cPLA2e Inducers and Their Uses

Abstract

The present invention relates to cPLA2e inducers and the use of cPLA2e inducers as medicaments, in particular for the treatment of cognitive impairment and / or diseases associated with cognitive impairment, such as dementia, more specifically age-related dementia and / or Alzheimer's disease.

Description

Technical Field

[0001] The present invention relates to cPLA2e inducers and the following uses of cPLA2e inducers: as a medicament, more particularly for the treatment of cognitive impairment and / or diseases associated with cognitive impairment, such as dementia, more specifically age-related dementia and / or Alzheimer's disease. Background Art

[0002] Mild cognitive impairment is characterized by deficits in memory, language, and / or other basic cognitive functions that do not interfere with an individual's daily life. This condition typically progresses to dementia, which is characterized by an overall deterioration of cognitive abilities to the extent that it does interfere with daily life.

[0003] Alzheimer's disease (AD) is the main form of senile dementia today, affecting approximately 50 million people worldwide. The progressive and irreversible cognitive impairment and memory loss that occur in AD, together with the presence of Aβ peptide aggregates and neurofibrillary tangles (NFTs), constitute the main hallmarks of the disease.

[0004] To date, most therapies attempted for AD have focused on targeting one of these two histopathological features, particularly Aβ levels. However, the high failure rate of AD trials (over 99%) and the high costs associated with the disease make it crucial to research AD with the goal of finding new therapies.

[0005] Research on AD has become increasingly complex because there is sometimes a lack of consistency between the appearance of classical AD markers and the symptoms of dementia. In several longitudinal studies, significant AD lesions have been observed in the brains of cognitively normal elderly subjects. These findings suggest that classical AD markers are insufficient to produce dementia and open up the possibility of studying patients with recoverable AD to find new potential targets for AD treatment.

[0006] Cognitive impairment is a condition associated with a large number of brain diseases. Brain diseases can have multiple causes, such as degenerative disorders, genetics, trauma, infections, malnutrition, etc. For example, cognitive impairment may be associated with aging and / or neurodegenerative diseases, such as Alzheimer's disease, Parkinson's disease, Huntington's disease, Amyotrophic Lateral Sclerosis (ALS), psychosis, Parkinson's disease psychosis, Alzheimer's disease psychosis, Lewy-body dementia, prion neurodegenerative diseases such as Creutzfeld-Jacob disease and kuru disease, corticobasal degeneration, frontotemporal degeneration, multiple sclerosis, normal pressure hydrocephalus, organic chronic brain syndrome, Pick's disease, progressive supranuclear palsy, or senile dementia. Cognitive impairment may also have a congenital basis, such as Prader-Willi syndrome, Down syndrome, Fragile X syndrome, Angelman syndrome, and autism spectrum disorders. Cognitive impairment may also be associated with brain trauma, such as chronic subdural hematoma, concussion, stroke, cerebral hemorrhage, or other brain injuries, such as those caused by infections (such as encephalitis, meningitis, and sepsis) or drug poisoning or abuse. Cognitive impairment may also be related to other conditions that damage or otherwise affect the normal function of the central nervous system, including sleep deprivation, mental disorders such as anxiety disorders, dissociative disorders, mood disorders, schizophrenia, psychotropic medication treatment, dopamine agonist treatment, and somatoform and factitious disorders; it may also be associated with conditions of the peripheral nervous system (such as chronic pain). In some cases, the cause of cognitive impairment may be unknown or uncertain.

[0007] Cognitive impairment can manifest in various ways, such as deficits in learning and / or memory, including but not limited to attention, information acquisition, information processing, working memory, short-term memory, long-term memory, anterograde memory, retrograde memory, memory retrieval, discriminative learning, decision-making, language retrieval, inhibitory response control, attentional set shifting, delayed reinforcement learning, reversal learning, temporal integration of voluntary behavior, and expression of interest in its surrounding environment and self-care. Cognitive impairment may be characterized by a progressive loss of memory, cognition, reasoning, executive function, planning, judgment, and emotional stability.

