A promoter whose expression intensity is regulated by bacterial intracellular polyhydroxy fatty acid ester (PHA) synthesis and its applications
By designing a promoter whose expression intensity is regulated by PHA synthesis, the problems of expression attenuation and accumulation of toxic intermediates during PHA fermentation were solved, achieving efficient synthesis and fermentation optimization of PHA, and improving the yield of final products and cell viability.
Patent Information
- Application Number
- CN202111656934.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-12-31
- Publication Date
- 2025-12-02
- Estimated Expiration
- 2041-12-31
AI Technical Summary
In existing technologies, promoter expression gradually weakens in the later stages of PHA fermentation, affecting the yield of the final product. Furthermore, the accumulation of toxic intermediates and premature expression of cell deformation genes in the early stages of fermentation lead to production stress, affecting cell division and proliferation.
A promoter was designed whose expression intensity is regulated by PHA synthesis and gradually increases. This promoter was used to construct an expression vector to simultaneously synthesize PHA and related products. Through regulation of the PhaR binding site, high expression in the later stage of fermentation and rapid conversion of toxic intermediate products in the early stage of fermentation were achieved.
It increased the final yield of PHA, reduced the production pressure in the early stage of fermentation, enhanced the cell's survival ability and ability to synthesize products, and optimized the fermentation effect.
Smart Images

Figure CN113999869B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of PHA synthesis technology, specifically to a promoter whose expression intensity is regulated by bacterial intracellular polyhydroxy fatty acid ester (PHA) synthesis and its application. Background Technology
[0002] Poly(hydroxybutyrate) (PHA) is a high-molecular-weight polyester that can be synthesized and accumulated intracellularly by many bacteria. After extraction and processing, its properties are comparable to those of polyethylene and polystyrene, making it a potential alternative to petroleum-based plastics. Furthermore, due to its biodegradable nature, PHA can be degraded by microorganisms in nature, and its development as a plastic product could address environmental issues such as white pollution and microplastics. Depending on its constituent monomers, PHA exhibits different material properties, allowing for applications in packaging materials, medical devices, organic agriculture, and advanced materials. Based on its constituent monomers, PHA can be categorized into short-chain PHAs with monomer carbon chains of 6 or fewer carbons, such as poly(3-hydroxybutyrate) (P3HB), poly(4-hydroxybutyrate) (P4HB), and poly(3-hydroxyvalerate) (P3HV); and medium- to long-chain PHAs composed of monomers with carbon chains of 6 or more carbons, such as poly(3-hydroxyhexanoate) (P3HHx).
[0003] As an intracellular product derived from biological fermentation, PHA is an important strategy for reducing fermentation costs and increasing the value of fermentation products through co-production fermentation with other extracellular products. Common co-products include amino acids, inositol, tetrahydropyrimidine, 1,3-propanediol, 3-hydroxypropionic acid, 1,5-pentanediamine, and 5-aminolevulinic acid (ALA).
[0004] Producing various secreted enzymes in bacteria can expand their adaptability to different substrates, develop their ability to utilize inexpensive carbon sources, and reduce industrial production costs. Designing enzymes that can be produced simultaneously with the fermentation process is significant for optimizing fermentation conditions and improving fermentation efficiency.
[0005] As an intracellular product, the yield of PHA fermentation is influenced by cell volume. Increasing cell volume synchronously with fermentation can promote PHA production. Genes related to cell volume regulation are often closely linked to cell division; premature regulation of these gene expression can affect cell division and proliferation, thus impacting the yield of the final product. Therefore, regulating the expression of these genes in later stages is significant.
[0006] In the later stages of bacterial fermentation, the expression of many promoters gradually weakens. However, in actual production, it is necessary to increase expression levels significantly in the later stages when there is a large cell mass, which can significantly improve the yield of the final product. PhaP protein is a PHA particle-binding protein, and its expression level is directly related to PHA synthesis. This ensures that it is gradually expressed during PHA synthesis and does not gradually weaken as fermentation progresses. Therefore, utilizing... phaP The promoter can be developed into a high-expression tool for later stages.
[0007] Meanwhile, in the later stages of fermentation, this promoter can be used in combination with various regulatory factor expression elements to achieve the inhibitory effect on specific genes in the later stages of fermentation, thereby increasing the yield of the main product. Summary of the Invention
[0008] To improve existing PHA fermentation processes and reduce fermentation costs, this invention provides a promoter whose expression intensity is regulated by PHA synthesis; that is, the promoter strength gradually increases with the accumulation of PHA. By preparing this promoter into an expression vector, PHA and other related products, such as products related to PHA synthesis, enzymes, and products related to cell deformation, can be synthesized simultaneously. Using the promoter or expression vector described in this application to construct recombinant bacteria can enhance their survival ability and product synthesis capacity. Specifically,
[0009] In a first aspect, the present invention provides an expression vector comprising a promoter and a nucleotide sequence encoding PhaR (PHA particle regulatory protein), wherein the promoter comprises a PhaR binding site.
[0010] In one specific embodiment of the present invention, the binding site of PhaR comprises the nucleotide sequence shown in SEQ ID NO: 5, or is a mutant of SEQ ID NO: 5.
[0011] The promoter can be selected from conventional promoters in the prior art, as long as the promoter contains a PhaR binding site and has promoter activity. Preferably, the promoter is selected from... phaP1 , phaP2 , phaP3 Or porin-R, where porin-R is the binding site of PhaR added to the porin promoter or its mutant.
[0012] Preferred, porin Promoter mutants include but are not limited to porin-203 , porin-211 , porin-42 or porin-140 Any one of them.
[0013] In one specific embodiment of the present invention, the promoter is phaP1 Its nucleotide sequence contains SEQ ID NO: 1 or contains a nucleotide sequence that has more than 80% homology with SEQ ID NO: 1 and has the same or similar activity.
[0014] In one specific embodiment of the present invention, the promoter is phaP2 Its nucleotide sequence contains SEQ ID NO:2 or contains a nucleotide sequence that has more than 80% homology with SEQ ID NO:2 and has the same or similar activity.
[0015] In one specific embodiment of the present invention, the promoter is phaP3 Its nucleotide sequence contains SEQ ID NO:3 or contains a nucleotide sequence that has more than 80% homology with SEQ ID NO:3 and has the same or similar activity.
[0016] In one specific embodiment of the present invention, the promoter is porin-R, whose nucleotide sequence includes SEQ ID NO: 6 or includes a nucleotide sequence that has more than 80% homology with SEQ ID NO: 6 and has the same or similar activity.
[0017] The expression vector described herein is capable of replication, transcription, and translation within host cells. Therefore, it also contains other conventional expression elements, such as terminators, restriction enzyme sites, etc.
[0018] Preferably, the expression vector can be a prokaryotic expression vector or a eukaryotic expression vector, and is preferably a prokaryotic expression vector.
[0019] Preferably, the expression vector is a plasmid.
[0020] Preferably, the expression vector further comprises genes encoding the product synthesis pathway.
