A specific primer for detecting CP of acrosternum hilare virus and a PCR detection method

By designing CP detection primers and PCR detection methods specific to the stink bug virus, the problem of mass mortality of individual stink bugs due to infection was solved, enabling efficient and rapid detection and healthy breeding of stink bugs, and supporting the commercial application and biological control of stink bugs.

CN113999935BActive Publication Date: 2026-01-02TOBACCO RESEARCH INSTITUTE OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES (QINGZHOU TOBACCO RESEARCH INSTITUTE OF CHINA NATIONAL TOBACCO COMPANY)
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202111248853.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-10-26
Publication Date
2026-01-02
Estimated Expiration
2041-10-26

AI Technical Summary

Technical Problem

The large-scale breeding of giant bugs has been hampered by the high mortality rate of individual bugs due to disease, which has affected their large-scale production and application. Research is needed on the types and functions of pathogens in giant bugs in order to build a prevention and control technology system.

Method used

We designed specific CP detection primers and PCR detection methods for the volcanovirus AcV-1. We used specific primers AcV-1F/R to detect whether volcanoes carry AcV-1 virus and used healthy volcano offspring for large-scale breeding.

Benefits of technology

This technology enables efficient, rapid, and accurate detection of whether black bugs carry the AcV-1 virus, ensuring the health of individual black bugs and supporting the commercial application and biological control of black bugs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN113999935B_ABST
    Figure CN113999935B_ABST
Patent Text Reader

Abstract

The application discloses a specific CP detection primer and PCR detection method for Acrosternum hilare virus, and belongs to the technical field of gene detection. The specific CP detection primer and PCR detection method for Acrosternum hilare virus comprises the following steps: step one, extraction of total RNA of Acrosternum hilare, grinding, extraction and purification are sequentially performed; step two, preparation of cDNA of Acrosternum hilare; step three, synthesis of specific primer for testing AcV-1; step four, PCR amplification reaction, PCR amplification program and identification of PCR product; and step five, re-inspection of the testing result. Not only can single head adult, 5th instar nymph and 4th instar nymph of Acrosternum hilare be detected, but also single head 3rd instar nymph, 2nd instar nymph, newly hatched nymph and egg mass can be detected, and the operation is simple, fast and convenient. The application adopts the PCR technology, and the operation process is simple, fast and efficient, and the whole process can be completed within 2 hours, the specificity is high, and the specific primer designed in the application has amplification capacity only for AcV-1.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of gene detection, in particular to a specific CP detection primer and PCR detection method for Arma chinensis virus. BACKGROUND

[0002] Arma chinensis, also known as Arma chinensis, belongs to Hemiptera, Pentatomidae, Asopinae, Arma, Arma chinensis nymphs and adults can prey on more than 40 common pests such as armyworm, moth, leaf beetle, scale insect, aphid and Spodoptera exigua. Arma chinensis is a kind of predatory insect, and its distribution range is relatively wide. It is mainly distributed in nearly 20 provinces in Heilongjiang, Beijing, Yunnan, Guizhou and other provinces. Based on the characteristics of wide spectrum of Arma chinensis, it has a significant inhibitory effect on the outbreak of pests such as Lepidoptera and Coleoptera which are harmful to agriculture. However, the number of Arma chinensis under natural conditions is difficult to meet the needs of pest control, so it is necessary to cultivate Arma chinensis indoors.

[0003] Arma chinensis has wide food spectrum and strong adaptability, which provides the possibility for its artificial large-scale breeding, and makes it an important natural enemy resource for field biological control. In recent years, Zunyi Company of Guizhou Tobacco Company has established artificial propagation base of Arma chinensis to study artificial mass propagation technology. By using large-scale rearing of armyworm as food, Arma chinensis is made into a mature commercial natural enemy insect, and field application technology for controlling tobacco pests is established. It has been listed as one of the key technologies recommended by the major special project of tobacco industry green prevention and control, and has been demonstrated and popularized in major tobacco areas in China.

