa attgaattat tgaagaaaca ttcagcagaa 300 attgcagctg ctattcctga tggttctatg gtcatcgaat tgggctctgg taatttgaga 360 aagatctgtt tgttgttaca agcctttgag gattcacata agtctatcga ctactatgca 420 ttagattat cacaaaagga attagaaaga actttgagcc atgttcctga ctttaaatat 480 gtctcttgtc atggactgct aggtacatat gatgatggtg ttacatggtt gaaacaacca 540 ggtatagtca ataagactaa gtgcatcatc catcttggtt cgtctattgg gaattttcat 600 agaaatgaag ctgccgattt cctgcagaca tttgctgatg taatgaaacc agacgactct 660 atggttattg gtcttgattc atgcggtaat ccagagatgt ctcgcattca aagattcatt 720 ttgaacggct tatccaatgc tatagcgtt tatggcaagg aaatattcta tgttccagat 780 tggagagtaa ttggtgaata tgtttacgat gatgaaggtg gcagacacca ggcttttatt 840 tcaccttga aagaagtcac tgctttaggg tctgttatta aagcccatga aagaattaaa 900 attgaacaat ctttgaagta ctctaaggcc tcagctgacg attatggag aaatgctggc 960 ttcgagaaa ctcaaacttg gacgagaaac ggtgaatatg gactacatat gttgcaaaga 1020 gctgatccgc ccttctctaa ggctccttct ttgtatgcag ctaatactct tccctctct 1080 tctgattgga gagcattgtg gtgtgcctgg gatattgtca ctagagctat gttgccacaa 1140 caggaattga ctgagaaacc tatagagtta agacatgcct acatctttta ccttggtcat 1200 attcctacct tcttagacat ccagttaacc aaaacatcag catgggctcc aacctctcca 1260 gttcttatc atgccatttt cgagcgcggc attgatcccg atgttgataa cccagaaaag 1320 tgtcatgatc actcagagat tccagatgaa tggccaccag tcgaagaaat tattgcttat 1380 caagataggg tgcgtgttag attgacagaa ctgtataaac agggtgtgca cacaattaca 1440 agaaaggctg ctagagctat ctgggtttca tttgaacatg aagctatgca tttggaaacc 1500 ttgttgtata tgatgctaca aagtgataaa gtgttgccac ctccacacac tggcgttcca 1560 gactttgaaa gaatggcaac taaggctttc gaagctcgta cgcaaaatat gtggttcgaa 1620 attccagaac agacttattag tcttggaaca gatgatccag aagatgggga tgaagacgtt 1680 cattttggat gggacaacga aaaaccagtt agaagagtta aggttcacgc gttgcaagct 1740 caaggaagac caattacaaa tgaggaatac gcattatata tttaccatac caactcttct 1800 aaactgccag catcttggag ttcgtcccct tcatcttctc tgtctaacgg cgtgtctcat 1860 cccagctccc ataacaagca tattccaact gatttgcctc attccttctt gcaaggtaag 1920 tttgttagaa ccgtatatgg tttgatacct ttatctttgg cgttggattg gcctgttcaa 1980 gcttcttatg atgaattagc tgactgtgca ttatggatgg gtggaagaat tccaacctta 2040 gaggaagcca gatcaatcta tgcctttgtt gaatctaaaa cgcaaatagc aacaggtaac 2100 acattggtca agaaagttcc tgctgttaat ggacacttgg ttaataacgg agttgaggaa 2160 actccaccac atgaatcctc ttcggcagtt gagaattctt tattcatcga cttagccggt 2220 ttgaacgtgg gttttaaaag ttggaatcct gaacctgtta catcttctgg tacgtctttg 2280 gctggacaat cctctatggg tggtgtatgg gagtggacct cttctgtttt aagaccacat 2340 gaagggttcc acccaatgga gttgtatcct ggttatacag ccgatttctt tgatgaaaaa 2400 cataatattg ttctcggagg atcatgggct actcatccaa gaatagcggg tagaaaaagc 2460 tttgttaact ggtatcaaag aaactatccg tacgcctggg ctggtgccag acttgttaaa 2520 gatgcttga 2529 <210> 17 <211> 1422 <212> DNA <213> Artificial sequence <220> <223> DNA sequences for codon optimization targeting Saccharomyces cerevisiae <220> <221> misc_feature <222> (1)..