Method for purifying virus or virus-like particles

By using a combination method of water-insoluble inorganic compounds and activated carbon, the problem of impurity separation in virus purification is solved, and an efficient and low-cost virus purification process is achieved.

CN114008067BActive Publication Date: 2025-08-05KANEKA CORP
View PDF 8 Cites 0 Cited by

Patent Information

Application Number
CN202080047182.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2019-07-04
Filing Date
2020-06-24
Publication Date
2025-08-05
Estimated Expiration
2040-06-24

AI Technical Summary

Technical Problem

The prior art is difficult to easily isolate impurities such as proteins and nucleic acids from viruses or virus-like particles, resulting in complex and high cost in purification.

Method used

Water-insoluble inorganic compounds such as magnesium, calcium and aluminum are used to contact with the liquid of virus or virus-like particles, selectively adsorb and remove impurities, and further purify with activated carbon. Finally, chromatography can be used for purification.

Benefits of technology

It realizes efficient and low-cost purification of virus or virus-like particles, reduces dependence on expensive equipment and materials, and simplifies the operation process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003435515550000111
    Figure BDA0003435515550000111
  • Figure BDA0003435515550000121
    Figure BDA0003435515550000121
  • Figure BDA0003435515550000131
    Figure BDA0003435515550000131
Patent Text Reader

Abstract

The present invention aims to provide a method for easily purifying viruses or virus-like particles. The method comprises contacting a liquid containing the virus or virus-like particles with a water-insoluble inorganic compound containing one or more elements selected from magnesium, calcium, and aluminum.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a method for purifying viruses or virus-like particles in a simple and convenient manner. Background Art

[0002] To identify viruses, commercially available kits are typically used to purify the genome from a sample and determine the genome's base sequence. Data on which viruses have which genome sequences is well established. Once the genome sequence is determined, the genus and species of the virus can be identified, requiring highly purified viruses. Furthermore, viruses have been used in gene therapy as vectors for introducing specific genes into cells, and naturally, the viruses used in gene therapy must be highly purified. Furthermore, detoxified viruses and inactive virus-like particles have been used as vaccines, and these, too, must be highly purified.

[0003] Viruses and virus-like particles are produced in transformed cells, eggs, and the like, and are purified from cell lysates and chorioallantoic fluid. However, these lysate and chorioallantoic fluid contain a large amount of impurities. Methods for purifying viruses and virus-like particles include ultracentrifugation, membrane separation, and chromatography. However, ultracentrifugation requires specialized equipment, making it difficult to scale up. Furthermore, membrane separation and chromatography require expensive materials and require significant labor and time to establish the conditions for high-level purification. Consequently, research has been conducted on simpler purification methods that could replace or be implemented in addition to these purification methods.

[0004] For example, Patent Document 1 describes an invention that purifies viruses by adjusting the inorganic salt concentration and pH of a virus-containing sample solution to facilitate adsorption of humic acid, a mixture of high-molecular-weight organic acids chemically and biologically synthesized from decomposition products of plant debris, microorganisms, and plankton debris, onto the surface of hydrophobic beads. However, cell lysates and chorioallantoic fluid containing viruses also contain impurities such as proteins and nucleic acids, and it remains unclear whether such a method can separate viruses from proteins, nucleic acids, and the like.

[0005] Patent Document 2 describes a method for purifying virus-like particles by trapping them in an expanded bed of an adsorbent. While insoluble inorganic compounds such as magnesium oxide can be used as materials for such adsorbents, these are examples only as inactive core materials for the adsorbents. In reality, the adsorbents used in the experiments have ion exchangers such as diethylaminoethyl (DEAE) on their surfaces as ligands. Therefore, it is believed that in order to selectively adsorb the target virus-like particles to the adsorbent while excluding other proteins and nucleic acids, it is necessary to examine conditions such as salt concentration and pH for each sample containing virus-like particles.

[0006] Prior art literature

[0007] Patent Literature

[0008] Patent Document 1: International Publication No. 2015 / 111606 Pamphlet

[0009] Patent Document 2: Japanese Patent Application Laid-Open No. 2017-55766 Summary of the Invention

[0010] Problems to be solved by the invention

[0011] As described above, a method for easily purifying viruses or virus-like particles from other impurities such as proteins and nucleic acids has not yet been established.

[0012] Therefore, an object of the present invention is to provide a method for purifying viruses or virus-like particles in a simple and convenient manner.

[0013] Solutions to Problems

[0014] The present inventors conducted intensive research to address the above-mentioned issues. As a result, they discovered that, among the components contained in a cell lysate containing viruses or virus-like particles, viruses and virus-like particles are less susceptible to adsorption to specific water-insoluble inorganic compounds, while readily and selectively adsorbing to other proteins and nucleic acids. This allows for the inexpensive and simple purification of viruses and virus-like particles, leading to the completion of the present invention.

[0015] The present invention is described below.

[0016] [1] A method for purifying a virus or virus-like particle, the method comprising:

[0017] A step of contacting a liquid containing the virus or virus-like particle with a water-insoluble inorganic compound containing one or more elements selected from magnesium, calcium, and aluminum.

[0018] [2] A method for producing a virus or virus-like particle, the method comprising:

[0019] A step of purifying the virus or virus-like particle by contacting a liquid containing the virus or virus-like particle with a water-insoluble inorganic compound containing one or more elements selected from magnesium, calcium and aluminum.

[0020] [3] The method according to [1] or [2] above, wherein:

[0021] The water-insoluble inorganic compound is one or more selected from the group consisting of magnesium carbonate, magnesium hydroxide, magnesium oxide, calcium sulfate, and aluminum oxide.

[0022] [4] The method according to any one of [1] to [3] above, further comprising:

[0023] A step of contacting a liquid containing the virus or virus-like particles with activated carbon.

[0024] [5] The method according to any one of [1] to [4] above, further comprising:

[0025] The process of purifying the above-mentioned virus or virus-like particles by chromatography.

[0026] [6] The method according to [5] above, wherein:

[0027] The above chromatography method is affinity chromatography.

[0028] [7] The method according to any one of [1] to [6] above, wherein

[0029] The above-mentioned virus or virus-like particle is an adeno-associated virus or a virus-like particle derived from an adeno-associated virus.

[0030] [8] The method according to any one of [1] to [7] above,

[0031] It allows proteins and / or nucleic acids other than the above-mentioned viruses or virus-like particles to be adsorbed on the above-mentioned water-insoluble inorganic compound.

[0032] [9] The method according to any one of [1] to [8] above, wherein

[0033] The above-mentioned liquid is animal cell culture medium or a processed product thereof.

[0034] Effects of the Invention

[0035] The adsorbent used in the method of the present invention is a specific water-insoluble inorganic compound that does not require binding to ion exchange groups, ligands, etc., and is therefore very inexpensive and does not require the labor required to produce adsorbents with ligands on their surfaces. Furthermore, the adsorbent used in the method of the present invention can reduce the total amount of protein and nucleic acid contained in cell lysates containing viruses or virus-like particles, and on the other hand, has low affinity for viruses and virus-like particles, thereby allowing the purification of viruses and virus-like particles. Therefore, the present invention is an industrially excellent technology that can simply and efficiently purify viruses or virus-like particles required for virus identification, gene therapy, vaccine therapy, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 This is a graph showing the quantitative results of total protein and adeno-associated virus when adeno-associated virus was purified from cell lysate using a water-insoluble or water-soluble inorganic compound.

[0037] Figure 2This is a graph showing the quantitative results of total protein and adeno-associated virus when adeno-associated virus was purified from a cell lysate using basic magnesium carbonate as a water-insoluble inorganic compound and varying its concentration.