[0004] Chinese researchers have carried out detailed research on the prevention and control effect and artificial rearing technology of Arma chinensis, including population dynamics, artificial feed and pest control species. However, in the process of large-scale breeding of Arma chinensis, the problem of mass death of individuals due to disease has been encountered, which seriously threatens the large-scale production and application of Arma chinensis. It is urgent to carry out related research on the species and function of pathogenic viruses in Arma chinensis.

[0005] In the early stage, through RNA-seq high-throughput sequencing, a new kind of double-stranded virus was found in Arma chinensis, which was named AcV-1. It is not clear what effect this virus has on the growth and reproduction of Arma chinensis. Research on the genomic sequence, biological classification, transmission route, tissue distribution of the virus and the physiological, biochemical and molecular regulation mechanism of the virus and Arma chinensis development helps to clarify the relationship between the virus and the host, lay a theoretical foundation for further research on the function of viral proteins, the mechanism of viral infection of the host and the replication of viral genome, and thus promote the application research of the double-stranded virus. If it is a harmful virus, a prevention and control technology system can be constructed according to its transmission route and other factors; if it is a beneficial virus, it can be further utilized to lay a foundation for the commercial application of Arma chinensis.

[0006] On the basis of the clear virus on the population of the breeding effect and its transmission route, the specific detection primer is designed, the individual of the stink bug is detected whether carrying AcV-1 through the method of single pair matching and detecting the mother, and the healthy stink bug offspring is used to construct the factory breeding population of the stink bug. SUMMARY

[0007] The application provides a stink bug virus specific CP detection primer and PCR detection method.The stink bug virus specific CP detection primer and PCR detection method have high detection accuracy, the primer AcV-1F / R is designed according to the nucleic acid sequence of the AcV-1 coding protein shell, 725 bp fragments can be amplified when the AcV-1 is rapidly detected by PCR, the single head adult stink bug, 5th instar nymph and 4th instar nymph can be detected, and the single head 3rd instar nymph, 2nd instar nymph, newly hatched nymph and egg mass can also be detected, the operation is simple and fast, the PCR technology is used, the operation process is simple, fast and efficient, the whole process can be completed in 2 hours, the specificity is strong, and the specific primer designed in the application has amplification capacity only for AcV-1.

[0008] In order to realize the above effect, the application provides the following technical scheme: a stink bug virus specific CP detection primer and PCR detection method, comprising the following steps:

[0009] Step one, the extraction of the total RNA of the stink bug, grinding, extraction and purification are sequentially performed;

[0010] Step two, the preparation of the cDNA of the stink bug;

[0011] Step three, the synthesis of the specific primer for detecting AcV-1;

[0012] Step four, PCR amplification reaction, PCR amplification program and PCR product identification;

[0013] Step five, the re-inspection of the test result.

[0014] Further, the following steps are included: Following the operating steps in step one, after grinding the bug sample, take 0.1 g into a 1.5 mL sterile enzyme-free centrifuge tube, add TRIzol™ Reagent and mix well. Let it stand at room temperature for 5 min, add 200 µL of chloroform, shake vigorously up and down for 25-30 s, let it stand at room temperature for 3 min, and then centrifuge at 12000 rpm at 4℃ for 15 min. After centrifugation, aspirate 400 µL of supernatant into a new 1.5 mL sterile enzyme-free centrifuge tube, add 500 µL of isopropanol, mix well, let it stand at room temperature for 10 min, and then centrifuge at 12000 rpm at 4℃ for 10 min. Discard the supernatant, add 1 mL of 75% ethanol, and resuspend the precipitate by pipetting. After washing, centrifuge at 7500 rpm at 4℃ for 5 min, discard the supernatant, centrifuge at 7500 rpm at 4℃ for 1 min, and aspirate the remaining supernatant and air dry.

[0015] Further steps include: dissolving RNA in 50-100 µL of DEPC water according to the operating steps in step one, detecting the RNA concentration and purity, and then storing it in a -80℃ refrigerator for later use.