(1422) <223> NcEgt2 DNA sequence with codon optimization for Saccharomyces cerevisiae <400> 17 atggttgcta ctactgttga attgccattg caacaaaaag ctgatgctgc tcaaactgtt 60 actggtccat tgccatttgg taacagcttg ttgaaagaat tcgttttgga tccagcctac 120 180 tcttatcaaa ctgctgctga agctagacca tgtccatttt tgagatatca aaccccagtt 240 ttgttggacg aatctagagc tgctgttgct aatttgttga aggttccagt tgaaaccgtt 300 gttttcgttg ctaatgctac tatgggtgtc aacactgttt tgagaaatat cgtttggtct 360 gctgatggta aggacgaaat cttgtacttt gatacaatct acggtgcttg cggtaagacc 420 attgattatg ttatcgaaga taagaggggc atcgtttcct ctagatgtat tccattgata 480 tacccagccg aagatgatga tgttgttgca gcttttagag atgccatcaa gaagtctaga 540 gaaaggta aaagaccaag attggccgtt atcgatgttg tttcttctat gccaggtgtt 600 agattcccat tcgaagatat cgttaagatc tgcaaagagg aagagatcat ttcttgcgtt 660 gatggtgctc aaggtattgg tatggttgat ttgaagatta ccgaaaccga tccagacttc 720 ctgattcta attgtcataa gtggttgttc accccaagag gttgtgctgt tttttatgtt 780 ccagtcagaa accagcactt gatcagatct actttgccaa cttctcatgg tttcgttcca 840 caagttggta atagattcaa tccattggtt ccagctggta acaagtctgc ttttgtttct 900 aacttcgaat tcgttggtac tgtcgataac tctccattct tctgtgttaa ggatgctatt 960 aagtggcgtg aagaggtttt aggtggtgaa gaaagaatta tggagtacat gactaagttg 1020 gctagagaag gtggtcaaaa ggttgctgaa atttgggta ctagagtctt ggaaaactct 1080 accggtacat tgattagatg cgccatggtt aatattgcct tgccttttgt tgttggtgaa 1140 gatccaaaag ctccagttaa gttgaccgaa aaagaagaaa aagacgtcga aggcttgtac 1200 gaaattccac atgaagaggc tatatggct ttcaagtgga tgtacaacgt attgcaagat 1260 gagttcaata ccttcgttcc aatgaccttt catagacgta gattttgggc tagattgtcc 1320 gctcaagttt acttggaaat gtctgatttt gaatgggctg gcaagacctt aaaagaattg 1380 tgtgaaaggg ttgctaaggg cgagtacaaa gaatctgctt aa 1422 <210> 18 <211> 1581 <212> DNA <213> Artificial sequence <220> <223> DNA sequences for codon optimization targeting Saccharomyces cerevisiae <220> <221> misc_feature <222> (1)..(1581) <223> CpEgt2 DNA sequence for codon optimization targeting Saccharomyces cerevisiae <400> 18 atgggtttgt tggaaggtga agaattggtt ttgagaggta gaggtcaagg tggtgaacct 60 agaccagaaa gagaaccaga attgaagttg gaacacgttc cagaaagggc tccagatggt 120 gaaccagaaa ctgaaggtca attgggtcca agaaaagaac ctgaacataa gttggaagct 180 gaatccgaac cattgcaaga aactccacaa agagaagttt tggcttttgg tagagcttgg 240 aagtccgaatttttgtttga tccagcttgg agaaacttga accatggtag ttttggtact 300 taccccttgt acatcagaga taagttgaga gcttatcaag atcaagctga agctagacct 360 gatcacttca ttagatacga agagtccaag ttgttgcata gatctagagc tgctgttgct 420 aagatagtta atgctccatt ggataccgtt gttttcgttg gtaatgctac tgaaggtgtc 480 aacactgtct tgagaaattt gagatgggac tccttggaaa aaggtggtca aaaggatgtt 540 atcctgtctt tctctactgt ttacgaagct tgtggtaacg ctgctgatta tatcgttgaa 600 tactttgccg gtaaggttga acatagaacc atcgaattgg aatacccagt tgaagatgct 660 gatgttattg ctgctttaag aggtgctgct actcaagttg ctagagaagg taaaagggct 720 agattggcta tgatggatgt tgttacttct agaccaggtg ttgtttttcc atgggaagct 780 gcagttagag tatgtagaga attgggtatc ttgtccttgg ttgatggtgc tcaaggtgtt 840 ggtatggtta gattggattt gactgctgct gatccagatt tcttcgtttc taactgtcat 900 aagtggttgt tggttccaag aggttgtgct atgttgtata ctccagctag aactcaatgt 960 