[0021] The product comprises PHA or monomers constituting PHA. The PHA is selected from homopolymers of 3-hydroxybutyric acid (PHB), binary copolymers of 3-hydroxybutyric acid and 4-hydroxybutyric acid (P3HB4HB), terpolymers of 3-hydroxybutyric acid, 4-hydroxybutyric acid, and 3-hydroxyvalerate (PHBV4HB), binary copolymers of 3-hydroxybutyric acid and 3-hydroxyhexanoate (PHBHHx), homopolymers or copolymers of 3-hydroxypropionic acid, wherein the homopolymer of 3-hydroxypropionic acid is P3HP, and the copolymer of 3-hydroxypropionic acid is P(3HB-co-3HP) or PHBHP; the monomers constituting PHA are selected from 3-hydroxybutyryl-CoA, 4-hydroxybutyryl-CoA, 3-hydroxyvalerate-CoA, 5-hydroxyvalerate-CoA, 3-hydroxyhexanoate-CoA, or 6-hydroxyhexanoate-CoA.
[0022] The product comprises:
[0023] a) Products co-produced with PHA and enzymes related to the production of products co-produced with PHA, wherein the products co-produced with PHA are selected from amino acids, inositol, tetrahydropyrimidine, 1,3-propanediol, 3-hydroxypropionic acid, 1,5-pentanediamine or 5-aminolevulinic acid.
[0024] b) An enzyme secreted outside the cell, selected from lipases, amylases, saccharifying enzymes, proteases, cellulases, esterases, glucans, pectinases, phospholipases, gelatinases, or nucleases (e.g., DNases or RNases).
[0025] c) Cell morphology-related proteins, selected from tubulin FtsZ, cytoskeletal protein MreB, or cell division regulator MinCD; or,
[0026] d) Proteins or RNAs related to intracellular gene regulation, selected from lactose operon repressor protein LacI, tetracycline operon repressor protein TetR, or sgRNA used in CRISPRi / CRISPRa, etc.
[0027] The product also includes various extracellular small molecule products and / or various extracellular hydrolases.
[0028] Preferably, the promoter expression product can be expressed on an expression vector or on the genome.
[0029] In a second aspect, the present invention provides an expression vector composition comprising one or more first expression vectors and one or more second expression vectors, wherein the first expression vector comprises a first promoter, the second expression vector comprises a second promoter, the first promoter and / or the second promoter comprises a PhaR binding site, and the first expression vector and / or the second expression vector comprises a nucleotide sequence encoding PhaR. Preferably, the PhaR binding site comprises the nucleotide sequence shown in SEQ ID NO: 5.
[0030] Preferably, the promoter containing the PhaR binding site is selected from... phaP1 , phaP2 , phaP3 Or porin-R, wherein porin-R is in porin Add a phaR binding site to the promoter or its mutant.
[0031] Preferred, porin Promoter mutants include but are not limited to porin-203 , porin-211 , porin-42 orporin-140 Any one of them.
[0032] In the expression vector composition:
[0033] i) The first expression vector contains a gene encoding a product synthesis pathway, wherein the product is PHA or a monomer constituting PHA; the second expression vector contains a gene encoding a product synthesis pathway, wherein the product is selected from:
[0034] a) Products co-produced with PHA and enzymes related to the production of products co-produced with PHA, wherein the products co-produced with PHA are selected from amino acids, inositol, tetrahydropyrimidine, 1,3-propanediol, 3-hydroxypropionic acid, 1,5-pentanediamine or 5-aminolevulinic acid.
[0035] b) Enzymes secreted outside the cell, selected from lipase, amylase, saccharifying enzyme, protease, cellulase, esterase, glucanase, pectinase, phospholipase, gelatinase or nuclease;
[0036] c) Cell morphology-related proteins, selected from tubulin FtsZ, cytoskeletal protein MreB, or cell division regulator MinCD; or,
[0037] d) Proteins or RNAs related to intracellular gene regulation, selected from lactose operon repressor protein LacI, tetracycline operon repressor protein TetR, or sgRNA used in CRISPRi / CRISPRa, etc.
[0038] ii) The second expression vector contains a gene encoding a product synthesis pathway-related gene, wherein the product is PHA or a monomer constituting PHA; the first expression vector contains a gene encoding a product synthesis pathway-related gene, wherein the product is selected from:
[0039] a) Products co-produced with PHA and enzymes related to the production of products co-produced with PHA, wherein the products co-produced with PHA are selected from amino acids, inositol, tetrahydropyrimidine, 1,3-propanediol, 3-hydroxypropionic acid, 1,5-pentanediamine or 5-aminolevulinic acid.
[0040] b) Enzymes secreted outside the cell, selected from lipase, amylase, saccharifying enzyme, protease, cellulase, esterase, glucanase, pectinase, phospholipase, gelatinase or nuclease;
[0041] c) Cell morphology-related proteins, selected from tubulin FtsZ, cytoskeletal protein MreB, or cell division regulator MinCD. These are used to achieve the gradual deformation required during cell growth; or...
[0042] d) Proteins or RNAs related to intracellular gene regulation, selected from lactose operon repressor protein LacI, tetracycline operon repressor protein TetR, or sgRNA used in CRISPRi / CRISPRa, etc.
[0043] A third aspect of the present invention provides a promoter, said promoter being in porin Add a PhaR binding site to the promoter or its mutant.
[0044] Preferred, porin Promoter mutants include but are not limited to porin-203 , porin-211 , porin-42 or porin-140 Any one of them.
[0045] In one specific embodiment of the present invention, the nucleotide sequence of the promoter contains SEQ ID NO: 6.
[0046] In a fourth aspect, the present invention provides a regulatory element comprising a promoter and a nucleotide sequence encoding PhaR, wherein the promoter comprises a PhaR binding site. The PhaR binding site comprises the nucleotide sequence shown in SEQ ID NO: 5.
[0047] In a fifth aspect, the present invention provides a backbone vector comprising a promoter and a nucleotide sequence encoding PhaR, wherein the promoter comprises a PhaR binding site. The PhaR binding site comprises the nucleotide sequence shown in SEQ ID NO: 5.
[0048] In a sixth aspect, the present invention provides a cell comprising the above-described expression vector, expression vector composition, promoter, regulatory element, or backbone vector.
[0049] In a seventh aspect, the present invention provides a cell comprising the above-described expression vector, expression vector composition, promoter, regulatory element, scaffold vector, or cell in the production of PHA or the production of monomers constituting PHA or the production of PHA-related products or the production of proteins related to cell morphology or the production of proteins or RNA related to intracellular gene regulation.
[0050] An eighth aspect of the present invention provides a recombinant bacterium, said recombinant bacterium comprising:
[0051] A) The aforementioned expression carriers;
[0052] B) The above-mentioned expression vector composition;
[0053] C) The promoters mentioned above;
[0054] D) The aforementioned skeletal carrier; or,
[0055] E) The aforementioned control elements.
[0056] Preferably, the recombinant bacteria are eukaryotic microorganisms and / or prokaryotic microorganisms. The prokaryotic microorganisms include, but are not limited to, any one of *Escherichia coli*, *Eubacterium roximatee*, *Bacillus*, *Corynebacterium glutamicum*, *Alcaligenes megaterium*, *Pseudomonas*, *Aeromonas*, or halophilic bacteria. The eukaryotic microorganisms include, but are not limited to, any one of yeast, fungi, or algae.
[0057] In one specific embodiment of the present invention, the recombinant bacteria are selected from Escherichia coli and Escherichia louvelii (E. coli). Ralstonia eutropha Also called Alcaligenes eutrophus , Cupriavidus necator ), Alcaligenes megaterium ( [[ID= ), Pseudomonas spp. .), Aeromonas spp. ( ), Halophilic Monotrophus ( ).