[0038] Figure 3 This is a graph showing the quantitative results of total protein and adeno-associated virus when adeno-associated virus was purified from cell lysates adjusted to various salt concentrations using basic magnesium carbonate as a water-insoluble inorganic compound.

[0039] Figure 4 This is a graph showing the quantitative results of total protein and adeno-associated virus when adeno-associated virus was purified from a cell lysate using a water-insoluble inorganic compound in the presence or absence of activated carbon.

[0040] Figure 5 This is a graph showing the quantitative results of total protein, adeno-associated virus, and DNA when adeno-associated virus was purified from a cell lysate treated with endonuclease using basic magnesium carbonate as a water-insoluble inorganic compound.

[0041] Figure 6 This is the particle size distribution of light basic magnesium carbonate used in the examples described below.

[0042] Figure 7 This is a graph showing the amount of adeno-associated virus, protein, and DNA in the case where a nucleic acid decomposition solution treated with endonuclease was further treated with the basic magnesium carbonate of the present invention and the case where it was not treated.

[0043] Figure 8 This is a graph showing the relationship between the amount of basic magnesium carbonate and the protein removal rate when a nucleic acid decomposition treatment liquid treated with endonuclease is further treated with the basic magnesium carbonate of the present invention.

[0044] Figure 9 This is a graph showing the particle size distribution of the purified AAV liquid, the pre-treated liquid 1 of Example 6 treated with light basic magnesium carbonate, and the pre-treated liquid 2 of Comparative Example 1 treated with a depth filter and an ultrafiltration membrane.

[0045] Figure 10 This is a graph showing the infectious titers of adeno-associated viruses purified by affinity chromatography using purified AAV solution, pretreatment solution 3 and pretreatment solution 4 of Example 11 treated with light basic magnesium carbonate, and pretreatment solution 5 of Comparative Example 2 treated with a depth filter and an ultrafiltration membrane. DETAILED DESCRIPTION

[0046] Hereinafter, the method of the present invention will be described step by step, but the present invention is not limited to the following specific examples.

[0047] 1. Preparation of virus / virus-like particle-containing liquid

[0048] In this step, a liquid containing the virus or virus-like particles to be purified is prepared. Implementation of this step is optional and is unnecessary when such a liquid has already been obtained.

[0049] Virus-like particles are all or part of the viral coat protein that primarily constitutes the capsid. Since they do not contain nucleic acids, they pose no risk of infection. On the other hand, since they induce an immune response, they can be used as active ingredients in vaccines. It should be noted that in the present invention, "virus or virus-like particle" encompasses not only "either virus or virus-like particle" but also "virus and virus-like particle," provided that both viruses and virus-like particles can be produced during the production process and that mixing the two is not a problem.

[0050] The virus is not particularly limited as long as it is a virus itself or a part thereof to be purified. For example, non-enveloped viruses include adeno-associated viruses, adenoviruses, enteroviruses, parvoviruses, papovaviruses, human papillomaviruses, rotaviruses, coxsackieviruses, sapoviruses, noroviruses, polioviruses, echoviruses, hepatitis A virus, hepatitis E virus, rhinoviruses, and astroviruses. Adeno-associated viruses have an AAV capsid serotype selected from AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, AAV-14, AAV-15, and AAV-16. Enveloped viruses include retroviruses, lentiviruses, Sendai viruses, herpes simplex viruses, vaccinia viruses, measles viruses, baculoviruses, and influenza viruses.

[0051] The virus-containing fluid can be prepared using conventional methods. For example, after sterilizing eggs, incubate them for 10-12 days, inoculate a predetermined amount of the virus strain into the allantoic cavity, and incubate for 2-3 days. The fluid is then cooled for approximately half a day to halt viral growth. The chorioallantoic fluid following viral growth can then be used as the virus-containing fluid.

[0052] The virus-containing liquid can also be produced by the transformation method in the same manner as the virus-like particle-containing liquid. That is, a vector having a nucleic acid encoding a virus or virus-like particle is used to introduce the nucleic acid into a host cell for transformation, and the transformed cells are cultured. Next, the transformed cells are separated from the culture solution by centrifugation and filtration, and the obtained cells are crushed in a buffer solution containing a surfactant or the like. In order to decompose the host-derived nucleic acid, the obtained cell lysate can be treated with a nuclease or the like. According to the method of the present invention, impurities can be effectively removed, thereby reducing the amount of expensive nucleases used. The cell lysate can be subjected to centrifugation and filtration, and the obtained supernatant can be used as a virus-containing liquid or a virus-like particle-containing liquid. The virus-containing liquid or the virus-like particle-containing liquid is preferably adjusted with a buffer solution or the like so that the concentration of the virus or virus-like particles is 10 4 vg / mL and above 10 15 vg / mL or less.

[0053] As host cells to be transformed, conventionally known cells can be used. Examples include animal cells such as HEK293 cells, CHO cells, COS cells, HeLa cells, C127 cells, 3T3 cells, and BHK cells; insect cells such as S2 cells and Sf cells; bacterial cells such as Escherichia coli, Bacillus subtilis, and Bacillus; fungal cells such as yeast and Aspergillus; and plant cells.

[0054] 2. Contact process with water-insoluble inorganic compounds

[0055] In this process, a liquid containing viruses or virus-like particles is brought into contact with a water-insoluble inorganic compound containing one or more elements selected from magnesium, calcium, and aluminum. Impurities other than viruses and virus-like particles are selectively adsorbed onto the water-insoluble inorganic compound, thereby purifying the viruses or virus-like particles. It should be noted that "purification" means a reduction in the proportion of impurities in the viruses or virus-like particles relative to the liquid before contact with the water-insoluble inorganic compound.

[0056] In the present invention, water-insolubility refers to the degree to which the powder of the inorganic compound dissolves within 30 minutes when placed in water and vigorously shaken for 30 seconds every 5 minutes at 20±5°C. Specifically, it means that the amount of water required to dissolve 1 g of the inorganic compound is 400 mL or more.

[0057] The water-insoluble inorganic compound comprises one or more elements selected from magnesium, calcium, and aluminum, and may include insoluble carbonates, insoluble sulfates, oxides, and the like. Preferably, the water-insoluble inorganic compound is one or more elements selected from magnesium carbonate, magnesium hydroxide, magnesium oxide, calcium sulfate, and aluminum oxide. For example, basic magnesium carbonate, which is a mixture of magnesium hydroxide and magnesium carbonate, may also be suitably used. Phosphates are not preferred because they have a high water solubility and may adsorb target viruses or virus-like particles.

[0058] The size of the water-insoluble inorganic compound can be appropriately adjusted, for example, the average particle size can be set to more than 0.1 μm and less than 1000 μm. When the average particle size is less than 1000 μm, the specific surface area of the water-insoluble inorganic compound is large enough to more efficiently adsorb impurities. In addition, when the average particle size is more than 0.1 μm, it is not necessary to consume too much energy for crushing. In addition, from the viewpoint of operability when filled in a column, the above-mentioned average particle size is preferably more than 10 μm. It should be noted that, in the present invention, the average particle size is measured by a laser diffraction particle size distribution measuring device. As the benchmark of the average particle size, there are volume benchmarks, weight benchmarks, number benchmarks, etc., preferably volume benchmarks.

[0059] The shape and structure of the water-soluble inorganic compound are not limited. For example, particles, plates, needles, and tubular compounds can be used. In addition, the specific surface area of the water-insoluble inorganic compound with a porous structure is large, which is beneficial for removing impurities. For example, spherical basic magnesium carbonate (with reference to Japanese Patent Publication No. 2008-137827) formed by the aggregation of gamma-alumina, tubular basic magnesium carbonate, and petal-shaped crystals can be used. It should be noted that gamma-alumina is a cubic alumina with a high specific surface area. Tubular basic magnesium carbonate is a microtubule particle formed by the aggregation of leaf-shaped fine crystals of basic magnesium carbonate, and "MgTube (R)" manufactured by Nippon Steel Corporation can be cited as an example.