[0008] Despite many advances, the treatment of cognitive impairments associated with brain diseases remains largely inadequate. For diseases such as Huntington's disease, Parkinson's disease, amyotrophic lateral sclerosis, Alzheimer's disease, Prader-Willi syndrome, Lewy body dementia, etc., treatment may be limited or unavailable. Additional treatment options are needed to treat cognitive impairments associated with brain diseases. Summary of the Invention

[0009] Now, the inventors surprisingly disclose that treatment with AAV2 / 9-mPLA2G4E, a viral vector encoding cPLA2e, mediates overexpression of hippocampal PLA2G4E (also known as cytosolic phospholipase A2ε (cPLA2e)), significantly rescued spatial memory impairment in aged APP / PS1 mice two months after stereotactic injection treatment; and it also improved the memory of aged C57BL / 6 / SJL WT mice three months after stereotactic injection treatment.

[0010] Accordingly, in a first aspect, the present invention relates to a nucleic acid construct comprising a nucleotide sequence encoding cytosolic phospholipase A2ε (cPLA2e).

[0011] In a specific embodiment of the nucleic acid construct, the cPLA2e is human cPLA2e; typically human cPLA2e of SEQ ID NO: 1 or SEQ ID NO: 3, or a human variant cPLA2e having at least 70% sequence identity to human cPLA2e SEQ ID NO: 1 or SEQ ID NO: 3.

[0012] In a more specific embodiment of the nucleic acid construct, the nucleotide sequence encoding cPLA2e is SEQ ID NO: 2 or SEQ ID NO: 4.

[0013] In a specific embodiment, the nucleic acid construct further comprises a promoter operably linked to the nucleotide sequence encoding cPLA2e.

[0014] In a more specific embodiment of the nucleic acid construct, the promoter operably linked to the nucleotide sequence encoding cPLA2e is a neuron-specific promoter, particularly, the promoter is a SYN1 promoter or a hybrid SYN1 promoter.

[0015] In a specific embodiment, the nucleic acid construct further comprises a polyadenylation signal sequence; particularly, the polyadenylation signal sequence of the bovine growth hormone gene.

[0016] In a specific embodiment, the nucleic acid construct comprises 5' ITR and 3' ITR sequences; preferably the 5' ITR and 3' ITR sequences of adeno-associated virus, more preferably the 5' ITR and 3' ITR sequences from AAV2 serotype.

[0017] In other embodiments, the nucleic acid construct of the invention is RNA, particularly mRNA.

[0018] In one aspect, the invention relates to a vector comprising the nucleic acid construct of the invention; preferably, the vector is a viral vector; more preferably an AAV vector.

[0019] In one aspect, the invention relates to a viral particle comprising the nucleic acid construct of the invention.

[0020] In a specific embodiment, the viral particle is selected from AAV particles, preferably comprising a capsid protein selected from the group consisting of AAV2, AAV5, AAV9 and AAV TT serotypes.

[0021] In one aspect, the invention also relates to a host cell comprising the nucleic acid construct or expression vector of the invention.

[0022] In another aspect, the invention relates to a method for producing a viral particle, the method comprising:

[0023] a) culturing packaging cells comprising the nucleic acid construct or vector of the invention in a culture medium; and

[0024] b) harvesting viral particles from the cell culture supernatant and / or inside the cells.

[0025] In another aspect, the invention relates to a pharmaceutical composition comprising: the nucleic acid construct, vector or viral particle or host cell of the invention; and a pharmaceutically acceptable carrier or excipient.

[0026] In another aspect, the invention relates to the nucleic acid construct, vector, viral particle or host cell of the invention, or to a pharmaceutical composition comprising the nucleic acid construct, vector, viral particle or host cell used as a drug.

[0027] In another aspect, the invention relates to a cPLA2e inducer used as a drug.

[0028] In a related aspect, the invention relates to a cPLA2e inducer for treating cognitive impairment and / or a disease associated with cognitive impairment in a subject in need thereof.

[0029] In a specific embodiment, the disease associated with cognitive impairment is dementia.

[0030] In a specific embodiment, the disease associated with cognitive impairment is age-related dementia or Alzheimer's disease.

[0031] In a specific embodiment, the cPLA2e inducer is selected from the group consisting of: a) the nucleic acid construct of the present invention; b) a vector comprising the nucleic acid construct of the present invention; c) a viral particle comprising the nucleic acid construct or vector of the present invention; d) a host cell comprising the nucleic acid construct or vector of the present invention; e) a cPLA2e polypeptide or protein; and f) a pharmaceutical composition comprising any one of the following: the nucleic acid construct, a vector comprising the nucleic acid construct, a viral particle comprising the nucleic acid construct or vector, and a cPLA2e polypeptide or protein.