[0058] The halophilic bacteria mentioned are of the genus *Halotrophomonas*. In one specific embodiment of the present invention, the halophilic bacteria include, but are not limited to, *Halotrophomonas*, and include, but are not limited to, *Halotrophomonas*. TD01 CGMCC. No.4353, LS21 CGMCC No. 6593 or M1CGMCC NO.19880.
[0059] A ninth aspect of the present invention provides a method for preparing the above-described recombinant bacteria, the method comprising introducing the above-described expression vector, the above-described expression vector composition, the above-described promoter, the above-described backbone vector, or the above-described regulatory element into the recombinant bacteria.
[0060] Preferably, the expression vector integrates the promoter into the recombinant bacterial genome or the expression vector is free in the recombinant bacteria.
[0061] In a tenth aspect, the present invention provides a fermentation method comprising fermenting and culturing the recombinant bacteria described above.
[0062] Preferably, the fermentation product is PHA or a monomer that constitutes PHA.
[0063] Preferably, the fermentation products also include, but are not limited to:
[0064] a) Products co-produced with PHA and enzymes related to the production of products co-produced with PHA, wherein the products co-produced with PHA are selected from amino acids, inositol, tetrahydropyrimidine, 1,3-propanediol, 3-hydroxypropionic acid, 1,5-pentanediamine or 5-aminolevulinic acid.
[0065] b) Enzymes secreted outside the cell, selected from lipase, amylase, saccharifying enzyme, protease, cellulase, esterase, glucanase, pectinase, phospholipase, gelatinase or nuclease;
[0066] c) Cell morphology-related proteins, selected from tubulin FtsZ, cytoskeletal protein MreB, or cell division regulator MinCD; or,
[0067] d) Proteins or RNAs related to intracellular gene regulation, selected from lactose operon repressor protein LacI, tetracycline operon repressor protein TetR, or sgRNA used in CRISPRi / CRISPRa, etc.
[0068] Preferably, the fermentation medium is a conventional medium or the composition of the medium is appropriately adjusted to suit the survival of microorganisms and the production of products.
[0069] Preferably, the fermentation conditions can be adjusted appropriately according to the specific recombinant bacteria.
[0070] Preferably, the fermentation equipment can be a shake flask, a small-scale fermenter, a pilot-scale fermenter, or a large-scale industrial fermenter.
[0071] In an eleventh aspect, the present invention provides a method for producing PHA, the method comprising fermenting and culturing the recombinant bacteria described above.
[0072] A twelfth aspect of the present invention provides a method for producing lysine, the method comprising fermenting and culturing the aforementioned recombinant bacteria. Preferably, the recombinant bacteria is *Eubacterium roximatee* containing... The above-mentioned expressive carriers.
[0073] In a thirteenth aspect of the present invention, a method for co-producing PHA and lysine is provided, the method comprising fermenting and culturing the aforementioned recombinant bacteria. Preferably, the recombinant bacteria is *Eubacterium roximatee* containing... The above-mentioned expressive carriers.
[0074] A fourteenth aspect of the present invention provides a method for producing threonine, the method comprising fermenting and culturing the aforementioned recombinant bacteria. Preferably, the recombinant bacteria is a culture medium for producing threonine. M1 or Importing campaniensis LS21 contains The above-mentioned expressive carriers.
[0075] A fifteenth aspect of the present invention provides a method for co-producing PHA and threonine, the method comprising fermenting and culturing the aforementioned recombinant bacteria. Preferably, the recombinant bacteria is a culture medium for the production of PHA and threonine. M1 or Importing in LS21 includes The above-mentioned expressive carriers.
[0076] A sixteenth aspect of the present invention provides a method for producing tetrahydropyrimidine, the method comprising fermenting and culturing the aforementioned recombinant bacteria. Preferably, the recombinant bacteria is a culture medium for the production of tetrahydropyrimidine. Importing in TD01 includes The above-mentioned expressive carriers.
[0077] A seventeenth aspect of the present invention provides a method for the co-production of PHA and tetrahydropyrimidine, the method comprising fermenting and culturing the aforementioned recombinant bacteria. Preferably, the recombinant bacteria is a culture medium for the production of PHA and tetrahydropyrimidine. Importing TD01 contains The above-mentioned expressive carriers.
[0078] An eighteenth aspect of the present invention provides a method for producing amylase, the method comprising fermenting and culturing the aforementioned recombinant bacteria. Preferably, the recombinant bacteria are... Importing TD01 contains The above-mentioned expressive carriers.
[0079] A nineteenth aspect of the present invention provides a method for co-producing PHA and amylase, the method comprising fermenting and culturing the aforementioned recombinant bacteria. Preferably, the recombinant bacteria is a culture medium for the production of PHA and amylase. Importing TD01 contains The above-mentioned expression vector, or the introduction of a substance containing [the above-mentioned expression vector] into Escherichia coli. The above-mentioned expression carriers and containing , and The carrier of expression.
[0080] A twentieth aspect of the present invention provides a method for producing 1,5-pentanediamine, the method comprising fermenting and culturing the aforementioned recombinant bacteria. Preferably, the recombinant bacteria is *Eubacterium roximatee* containing... The above-mentioned expressive carriers.
[0081] In a twenty-first aspect, the present invention provides a method for the co-production of PHA and 1,5-pentanediamine, the method comprising fermenting and culturing the aforementioned recombinant bacteria. Preferably, the recombinant bacteria is *Eubacterium roximatee* containing... The above-mentioned expressive carriers.
[0082] In a twenty-second aspect, the present invention provides a method for producing 3-hydroxypropionic acid, the method comprising fermenting and culturing the recombinant bacteria described above. Preferably, the recombinant bacteria is prepared by introducing into *Alcaligenes megaterium*, *Pseudomonas*, or *Aeromonas* species the recombinant bacteria containing... and / or The above-mentioned expressive carriers.
[0083] In a twenty-third aspect, the present invention provides a method for co-producing PHA and 3-hydroxypropionic acid, the method comprising fermenting and culturing the aforementioned recombinant bacteria. Preferably, the recombinant bacteria is prepared by introducing into *Alcaligenes megaterium*, *Pseudomonas*, or *Aeromonas* species the recombinant bacteria containing... and / or The above-mentioned expressive carriers.
[0084] A twenty-fourth aspect of the present invention provides a method for promoting cell growth, the method comprising fermenting and culturing the aforementioned recombinant bacteria. Preferably, the recombinant bacteria are... Importing TD01 contains The above-mentioned expressive carriers.
[0085] A twenty-fifth aspect of the present invention provides a method for increasing cell volume, the method comprising fermenting and culturing the aforementioned recombinant bacteria. Preferably, the recombinant bacteria are... Importing TD01 contains The above-mentioned expressive carriers.
[0086] Using the promoter described in this application for fermentation production can improve fermentation results through four pathways:
[0087] 1) A self-excited expression circuit is formed to self-excite the gene for PHA synthesis, thereby further increasing intracellular production. For example, by using the promoter described in this application to overexpress the gene related to PHA synthesis, the expression level of the promoter gradually increases as PHA accumulates, and the increased expression level of the promoter leads to greater accumulation of PHA, thus forming a self-excited expression circuit.