[0060] The amount of the water-insoluble inorganic compound used can be adjusted based on the concentration of the virus-containing liquid or virus-like particle-containing liquid. For example, the water-insoluble inorganic compound can be used in an amount of 1 g to 20 g per 100 mL of the virus-containing liquid or virus-like particle-containing liquid. This ratio is preferably 15 g / 100 mL or less. Furthermore, the water-insoluble inorganic compound can be used in an amount of 1% to 20% by mass per 100 mL of the virus-containing liquid or virus-like particle-containing liquid. This ratio is preferably 15% by mass or less.

[0061] The method for contacting the virus-containing liquid or virus-like particle-containing liquid with the water-insoluble inorganic compound can be appropriately selected. For example, the water-insoluble inorganic compound can be added to the virus-containing liquid or virus-like particle-containing liquid and shaken or stirred. The temperature at this time can be room temperature, specifically, from 1°C to 30°C, or from 15°C to 25°C. Furthermore, the contact time can be from 5 seconds to 10 hours.

[0062] After contact, the water-insoluble inorganic compound can be separated from the virus-containing liquid or virus-like particle-containing liquid by centrifugation, filtration, or the like. In this case, the viruses or virus-like particles are primarily dispersed in the liquid component, while all or a portion of the other impurities are primarily adsorbed on the water-insoluble inorganic compound. Furthermore, while some viruses or virus-like particles may be adsorbed on the water-insoluble inorganic compound while some of the other impurities dissolve in the liquid component, this can at least reduce the total amount of impurities in the liquid component, concentrating the viruses or virus-like particles in the liquid component.

[0063] Impurities adsorbed to the water-insoluble inorganic compound in this step are not particularly limited, as long as they are compounds other than viruses and virus-like particles. Examples include damaged viruses or damaged virus-like particles, host cell inclusions, and cell culture inclusions. Host cell inclusions include host cell-derived nucleic acids, plasmids, and host cell-derived proteins. Cell culture inclusions include culture medium components, serum albumin and other serum proteins, and plasmid DNA used for transfection.

[0064] Alternatively, a water-insoluble inorganic compound can be filled into a column, and a virus-containing liquid or virus-like particle-containing liquid can be passed through, thereby causing impurities other than viruses or virus-like particles to be adsorbed by the water-insoluble inorganic compound. In this case, impurity adsorption and separation of liquid components from the water-insoluble inorganic compound can be performed simultaneously. The amount of water-insoluble inorganic compound filled into the column and the flow rate of the virus-containing liquid or virus-like particle-containing liquid are preferably adjusted within a range that allows sufficient adsorption of impurities by the water-insoluble inorganic compound.

[0065] Alternatively, a filter having a layer containing a water-insoluble inorganic compound can be prepared and used to filter a liquid containing viruses or virus-like particles, thereby causing impurities other than viruses or virus-like particles to be adsorbed on the filter. For the layer containing the water-insoluble inorganic compound, the water-insoluble inorganic compound can be deposited solely on the supporting substrate, or the layer containing the water-insoluble inorganic compound can be sandwiched between supporting substrates from above and below. Examples of materials for the supporting substrate layer include one or more water-insoluble media selected from the group consisting of activated carbon; polysaccharides such as cellulose, cellulose acetate, nitrocellulose, agarose, and chitosan; synthetic polymers such as polyacrylonitrile, polyester, polyethersulfone, polypropylene, and polytetrafluoroethylene; and inorganic substances such as diatomaceous earth, perlite, glass, silica, alumina, zirconia, and barium titanate.

[0066] 3. Contact process with activated carbon

[0067] In this step, the liquid containing the virus or virus-like particles is brought into contact with activated carbon. This step can be performed before or after the aforementioned contact step with the water-insoluble inorganic compound, or a combination of the water-insoluble inorganic compound and activated carbon can be used and performed simultaneously.

[0068] Activated carbon is made by burning charcoal, coconut shells, etc. to develop pores and make it porous. It has excellent adsorption properties. The typical specific surface area of activated carbon is 800m 2 / g and above and 2500m 2 / g or less.

[0069] Examples of activated carbon include mineral activated carbon and plant activated carbon. Examples of mineral activated carbon include coal-based activated carbon and petroleum-based activated carbon. Examples of plant-based activated carbon include wood-based activated carbon and coconut shell activated carbon, with wood-based activated carbon being preferred.

[0070] The raw materials of activated carbon are not particularly limited as long as they are carbonaceous materials. Examples thereof include wood such as sawdust, charcoal, ash, peat, peat or wood chips; coconut shells; coal such as lignite, brown coal and anthracite; petroleum pitch; oil carbon; and organic compounds such as rayon, acrylonitrile and phenolic resin.

[0071] The method for producing activated carbon is not particularly limited. Examples include: a liquid activation method in which zinc chloride or phosphoric acid is added to a raw material at high temperature to cause a carbonization reaction at high temperature; and a gas activation method in which the carbonized raw material is reacted with a gas such as water vapor, carbon dioxide, air, or combustion gas at high temperature. Preferred examples include the zinc chloride activation method, the acid activation method using phosphoric acid, and the steam activation method.

[0072] The shape of activated carbon is not particularly limited, and examples thereof include granular activated carbon such as crushed carbon, granular carbon, pelletized carbon, and granular carbon; fibrous activated carbon such as fiber and cloth; specially formed activated carbon such as sheet, molded body, and honeycomb; and powdered activated carbon.

[0073] Activated carbon imparted with a positive or negative charge, and activated carbon modified with a surface modifier such as polyhydroxyethyl methacrylate (PHEMA), heparin, cellulose, or polyurethane are also included in the activated carbon used in the purification method of the present invention. Furthermore, carbon gels produced by the sol-gel method are also included in the activated carbon used in the purification method of the present invention. Examples of raw materials used in the sol-gel method include phenol, melamine, resorcinol, and formaldehyde.

[0074] The average pore diameter of activated carbon is not particularly limited, but is generally 0.1 nm to 20 nm, preferably 0.5 nm to 5.0 nm, more preferably 2.0 nm to 5.0 nm, and even more preferably 3.0 nm to 5.0 nm. The average pore diameter of activated carbon can be calculated using the BJH method using a nitrogen adsorption isotherm curve.

[0075] The purification method using activated carbon of the present invention is not particularly limited to a specific method, and examples thereof include batch methods, membrane treatment methods, and column chromatography. The activated carbon can be appropriately shaped according to the various methods. Depending on the needs, the activated carbon can be used in the form of particles such as particles encapsulated in a porous polymer or gel, membranes such as those adsorbed, fixed, or formed using a support or fiber such as polypropylene or cellulose, or filter cartridges.

[0076] Specific examples of membranes or filter elements containing activated carbon include CUNO (R) Activated carbon filter element, ZetaPlus (R) Activated carbon filter element (Sumitomo 3M); Millistak (R) + Activated carbon filter (Merck Millipore); SUPRA AKS1 filter, AKS1 filter, Stax (TM) AKS1 (all manufactured by Pall Corporation); ADALL (manufactured by UNITIKA Corporation); K filter (R) , activated carbon sheet (all manufactured by Toyobo Co., Ltd.); Hemax (manufactured by Kuraray Co., Ltd.); Hemosorba (R) (Asahi Kasei Medical Co., Ltd.); Hemocolumn (TERUMO Co., Ltd.); or Heselus (Teijin Limited), etc., but not limited thereto. Among them, as a membrane or filter element containing wood-based activated carbon, for example, Zeta Plus (R) Activated carbon filter element (Sumitomo 3M); SUPRA AKS1 filter, AKS1 filter, or Stax (TM) AKS1 (all manufactured by Pall Corporation), etc.