[0032] In a more specific embodiment, the cPLA2e inducer is the nucleic acid construct, vector or viral particle of the present invention, or a pharmaceutical composition comprising the nucleic acid, vector or viral particle.

[0033] In a specific embodiment, the cPLA2e inducer is a protein having cPLA2e activity, preferably the protein of SEQ ID NO: 1 or SEQ ID NO: 3. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 A. Escape latency to the hidden platform in the MWM test at two months after stereotaxic surgery in aged WT (negative control), APP / PS1 sham (sham-injected APP / PS1 mice), and APP / PS1 AAV2 / 9-mPLA2G4E (APP / PS1 mice treated with AAV2 / 9-mPLA2G4E). (Two-way ANOVA test followed by Bonferroni post hoc test, n = 6 - 9, *P ≤ 0.05 APP / PS1 sham vs. WT, **P ≤ 0.01 APP / PS1 sham vs. WT, +P ≤ 0.05 APP / PS1 AAV2 / 9-mPLA2G4E vs. WT, $P ≤ 0.05 APP / PS1 AAV2 / 9-mPLA2G4E vs. APP / PS1 sham and $$P ≤ 0.01 APP / PS1 AAV2 / 9-mPLA2G4E vs. APP / PS1 sham).

[0035] Figure 1B. Percentage of time spent in the correct quadrant during the 15-s and 60-s probe trials on day 6, two months after hippocampal injection, in aged WT, APP / PS1 sham, and APP / PS1 AAV2 / 9-mPLA2G4E. (One-way ANOVA followed by Newman-Keuls post hoc test, n = 6 - 9, *P ≤ 0.05 APP / PS1 sham vs. WT, **P ≤ 0.01 APP / PS1 sham vs. WT and $P ≤ 0.05 APP / PS1 AAV2 / 9-mPLA2G4E vs. APP / PS1 sham).

[0036] Figure 2 A. Representative Golgi staining images of apical dendrites of CA1 hippocampal pyramidal neurons in aged WT (negative control), APP / PS1 sham (mice with sham injection of APP / PS1), and APP / PS1 AAV2 / 9-mPLA2G4E (APP / PS1 mice treated with AAV2 / 9-mPLA2G4E). Scale bar = 10 μm.

[0037] Figure 2 B. Tissue blots showing quantification of spine density in CA1 hippocampal pyramidal neurons from WT, APP / PS1 sham, and AAV2 / 9-PLA2G4E-treated mice (One-way ANOVA followed by Newman-Keuls post hoc test, n = 4, +p ≤ 0.05 WT vs. APP / PS1 AAV2 / 9-PLA2G4E, $p ≤ 0.05 APP / PS1 sham vs. APP / PS1 AAV2 / 9-PLA2G4).

[0038] Figure 3 A. Escape latency to the hidden platform, three months after hippocampal injection by stereotaxic surgery, in aged WT sham (mice with sham injection of C57BL / 6 / SJL WT) and WT AAV2 / 9-mPLA2G4E (C57BL / 6 / SJL WT mice treated with AAV2 / 9-mPLA2G4E) in the MWM test (Two-way ANOVA followed by Bonferroni post hoc test, n = 4 - 5).

[0039] Figure 3 B. Percentage of time spent in the correct quadrant during the 15-s and 60-s probe trials on day 5, three months after stereotaxic surgery, in aged WT sham and WT AAV2 / 9-mPLA2G4E mice. (One-way ANOVA followed by Newman-Keuls post hoc test, n = 4 - 5, *P ≤ 0.05 WT AAV2 / 9-mPLA2G4E vs. WT sham).

[0040] Figure 4 A. The figure shows the experimental design of a fear conditioning paradigm used to elucidate the role of PLA2G4E in memory function. The graphs represent the percentage of freezing behavior of TT mice during the training and testing phases, respectively.

[0041] Figure 4 B. pCREB levels measured by immunoblotting of hippocampal extracts and normalized against β-actin (one-way ANOVA test followed by Newman-Keuls post hoc test, n = 7 - 8, **P ≤ 0.01 versus TT, ++P ≤ 0.01 T24 versus TT).