[0088] 2) Overcoming the accumulation of toxic metabolic intermediates in the early stages of fermentation, achieving rapid conversion of toxic intermediate metabolites. For example, SSD, an intermediate product in the PHA synthesis process, is toxic. By using the promoter described in this application to overexpress SucD, and simultaneously overexpressing 4HbD and OrfZ, SSD can be quickly converted into PHA monomers and then synthesized into PHA, thus reducing toxicity.
[0089] 3) To avoid metabolic stress on bacteria due to excessive expression of certain proteins in the early stages of fermentation, which could affect bacterial growth. For example, to reduce the stress on bacteria from overexpressing amylase in the early stages of fermentation, the promoter described in this application is used for overexpression. Gene.
[0090] 4) Avoid premature expression of genes that cause cell deformation, which could affect cell division. In the production of PHA, deformation in the later stages of fermentation can increase the final yield and reduce extraction difficulty. For example, overexpression using the promoter described in this application... The solution lies in genes.
[0091] The “PHA” described in this invention refers to homopolymer PHA and / or copolymer PHA. Preferably, the PHA is selected from homopolymers or copolymers of 3-hydroxybutyric acid (3HB) PHB, binary copolymers of 3-hydroxybutyric acid (3HB) and 4-hydroxybutyric acid (4HB) P3HB4HB, terpolymers of 3-hydroxybutyric acid (3HB), 4-hydroxybutyric acid (4HB) and 3-hydroxyvalerate P(3HB-co-4HB-co-3HV), binary copolymers of 3-hydroxybutyric acid (3HB) and 3-hydroxyhexanoate PHBHHx, and homopolymers or copolymers of 3-hydroxypropionic acid (3HP). Preferably, the homopolymer of 3-hydroxypropionic acid (3HP) is P3HP, and preferably, the copolymer of 3-hydroxypropionic acid (3HP) is P(3HB-co-3HP) or PHBHP. In one specific embodiment of the present invention, the PHA is selected from 3-hydroxybutyric acid homopolymer PHB, 3-hydroxybutyric acid and 4-hydroxybutyric acid binary copolymer P3HB4HB, 3-hydroxybutyric acid, 4-hydroxybutyric acid and 3-hydroxyvalerate terpolymer PHBV4HB, 3-hydroxybutyric acid and 3-hydroxyhexanoic acid binary copolymer PHBHHx, and homopolymers or copolymers of 3-hydroxypropionic acid, wherein the homopolymer of 3-hydroxypropionic acid is P3HP, and the copolymer of 3-hydroxypropionic acid is P(3HB-co-3HP) or PHBHP.
[0092] The "monomers constituting PHA" described in this invention include, but are not limited to, 3-hydroxybutyryl-CoA (3HB-CoA), 4-hydroxybutyryl-CoA (4HB-CoA), 3-hydroxyvaleryl-CoA (3HV-CoA), 5-hydroxyvaleryl-CoA (5HV-CoA), 3-hydroxyhexanoyl-CoA (3HHx-CoA), and 6-hydroxyhexanoyl-CoA (6HHx-CoA).
[0093] The term "comprising" or "including" as used in this invention is an open-ended expression. When used to describe the sequence of a protein or nucleic acid, the protein or nucleic acid may be composed of the sequence, or may have additional amino acids or nucleotides at one or both ends of the protein or nucleic acid, but still have the same or similar activity as the original sequence. Attached Figure Description
[0094] The embodiments of the present invention will now be described in detail with reference to the accompanying drawings, wherein:
[0095] : Use The cell elongation phenotype after promoter expression of MinCD.
[0096] : Use The phenotype of increased cell volume after LacI promoter expression. Detailed Implementation
[0097] The following examples are provided to better understand the present invention, but are not intended to limit the invention. Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0098] Example 1: Properties and identification of series promoters
[0099] I. In middle and Prediction of promoters
[0100] PhaP is a PHA granule-binding protein (Phasin) found in Halomonas bacteria. There are three in the genome. Genes, respectively , , There is also a gene regulating the synthesis of a PHA protein. These three and The expression intensity varies, and can be selected according to the needs of subsequent gene expression. Among them, Strength of series promoters, The strongest Secondly, Weakest. Promoter prediction upstream of the open reading frames of these four genes can determine their specific locations. Details are as follows:
[0101] The promoter in The sequence located 109 bases upstream of the open reading frame, along with the subsequent regulatory sequence, is as follows: SEQ ID NO: 1:
[0102] ggttgttgttgtcggtggctagtcgcaatgttatgaaaaaatcatgttgcgctgcacaaaaagcactgctagctttgttgttagtaaaggcaaccgcctgatcatcgaccgctcatcgatgcgtgtcgaatcgctagctcacttaaggagattatgtg
[0103] The promoter in The sequence at position 79 upstream of the open reading frame and the subsequent regulatory sequence are as follows, SEQ ID NO: 2:
[0104] atgttgcactgcacaaaaccccctgttatgctgcaacgCaagataactagatatcagctgcggtgggtgcttaacaaaaccgttgctgatcaaccaacactaacggcaccgtcaatca
[0105] The promoter in The sequence located 446 bases upstream of the open reading frame, along with the subsequent regulatory sequence, is as follows: SEQ ID NO: 3:
[0106] cagcacggtgcgcttggcgtaacgctgctacactctaggaagatggttaaggagtcgcctatgaaaatcaacgttgaatttgacttgacaccggatgagtttcgccaatcgctagggctgcc ggatgttgaggcgtttcagcaaaacctgctggaaaacattcagcggcaaatggaatctggggtggatggctatgaccccatgaatctaatgcgaccttttctgcagcagccaatgatgcagca gggagtctcgcaagggctggctaatttcggcacgtatcaacagatgatgttggatatgttgcgcaaagcgggaacctcaggcggcagtgctgaacaggatagcgacacgagccaagacgagtc ccaagaagcagctaaaccaaagccagcagcatcaggtaaaagcgcatcaagtgcgagaagctccaaagcgaaagcgacagcttcttcgcgttctcgcgctaaagggtagaaatgtaatgtgaa
[0107] The promoter in The sequence at position 37 upstream of the open reading frame and the subsequent regulatory sequence are as follows, SEQ ID NO: 4:
[0108] gcttgcataggcgcatgttgcaggcacaatagcagcaacggcgacaaagcctctaccgcgtttaaggagatgcgcta
[0109] II. middle promoter and Prediction and validation of PhaR binding regions in promoters
[0110] 1. In PhaR Regulation verification
[0111] The phaP-GFP labeled strains can exhibit significant green fluorescence when producing PHA, but almost no fluorescence when not producing PHA. When cultured on LB60 plates, due to the lack of compliance with the high-carbon, low-nitrogen culture strategy for PHA production, a large amount of PHA will not accumulate intracellularly, and no fluorescence will be observed on the plates at this time.
[0112] Knockout Subsequently, the bacterial cells showed obvious fluorescence on LB60 plates, proving that... The promoter is regulated by RhaR repression; knockout This allows it to be independent of PHA synthesis, and fluorescence appears when PHA is not synthesized. In other words, the control of PhaR is... The promoter is crucial for the regulation of PHA synthesis.