[0016] Further, the following steps are included: Following the operating steps in step two, the first-strand cDNA of the AcV-1 genome was synthesized using the TransScript® One-Step gDNA Removal and cDNA Synthesis SuperMix (TransGen, Beijing, China) kit. The reverse transcription system consisted of: Total RNA 2 µL, Oligo(dT) 1 µL, and RNase-free Water 5 µL. The mixture was incubated at 65°C for 5 min, followed by an ice bath for 2 min. Then, 10 µL of 2×TS Reaction Mix, 1 µL of TransScript® RT / RI Enzyme Mix, and 1 µL of gDNA Remover were added to the system. The reaction conditions were 42°C for 30 min and 85°C for 5 s. The resulting cDNA was stored at -20°C.

[0017] Further, including the following steps: According to the operating steps in 31, AcV-1F: CACAGGGGATTTTACTGAAGC.

[0018] Further, including the following steps: According to the operation steps in step three, AcV-1R:CGTCGGGTGTACCTGTAGAAA.

[0019] Further, the following steps are included: according to the operation steps in step four, the reaction system is 20 µL, wherein 2×EasyTaq PCR Super Mix (TransGen, Beijing, China) is 10 µL, forward primer is 0.5 µL, reverse primer is 0.5 µL, ddH2O is 8 µL, and cDNA is 1 µL.

[0020] Further, the following steps are included: according to the operation steps in step four, 94℃ pre-denaturation is 5 min; 94℃ is 30 sec, 60℃ is 30 sec, and 72℃ is 30 sec, and 35 cycles are performed.

[0021] Further, the following steps are included: according to the operation steps in step four, 5 µL of PCR product is separated by 1.0% agarose gel electrophoresis containing a nucleic acid dye, and the result is determined according to the size of the amplification product in a gel imaging system.

[0022] Further, the following steps are included: according to the operation steps in step five, AcV-1 specific primers AcV-1F / R and isoptera Actin primers are used to detect samples with / without AcV-1, isoptera Actin primers are used to detect samples to ensure the availability of isoptera cDNA samples, AC-Actin primers are used to detect samples and positive controls, and no band is detected in the negative control, which indicates that the cDNA of the detection sample is available; the positive control has a band in the detection result of AcV-1F / R, and the negative control has no band, which indicates that the detection result is reliable, no amplification product is detected in the control (i.e., isoptera sample without AcV-1), and YC1-YC13 are isoptera samples with AcV-1, and a 725 bp target band is amplified, which indicates that the designed AcV-1F / R primers have high specificity.

[0023] The application provides a specific CP detection primer and PCR detection method for isoptera virus, which has the following beneficial effects:

[0024] The specific CP detection primer and PCR detection method for isoptera virus have high detection accuracy, the primer AcV-1F / R designed according to the nucleic acid sequence of the protein coat encoded by AcV-1 can amplify a 725 bp fragment in the rapid detection of AcV-1, and not only can detect isoptera adult, 5th instar nymph and 4th instar nymph, but also can detect 3rd instar nymph, 2nd instar nymph, newly hatched nymph and egg mass, and the operation is simple and fast, the PCR technology is used, the operation process is simple, fast and efficient, the whole process can be completed within 2 hours, the specificity is high, and the specific primer designed in the application has amplification capacity only for AcV-1. BRIEF DESCRIPTION OF DRAWINGS

[0025] Figure 1 For the detection effect of specific primers AcV-1F / R and the specific primers of the planthopper Actin on the samples with (a) and without AcV-1, (b) CK1-3: samples without AcV-1, YC1-13: samples with AcV-1, +: positive control, -: negative control.

[0026] Figure 2 For the detection effect of specific primers AcV-1F / R on plasmids with different temperatures, the copy number of which is 2.05×10 7 copies / µL ( Figure 2 a), 2.05×10 3 copies / µL ( Figure 2 b);

[0027] Figure 3 For the detection effect of specific primers AcV-1F / R on plasmids with different concentrations;

[0028] Figure 4 For the schematic diagram of the detection method of the application. DETAILED DESCRIPTION

[0029] The application provides a technical solution: please refer to Figures 1-4 A specific CP detection primer and PCR detection method for planthopper virus, comprising the following steps:

[0030] Step one, extraction of total RNA of planthoppers, grinding, extraction and purification are sequentially performed;

[0031] Step two, preparation of cDNA of planthoppers;

[0032] Step three, synthesis of specific primers for testing AcV-1;

[0033] Step four, PCR amplification reaction, PCR amplification program and identification of PCR products;

[0034] Step five, re-inspection of the test results.