[0042] Figure 4 C. PLA2G4E levels measured by immunoblotting of hippocampal extracts and normalized against β-actin (one-way ANOVA test followed by Newman-Keuls post hoc test, n = 7 - 8, **P ≤ 0.01 versus TT, ++P ≤ 0.01 T24 versus TT).

[0043] Figure 5 . Levels of pCREB, pGluA1, synapsin I, and PLA2G4E measured by immunoblotting and normalized against β-actin in primary neuron cultures treated with bicuculline (Bic) and / or AAV9-shPLA2G4E (shPLA) (one-way ANOVA test followed by Newman-Keuls post hoc test, n = 3 - 6, **P ≤ 0.01, ***P ≤ 0.001 control versus Bic; ++P ≤ 0.01 control versus shPLA; $P ≤ 0.05, $$P ≤ 0.01, $$$P ≤ 0.001 Bic versus shPLA + Bic). Data are represented as arbitrary units relative to control (mean ± SEM). Detailed Description

[0044] In one aspect, the present invention relates to a cytosolic phospholipase A2ε inducer for use as a medicament, and more particularly, for treating cognitive impairments and / or diseases associated with cognitive impairments in a subject in need thereof.

[0045] As used herein, the terms “cytosolic phospholipase A2ε” and “phospholipase A2 group IVE”, “PLA2G4E” or “cPLA2e” refer interchangeably to a calcium-dependent enzyme member of the cytosolic phospholipase A2 group IV family that selectively hydrolyzes the sn-2 position of glycerophospholipids. Members of this family are involved in regulating membrane tubule-mediated trafficking. This enzyme plays a role in trafficking through the clathrin-independent endocytic pathway. The enzyme regulates the recycling process by forming tubules that transport internalized clathrin-independent cargo proteins back to the cell surface (Capestrano M. et al. Journal of Cell Science 2014;127:977–993). PLA2G4E can use phosphatidylethanolamine (PE) as an acyl chain donor to catalyze the calcium-dependent formation of N-acyl phosphatidylethanolamine (NAPE) (Ogura Y. et al. Nat Chem Biol. 2016;12(9):669–671). Human cPLA2e is naturally encoded by the PLA2G4E gene; human cPLA2e is recorded in, for example, UniprotKB (https: / / www.uniprot.org / ), entry accession number Q3MJ16. This entry describes 2 isoforms generated by alternative splicing: a) isoform 1 (identifier: Q3MJ16-3), which was selected as the “canonical” sequence (SEQ ID NO: 1); b) isoform 2 (identifier: Q3MJ16-2), which differs from the canonical sequence in that it lacks amino acids 1–376 in isoform 2 (SEQ ID NO: 3). The term “cPLA2e” refers to the enzyme and any additional co-translational or post-translational modifications thereof.

[0046] As used herein, the term “cPLA2e inducer” refers to a reagent (molecule or composition) that directly or indirectly causes an increase in cPLA2e activity within a cell when administered to the cell; in particular, a reagent that causes an increase in the expression of the cPLA2e enzyme, such as a cPLA2e transgene (i.e., a nucleotide sequence encoding cPLA2e) or an expression product of said transgene.

[0047] Nucleic acid construct

[0048] In one embodiment, the cPLA2 inducer for use in the present invention is a nucleic acid construct or comprises a nucleic acid construct that comprises a nucleotide sequence encoding cytosolic phospholipase A2ε (cPLA2e).

[0049] Thus, in another aspect, the present invention relates to a nucleic acid construct that comprises a nucleotide sequence encoding cytosolic phospholipase A2ε (cPLA2e).

[0050] The terms "nucleic acid" and "polynucleotide" or "nucleotide sequence" are used interchangeably herein and refer to any molecule composed of or containing monomeric nucleotides. Nucleic acids can be oligonucleotides or polynucleotides. Nucleotide sequences can be DNA or RNA. Nucleotide sequences can be chemically modified or artificial. Nucleotide sequences include peptide nucleic acids (PNAs), morpholinos, and locked nucleic acids (LNAs), as well as glycol nucleic acids (GNAs) and threose nucleic acids (TNAs). Each of these sequences is distinguished from naturally occurring DNA or RNA by a change in the molecular backbone. Additionally, phosphorothioate nucleotides can be used. Other deoxynucleotide analogs include methylphosphonates, aminophosphonates, dithiophosphates, N3'P5'-aminophosphonates, and oligoribonucleotide phosphorothioates, and 2'-O-allyl analogs of the nucleotides useful in the present invention and 2'-O-methyl ribonucleotide methylphosphonates.