[0113] 2. In middle phaR and phaP And verification of its own promoter region binding site
[0114] Footprint experiments have confirmed that phaR and phaP The binding sites of its own promoter region are:
[0115] SEQ ID NO: 5: atgttgc
[0116] In summary, the experimental results show that phaP The positions of the series of promoters, and their nucleotide sites dependent on SEQ ID NO: 5, are regulated at the transcriptional level by the PhaR protein. Subsequent experiments were designed based on this.
[0117] Example 2: In Halomonas bluephagenesis China utilizes phaP Series promoters for PHA production
[0118] Halomonas bluephagenesis As a natural PHA-producing strain, it can accumulate large amounts of PHA intracellularly and utilize... phaP A series of promoters are used to overexpress the gene that produces PHA, which mainly improves PHA production in two ways.
[0119] 1) Form a self-excited expression circuit to overexpress the gene that synthesizes PHA, thereby further increasing the intracellular yield.
[0120] 2) Overcome the accumulation of toxic metabolic intermediates in the early stage of fermentation and achieve rapid conversion of toxic intermediate metabolites.
[0121] 1. In Halomonas bluephagenesis China utilizes phaP1 Promoter production of poly-3-hydroxy fatty acid esters (P3HB)
[0122] The enzymes required for the production of P3HB include acetyl-CoA acetyltransferase (PhaA), 3-hydroxybutyryl-CoA dehydrogenase (PhaB), and PHA synthase (PhaC). During the synthesis of PHA, the production of P3HB is self-inducible by overexpressing these synthases.
[0123] The experimental scheme is as follows: Halomonas bluephagenesis In TD01, a plasmid pSEVA341 was used to construct... phaP1 Startup sub-connection phaA , phaB and phaC There are a total of 9 different combinations of genes or their arbitrary combinations, and the specific experimental data are shown in Table 1. It can be seen that expressing PhaA, PhaB, PhaC proteins or their combinations through self-excitation using this promoter can increase PHA content and cell dry weight levels.
[0124] Table 1: In Halomonas bluephagenesis China utilizes phaP1 Promoter overexpression phaCAB
[0125]
[0126] 2. In Halomonas bluephagenesis China utilizes phaP2 Promoter production of poly(3-hydroxybutyric acid-4-hydroxybutyric acid) copolyester
[0127] Poly(3-hydroxybutyric acid-4-hydroxybutyric acid) copolyester [P(3HB- co [P(3HB-4HB)] is a binary polyester, compared to P3HB which is composed solely of 3-hydroxy fatty acids. co P(3HB-) has better ductility, and its Young's modulus gradually increases with the increase of the proportion of 4-hydroxy fatty acids (4HB). Therefore, the production of P(3HB-) co In the production of (-4HB), increasing the proportion of 4HB is of great significance.
[0128] The production of 4HB monomer originates from succinyl-CoA in the tricarboxylic acid cycle. It requires the synthesis of 4-hydroxybutyryl-CoA (4HB-CoA) via succinate semialdehyde dehydrogenase (SucD), 4-hydroxybutyrate dehydrogenase (4HbD), and 4-hydroxybutyryl-CoA reductase (OrfZ). 4HB-CoA can be recognized by phac and synthesized into P(3HB- co -4HB). In this process, the product of SucD, succinic semialdehyde (SSD), is toxic. Improving the transfer efficiency of this substrate is of great significance for increasing the yield of the final product. The main idea of this experiment is to reduce the accumulation of toxic intermediates.
[0129] pass phaP2 Promoter overexpression sucD Long expression promoter porin Express 4hbD and orfZ This ensures that when SSD is produced, there is already enough 4HbD and OrfZ in the cell to react it into downstream metabolites.
[0130] The specific experimental design is as follows: the experimental group is in Halomonas bluephagenesis Among the TD01 strains, there are phaP2 promoter expression sucD Genes, and porin promoter expression 4hbD Genes and orfZ Gene (TD01+P2-) sucD + porin - 4hbD - orfZ Control group 1 was formed by knocking out the experimental group. phaR , lift for phaP2 promoter suppression (TD01∆) phaR +P2- sucD + porin - 4hbD - orfZ Control group 2 consisted entirely of... porin The promoter expresses these three genes (TD01+). porin - sucD + porin - 4hbD - orfZ The experimental results are shown in Table 2. It can be seen from this that... phaP2 Promoters can increase the 4HB ratio to some extent, which can help improve the material properties.
[0131] Table 2: In Halomonas bluephagenesis China utilizes phaP2 The promoter produces P(3HB- co -4HB)
[0132]
[0133] 3. In Halomonas bluephagenesis China utilizes phaP1 The promoter produces poly(3-hydroxybutyric acid-3-hydroxyvalerate) copolyester (PHBV).
[0134] Compared to PHB, PHBV has a lower melting point and glass transition temperature due to the incorporation of the monomer 3-hydroxyvalerate (3HV), which provides many conveniences for material processing. The enzymes required for the production of PHBV are the same as those for PHB, including PhaA, PhaB, and PhaC. However, propionyl-CoA is required as a precursor. Heterologous expression can be used. scpAB Propionyl-CoA synthesized by the gene cluster serves as a precursor, enabling... Halomonas bluephagenesis PHBV is synthesized internally. This system is also applicable to self-excited systems.
[0135] Integrated into the genome scpAB basal bacteria Halomonas bluephagenesis TD08, and its overexpression in PHB production phaA Gene, phaB Gene or phaC Gene plasmids were selected, and those with better overexpression were chosen. phaA Gene or phaB Genes, or a combination of both, can be seen to be expressed via self-excitation using this promoter. phaA Gene, phaB Gene, phaC Genes or combinations thereof can increase PHBV content and cell dry weight levels. The experimental results are shown in Table 3. It can be seen that, in strains producing PHBV, genes based on… phaP A series of promoters are used to increase the yield of PHA.
[0136] Table 3: In Halomonas bluephagenesis China utilizes phaP1 Promoter production of PHBV
[0137]
[0138] Example 3: In Halomonas bluephagenesis China utilizes phaP Small molecule products synthesized by a series of promoters and co-produced with PHA.
[0139] PHA, as an intracellular accumulation product, can reduce fermentation costs and increase product added value by simultaneously generating extracellular secretory small molecule products. However, in the small molecule production process, there are problems such as excessive stress on cell growth caused by the large expression of various enzymes in the early stage of bacterial fermentation, and the inability to release a large number of toxic intermediate metabolites in a timely manner. To solve these two problems, the following strategies can be adopted.
[0140] 1) Overcome the accumulation of toxic metabolic intermediates in the early stage of fermentation and achieve rapid conversion of toxic intermediate metabolites.
[0141] 2) To avoid the bacteria from experiencing metabolic stress due to the large expression of certain proteins in the early stages of fermentation, which could affect their growth.
[0142] 1. In Halomonas bluephagenesis China utilizes phaP1 The promoter produces 3-hydroxypropionic acid
[0143] The production of 3-hydroxypropionic acid (3HP) using glycerol can... dhaB and aldD These two genes encode glycerol dehydratase and 3-hydroxypropionaldehyde dehydrogenase. 3-Hydroxypropionic acid is an important component of a three-carbon platform. During fermentation, the toxic intermediate metabolite 3-hydroxypropionaldehyde is produced. Similarly, the production of P(3HB- co The strategy for the 4HB component in (-4HB) can utilize long expression strong promoter overexpression. aldD Genes, while utilizing phaP1 promoter expression dhaB Genes are used to prevent the excessive accumulation of the toxic intermediate metabolite 3-hydroxypropanal within cells.