[0077] The packing density, particle size, hardness, loss on drying, ignition residue, specific surface area, pore volume, etc. of the activated carbon used can be appropriately selected.

[0078] The amount of activated carbon used can be adjusted by the concentration of the virus-containing liquid or virus-like particle-containing liquid. For example, 0.5 g to 5 g of activated carbon can be used per 100 mL of the virus-containing liquid or virus-like particle-containing liquid.

[0079] The method for contacting the virus-containing liquid or virus-like particle-containing liquid with activated carbon is the same as for the water-insoluble inorganic compound. Activated carbon can be added to the virus-containing liquid or virus-like particle-containing liquid and shaken or stirred, or the activated carbon can be packed into a column. When this step and the contact step with the water-insoluble inorganic compound are performed simultaneously, the water-insoluble inorganic compound and activated carbon can be used in combination.

[0080] 4. Further purification process

[0081] The above-mentioned contact step with the water-insoluble inorganic compound, or the contact step with the water-insoluble inorganic compound, and the contact step with activated carbon can be repeated two or more times if the virus or virus-like particles cannot be fully purified in one step. The upper limit of the number of repetitions is not particularly limited and can be, for example, 10 times or less, preferably 5 times or less. In addition, if the virus or virus-like particles are not fully purified, an existing purification method can be implemented after the contact step with the water-insoluble inorganic compound, or the contact step with the water-insoluble inorganic compound, and the contact step with activated carbon. In this case, the impurity concentration is reduced by these steps of the present invention, and the target virus or virus-like particles are concentrated, thereby significantly reducing the burden on the existing purification method. Examples of existing purification methods include ultracentrifugation, membrane separation, and chromatography. From the perspective of mass production, membrane separation and chromatography are preferred. In addition, after the contact process with the water-insoluble inorganic compound, in order to decompose the host-derived nucleic acid contained in the liquid containing viruses or virus-like particles, it can be treated with nucleases, etc. Since the method according to the present invention can effectively remove impurities, the amount of expensive nucleases used can be reduced.

[0082] Examples of the chromatography method include affinity chromatography and ion exchange chromatography, with affinity chromatography being particularly preferred. In affinity chromatography, there is no need to adjust the pH or salt concentration of the eluent in advance, and purification can be performed efficiently.

[0083] Typically, cell culture fluids contain a small amount of viruses and a large amount of impurities. Therefore, when purifying viruses or virus-like particles using chromatography, impurities are removed by ultrafiltration or the viruses or virus-like particles are concentrated in advance. Alternatively, after treating a fluid containing viruses or virus-like particles with a water-insoluble inorganic compound according to the present invention, purification by chromatography can be performed without prior ultrafiltration.

[0084] After the virus or virus-like particles are purified, the amount of solvent can be reduced to concentrate the virus or virus-like particles, or the solvent can be replaced.

[0085] By using the purification method of the present invention described above, viruses or virus-like particles with higher purity can be efficiently produced.

[0086] This application claims priority based on Japanese Patent Application No. 2019-125243 filed on July 4, 2019. The entire contents of the specification of Japanese Patent Application No. 2019-125243 filed on July 4, 2019 are incorporated herein by reference.

[0087] Example

[0088] The present invention will be described in more detail below with reference to the following embodiments. However, the present invention is not limited to the following embodiments and can be implemented with appropriate modifications within the scope applicable to the above and following purports, all of which are included in the technical scope of the present invention.

[0089] Example 1

[0090] (1) Preparation of adeno-associated virus (AAV) producing cells

[0091] AAV vector production kit (“AAVpro (R) A plasmid for AAV2 production expressing VENUS (GenBank: ACQ43955.1), a variant of the fluorescent protein GFP, was prepared using the "Helper Free System" manufactured by Takara Bio.

[0092] AAV production was initiated by transfecting cultured HEK293 cells with a plasmid prepared using a transfection reagent ("Polyethylenimine MAX" manufactured by Polysciences, MW: 40,000). Following completion of the culture, the cells were detached and the cell culture fluid was recovered. This fluid was centrifuged, and the supernatant removed to obtain AAV-producing cells.

[0093] (2) Evaluation of the ability of magnesium salts to remove impurity proteins

[0094] The AAV-producing cells obtained in (1) above were suspended in a 0.1% Triton (R)Dulbecco's phosphate buffered saline (manufactured by Sigma-Aldrich, hereinafter referred to as "PBS") in X-100 was stirred in ice for 20 minutes to disrupt the cells. 7.5v / v% of a 1M magnesium chloride aqueous solution and 0.1v / v% of a 25KU / mL nuclease aqueous solution (manufactured by Kaneka Co., Ltd.) were added to the obtained cell disruption solution, and the solution was allowed to stand at 37°C for 30 minutes to decompose the cell-derived nucleic acid. After the reaction, 15v / v% of a 0.5M EDTA solution was added to the reaction solution, followed by centrifugation to recover the supernatant. The obtained supernatant was used as a pretreatment solution. In the pretreatment solution, 100v / v% of PBS and 20w / v% of magnesium sulfate heptahydrate, magnesium chloride, or light basic magnesium carbonate (manufactured by Wako Pure Chemical Industries, Ltd.) were added to the pretreatment solution, and the solution was shaken at 25°C for 1 hour. In addition, as a control, a liquid obtained by diluting the pretreatment solution with PBS without adding additives was also shaken in the same manner. After shaking, centrifugation was performed, the supernatant was recovered, and the AAV amount and total protein amount were quantified. It should be noted that the AAV concentration was determined using the AAV titer quantification kit "(AAVpro (R) The total protein concentration was quantified using a protein colorimetric detection reagent ("Pierce 660nm Protein Assay Reagent" manufactured by Thermo Fisher Scientific) using BSA as a standard. The quantitative results are shown in Tables 1 and Figure 1 .

[0095] [Table 1]

[0096]

[0097] As shown in Table 1 and Figure 1 As shown in the results, in the solution to which basic magnesium carbonate, a water-insoluble magnesium salt, was added, the total protein concentration was low, while the AAV concentration was high. As shown in these results, it was found that the insoluble magnesium salt could significantly remove impure proteins and recover AAV without loss.

[0098] In contrast, in the control example without additives and the examples in which magnesium sulfate heptahydrate and magnesium chloride were added as water-soluble magnesium salts, no effect of reducing impurity proteins was observed, and the AAV concentration was low when a water-soluble magnesium salt was added.

[0099] Example 2: Evaluation of the effect of basic magnesium carbonate addition on the removal rate of impurity protein

[0100] The pretreatment solution was prepared in the same manner as in Example 1. After adding 100 v / v% PBS, 1, 5, 10, or 20 w / v% of basic magnesium carbonate was added relative to the volume of each solution, and the amount of AAV and total protein were quantified. In addition, as a control, the pretreatment solution was diluted with PBS without adding any additives and the evaluation was also performed in the same manner. The results are shown in Tables 2 and 3. Figure 2 .

[0101] [Table 2]

[0102]

[0103] As shown in Table 2 and Figure 2 The results shown in the figure show that, within the range of 1 to 20 w / v% of the solution, the greater the amount of basic magnesium carbonate added, the lower the total protein concentration and the higher the impurity removal effect. Furthermore, a trend was observed in which the AAV concentration decreased with increasing amounts of basic magnesium carbonate added, but at 10 w / v%, a higher AAV concentration was achieved than when no additive was used.