[0051] As used herein, the term "nucleic acid construct" refers to a non-naturally occurring nucleic acid produced using recombinant DNA techniques. In particular, a nucleic acid construct is a single-stranded or double-stranded nucleic acid molecule that has been modified to contain fragments of nucleic acid sequences that are combined or juxtaposed in a manner not found in nature.

[0052] In some embodiments, the nucleic acid construct of the present invention comprises a nucleotide sequence encoding a naturally occurring cPLA2e (wild-type cPLA2e); the naturally occurring cPLA2e (wild-type cPLA2e) is, for example, a naturally occurring human cPLA2e (such as isoform 1 or 2), a cPLA2e known in primates, rodents, or other mammals. In some embodiments, cPLA2e is a variant, peptide, or polypeptide that contains substitutions, insertions, and / or additions, deletions, and / or covalent modifications relative to a naturally occurring cPLA2e (usually relative to human cPLA2e isoform 1 or 2). In some embodiments, the cPLA2e encoded by the nucleic acid construct of the present invention is a fusion protein or polypeptide, where some amino acids (such as tags) or polypeptides (such as carrier polypeptides) can be added to the encoded cPLA2e (e.g., at the N-terminus or C-terminus), for example, for localization or targeting. In some embodiments, the cPLA2e encoded by the nucleic acid construct is a cPLA2e fragment, where amino acid residues located in the carboxyl, amino terminus, or internal region of cPLA2e (usually human cPLA2e isoform 1 or 2) can optionally be deleted.

[0053] In one embodiment, the nucleic acid construct of the invention comprises a nucleotide sequence encoding: human cPLA2e, preferably human cPLA2e of SEQ ID NO: 1 or SEQ ID NO: 3 corresponding to isotype 1 or 2, respectively; or a human variant cPLA2e having at least 70%, 75%, 80%, 85%, 90%, 95% or 99% sequence identity to the coding sequence of a naturally occurring cPLA2e or recombinant cPLA2e (usually relative to human cPLA2e SEQ ID NO: 1 or SEQ ID NO: 3).

[0054] As recognized by those skilled in the art, human cPLA2e isotype 1 or 2 protein fragments, functional protein domains, variants and homologous proteins (orthologs) are also considered to be within the scope of cPLA2e of the nucleic acid constructs of the invention. It should be understood that different embodiments of cPLA2e have cPLA2e activity that is substantially the same as that of human cPLA2e isotype 1 or 2. Substantially the same activity can be, for example, up to ±5% of the activity, including ±4% of the activity, ±3% of the activity, ±2% of the activity, ±1% of the activity or less.

[0055] As described above, cPLA2e is a calcium-dependent enzyme member of the cytosolic phospholipase A2 group IV family that selectively hydrolyzes the sn-2 position of glycerophospholipids. It has been described as exhibiting very low phospholipase (PLA) activity. Instead, it has been shown to have calcium-dependent N-acyltransferase (Ca-NAT) activity that produces N-acyl phosphatidylethanolamine (NAPE) and N-acylethanolamine (NAE) in mammalian cells. Its transacylase properties are related to serine hydrolase activity (Ogura et al., Nat Chem Biol. 2016, 12(9), 669-671).

[0056] Ca-NAT activity can be determined by measuring NAPE production in a biological sample (such as a cell lysate). For example, the production of N-C16:0DOPE in a reaction of DPPC (40 μM) and DOPE (75 μM) for 30 minutes at 37 °C in the reaction mixture with or without the addition of CaCl2 (3 mM). In the calculation of calcium-dependent activity, the calcium-independent activity is subtracted. Alternatively, targeted analysis of NAPE production (such as NAPE containing 13 C16:0) can be carried out by incubating mammalian cells (such as HEK293T cells) in serum-containing medium with or without 2 μM ionomycin. Before lipid extraction, the cells are incubated at 37 °C for a period of time (such as 30 minutes). The extracted lipids can be separated by chromatography and analyzed by mass spectrometry (such as LC-MS / MS).