[0144] The specific experimental setup was as follows: the experimental group was... Halomonas bluephagenesis Based on TD01, using phaP1 promoter expression dhaB and using long expression to initiate porin Expressed aldD Control group 1 had the expression system unchanged, but the strain itself was knocked out. phaR Control group 2 utilizes a promoter with long expression. porin These two genes were expressed. Specific experimental results are shown in Table 4. It can be seen that, when using... phaP In the promoter, the yield of 3HP was significantly increased compared to the control groups 1 and 2.
[0145] Table 4: In Halomonas bluephagenesis middle phaP1 Promoter production of 3-hydroxypropionic acid
[0146]
[0147] 2. In Halomonas bluephagenesi s in use phaP3 The promoter produces tetrahydropyrimidine.
[0148] Tetrahydropyrimidine (ectoine) is an osmotic pressure regulator produced by halophilic bacteria to counteract high concentrations of extracellular salt ions. Industrially, it has applications in cosmetics, antifreeze, and other chemical products. The production of tetrahydropyrimidine requires starting with aspartic acid and proceeding through gene clusters... ectABC To achieve the production of tetrahydropyrimidine.
[0149] This experiment utilizes strategies to reduce initial bacterial division stress. In terms of experimental design, the experimental group consisted of... Halomonas bluephagegenesis TD01 is a basal bacterial strain, used on plasmids. phaP3 promoter expression ectABC Gene clusters. Control group 1 used the same plasmid, but the *Chaetomium* strain was knocked out. phaR of Halomonas bluephagenesis TD01. The basal bacteria in control group 2 were... Halomonas bluephagenesis TD01, on the plasmid is porin Gene clusters expressed by promoters. The results are shown in Table 5, from which it can be seen that... phaP3 promoter expression ectABC Genes can increase the production of tetrahydropyrimidine (ectoine).
[0150] Table 5: In Halomonas bluephagenesis China utilizes phaP3 Promoter production of tetrahydropyrimidine ectoine
[0151]
[0152] Example 4: In Halomonas bluephagenesis China utilizes phaP Series of promoters express secretases
[0153] Expressing secreted enzymes in bacteria can expand the available substrates for the bacteria. For example, overexpressing amylase can enable bacteria to better utilize extracellular starch, increasing their ability to utilize complex carbon sources. Expressing these enzymes often requires high-dose expression, which can place significant metabolic stress on bacteria during the early stages of cell division. Similarly, the growth strategies mentioned above, which aim to avoid metabolic stress caused by excessive expression of certain proteins during the early stages of fermentation, can be used to reduce the initial divisional stress on bacteria.
[0154] exist Halomonas bluephagenesis China utilizes phaP1 Promoter expression of amylase. Amylase production mainly consists of a protein encoding amylase and an N-terminal signal peptide (AmyL). By expressing amylase, bacteria can utilize starch as a carbon source for growth, increasing their ability to use food waste as a raw material.
[0155] This experimental design references the strategy described above to reduce the stress on bacteria from overexpressing amylase during the initial fermentation stage. The experimental group was... Halomonas bluephagenesis Based on TD01, using phaP1 promoter expression AmyL Gene, control group 1 was in TD01∆ phaR Based on this, use the same plasmid to express AmyL Gene, control group 2 was based on TD01, using porin promoter expression AmyLGenes. The measurement index was amylase activity, and the specific results are shown in Table 6. It can be seen that the use of... phaP1 Promoter expression of amylase increases the cumulative amylase activity. The enzyme activity index in the table refers to the ratio of the diameter of the starch degradation zone to the colony diameter.
[0156] Table 6: In Halomonas bluephagenesis China utilizes phaP1 Promoter expression of amylase
[0157]
[0158] Example 5: In Halomonas bluephagenesis China utilizes phaP A series of promoters increase PHA levels through cell deformation.
[0159] In the later stages of PHA fermentation, the accumulation of PHA is limited by cell volume and cannot increase further. Interfering with genes that regulate cell division in these later stages can, to some extent, increase the PHA content. Genes used for expression include the cell division inhibitor MinCD and MreB, which encodes a cytoskeletal protein.
[0160] Because cell division is crucial for cellular function, the regulation of this gene must be controlled during the later stages of fermentation, that is, using... phaP Promoter strategy.
[0161] During bacterial binary fission, the cell division inhibitor MinC is a suppressor of the FtsZ protein, preventing its polymerization. The FtsZ protein is an intracellular division loop that recruits other proteins at the cell division site, ultimately leading to cell division. Under natural conditions, MinC is precisely regulated intracellularly, constantly shuttling within the cell to achieve the lowest concentration at the cell center, where FtsZ is less inhibited, resulting in cell division occurring in the middle of the cell. Overexpression of MinC disrupts this balance, ultimately preventing cell division and causing the cell to elongate. Specifically… Halomonas bluephagenesis China utilizes phaP2 Gene overexpression of the cell division inhibitor MinCD promotes cell growth and increases PHA content.
[0162] This experiment aims to avoid prematurely interfering with cell division and affecting cell growth. The experimental group was... Halomonas bluephagenesis Plasmid overexpression based on TD01 strain minCD Gene, control group 1 is in Halomonas bluephagenesis Plasmid overexpression based on TD01 strain minCD Gene, control group 2 was based on TD01 and a blank plasmid (Table 7). It can be seen that, compared to control groups 1 and 2, using...phaP1 Promoter overexpression minCD Genes can increase PHA content and cell dry weight. Elongated cell morphology, such as... Figure 1 As shown.
[0163] Table 7: In Halomonas bluephagenesis China utilizes phaP2 promoter overexpression minCD Gene
[0164]
[0165] Example 6: In Escherichia coli Escherichia coli The study utilized a porin-R promoter containing a PhaR binding site to express amylase.
[0166] After it has been identified phaP Following the promoter and its regulation, this process can also be regulated in *E. coli*. *E. coli* lacks the natural ability to synthesize PHA and produce amylase; therefore, a dual-plasmid system is used to simultaneously express the PHA-producing enzyme (PhaCAB) and the amylase expressed by the porin-R promoter controlled by PhaR. The porin-R promoter is artificially designed and integrated into the original... porin The promoter is followed by a PhaR binding site (SEQ ID NO: 5), which enables it to be regulated by PhaR and thus increases in intensity with the accumulation of PHA.
[0167] The sequence of porin-R is as follows, SEQ ID NO: 6:
[0168] ATGCCTCCACAACCGCTCGTCACAtcctgttgcgtTCACTGGAATCCCAgtatagagtTTGACCTGCGAGatgttgcCAaGCTGTCACCGGATGTGCTTTCCGGTCTGATGAGTCCGTGAGGACGAAACAGCCTCTACAAATAATTTTGTTTAAgagttactagagaaagaggagaaatactag
[0169] The experiment was conducted on Escherichia coli JM109. The experimental group was introduced with bacteria derived from... Ralstonia eutropha of phaCAB The plasmid containing the gene cluster (platinum name PBHR68, with an endogenous promoter) and expression with the porin-R promoter amyL Genes and phaR The gene was not expressed on the plasmid of control group 1. phaR Gene, control group 2 used long expression promoter porinExpress amyL Genes. It can be seen that the use of PhaR-regulated genes... phaP The promoter showed higher cumulative amylase activity (Table 8). The enzyme activity index in the table refers to the ratio of the diameter of the starch degradation zone to the colony diameter.