[0104] Example 3: Evaluation of the effect of salt concentration on the removal rate of impurity proteins

[0105] A phosphate buffer solution of pH 7.4 (0.2 g / L dipotassium hydrogen phosphate, 2.9 g / L disodium hydrogen phosphate dodecahydrate) and a 1M sodium chloride-phosphate buffer solution of pH 7.4 (0.2 g / L dipotassium hydrogen phosphate, 2.9 g / L disodium hydrogen phosphate dodecahydrate, 58.4 g / L sodium chloride) were prepared. A pretreatment solution was prepared in the same manner as in Example 1, using the above two phosphate buffers instead of 100 v / v% PBS to prepare an AAV solution with a final sodium chloride concentration of 68.5 mM, 137 mM, 274 mM or 548 mM. 10% by mass of basic magnesium carbonate was added to the solution, and the amount of AAV and the total protein amount were quantified in the same manner as in Example 1. In addition, as a control, a pretreatment solution obtained by diluting with PBS without adding basic magnesium carbonate was also tested in the same manner. The results are shown in Tables 3 and Figure 3 .

[0106] [Table 3]

[0107]

[0108] As shown in Table 3 and Figure 3 The results show that within the sodium chloride concentration range of 68.5 to 548 mM, the lower the sodium chloride concentration before adding basic magnesium carbonate, the lower the total protein concentration, indicating a higher impurity removal effect. On the other hand, the AAV concentration does not seem to be correlated with the sodium chloride concentration.

[0109] Example 4: Impurity Removal Effect of a Combination of a Water-Insoluble Inorganic Compound and Activated Carbon

[0110] A pretreatment solution was prepared in the same manner as in Example 1. After adding 100 v / v% PBS or PBS containing 2% by mass of activated carbon, 10% by mass of a water-insoluble inorganic compound was added relative to the volume of each solution, and the amount of AAV and the total protein were quantified. As the water-insoluble inorganic compound, basic magnesium carbonate, magnesium oxide, magnesium hydroxide, calcium sulfate, or aluminum oxide was used. In addition, as a control, a pretreatment solution obtained by diluting with PBS without adding a water-insoluble inorganic compound was also tested in the same manner. The results are shown in Tables 4 and 5. Figure 4 .

[0111] [Table 4]

[0112]

[0113] As shown in Table 4 and Figure 4 The results show that not only basic magnesium carbonate but also water-insoluble inorganic compounds such as magnesium oxide, magnesium hydroxide, calcium sulfate, and aluminum oxide are effective in removing impurity proteins. These inorganic compounds are used in pharmaceuticals and medical applications and are also suitable for use in the production of biopharmaceuticals. Furthermore, it was found that the impurity removal effect was further enhanced when combined with activated carbon.

[0114] Example 5: Effect of Reduction of Endonuclease Usage by Water-Insoluble Inorganic Compound / Activated Carbon Treatment

[0115] The AAV-producing cells recovered in Example 1 (1) were suspended in a 0.1% Triton (R)X-100 PBS was stirred on ice for 20 minutes to disrupt the cells. 75v / v% of 1M magnesium chloride solution and 0.1v / v% or 0.01v / v% of 250U / mL nucleic acid degrading enzyme aqueous solution ("KANEKA Endonuclease" manufactured by Kaneka Co., Ltd.) were added to the obtained cell disruption solution and allowed to stand at 37°C for 30 minutes to decompose the cell-derived nucleic acid. After the reaction, 15v / v% of 0.5M EDTA solution was added to the reaction solution to prepare a pretreatment solution. For each pretreatment solution, a treatment solution with two conditions, one without adding a water-insoluble inorganic compound or one with only 10% by mass of basic magnesium carbonate, was prepared and shaken at 25°C for 1 hour. After shaking, centrifugation was performed to recover the supernatant. The AAV concentration and total protein concentration of the supernatant were evaluated in the same manner as in Example 1. In addition, the residual DNA derived from HEK293 cells in the supernatant was quantified with reference to the method described in J. Phrama. Biomed. Anal. (2014), 100, 145-149. Specifically, primer 1: GAGGCGGGCGGATCA (sequence number 1), primer 2: CCCGGCTAATTTTTGTATTTTTAGTAG (sequence number 2), and a real-time PCR kit ("Power SYBRTM Green PCR Master Mix" manufactured by Life Technologies) were used, and the analysis was performed using a QuantStudio3 real-time PCR system (manufactured by Life Technologies). As a standard for human-derived DNA, a calibration curve was prepared using Human Genomic DNA (manufactured by GenScript) and the amount of DNA was quantified. The results are shown in Tables 5 and Figure 5 .

[0116] [Table 5]

[0117]

[0118] As shown in Table 5 and Figure 5 The results shown show that the residual amount of host-derived DNA was comparable when using 25 U / mL of nuclease and when using 2.5 U / mL of nuclease with the addition of basic magnesium carbonate. These results demonstrate that when using a water-insoluble inorganic compound, even when the amount of expensive nuclease is reduced to 1 / 10, host-derived DNA can be efficiently removed.

[0119] Example 6: Crude purification of viruses

[0120] (1) Preparation of adeno-associated virus (AAV) producing cells

[0121] AAV vector production kit (“AAVpro (R) A plasmid for AAV production expressing VENUS (GenBank: ACQ43955.1), a variant of the fluorescent protein GFP, was prepared using the "Helper Free System" (manufactured by Takara Bio). The AAV serotype used was any of AAV1, AAV2, AAV5, or AAV6 in the kit.

[0122] The prepared plasmid was transfected into cultured HEK293 cells using a transfection reagent ("Polyethylenimine MAX" manufactured by Polysciences, MW: 40,000) to produce AAV. After completion of the culture, the cells were detached and the cell culture medium was recovered.

[0123] (2) Preparation of nucleic acid decomposition treatment solution

[0124] The surfactant ("Triton (R) X-100”) was added to the AAV culture solution obtained in (1) above, and stirred on ice for 20 minutes to lyse the cells. 7.5 v / v% of 1M magnesium chloride aqueous solution and 0.1 v / v% of nuclease endonuclease (250 KU / mL, manufactured by Kaneka Co., Ltd.) were added to the obtained cell lysate, and the solution was allowed to stand at 37°C for 30 minutes to decompose the cell-derived nucleic acid. The amount of AAV and the amount of total protein were quantified using this as a nucleic acid decomposition treatment solution. The results are shown in Table 6. It should be noted that the AAV concentration was determined using an AAV titer quantification kit (“AAVpro (R) Quantification was performed using Titration Kit (for Real Time PCR) Ver. 2, manufactured by Takara Bio, and total protein concentration was quantified using a protein colorimetric detection reagent (Pierce 660 nm Protein Assay Reagent, manufactured by Thermo Fisher Scientific) using bovine serum albumin (BSA) as a standard.

[0125] (3) Impurity removal using water-insoluble magnesium compounds

[0126] Into a cylindrical polyethylene container having an outer diameter of 12.7 cm and a total height of 23.5 cm, light basic magnesium carbonate (59 g, manufactured by Wako Pure Chemical Industries, Ltd.) and a stirrer were added. The nucleic acid decomposition treatment solution (590 g) obtained in (2) above was further added and stirred at room temperature for 1 hour. It should be noted that the ratio of light basic magnesium carbonate to the nucleic acid decomposition treatment solution was 10 w / w%.

[0127] Next, the mixed solution was filtered through a polyethersulfone filter ("Nalgene Rapid-Flow Sterile Disposable Filter Units" manufactured by Thermo Scientific, pore size: 0.2 μm), and the resulting filtrate was used as the primary filtrate. PBS (59 mL) was added to the remaining filter residue and filtered, and the resulting filtrate was used as the secondary filtrate. The primary filtrate and the secondary filtrate were mixed and used as pretreatment liquid 1, and the amount of AAV and the amount of total protein were quantified under the same conditions as above. In addition, for the nucleic acid decomposition treatment liquid, the amount of AAV and the amount of total protein were also quantified. The results are shown in Table 6.