[0057] In a preferred embodiment of the nucleic acid construct of the present invention, the nucleotide sequence encoding cPLA2e is: SEQ ID NO: 2 or SEQ ID NO: 4; or a variant nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90% or at least 95% identity relative to SEQ ID NO: 2 or 4.

[0058] As used herein, the term "sequence identity" or "identity" refers to the number of matches (identical nucleic acid residues or amino acid residues) in positions from an alignment of two polynucleotide sequences or two polypeptide sequences. Sequence identity is determined by comparing the sequences when aligned so as to maximize overlap and identity while minimizing sequence gaps. In particular, depending on the lengths of the two sequences, any of a variety of mathematical global or local alignment algorithms can be used to determine sequence identity. Sequences of similar length are preferably aligned using a global alignment algorithm (e.g., the Needleman and Wunsch algorithm; Needleman and Wunsch, 1970, J Mol Biol.; 48(3):443-53), which aligns the sequences optimally over their entire length, while sequences of significantly different lengths are preferably aligned using a local alignment algorithm (e.g., the Smith and Waterman algorithm (Smith and Waterman, 1981, J Theor Biol.; 91(2):379-80) or the Altschul algorithm (Altschul SF et al., 1997, Nucleic Acids Res.; 25(17):3389-402; Altschul SF et al., 2005, Bioinformatics; 21(8):1451-6)). Alignments for determining the percentage nucleic acid sequence identity can be achieved in a variety of ways within the skill in the art, e.g., using publicly available computer software obtainable on Internet websites such as http: / / blast.ncbi.nlm.nih.gov / or http: / / www.ebi.ac.uk / Tools / emboss / . Those skilled in the art can determine appropriate parameters for measuring the alignment, including any algorithm needed to achieve maximal alignment over the full length of the sequences being compared. For the purposes of this disclosure, the nucleic acid sequence identity % value refers to the value produced using the pairwise sequence alignment program EMBOSS Needle, which uses the Needleman-Wunsch algorithm to create an optimal global alignment of two sequences, with all search parameters set to default values, i.e., scoring matrix = BLOSUM62, gap open = 10, gap extend = 0.5, end gap penalty = false, end gap open = 10, end gap extend = 0.5.

[0059] The nucleic acid constructs described herein can have different uses: among others, the nucleic acid constructs can be used to generate viral vectors for gene therapy, or to generate non-viral vectors also for gene therapy, such as nucleic acid constructs having an mRNA structure.

[0060] In one embodiment, a nucleic acid construct according to the invention comprises a nucleotide sequence encoding cPLA2e and at least a nucleic acid element suitable for its expression in a host cell.

[0061] For example, in one embodiment, the nucleic acid construct comprises a nucleotide sequence encoding cPLA2e and one or more control sequences required for the expression of said coding sequence in a relevant target cell type or tissue. Generally, the nucleic acid construct comprises a coding sequence and regulatory sequences required for the expression of the selected gene product before (5' non-coding sequence) and after (3' non-coding sequence) the coding sequence. Thus, in a specific embodiment, the nucleic acid construct comprises at least: (ii) a promoter; (i) a nucleotide sequence encoding cPLA2e under the control of the promoter; and (iii) a 3' untranslated region that typically contains a polyadenylation signal sequence and / or a transcription terminator. The nucleic acid construct may also comprise additional regulatory elements, such as enhancer sequences, introns, microRNA targeting sequences, a multiple cloning site for facilitating the insertion of a DNA fragment into a vector and / or a splicing signal sequence.

[0062] Promoter

[0063] In one embodiment, the nucleic acid construct of the invention further comprises a promoter. The promoter initiates the expression of the transgene after introduction into the host cell.

[0064] As used herein, the term "transgene" refers to a nucleic acid molecule, DNA or cDNA encoding a gene product used as an active ingredient in gene therapy. The gene product can be RNA, a peptide or a protein; the transgene can encode a natural gene product or a recombinant non-naturally occurring gene product, for example, cPLA2e.