[0035] Specifically, the following steps are included: according to the operation steps in step one, after the grinding of the acridovanivorus sample, 0.1 g is taken into a 1.5 mL sterile and enzyme-free centrifuge tube, TRIzol™ Reagent is added and mixed, it is placed at room temperature for 5 min, 200 µL chloroform is added, it is shaken vigorously up and down for 25-30 s, it is placed at room temperature for 3 min, then it is centrifuged at 4°C 12000 rpm for 15 min, after the completion of centrifugation, 400 µL supernatant is taken into a new 1.5 mL sterile and enzyme-free centrifuge tube, 500 µL isopropanol is added, it is mixed, it is placed at room temperature for 10 min, then it is centrifuged at 4°C 12000 rpm for 10 min, the supernatant is discarded, 1 mL 75% ethanol is added, the precipitate is suspended by blowing, after the completion of washing, it is centrifuged at 4°C 7500 rpm for 5 min, the supernatant is discarded, it is centrifuged at 4°C 7500 rpm for 1 min, the remaining supernatant is sucked out, and it is air-dried.

[0036] Specifically, the following steps are included: according to the operation steps in step one, 50-100 µL DEPC water is used to dissolve the RNA, after detecting the RNA concentration and purity, it is stored in a -80°C refrigerator for standby use.

[0037] Specifically, the following steps are included: according to the operation steps in step two, the first strand cDNA of AcV-1 genome is synthesized by referring to the TransScript® One-Step gDNA Removal and cDNA Synthesis SuperMix (TransGen, Beijing, China) kit, the reverse transcription system is: Total RNA 2 µL, Oligo(dT) 1 µL, RNase-free Water 5 µL, it is mixed and incubated at 65°C for 5 min, it is placed on ice for 2 min, then 2×TS Reaction Mix 10 µL, TransScript® RT / RI Enzyme Mix 1 µL, gDNA Remover 1 µL are added into the system, the reaction conditions are 42°C for 30 min and 85°C for 5 s, and the obtained cDNA is stored at -20°C.

[0038] Specifically, the following steps are included: according to the operation steps in 31, AcV-1F: CACAGGGGATTTTACTGAAGC.

[0039] Specifically, the following steps are included: according to the operation steps in step three, AcV-1R: CGTCGGGTGTACCTGTAGAAA.

[0040] Specifically, the following steps are included: according to the operation steps in step four, the reaction system is 20 μL, including 2x EasyTaq PCR Super Mix (TransGen, Beijing, China) 10 μL, Forward Primer 0.5 μL, Reverse Primer 0.5 μL, ddH2O 8 μL, and cDNA 1 μL.

[0041] Specifically, the following steps are included: according to the operation steps in step four, 94 ℃ pre-denaturation for 5 min; 94 ℃ for 30 sec, 60 ℃ for 30 sec, 72 ℃ for 30 sec, 35 cycles.

[0042] Specifically, the following steps are included: according to the operation steps in step four, 5 μL of PCR product is separated by 1.0% agarose gel electrophoresis containing nucleic acid dye, and the result is determined according to the size of the amplified product in the gel imaging system.

[0043] Specifically, the following steps are included: according to the operation steps in step five, AcV-1 F / R specific primers and Ischnids Actin primers are used to detect AcV-1 carrying / non-carrying Ischnids samples, Ischnids Actin primers are used to detect samples to ensure the availability of Ischnids cDNA samples, AC-Actin primers are used to detect samples and positive controls, and there are bands in the negative control, which indicates that the cDNA of the detected sample is available; the positive control has a band in the detection result of AcV-1 F / R, and the negative control has no band, which indicates that the detection result is reliable, and the control (i.e. not carrying AcV-1) Ischnids sample has no amplification product, and YC1-YC13 are AcV-1 carrying Ischnids samples, which all amplify the 725 bp target band, indicating that the designed AcV-1 F / R primers have strong specificity.