ttgttgagaa ctgctttggc tacttctcat ggttatgttc caccatctgc tgctccagct 1020 ccaccaggtt ctaaatctag atatgttgct aacttcgaat tcgttggcac tagagataat 1080 ggtccatatt tgtgtgttgc tgatgcaatt gcttggagag aacgtgtttg tggtggtgaa 1140 gaaaacatct tgagatactt gtgggctttg aacaagaagg gtattagaat tgtcgctaga 1200 gctttgggta ctacccattt ggataacgaa actgaaactt tgaccaactg tgctatgggt 1260 aatgttgctt tgccaatgag agttgatgat gaagatgcct ctactgcttt agatgctgct 1320 ccttctgctg ctattgctgc accagatgtt gttgttgcaa gagaaaatgt tgcattggtt 1380 gacaagtgga tgagagaaag attattcgat gactacaaga ccttcatgac cttgttcgtt 1440 atgcaagata gatactgggt tagactgtct gctcaaatct acttggatga acaagattat 1500 gaagccgccg gtgatatttt gaaagctttg tgtgaaagaa tcaggcgtag agaatatttg 1560 gttccacaac cagttgagta a 1581 <210> 19 <211> 1116 <212> DNA <213> Artificial sequence <220> <223> DNA sequences for codon optimization targeting Saccharomyces cerevisiae <220> <221> misc_feature <222> (1)..(1116) <223> MsEgtE DNA sequence codon-optimized for Saccharomyces cerevisiae <400> 19 atgatgttgg ctcaacaatg gagagatgct agaccaaaag tcgccggttt gcacttagat 60 tctggtgctt gctctagaca atcttttgcc gttattgacg caactactgc tcatgctagg 120 catgaagcag aagttggtgg ttatgttgca gctgaagccg ctactccagc tttagatgct 180 ggtagggctg ctgtcgcctc tttgattggt tttgctgcat cagatgttgt ttacacttct 240 ggttctaatc acgctattga tttactattg tcttcttggc caggtaaaag aactttagcc 300 tgtttgcccg gtgaatatgg tccaaatttg tctgctatgg ctgcaaatgg ttttcaagtt 360 agagctctgc cagtggatga tgatggtaga gttttggttg atgaagcttc tcatgaattg 420 tctgctcatc cagttgcctt agtccatttg accgctttgg cttctcatag aggtattgcc 480 cagccagcag ctgaattggt tgaagcttgt cataacgccg gtatcccagt tgttattgat 540 gctgcacagg cattgggcca tttagattgt aatgttggtg ctgatgcggt ctattcctcc 600 tctagaaat ggttggctgg tccaaggggt gttggtgtac tagctgttag accagaatta 660 gctgaaagat tacaaccaag aattccacca tctgattggc caatcccaat gtctgttttg 720 gaaaaattgg aattaggtga gcataacgct gctgctagag ttggtttttc tgttgctgtg 780 ggtgaacatc tcgcagctgg accaactgct gtcagggaaa gattagctga agttggtaga 840 ttatctaggc aagtcttggc tgaagttgat ggatggagag tcgtcgaacc agttgatcaa 900 ccaactgcaa ttactacttt agaatctacc gatggtgcag atccagcttc tgttagatct 960 tggttaatcg ctgaaagagg tattgttact actgcttgtg agttggctag agctccattt 1020 gaaatgagaa ctccagtcct gagaatttct ccacatgttg acgttacagt tgatgaatta 1080 gaacaatttg ctgcagcttt gagagaagct ccatga 1116 <210> 20 <211> 392 <212> PRT <213> Schizosaccharomyces pombe <400> 20 Met Ala Glu Asn Asn Val Tyr Gly His Glu Met Lys Lys His Phe Met 1 5 10 15 Leu Asp Pro Asp Tyr Val Asn Val Asn Asn Gly Ser Cys Gly Thr Glu 20 25 30 Ser Leu Ala Val Tyr Asn Lys His Val Gln Leu Leu Lys Glu Ala Gln 35 40 45 Ser Lys Pro Asp Phe Met Cys Asn Ala Tyr Met Pro Met Tyr Met Glu 50 55 60 Ala Thr Arg Asn Glu Val Ala Lys Leu Ile Gly Ala Asp Ser Ser Asn 65 70 75 80 Ile Val Phe Cys Asn Ser Ala Thr Asp Gly Ile Ser Thr Val Leu Leu 85 90 95 Thr Phe Pro Trp Glu Gln Asn Asp Glu Ile Leu Met Leu Asn Val Ala 100 105 110 Tyr Pro Thr Cys Thr Tyr Ala Ala Asp Phe Ala Lys Asn Gln His Asn 115 