[0170] Table 8: Utilization of Escherichia coli strain JM109 phaP1 promoter expression of amylase
[0171]
[0172] Example 7: Utilization of *Rochetomyces rochetomyces* phaP1 Promoter expression of lysine dehydrogenase converts lysine to 1,5-pentanediamine
[0173] 1,5-Pentanediamine is an important monomer for polymer synthesis, used to synthesize polymers such as polyamides. However, it possesses some toxicity; the accumulation of 1,5-pentanediamine in the early stages of fermentation can negatively impact cell growth. In bio-fermentation production, it primarily originates from the decarboxylation of L-lysine. The enzyme catalyzing this reaction is derived from *E. coli*. cadA Genetically encoded lysine decarboxylase.
[0174] use phaP1 Promoter expression of lysine decarboxylase is a strategy to address the cytotoxicity caused by the accumulation of 1,5-pentanediamine in the early stages of fermentation. The specific experimental results of lysine decarboxylase expression in *Rhodotorula roximatei* are shown in Table 9. The experimental group used... phaP1 promoter expression cadA The plasmid contains genes, and also includes a gene encoding the PhaR protein for regulation. The plasmid in control group 1, compared to the experimental group, does not include... phaR Control group 2 used porin promoter expression cadA Genes. All groups above overexpressed. cadA This allows 1,5-pentanediamine to be transported extracellularly (Table 9).
[0175] Table 9: Ralstonia eutropha China utilizes phaP1 Promoter for the production of 1,5-pentanediamine
[0176]
[0177] Example 8: Alcaligenes megaterium ( Alcaligenes latus ), Pseudomonas spp. Pseudomonas spp.), Aeromonas spp. Aeromonas spp.) exploit phaP1 Promoter expression of 3-hydroxypropionic acid metabolic pathway to produce 3-hydroxypropionic acid
[0178] 1. Alcaligenes megaterium ( Alcaligenes latus )use phaP1 Promoter production of 3-hydroxypropionic acid
[0179] Alcaligenes megaterium is a bacterium capable of using sucrose as a carbon source for growth and naturally accumulating PHA. Due to its excellent PHA production capacity, it has also been developed as a production strain. Alcaligenes megaterium can produce 3-hydroxypropionic acid through overexpression using a long-expression, strong promoter. aldD Genes, while utilizing phaP1 promoter expression dhaB Genes are used to prevent the excessive accumulation of the toxic intermediate metabolite 3-hydroxypropanal within cells.
[0180] Specifically, the experimental group used plasmids... phaP1 promoter expression dhaB Genes, while using long expression porin promoter expression aldD The gene, and PhaR, were expressed using their own promoter. Control group 1 did not express PhaR compared to the experimental group. Control group 2 expressed PhaR using a long expression promoter compared to the experimental group. dhaB Genes (Table 10).
[0181] Table 10: Alcaligenes latus China utilizes phaP1 Promoter production of 3-hydroxypropionic acid
[0182]
[0183] 2. Pseudomonas spp. ( Pseudomonas spp.) exploit phaP1 Promoter production of 3-hydroxypropionic acid
[0184] Pseudomonas species are also natural PHA-producing strains, primarily producing long-chain PHA monomers with 6 to 14 carbon atoms. Therefore, it is also possible to utilize PHA production simultaneously with these strains. phaP1 The promoter produces 3-hydroxypropionic acid. The experimental design is similar to that of *Alcaligenes megaterium*, using... Pseudomonas putida For example, the specific results are shown in Table 11.
[0185] Table 11: Pseudomonas putida China utilizes phaP1 Promoter production of 3-hydroxypropionic acid
[0186]
[0187] 3. Aeromonas spp. ( Aeromonas spp.) exploit phaP Promoter production of 3-hydroxypropionic acid
[0188] Aeromonas hydrophila is a natural PHA-producing strain, primarily producing medium- to long-chain PHA monomers with 5 to 12 carbon atoms, compared to other producing strains. Therefore, it is also possible to utilize [other strains] while producing these types of PHA products. The promoter produces 3-hydroxypropionic acid. The experimental design is similar to that of *Alcaligenes megaterium*, using... Taking 4AK4 as an example, the specific results are shown in Table 12.
[0189] Table 12: 4AK4 Promoter production of 3-hydroxypropionic acid
[0190]
[0191] Example 9: LS21 CGMCC No.6593 and M1 CGMCC NO.19880 Promoter expression of threonine synthesis pathway to produce threonine
[0192] Threonine is one of the essential amino acids for the human body and is widely used in feed additives, food additives, and other fields. Due to the specific culture conditions of *Haloxylon ammodendron* (requiring a certain concentration of sodium salt), large-scale open fermentation can be carried out without significant contamination, making its open fermentation for threonine production of considerable industrial value. Among *Haloxylon ammodendron* (… LS21 CGMCC No. 6593 and In M1 CGMCCNO.19880, a threonine transfer protein is lacking, preventing the secretion of produced threonine outside the cell. Secretory threonine not only has advantages in downstream processing but also facilitates the simultaneous production of the intracellular product PHA. However, excessive overexpression of threonine transfer protein (derived from *E. coli*) during the early stages of fermentation is crucial. The coding process can affect the normal intracellular utilization of threonine, resulting in poor cell growth and ultimately affecting PHA production.
[0193] In terms of specific experimental design, the experimental group used... promoter expression Genes, expressed simultaneously Gene, control group 1 used Promoter, but no expression Genes. Control group 2 used a weaker, longer expression promoter. Express Gene, control group 3 was wild-type with a stronger promoter promoter expression Genes. It can be seen that the use of... The promoter can overcome the effects of strong promoters on cell growth and the insufficient secretion caused by weak promoters. Specific results are shown in Tables 13 and 14.
[0194] Table 13: LS21 utilize Promoter production of 3-hydroxypropionic acid
[0195]
[0196] Table 14: M1 utilize Promoter production of 3-hydroxypropionic acid
[0197]
[0198] Example 10: Utilizing promoter expression exist China Gene suppression can increase cell volume.
[0199] Genes are intracellular structures that regulate cell size; inhibiting them causes cell volume to increase, and they can be inserted into the promoter region. site, The product is called a lac repressor, which functions by interacting with the 5' end of the lacZ, Y, and A gene clusters. Combined, when manipulating genes When occupied by LacI, RNA polymerase does not bind to the promoter, thus inhibiting transcription initiation at the promoter and thereby suppressing transcription. Genes enable cells to grow larger in the later stages of cell growth, increasing PHA content.
[0200] The specific experimental setup was as follows: the experimental group consisted of... Site insertion into TD01's own genome After the starter, import it. promoter expression The gene plasmid; control group 1 only included the gene plasmid. Site insertion into TD01's own genome After the promoter, no expression is imported. The gene plasmid; control group 2 was... TD01, without insertion The site does not import expression The specific results of the gene plasmid are shown in Table 15. As shown.