[0044] The method of the embodiment is detected and analyzed, and compared with the prior art, and the following data is obtained:

[0045] Ease of operation Accuracy of detection Specificity Examples Higher Lower Higher Prior art Lower Higher Lower

[0046] According to the data in the above table, when the embodiment is implemented, the 725 bp fragment can be amplified in the PCR rapid detection of AcV-1 by the Ischnids virus specific CP detection primer and PCR detection method of the application, which can not only detect Ischnids adult, 5th instar nymph and 4th instar nymph, but also detect 3rd instar nymph, 2nd instar nymph, newly hatched nymph and egg mass, which is simple and fast to operate. The application adopts PCR technology, which is simple, fast and efficient in operation process, and has strong specificity. The specific primer designed by the application only has amplification capacity for AcV-1.

[0047] Embodiment 1: The application provides a specific CP detection primer and PCR detection method for Acrosternum hilare virus, comprising the following steps: step one, extraction of total RNA of Acrosternum hilare, grinding, extraction and purification are sequentially performed, after grinding of the Acrosternum hilare sample, 0.1 g is taken into a 1.5 mL sterile and enzyme-free centrifuge tube, TRIzol™ Reagent is added and mixed, room temperature standing is performed for 5 min, 200 μL chloroform is added, and vigorous shaking is performed for 25-30 s, room temperature standing is performed for 3 min, 4℃ 12000 rpm centrifugation is performed for 15 min, after completion of centrifugation, 400 μL supernatant is taken into a new 1.5 mL sterile and enzyme-free centrifuge tube, 500 μL isopropanol is added and mixed, room temperature standing is performed for 10 min, 4℃ 12000 rpm centrifugation is performed for 10 min, the supernatant is discarded, 1 mL 75% ethanol is added, the precipitate is suspended by blowing, after completion of washing, 4℃ 7500 rpm centrifugation is performed for 5 min, the supernatant is discarded, 4℃ 7500 rpm centrifugation is performed for 1 min, the remaining supernatant is absorbed, and after air drying, 50-100 μL DEPC water is used to dissolve the RNA, after detection of the RNA concentration and purity, the RNA is stored in a-80℃ refrigerator for standby, step two, preparation of cDNA of Acrosternum hilare, the first strand cDNA of the AcV-1 genome is synthesized by referring to a TransScript® One-Step gDNA Removal and cDNA Synthesis SuperMix (TransGen, Beijing, China) kit, and a reverse transcription system is as follows: Total RNA 2 μL, Oligo(dT) 1 μL, RNase-free Water 5 μL are mixed and incubated at 65℃ for 5 min, after ice bath for 2 min, 2×TS Reaction Mix 10 μL, TransScript® RT / RI Enzyme Mix 1 μL and gDNA Remover 1 μL are further added to the system, and the reaction condition is 42℃ for 30 min and 85℃ for 5 s, and the obtained cDNA is stored at-20℃, step three, synthesis of specific primer for detecting AcV-1, AcV-1F: CACAGGGGATTTTACTGAAGC, AcV-1R: CGTCGGGTGTACCTGTAGAAA, wherein the specific detection primer of the AcV-1 of the application can specifically amplify a 725 bp gene fragment,CACAGGGGATTTTACTGAAGCAGAAATGCGTAAGTTATGGACAGATAAAACATATGCGAAGAAACCAGCCCGCATTTATGCACAAGCAGCACGAGAACTTAAACAACTTGAAGCAAATAACTCACCATCCACAGCATTAGGACAGATTTCAGAAGGACTATCCACTTTGAGTCACATACCAGTATTAGGAAATATCTTTAGCACCCCAGCATGGATATCGGCGAAAGCTGCAGATTTGGCAAAATTATTTGGTTTTTCTAAACCTACGGTTCAAGGTAAAGTTGGAGAATGTAAGTTACGCGGTCAAGGAAGAATGGCAAATTTTGACGGTATGGATATGTCACACAAAATGGCATTGTCGTCAACTAATGAAATAGAAACAAAAGAAGGATTGGCAGGAACATCACTAGACGAAATGGATTTATCTCGGATTCTATCTATCCCAAATTATTGGGATCGATTCACTTGGAAAACATCGGATGCAACAAATGCAGTTTTGTGGGATAATTATGTATCACCTTTTAAAGTAAAACCATATTCTTCAACAATAACAGATAGATTTAGATGCACTCATATGGGATATGTAGCCAACGCTTTTACTTATTGGAGAGGTTCTATTGTATATACTTTTAAATTTGTAAAAACTCAATATCATTCAGGTAGGTTAAGAATTTCATTTATTCCATATTATTACAACGATAAGATTTCTACAGGTACACCCGACG The nucleotide sequence is as follows: CACAGGGGATTTTACTGAAGCAGAAATGCGTAAGTTATGGACAGATAAAACATATGCGAAGAAACCAGCCCGCATTTATGCACAAGCAGCACGAGAACTTAAACAACTTGAAGCAAATAACTCACCATCCACAGCATTAGGACAGATTTCAGAAGGACTATCCACTTTGAGTCACATACCAGTATTAGGAAATATCTTTAGCACCCCAGCATGGATATCGGCGAAAGCTGCAGATTTGGCAAAATTATTTGGTTTTTCTAAACCTACGGTTCAAGGTAAAGTTGGAGAATGTAAGTTACGCGGTCAAGGAAGAATGGCAAATTTTGACGGTATGGATATGTCACACAAAATGGCATTGTCGTCAACTAATGAAATAGAAACAAAAGAAGGATTGGCAGGAACATCACTAGACGAAATGGATTTATCTCGGATTCTATCTATCCCAAATTATTGGGATCGATTCACTTGGAAAACATCGGATGCAACAAATGCAGTTTTGTGGGATAATTATGTATCACCTTTTAAAGTAAAACCATATTCTTCAACAATAACAGATAGATTTAGATGCACTCATATGGGATATGTAGCCAACGCTTTTACTTATTGGAGAGGTTCTATTGTATATACTTTTAAATTTGTAAAAACTCAATATCATTCAGGTAGGTTAAGAATTTCATTTATTCCATATTATTACAACGATAAGATTTCTACAGGTACACCCGACGwherein 2x EasyTaq PCR Super Mix (TransGen, Beijing, China) 10 μL, Forward Primer 0.5 μL, Reverse Primer 0.5 μL, ddH2O 8 μL, cDNA 1 μL, 94°C pre-denaturation 5 min; 94°C 30 sec, 60°C 30 sec, 72°C 30 sec, 35 cycles, 5 μL PCR product was separated by 1.0% agarose gel electrophoresis containing nucleic acid dye, and the results were determined according to the size of the amplified product in the gel imaging system, step five, rechecking the test results, using specific primers AcV-1F / R and Ischnids Actin primers to detect Ischnids samples with / without AcV-1, using Ischnids Actin primers to detect samples to ensure the availability of Ischnids cDNA samples, AC-Actin primers to detect samples and positive control have bands and negative control has no band, indicating that the cDNA of the test sample is available; the positive control has a band and the negative control has no band in the detection results of AcV-1F / R, indicating that the detection results are reliable, the control (i.e. Ischnids without AcV-1) has no amplification product, Figure 1 a lane 1 and Figure 1 b lanes 1 and 2 are control (i.e. Ischnids without AcV-1) samples without amplification product, YC1-YC13 are Ischnids samples carrying AcV-1, all of which amplify the 725 bp target band, indicating that the designed AcV-1F / R primers have strong specificity.