120 125 Leu Arg Leu Asp Val Ile Asp Val Gly Val Glu Ile Asp Glu Asp Leu 130 135 140 Phe Leu Lys Glu Val Glu Gln Arg Phe Leu Gln Ser Lys Pro Arg Ala 145 150 155 160 Phe Ile Cys Asp Ile Leu Ser Ser Met Pro Val Ile Leu Phe Pro Trp 165 170 175 Glu Lys Val Val Lys Leu Cys Lys Lys Tyr Asn Ile Val Ser Ile Ile 180 185 190 Asp Gly Ala His Ala Ile Gly His Ile Pro Met Asn Leu Ala Asn Val 195 200 205 Asp Pro Asp Phe Leu Phe Thr Asn Ala His Lys Trp Leu Asn Ser Pro 210 215 220 Ala Ala Cys Thr Val Leu Tyr Val Ser Ala Lys Asn His Asn Leu Ile 225 230 235 240 Leu Ala Pro Leu Ser Tyr Gly Tyr Gly Leu Arg Glu Lys Glu Ser 245 250 255 Ile Ala Ala Asp Thr Leu Thr Asn Arg Phe Val Asn Ser Phe Lys Gln 260 265 270 Asp Leu Pro Lys Phe Ile Ala Val Gly Glu Ala Ile Lys Phe Arg Lys 275 280 285 Ser Ile Gly Gly Glu Glu Lys Ile Gln Gln Tyr Cys His Glu Ile Ala 290,295,300 Lys Gly Ala Glu Ile Is Lys Glu Leu Gly Thr Ser Phe Ile 305 310 315 320 Lys Pro Pro Tyr Pro Val Ala Met Val Asn Val Glu Val Pro Leu Arg 325 330 335 Asn Ile Pro Ser Ile Glu Thr Gln Lys Val Phe Trp Pro Lys Tyr Asn 340 345 350 Thr Phe Leu Arg Phe Met Glu Phe Lys Gly Lys Phe Tyr Thr Arg Leu 355 360 365 Ser Gly Ala Val Tyr Leu Glu Gln Ser Asp Phe Tyr Tyr Ile Ala Lys 370 375 380 Val Ile Lys Asp Phe Cys Ser Leu 385,390 <210> 21 <211> 392 <212> PRT <213> Schizosaccharomyces pombe <400> 21 Met Ala Glu Asn Asn Val Tyr Gly His Glu Met Lys Lys His Phe Met 1 5 10 15 Leu Asp Pro Asp Tyr Val Asn Val Asn Asn Gly Ser Cys Gly Thr Glu 20 25 30 Ser Leu Ala Val Tyr Asn Lys His Val Gln Leu Leu Lys Glu Ala Gln<A 35 40 45 Ser Lys Pro Asp Phe Met Cys Asn Ala Tyr Met Pro Met Tyr Met Glu 50 分55 60 Ala Thr Arg Asn Glu Val Ala Lys Leu Ile Gly Ala Asp Ser Ser Asn 65 70 75 80 Ile Val Phe Cys Asn Ser Ala Thr Asp Gly Ile Ser Thr Val Leu Leu 85 90 95 Thr Phe Pro Trp Glu Gln Asn Asp Glu Ile Leu Met Leu Asn Val Ala 100 105 110 Tyr Pro Thr Cys Thr Tyr Ala Ala Asp Phe Ala Lys Asn Gln His Asn 115 120 125 Leu Arg Leu Asp Val Ile Asp Val Gly Val Glu Ile Asp Glu Asp Leu It should be noted that there seems to be an error in the "50 分55 60" in the original text. It is assumed to be "50 55 60" in the translation.130 135 140 Phe Leu Lys Glu Val Glu Gln Arg Phe Leu Gln Ser Lys Pro Arg Ala 145 150 155 160 Phe Ile Cys Asp Ile Leu Ser Ser Met Pro Val Ile Leu Phe Pro Trp 165 170 175 Glu Lys Val Val Lys Leu Cys Lys Lys Tyr Asn Ile Val Ser Ile Ile 180 185 190 Asp Gly Ala His Ala Ile Gly His Ile Pro Met Asn Leu Ala Asn Val 195 200 205 Asp Pro Asp Phe Leu Phe Thr Asn Ala His Lys Trp Leu Asn Ser Pro 210 215 220 Ala Ala Cys Thr Val Leu Tyr Val Ser Ala Lys Asn His Asn Leu Ile 225 230 235 240 Glu Ala Leu Pro Leu Ser Tyr Gly Tyr Gly Leu Arg Glu Lys Glu Ser 245 250 255 Ile Ala Ala Asp Thr Leu Thr Asn Arg Phe Val Asn Ser Phe Lys Gln 260 265 270 Asp Leu Pro Lys Phe Ile Ala Val Gly Glu Ala Ile Lys Phe Arg Lys 275 280 285 Ser Ile Gly Gly Glu Glu Lys Ile Gln Gln Tyr Cys His Glu Ile Ala 290 295 300 Leu Lys Gly Ala Glu Ile Ile Ser Lys Glu ...