[0128] [Table 6]

[0129]

[0130] As shown in Table 6, no decrease in AAV levels was observed before and after treatment. On the other hand, the total protein level was significantly reduced, confirming that this method can easily remove cell-derived impurity proteins.

[0131] Furthermore, it was confirmed that not only the cell lysate but also the basic magnesium carbonate particles adsorbed with impurity proteins could be separated from the target AAV by using a 0.2 μm filter.

[0132] (4) Determination of particle size distribution of water-insoluble inorganic compounds

[0133] The light basic magnesium carbonate used in Example 6 (3) was suspended in water, and the particle size distribution was evaluated by a wet method using a particle size distribution measuring device "(Partica LA-960" manufactured by Horiba, Ltd.). The results are shown in Figure 6 .

[0134] As a result, the median diameter was 7.9 μm and the volume-based 10% diameter was 5.2 μm. In other words, it can be considered that if a filter with a pore size of 5 μm or less is used, more than 90% of the basic magnesium carbonate can be separated. In Example 6 (3), AAV passed through a filter with a pore size of 0.2 μm. Therefore, a filter with a pore size of 0.2 to 5 μm can be used to separate the basic magnesium carbonate particles from AAV.

[0135] Comparative Example 1: Virus Crude Purification Using Depth Filters and Ultrafiltration Membranes

[0136] The depth filter ("Supracap 50 capsule with V100P" manufactured by PALL, effective filtration area: 22 cm) was rinsed with a 20 mM Tris + 120 mM NaCl aqueous solution (pH 8.0) 2, pore size: 1-3 μm). Next, the nucleic acid decomposition treatment solution (592 g) obtained in Example 1 (2) was filtered through the depth filter, and the resulting filtrate was recovered as the primary filtrate. Furthermore, a 20 mM Tris + 120 mM NaCl aqueous solution (pH 8.0, 50 mL) was passed through the depth filter, and the resulting filtrate was recovered as the secondary filtrate. The resulting primary filtrate and secondary filtrate were mixed to form a clarified solution.

[0137] A pump system ("AKTA flux S" manufactured by GE Healthcare) and an ultrafiltration membrane ("Suspended-Screen Ultrafiltration Cassettes with Omegatm Membrane: Centramate" manufactured by PALL, membrane area: 0.02 m 2 The clarified solution (647 mL) was concentrated to approximately 50 mL. While maintaining the volume of the concentrate, a 20 mM Tris + 120 mM NaCl + 0.005% Tween 20 + 1 mM MgCl2 aqueous solution (pH 8.1) approximately 8 times the volume of the concentrate was used as the dialysate. Water was continuously added to replace the buffer. After the dialysis was completed, the system was flushed with the dialysate, and the dialyzed liquid was recovered.

[0138] The dialyzed liquid was filtered through a polyethersulfone filter ("Nalgene Rapid-Flow Sterile Disposable Filter Units" manufactured by Thermo Scientific, pore size: 0.2 μm) and used as pretreatment liquid 2. The AAV amount and total protein amount of pretreatment liquid 2 were quantified in the same manner as in Example 6(1). The results are shown in Table 7.

[0139] [Table 7]

[0140]

[0141] As shown in Table 7, although the amount of AAV did not change before and after filtration using the depth filter, the total protein concentration did not decrease significantly, and most of the impurity proteins remained.

[0142] Before and after treatment with the ultrafiltration membrane, the total protein concentration decreased significantly, indicating that impurity proteins were removed. Furthermore, a decrease in the amount of AAV was also observed. Since AAV was also detected in the permeate, it is speculated that the large pore size of the ultrafiltration membrane allowed the AAV to permeate.

[0143] The above results indicate that crude purification using depth filters and ultrafiltration membranes not only requires multiple steps and is complex, but also carries the risk of reducing the AAV recovery rate, even though the total protein amount can be reduced.

[0144] Example 7: Virus purification using affinity chromatography

[0145] The nucleic acid decomposition solution obtained in Example 6 (2) was centrifuged and the supernatant was filtered through a polyethersulfone filter ("Nalgene Rapid-Flow Sterile Disposable Filter Units" manufactured by Thermo Scientific, pore size: 0.2 μm). This was used as the clear solution without pretreatment. The amount of AAV isolated from this clear solution without pretreatment was 1×10 12 vg of liquid was mixed with 9 times the amount of equilibration buffer, and filtered using a filter.

[0146] The resulting filtrate was subjected to affinity chromatography under the following conditions to purify AAV. AAV in the eluate was quantified by quantitative PCR, and the recovery rate relative to the amount of loaded AAV was calculated.

[0147] <Chromatography conditions>

[0148] Column: Tricron 5 / 50 (manufactured by GE Healthcare)

[0149] Carrier: POROS Capture Select AAVX (manufactured by Thermo Scientific), 1 mL

[0150] Flow rate: 0.5 mL / min

[0151] Equilibration buffer: 20 mM Tris-HCl buffer, 0.5 M NaCl (pH 8.0)

[0152] Dissolution buffer: 0.1M citric acid buffer (pH 2.1)

[0153] For comparison, the amount of AAV isolated from the pretreatment solution 1 of Example 1 and the pretreatment solution 2 of Comparative Example 1 was 1×10 12 vg of liquid was mixed with 9 times the amount of equilibration buffer, and the filtrate obtained by filtration was also subjected to the affinity chromatography to quantify the amount of AAV and calculate the AAV recovery rate. The results are shown in Table 8.

[0154] [Table 8]

[0155]

[0156] The results in Table 8 show that the recovery rate of the clarified liquid obtained by the pretreatment according to this example through purification by the subsequent affinity chromatography method is higher than that of the pretreated liquid obtained by depth filtration and ultrafiltration (Comparative Example 1) and the clarified liquid without pretreatment (Comparative Example 2).

[0157] Example 8: Evaluation of treatment conditions using a water-insoluble magnesium compound

[0158] The treatment conditions of the AAV culture medium using the water-insoluble magnesium compound, specifically the addition amount, treatment time, and nuclease concentration, were shown in Table 4, and the AAV recovery rate, protein removal rate, and DNA removal rate were evaluated.

[0159] The surfactant ("Triton (R) X-100”) was added to the AAV culture fluid obtained in Example 6 (1), and stirred in ice for 20 minutes to dissolve the cells. A 7.5 v / v% 1M magnesium chloride aqueous solution was added to the obtained cell lysate, and a nuclease (manufactured by Kaneka Co., Ltd.) was added in a manner of a final concentration of 50 U / mL, 5 U / mL or 0.5 U / mL, and the cell-derived nucleic acid was decomposed by standing at 37°C for 30 minutes. This was used as a nucleic acid decomposition treatment solution. Light basic magnesium carbonate (manufactured by Wako Pure Chemical Industries, Ltd.) was added in a manner of 10 w / v%, 5 w / v% or 1 w / v% relative to 20 mL of each nucleic acid decomposition treatment solution, and the mixture was shaken and stirred at room temperature for 1 minute, 10 minutes or 60 minutes. A polyethersulfone filter ("Nalgene Rapid-Flow Sterile Disposable Filter Units" Thermo Fisher Scientific) was used. The treated liquid was filtered using a PBS (manufactured by Scientific, pore size: 0.2 μm). Hereinafter, the obtained filtrate will be referred to as the primary filtrate. PBS (2 mL) was added to the remaining filter residue and filtered. Hereinafter, the obtained filtrate will be referred to as the secondary filtrate. The primary filtrate and the secondary filtrate were mixed. Hereinafter, the obtained mixed solution will be referred to as pretreatment liquid 3. The amount of AAV and the amount of total protein in pretreatment liquid 3 were quantified under the same conditions as in Example 6 (2). In addition, the amount of residual DNA derived from the host was quantified by the same method as in Example 5.