[0048] Example 2: The extraction of total RNA, the preparation of cDNA, the synthesis of AcV-1 F / R, PCR amplification and the identification of PCR product were the same as Example 1. The target fragment in Example 1 was recovered by gel cutting according to the instructions of EasyPure® Quick Gel Extraction Kit (TransGen, Beijing, China), and the recovered target fragment was ligated with vector pEASY-T1 at 25°C for 30 min. The E. coli DH5α competent cells were transformed by heat shock method, and were coated on the culture medium containing ampicillin (Amp) for overnight culture. The colonies on the plate were picked for colony PCR. The bacterial liquid samples corresponding to the correct size bands in the PCR results were sent to Shanghai Pishenlon Biotechnology Co., Ltd. for sequence determination. The correct bacterial liquid was cultured overnight at 37°C with 200 rpm in a shaker, and the plasmid was extracted according to the instructions of EasyPure® Plasmid MiniPrep Kit (TransGen, Beijing, China). The concentration of the extracted plasmid was 419.1 ng / µL. The standard curve of AcV-1 was established by absolute fluorescence quantification by probe method, with the extracted plasmid standard as the template, and 7 concentrations were diluted by 10 times as the gradient. The copy number of the virus was calculated by the standard curve of AcV-1. The plasmid with a copy number of 2.05×10 10 copies / µL was used as the template for PCR amplification at annealing temperatures of 52°C, 54°C, 56°C, 58°C, 60°C and 62°C, respectively. 6 copies / µL.

[0049] Example 3: The extraction of total RNA, the preparation of cDNA, the synthesis of AcV-1 F / R, PCR amplification, identification and purification, vector cloning, and plasmid extraction were the same as Example 2. The concentration of the plasmid was 2.05×10 13 copies / µL, which was diluted by 10 times as the gradient to 10 concentration gradients from 2.05×10 8 copies / µL. The specific primers AcV-1 F / R were used for specific amplification with the above 10 concentration gradients of plasmid as the template. The detection effect was shown in Figure 3 The lowest detection limit reached 20.5 copies / uL, and the concentration gradient was 2.05×10 8 copies / µL, 2: 2.05×10 7 copies / µL, 3: 2.05×10 6 copies / µL, 4: 2.05×10 5 copies / µL, 5: 2.05×10 4 copies / µL, 6: 2.05×103 copies / µL, 7: 2.05 x 10 2 copies / µL, 8: 20.5 copies / µL, 9: 2.05 copies / µL, 10: 0.205 copies / µL, -: negative control.

[0050] While embodiments of the application have been shown and described, it is to be understood that the embodiments described are merely exemplary and that changes, modifications, substitutions and variations can be made to the embodiments without departing from the principles and spirit of the application, the scope of which is defined by the claims and their equivalents.

Claims

1. A PCR detection method for CP detection specific to a piezodorus spp. virus, characterized by, The method comprises the following steps: S1, extraction of total RNA of Acrosternum hilare, grinding, extraction and purification are carried out in sequence; S2, preparation of cDNA of Acrosternum hilare; S3, synthesis of specific primers of AcV-1; AcV-1F: CACAGGGGATTTTACTGAAGC; AcV-1R: CGTCGGGTGTACCTGTAGAAA; S4, PCR amplification reaction, PCR amplification program and identification of PCR product; S5, re-inspection of the test result; The specific primer of AcV-1 specifically amplifies a gene fragment, and the nucleotide sequence is as follows: CACAGGGGATTTTACTGAAGCAGAAATGCGTAAGTTATGGACAGATAAAACAT ATGCGAAGAAACCAGCCCGCATTTATGCACAAGCAGCACGAGAACTTAAACAACTTGAAGCAAATAACTCACCATCCACAGCATTAGGACAGATTTCAGAAGGACTATCCACTTTGAGTCACATACCAGTATTAGGAAATATCTTTAGCACCCCAGCATGGATATCGGCGAAAGCTGCAGATTTGGCAAAATTATTTGGTTTTTCTAAACCTACGGTTCAAGGTAAAGTTGGAGAATGTAAGTTACGCGGTCAAGGAAGAATGGCAAATTTTGACGGTATGGATATGTCACACAAAATGGCATTGTCGTCAACTAATGAAATAGAAACAAAAGAAGGATTGGCAGGAACATCACTAGACGAAATGGATTTATCTCGGATTCTATCTATCCCAAATTATTGGGATCGATTCACTTGGAAAACATCGGATGCAACAAATGCAGTTTTGTGGGATAATTATGTATCACCTTTTAAAGTAAAACCATATTCTTCAACAATAACAGATAGATTTAGATGCACTCATATGGGATATGTAGCCAACGCTTTTACTTATTGGAGAGGTTCTATTGTATATACTTTTAAATTTGTAAAAACTCAATATCATTCAGGTAGGTTAAGAATTTCATTTATTCCATATTATTACAACGATAAGATTTCTACAGGTACACCCGACG.