Claims

1. A yeast cell capable of producing thioneine, the yeast cell expressing: a) a first heterologous enzyme capable of converting L-histidine and / or L-cysteine ​​into S-(histidinetrimethyl-2-yl)-L-cysteine-S-oxide; and b) a second heterologous enzyme capable of converting S-(histidinetrimethyl-2-yl)-L-cysteine-S-oxide into 2-(hydroxysulfanyl)-histidinetrimethyl inner salt; wherein the yeast cell is further capable of converting 2-(hydroxysulfanyl)-histidine trimethylolate into ergothioneine, and wherein the yeast is selected from the group consisting of Saccharomyces cerevisiae and Yarrowia lipolytica, and wherein the first heterologous enzyme and the second heterologous enzyme are: i) Egt1 (NcEgt1) from Neurospora crassa and Egt2 (CpEgt2) from Claviceps purpurea, wherein the sequence of CpEgt2 is shown in SEQ ID NO: 12; ii) NcEgt1 and Egt2 from Schizosaccharomyces pombe (SpEgt2); iii) NcEgt1 and Egt2 from Neurospora crassa (NcEgt2); iv) NcEgt1 and EgtE from Mycolicibacterium smegmatis (MsEgtE); v) Egt1 (SpEgt1) and NcEgt2 from Schizosaccharomyces pombe; vi) SpEgt1 and SpEgt2; vii) SpEgt1 and CpEgt2; viii) SpEgt1 and MsEgtE; ix) Egt1 (CpEgt1) and NcEgt2 from ergot fungus, wherein the sequence of CpEgt1 is shown in SEQ ID NO: 6; x) CpEgt1 and MsEgtE.

2. The yeast cell of claim 1, wherein the first heterologous enzyme and the second heterologous enzyme are: i) NcEgt1 and CpEgt2; ii) NcEgt1 and SpEgt2; iii) NcEgt1 and NcEgt2; iv) NcEgt1 and MsEgtE; v) CpEgt1 and MsEgtE.

3. The yeast cell of claim 1, wherein the yeast cell further expresses or overexpresses an ergothioneine transporter.

4. The yeast cell of claim 3, wherein the ergothioneine transporter is a heterologous ergothioneine transporter.

5. The yeast cell of claim 4, wherein the heterologous ergothioneine transporter is MsErgT encoded by SEQ ID NO: 35 or HsSLC22A4 encoded by SEQ ID NO:

36.

6. The yeast cell according to any one of claims 1 to 5, wherein the yeast cell is capable of producing ergothioneine in a total titer of at least 1 mg / L, wherein the total titer is the sum of the intracellular ergothioneine titer and the extracellular ergothioneine titer.