[0160] In addition, as a control, the nucleic acid decomposition treatment liquid treated with 50 U / mL of endonuclease was treated without basic magnesium carbonate, and the AAV amount, protein amount, and DNA amount were quantified in the same manner. In addition, the AAV recovery rate of each treatment liquid was calculated when the AAV amount of the control was set to 100%. In addition, the protein removal rate and DNA removal rate of each treatment liquid were calculated when the removal rate was set to 0% for the protein amount and DNA amount of the control. The results are shown in Table 9. Figure 7 and Figure 8 .

[0161] [Table 9]

[0162]

[0163] The DNA removal rate was 84% or higher under all conditions, indicating that DNA removal was efficient even when the addition amount, treatment time, and nuclease concentration were at the lowest levels. Figure 8 As shown in FIG, the protein removal rate tends to increase as the amount of basic magnesium carbonate added increases. This suggests that a larger amount is preferred for efficient protein removal.

[0164] Example 9: Determination of AAV Particle Size

[0165] The particle size distribution of the pretreatment solution 1 of Example 6 treated with light basic magnesium carbonate, the pretreatment solution 2 of Comparative Example 1 treated with a depth filter and an ultrafiltration membrane, and the purified AAV solution purified by cation exchange chromatography and anion exchange chromatography was measured using a particle size / molecular size measuring device ("Zetasizer NanoZS" manufactured by Malvern). The results are shown in Tables 10 and 10. Figure 9 .

[0166] [Table 10]

[0167] Particle size Purification of AAV 32.67±10.96nm Pretreatment liquid 1 (Example 6) 34.03±7.826nm Pretreatment liquid 2 (Comparative Example 1) 45.64±11.30nm

[0168] The results of the particle size distribution measurement showed that a peak estimated to be AAV was confirmed at around 30 nm in the purified AAV. In addition, a peak of the same size was also confirmed in pretreatment liquid 1. Based on this result, it can be inferred that AAV was purified into particles of the same size by removing impurities using basic magnesium carbonate. On the other hand, a peak estimated to be AAV was confirmed at around 40 nm in pretreatment liquid 2. It can be inferred that the particle size is larger than that of purified AAV because host-derived proteins and DNA are attached to AAV particles and are observed as large particles.

[0169] In addition, it can be considered that the reason why the purification yield based on affinity chromatography from pretreatment solution 1 in Example 7 is higher than that from pretreatment solution 2 is that the particle size of AAV without impurities attached is small, so AAV and impurities are not likely to clog the pores of the bead carrier.

[0170] Example 10: Evaluation of the infectious titer of purified viruses

[0171] The infectivity titer of AAV contained in the pretreatment solution 1 treated with light basic magnesium carbonate in Example 6 (3) and the pretreatment solution 2 of Comparative Example 1 treated with a depth filter and an ultrafiltration membrane was evaluated.

[0172] Specifically, the pretreatment solution 1 or the pretreatment solution 2 was subjected to affinity chromatography to purify AAV. HEK293 cells were cultured and 4×10 4 Cells / well were seeded in a 96-well plate coated with a high-purity collagen acidic solution "(AteloCell)" (Kokai Kabushiki Kaisha). Cultured overnight at 37°C to allow the cells to adhere to the coated plate. The AAV purified from pretreatment solution 1 or pretreatment solution 2 was diluted with Dulbecco's Modified Eagle Medium (DMEM, manufactured by Thermo Fisher Scientific), the culture medium was removed, replaced with each AAV dilution, and cultured at 37°C. The MOI (Multiplicity Of Infection) at this time was 10,000, and 3 cases were implemented for each. After culture, the fluorescence intensity of the fluorescent protein Venus produced by HEK293 cells infected with AAV was quantified using a Cytation1 cell imaging / multi-mode reader (manufactured by BioTek) (excitation wavelength 485nm, fluorescence wavelength 528nm).

[0173] As a result, the fluorescence intensity was 98392±6247 when infected with AAV purified from pretreatment liquid 1, and 72580±23300 when purified from pretreatment liquid 2. This confirmed that there was no significant difference in fluorescence intensity, and that the AAV purified by the method of the present invention exhibited the same infectivity titer as that of AAV purified by conventional methods.

[0174] Example 11: Removal of impurities from AAV culture fluids containing various serotypes

[0175] By the method described in Example 6, cell lysates of AAV1, AAV2, AAV5, and AAV6 were obtained. 50 mg of basic magnesium carbonate was added to 5 mL of each cell lysate, and the mixture was shaken at room temperature for 1 hour. As a control, each cell lysate without additives was shaken under the same conditions. The supernatant was recovered by centrifugation, and the AAV concentration, protein concentration, and host-derived DNA concentration of the recovered solution were quantified. The results are shown in Table 11.

[0176] [Table 11]

[0177]

[0178] As shown in Table 11, it can be seen that regardless of the serotype, the use of a water-insoluble inorganic compound can efficiently remove proteins and host-derived DNA. Based on these results, it can be concluded that the method of the present invention is independent of the serotype of AAV and is widely applicable.

[0179] Example 12

[0180] Prepare cell disruption solution by the method identical with Example 6, add nuclease (250kU / mL, Co., Ltd. Zhonghua system) in the mode of final concentration being 5U / mL, stand at 37 DEG C for 30 minutes, cell-derived nucleic acid is decomposed.The nucleic acid decomposition treatment solution (260g) obtained and light basic magnesium carbonate (Wako Pure Chemical Industries, Ltd. system, 2.6g) are mixed, stirred at room temperature for 10 minutes.It should be noted that, light basic magnesium carbonate is 1w / w% relative to the ratio of nucleic acid decomposition treatment solution.

[0181] Next, the mixed solution was filtered through a polyethersulfone filter ("Nalgene Rapid-Flow Sterile Disposable Filter Units" manufactured by Thermo Scientific, pore size: 0.2 μm), and the resulting filtrate was used as the primary filtrate. PBS (26 mL) was added to the remaining filter residue and filtered, and the resulting filtrate was used as the secondary filtrate. The primary and secondary filtrates were mixed and used as pretreatment solution 3 to quantify the AAV amount, total protein amount, and residual DNA concentration.

[0182] Separately, light basic magnesium carbonate (Wako Pure Chemical Industries, Ltd., 26 g) and nucleic acid decomposition treatment solution (264 g) were mixed and stirred at room temperature for 10 minutes. Pretreatment solution 4 was similarly obtained, and the AAV amount, total protein amount, and residual DNA concentration were quantified. It should be noted that the ratio of light basic magnesium carbonate to nucleic acid decomposition treatment solution was 10 w / w%. The results are shown in Tables 12 and 13.

[0183] [Table 12]

[0184] Liquid weight Protein concentration DNA concentration AAV concentration AAV amount Before treatment 260g 0.502mg / mL 15.3 ng / mL 7.06E+10vg / mL 1.84E+13vg Pretreatment liquid 3 (Example 11) 256g 0.312 mg / mL 0.01 ng / mL 7.46E+10vg / mL 1.91E+13vg

[0185] [Table 13]

[0186] Liquid weight Protein concentration DNA concentration AAV concentration AAV amount Before treatment 264g 0.502mg / mL 15.3 ng / mL 7.06E+10vg / mL 1.86E+13vg Pretreatment liquid 4 (Example 11) 280g 0.359 mg / mL 0.01 ng / mL 5.83E+10vg / mL 1.63E+13vg

[0187] Comparative Example 2

[0188] The cell lysis solution was prepared by the same method as in Example 6, and a nuclease (250 kU / mL, manufactured by Kaneka Co., Ltd.) was added at a final concentration of 50 U / mL. The cell-derived nucleic acid was decomposed by standing at 37°C for 30 minutes. 532 g of the liquid after the nucleic acid decomposition was filtered by the same method as in Comparative Example 1 to obtain a clear liquid. A pump system ("AKTA flux S" manufactured by GE Healthcare) and an ultrafiltration membrane ("Suspended-Screen Ultrafiltration Cassettes with Omegatm Membrane: Centramate" manufactured by PALL, membrane area: 0.02 m 2 The 5% soluble HCl (pretreatment solution 5) was concentrated and buffer exchanged in the same manner as in Comparative Example 2. This was used as pretreatment solution 5, and the AAV amount, total protein amount, and residual DNA concentration were quantified. The results are shown in Table 14.