2. The PCR detection method for CP detection of Piezodorus spp. according to claim 1, characterized by, The method comprises the following steps: According to the operation steps in S1, after the grinding of the sample, 0.1 g was taken into a 1.5 mL sterile and enzyme-free centrifuge tube, and TRIzol was added TM Mix the reagent, stand at room temperature for 5 min, add 200 μL chloroform, shake vigorously for 25-30 s, stand at room temperature for 3 min, then centrifuge at 12,000 rpm at 4°C for 15 min. After centrifugation, 400 μL of supernatant was taken into a new 1.5 mL sterile and enzyme-free centrifuge tube, 500 μL of isopropanol was added, mixed, and stood at room temperature for 10 min. Then centrifuge at 12,000 rpm at 4°C for 10 min, discard the supernatant, add 1 mL of 75% ethanol, and blow the precipitate to suspend it. After washing, centrifuge at 7,500 rpm at 4°C for 5 min, discard the supernatant, centrifuge at 7,500 rpm at 4°C for 1 min, remove the remaining supernatant, and dry.

3. The PCR detection method for CP detection of Piezodorus guildinii virus according to claim 1, characterized by, The method comprises the following steps: according to the operation steps in S1, 50-100 μL DEPC water is used to dissolve RNA, after detection of the concentration and purity of the RNA, the RNA is stored in a refrigerator at-80 ℃ for standby use.

4. The PCR detection method for CP detection of Piezodorus guildinii virus according to claim 1, characterized by, comprising the following steps: according to the operating steps in S2, referring to One-Step gDNA Removal and cDNA Synthesis Super Mix kit to synthesize the first strand cDNA of AcV-1 genome, the reverse transcription system: Total RNA 2 μL, Oligo dT 1 μL, RNase-free Water 5 μL, mixed and incubated at 65°C for 5 min, ice bath for 2 min, then 2×TS Reaction Mix 10 μL, RT / RI Enzyme Mix 1 μL, gDNA Remover 1 μL, the reaction condition is 42°C for 30 min, 85°C for 5 s, and the obtained cDNA is stored at -20°C.

5. The PCR detection method for CP detection of Piezodorus guildinii virus according to claim 1, characterized by, Comprising the following steps: According to the operation steps in S4, the reaction system is 20 μL, wherein PCR Super Mix 10 μL, Forward Primer 0.5 μL, Reverse Primer 0.5 μL, ddH2O 8 μL, cDNA 1 μL.

6. The PCR detection method for CP detection of Piezodorus guildinii virus according to claim 1, wherein, Comprising the following steps: pre-denaturation at 94℃ for 5 min, 94℃ for 30 sec, 60℃ for 30 sec, 72℃ for 30 sec, 35 cycles.

7. The PCR detection method for CP detection of Piezodorus guildinii virus according to claim 1, characterized by, Comprising the following steps: According to the operation steps in S4, 5 μL of PCR product was separated by 1.0% agarose gel electrophoresis containing nucleic acid dye, and the results were determined according to the size of the amplified product in a gel imaging system.

8. The PCR detection method for CP detection of Piezodorus guildinii virus according to claim 1, characterized by, Comprising the following steps: According to the operation steps in S5, AcV-1 F / R specific primers and Ischnids Actin primers were used to detect Ischnids samples with / without AcV-1, Ischnids Actin primers were used to detect samples to ensure the availability of Ischnids cDNA samples, AC-Actin primers were used to detect samples and positive controls, and no band was observed in the negative control, indicating that the cDNA of the detected samples was available; the positive control had a band in the detection results of AcV-1 F / R, and the negative control had no band, indicating that the detection results were reliable; no amplification product was observed in the control Ischnids sample, and the positive control had a band, indicating that the AcV-1 F / R primers designed in the Ischnids sample carrying AcV-1 had a 725 bp target band, and the specificity of the primers was strong.