[0201] Table 15: China utilizes promoter expression Gene suppression network Gene
[0202]
[0203] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.
[0204] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not describe the various possible combinations separately.
Claims
1. A recombinant bacterium, characterized in that, The recombinant bacteria contain: A) An expression vector; the expression vector comprises a promoter and a nucleotide sequence encoding PhaR, wherein the promoter is as shown in SEQ ID NO: 1-3 or 6, and the expression intensity of the promoter is regulated by the synthesis of PHA; or, B) Expression vector composition; the expression vector composition comprises one or more first expression vectors and one or more second expression vectors, the first expression vector comprising a first promoter, the second expression vector comprising a second promoter, the first promoter being as shown in SEQ ID NO: 1-3 or 6, the first expression vector or the second expression vector comprising a nucleotide sequence encoding PhaR, the expression intensity of the first promoter being regulated by the synthesis of PHA; The product of the fermentation by the recombinant bacteria contains PHA or monomers that make up PHA.
2. The recombinant bacteria according to claim 1, characterized in that, in, The expression vector in A) also contains genes encoding the product synthesis pathway, and the product contains PHA or a monomer that constitutes PHA.
3. The recombinant bacteria according to claim 1, characterized in that, in, B) In the expression vector composition: i) The first expression vector contains a gene encoding a product synthesis pathway, wherein the product is PHA or a monomer constituting PHA; the second expression vector contains a gene encoding a product synthesis pathway, wherein the product is selected from: a) Products co-produced with PHA and enzymes related to the production of products co-produced with PHA, wherein the products co-produced with PHA are selected from amino acids, inositol, tetrahydropyrimidine, 1,3-propanediol, 3-hydroxypropionic acid, 1,5-pentanediamine or 5-aminolevulinic acid. b) Enzymes secreted outside the cell, selected from lipase, amylase, saccharifying enzyme, protease, cellulase, esterase, glucanase, pectinase, phospholipase, gelatinase or nuclease; c) Cell morphology-related proteins, selected from tubulin FtsZ, cytoskeletal protein MreB, or cell division regulator MinCD; or, d) Proteins related to intracellular gene regulation, selected from lactose operon repressor protein LacI or tetracycline operon repressor protein TetR; ii) The second expression vector contains a gene encoding a product synthesis pathway-related gene, wherein the product is PHA or a monomer constituting PHA; the first expression vector contains a gene encoding a product synthesis pathway-related gene, wherein the product is selected from: a) Products co-produced with PHA and enzymes related to the production of products co-produced with PHA, wherein the products co-produced with PHA are selected from amino acids, inositol, tetrahydropyrimidine, 1,3-propanediol, 3-hydroxypropionic acid, 1,5-pentanediamine or 5-aminolevulinic acid. b) Enzymes secreted outside the cell, selected from lipase, amylase, saccharifying enzyme, protease, cellulase, esterase, glucanase, pectinase, phospholipase, gelatinase or nuclease; c) Cell morphology-related proteins, selected from tubulin FtsZ, cytoskeletal protein MreB, or cell division regulator MinCD; or, d) Proteins related to intracellular gene regulation, selected from lactose operon repressor protein LacI or tetracycline operon repressor protein TetR.
4. The recombinant bacteria according to claim 2, characterized in that, A) The PHA in the expression vector is selected from 3-hydroxybutyric acid homopolymer PHB, 3-hydroxybutyric acid and 4-hydroxybutyric acid binary copolymer P3HB4HB, 3-hydroxybutyric acid, 4-hydroxybutyric acid and 3-hydroxyvalerate terpolymer PHBV4HB, 3-hydroxybutyric acid and 3-hydroxyhexanoic acid binary copolymer PHBHHx, and homopolymers or copolymers of 3-hydroxypropionic acid, wherein the homopolymer of 3-hydroxypropionic acid is P3HP, and the copolymer of 3-hydroxypropionic acid is P(3HB-co-3HP) or PHBHP; the monomers constituting PHA are selected from 3-hydroxybutyryl-CoA, 4-hydroxybutyryl-CoA, 3-hydroxyvalerate-CoA, 5-hydroxyvalerate-CoA, 3-hydroxyhexanoyl-CoA, or 6-hydroxyhexanoyl-CoA.
5. The recombinant bacteria according to claim 2, characterized in that, A) The product described in the expression vector also includes: a) Products co-produced with PHA and enzymes related to the production of products co-produced with PHA, wherein the products co-produced with PHA are selected from amino acids, inositol, tetrahydropyrimidine, 1,3-propanediol, 3-hydroxypropionic acid, 1,5-pentanediamine or 5-aminolevulinic acid. b) Enzymes secreted outside the cell, selected from lipase, amylase, saccharifying enzyme, protease, cellulase, esterase, glucanase, pectinase, phospholipase, gelatinase or nuclease; c) Cell morphology-related proteins, selected from tubulin FtsZ, cytoskeletal protein MreB, or cell division regulator MinCD; or, d) Proteins related to intracellular gene regulation, selected from lactose operon repressor protein LacI or tetracycline operon repressor protein TetR.
6. The recombinant bacteria according to any one of claims 1-5, characterized in that, The recombinant bacteria are selected from Escherichia coli (E. coli) Escherichia coli ), Roche's et al. Ralstonia eutropha ), Alcaligenes megaterium ( Alcaligenes latus ), Pseudomonas spp. Pseudomonas Aeromonas spp. Aeromonas ) or halophilic mononucleosis ( Halomonas ).
7. A method for preparing the recombinant bacteria according to any one of claims 1-6, characterized in that, The preparation method includes introducing the expression vector (A) or expression vector composition (B) of any one of claims 1-6 into recombinant bacteria.
8. The preparation method according to claim 7, characterized in that, The expression vector integrates the promoter into the recombinant bacterial genome or the expression vector remains free in the recombinant bacteria.
9. A fermentation method, characterized in that, The method includes fermenting the recombinant bacteria according to any one of claims 1-6, wherein the fermentation product contains PHA or a monomer constituting PHA.
10. The fermentation method according to claim 9, characterized in that, The products of the fermentation also include: a) Products co-produced with PHA and enzymes related to the production of products co-produced with PHA, wherein the products co-produced with PHA are selected from amino acids, inositol, tetrahydropyrimidine, 1,3-propanediol, 3-hydroxypropionic acid, 1,5-pentanediamine or 5-aminolevulinic acid. b) Enzymes secreted outside the cell, selected from lipase, amylase, saccharifying enzyme, protease, cellulase, esterase, glucanase, pectinase, phospholipase, gelatinase or nuclease; c) Cell morphology-related proteins, selected from tubulin FtsZ, cytoskeletal protein MreB, or cell division regulator MinCD; or, d) Proteins related to intracellular gene regulation, selected from lactose operon repressor protein LacI or tetracycline operon repressor protein TetR.
Citation Information
Patent Citations
In vivo incorporation of unnatural amino acids
AU2008200780A1
Polymer particles and uses thereof
AU2013201354A1
Preparing method and application of large-grained inclusion in microorganism cells
CN110004182A
Method for producing short-and-medium-chain-length polyhydroxyalkanoate (PHA) and functional derivatives thereof
CN111235173A
Poly (3-hydroxybutyrate-4-hydroxybutyrate-5-hydroxyvalerate) tripolymer and construction of microbial production strain thereof
CN113684169A