[0189] [Table 14]

[0190] Liquid weight Protein concentration DNA concentration AAV concentration AAV amount Before treatment 532g 0.502mg / mL 15.3 ng / mL 7.06E+10vg / mL 3.75E+13vg Pretreatment liquid 5 (Comparative Example 2) 69g 0.275 mg / mL 0.01 ng / mL 3.87E+11vg / mL 2.67E+13vg

[0191] The results in Tables 12 to 14 indicate that in the impurity removal method using light basic magnesium carbonate (pretreatment solution 3 and pretreatment solution 4), even if the amount of endonuclease is set to 1 / 10, the amount of residual DNA can be reduced to the same level as that of pretreatment solution 5.

[0192] Example 13

[0193] AAV was purified from the pretreatment solutions obtained in Example 12 and Comparative Example 2 by affinity chromatography using the same method as in Example 7 (elution buffer: 0.1 M citric acid + 0.5 M NaCl (pH 2.1)).

[0194] The infectious titer of the purified AAV was determined. HEK293 cells were cultured and 4×10 4Cells / well were seeded in a 96-well plate coated with collagen for cell culture ("AteloCell" Co., Ltd.). Cultured overnight at 37°C to allow the cells to adhere to the coated plate. Purified AAV was diluted with DMEM (manufactured by Thermo Fisher Scientific), the culture medium was removed, replaced with diluted AAV, and cultured at 37°C. The MOI (Multiplicity Of Infection) at this time was 10,000, and 3 cases were implemented respectively. After culture, the fluorescence intensity of the fluorescent protein Venus produced by HEK293 cells infected with AAV was quantified using a Cytation1 cell imaging / multi-mode reader (manufactured by BioTek) (excitation wavelength 485nm, fluorescence wavelength 528nm).

[0195] In addition, the infection titer of AAV purified by ultracentrifugation was evaluated as a control. The results are shown in Table 15 and Figure 10 .

[0196] [Table 15]

[0197]

[0198] When the pretreatment solution obtained in Example 12 was subjected to affinity chromatography and the purified AAV was infected into cells, there was no significant difference in fluorescence intensity compared to the case of infection with AAV purified by ultracentrifugation, and the infection titer was approximately the same.

[0199] On the other hand, it is speculated that the AAV purified by subjecting the pretreatment solution obtained in Comparative Example 2 to affinity chromatography had lower fluorescence intensity and lower infectious titer than the AAV purified by ultracentrifugation.

[0200] The above results indicate that the impurity removal method using light basic magnesium carbonate has little effect on the infectious titer of AAV.

[0201] Example 14: Removal of impurities from lentiviral culture medium

[0202] (1) Preparation of lentiviral cell culture supernatant

[0203] To reach 1.5-1.8×10 6The cultured Lenti-X293T cells (manufactured by Takara Bio) were inoculated into 6-well plates coated with collagen for cell culture ("AteloCell" manufactured by Kogyo Co., Ltd.) in a cell / well format. Incubate at 37°C for 24 hours. Use Lipofectamine to transfect the transfer plasmid CS VI-CMV-Venus (reference: WO2018 / 088519) and the packaging plasmid ("3rd Generation pLenti Combo Mix" manufactured by Applied Biological) and incubate at 37°C for 6 hours. Then, replace the culture medium and culture at 37°C for 72 hours to produce lentivirus. The culture supernatant was recovered and filtered with a syringe filter with a pore size of 0.8μm to remove the cells and recover the culture supernatant containing the lentivirus.

[0204] (2) Removal of impurities from lentiviral culture medium

[0205] 50 mg or 500 mg of basic magnesium carbonate was added to 5 mL of the culture supernatant and shaken at room temperature for 1 minute or 1 hour. As a control, each cell lysate without additives was also shaken under the same conditions. During centrifugation, the supernatant was recovered, and the amount of lentivirus in the recovered liquid was evaluated using a simple lentivirus amount determination reagent ("Lenti-X GoStix Plus" manufactured by Takara Bio). In addition, the protein concentration was quantified by the same method as in Example 1. Furthermore, the recovered liquid was centrifuged at 18,000 rpm and 4°C for 2 hours to precipitate the lentivirus. After removing the supernatant, the lentivirus was suspended in PBS at 1 / 10 the amount of the recovered liquid after centrifugation, and the protein concentration was measured as a virus concentrate. The results are shown in Table 16.

[0206] [Table 16]

[0207]

[0208] The lentivirus content of each recovered solution was assessed using a simple lentivirus assay reagent. Lentivirus bands were confirmed in all recovered solutions, indicating recovery. Since no difference in band intensity was observed visually, it was determined that similar amounts of lentivirus were recovered. Furthermore, the protein concentrations of the recovered solutions and the virus concentrate were assessed. As shown in Table 16, the sample supplemented with basic magnesium carbonate had a lower protein concentration.

[0209] From the above results, it was found that the impurity removal method of the present invention using basic magnesium carbonate can also be applied to enveloped viruses such as lentiviruses. Sequence Listing <110> Kaneka Co., Ltd. <120> Method for purifying viruses or virus-like particles <130> B190146 <140> JP2019-125243 <141> 2019-07-04 <160> 2 <210> 1 <211> 15 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 1 gaggcgggcg gatca 15 <210> 2 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 2 cccggctaatttttgtatttttagtag 27

Claims

1. A method for purifying a virus or virus-like particle, the method comprising: A step of contacting a liquid containing the virus or virus-like particle with one or more water-insoluble inorganic compounds selected from magnesium carbonate, magnesium hydroxide, magnesium oxide, and basic magnesium carbonate, so that proteins and / or nucleic acids other than the virus or virus-like particle are adsorbed on the water-insoluble inorganic compound.

2. A method for producing a virus or virus-like particle, the method comprising: A process of contacting a liquid containing the virus or virus-like particles with one or more water-insoluble inorganic compounds selected from magnesium carbonate, magnesium hydroxide, magnesium oxide, and basic magnesium carbonate, and allowing proteins and / or nucleic acids other than the virus or virus-like particles to be adsorbed onto the water-insoluble inorganic compounds, thereby purifying the virus or virus-like particles.

3. The method according to claim 1 or 2, further comprising: A step of contacting a liquid containing the virus or virus-like particles with activated carbon.

4. The method according to claim 1 or 2, further comprising: The process of purifying the virus or virus-like particle by chromatography.

5. The method according to claim 4, wherein The chromatography method is affinity chromatography.

6. The method according to claim 1 or 2, wherein: The virus or virus-like particle is an adeno-associated virus or a virus-like particle derived from an adeno-associated virus.

7. The method according to claim 1 or 2, wherein: The liquid is animal cell culture fluid or a processed product thereof.

Citation Information

Patent Citations

  • Method for producing basic magnesium carbonate particle, and spherical basic magnesium carbonate particle

    JP2008137827A

  • Method for capturing particles of interest from mixture

    JP2017055766A

  • Malware detecting system and malware detecting method

    JP2019125243A

  • Method for producing virus solution and method for detecting virus

    WO2015111606A1

  • Method for producing transgenic cells

    WO2018088519A1