7. The yeast cell of claim 6, wherein the total titer is at least 2 mg / L.

8. The yeast cell of claim 6, wherein the total titer is at least 3 mg / L.

9. The yeast cell of claim 6, wherein the total titer is at least 4 mg / L.

10. The yeast cell of claim 6, wherein the total titer is at least 5 mg / L.

11. The yeast cell of claim 6, wherein the total titer is at least 6 mg / L.

12. The yeast cell of claim 6, wherein the total titer is at least 7 mg / L.

13. The yeast cell of claim 6, wherein the total titer is at least 8 mg / L.

14. The yeast cell of claim 6, wherein the total titer is at least 9 mg / L.

15. The yeast cell of claim 6, wherein the total titer is at least 10 mg / L.

16. The yeast cell of claim 6, wherein the total titer is at least 11 mg / L.

17. The yeast cell of claim 6, wherein the total titer is at least 12 mg / L.

18. The yeast cell of claim 6, wherein the total titer is at least 13 mg / L.

19. The yeast cell of claim 6, wherein the total titer is at least 14 mg / L.

20. The yeast cell of claim 6, wherein the total titer is at least 15 mg / L.

21. The yeast cell of claim 6, wherein the total titer is at least 20 mg / L.

22. The yeast cell of claim 6, wherein the total titer is at least 25 mg / L.

23. The yeast cell of claim 6, wherein the total titer is at least 30 mg / L.

24. The yeast cell of claim 6, wherein the total titer is at least 35 mg / L.

25. The yeast cell of claim 6, wherein the total titer is at least 40 mg / L.

26. The yeast cell of claim 6, wherein the total titer is at least 45 mg / L.

27. The yeast cell of claim 6, wherein the total titer is at least 50 mg / L.

28. The yeast cell of claim 6, wherein the total titer is at least 100 mg / L.

29. The yeast cell of claim 6, wherein the total titer is at least 150 mg / L.

30. The yeast cell of claim 6, wherein the total titer is at least 200 mg / L.

31. The yeast cell of claim 6, wherein the total titer is at least 300 mg / L.

32. The yeast cell of claim 6, wherein the total titer is at least 400 mg / L.

33. The yeast cell of claim 6, wherein the total titer is at least 500 mg / L.

34. The yeast cell of claim 6, wherein the total titer is at least 600 mg / L.

35. The yeast cell of claim 6, wherein the total titer is at least 700 mg / L.

36. The yeast cell of claim 6, wherein the total titer is at least 800 mg / L.

37. The yeast cell of claim 6, wherein the total titer is at least 900 mg / L.

38. The yeast cell of claim 6, wherein the total titer is at least 1 g / L.

39. The yeast cell of claim 1, wherein: i. The sequence of NcEgt1 is SEQ ID NO: 2; ii. The sequence of SpEgt1 is SEQ ID NO: 4; iii. The sequence of NcEgt2 is SEQ ID NO: 8; iv. The sequence of SpEgt2 is SEQ ID NO: 10; v. The sequence of MsEgtE is SEQ ID NO:

14.

40. A method for producing ergothioneine in a yeast cell, comprising the steps of: i) providing a yeast cell capable of producing ergothioneine, the yeast cell expressing: a) a first heterologous enzyme capable of converting L-histidine and / or L-cysteine ​​into S-(histidinetrimethyl-2-yl)-L-cysteine-S-oxide; and b) a second heterologous enzyme capable of converting S-(histidinetrimethyl-2-yl)-L-cysteine-S-oxide into 2-(hydroxysulfanyl)-histidinetrimethyl inner salt; wherein the yeast cell is further capable of converting 2-(hydroxysulfanyl)-histidine trimethylolate into ergothioneine; ii) culturing the yeast cells in a culture medium; Thus, ergothioneine is obtained. The yeast cell is the yeast cell of any one of claims 1 to 39.

41. The method of claim 40, wherein the yeast cell is a GRAS organism.

42. The method of claim 40, wherein the yeast cell comprises a first nucleic acid encoding a first heterologous enzyme and / or a second nucleic acid encoding a second heterologous enzyme.

43. The method of any one of claims 40 to 42, wherein the culture medium comprises at least one amino acid.

44. The method of claim 43, wherein the at least one amino acid is histidine, cysteine, or methionine.

45. The method of claim 44, wherein the histidine is L-histidine, the cysteine ​​is L-cysteine, or the methionine is L-methionine.

46. ​​The method of any one of claims 40 to 42, wherein the culture medium comprises at least one amino acid at a concentration of at least 0.1 g / L.

47. The method of claim 46, wherein the concentration of the at least one amino acid is at least 0.2 g / L.

48. The method of claim 46, wherein the concentration of the at least one amino acid is at least 0.3 g / L.

49. The method of claim 46, wherein the concentration of the at least one amino acid is at least 0.4 g / L.

50. The method of claim 46, wherein the concentration of the at least one amino acid is at least 0.5 g / L.

51. The method of claim 46, wherein the concentration of the at least one amino acid is at least 0.75 g / L.

52. The method of claim 46, wherein the at least one amino acid is at a concentration of at least 1 g / L.

53. The method of claim 46, wherein the concentration of the at least one amino acid is at least 2 g / L.

Images