[0065] As used herein, the term "promoter" refers to a regulatory element that directs the transcription of a nucleic acid (transgene) operably linked to the promoter. The promoter can regulate the rate and efficiency of transcription of the operably linked nucleic acid. The promoter can also be operably linked to other regulatory elements that enhance ("enhancer") or inhibit ("repressor") the promoter-dependent transcription of the nucleic acid. These regulatory elements include, but are not limited to, transcription factor binding sites, repressor and activator protein binding sites, and any other nucleotide sequences known to those skilled in the art that act directly or indirectly to regulate the amount of transcription through the promoter, including, for example, attenuators, enhancers and silencers. The promoter is located near the transcription start site of the gene or coding sequence operably linked to it, upstream (towards the 5' region of the sense strand) on the same strand of the DNA sequence. The length of the promoter can be about 100 - 1000 base pairs. Positions in the promoter are designated relative to the transcription start site of a particular gene (i.e., upstream positions are negative numbers counted backwards from -1, for example, -100 is the position 100 base pairs upstream).

[0066] As used herein, the term "operably linked" refers to the joining of polynucleotide (or polypeptide) elements in a functional relationship. A nucleic acid is "operably linked" when placed into a functional relationship with another nucleic acid sequence. For example, a promoter or transcriptional regulatory sequence is operably linked to a coding sequence if it affects the transcription of the coding sequence. Operably linked means that the polynucleotide sequences being joined are generally contiguous; and in the case of joining two protein coding regions, the polynucleotide sequences are contiguous and in frame.

[0067] In one embodiment, the nucleic acid construct of the present invention further comprises a promoter operably linked to the nucleotide sequence encoding cPLA2e.

[0068] In one embodiment, the promoter operably linked to the cPLA2e coding sequence is a heterologous promoter. As used herein, the term "heterologous" when used as an attribute of a nucleotide or peptide sequence (such as a heterologous promoter, heterologous enhancer, etc.) refers to a sequence that is not naturally operably linked to another nucleotide or peptide sequence; in this specific case, a "heterologous promoter" means that the promoter sequence is not the promoter sequence that is naturally operably linked to the nucleotide sequence encoding cPLA2e.

[0069] Typically, such a promoter can be a tissue or cell type-specific promoter, or an organ-specific promoter, or multiple organ-specific promoters or a systemic or ubiquitous promoter.

[0070] In a specific embodiment, the nucleic acid construct of the present invention further comprises a promoter operably linked to the nucleotide sequence encoding cPLA2e, and wherein the promoter directs the expression of the encoded cPLA2e at least in hippocampal neurons.

[0071] In a specific embodiment of the nucleic acid construct of the present invention, the promoter operably linked to the nucleotide sequence encoding cPLA2e is a neuron-specific promoter.

[0072] As used herein, the term "specific promoter" refers to a promoter whose activity is not necessarily limited to a single cell type, but still shows selectivity in that it is active in one class of cells or tissues and less active or silent in another class of cells or tissues. However, it is preferred that the promoters of the nucleic acid constructs of the present invention exhibit strict cell specificity in that they are only active at a detectable level in neuronal cells.

[0073] Thus, as used herein, a "neuron-specific promoter" is a promoter that controls the expression of a gene that is expressed uniquely or predominantly in neuronal cells or cells derived from neuronal cells. A neuron-specific promoter directs the expression of a gene in neuronal cells or cells derived from neuronal cells, but substantially does not direct the expression of the same gene in other cell types such as glial cells, and thus has neuron-specific transcriptional activity. In some cases, there may be some low-level expression in other cell types, but such expression is significantly lower than the expression in neuronal cells. For example, the expression in neuronal cells can be at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, or at least 10-fold the expression level in other cells. Such a promoter can be a strong promoter, or such a promoter can be a weak promoter, and it can direct the constitutive expression of a gene in neuronal cells or cells derived from neuronal cells, or it can direct the expression in response to certain conditions, signals, or cellular events.

[0074] Thus, a neuron-specific promoter allows the gene linked thereto to be actively expressed in neurons and prevents the gene linked thereto from being expressed in other cells or tissues.

[0075] In a more specific embodiment of the nucleic acid construct of the present invention, the promoter operably linked to the nucleotide sequence encoding cPLA2e is a neuron-specific promoter selected from the group consisting of: synapsin 1 (SYN1) gene promoter (Kügler S et al. Gene Ther. 2003; 10(4): 337-47), neuron-specific enolase (NSE) gene promoter (Forss-Petters S et al. Neuron. 1990; 5(2): 187-97; Twyman RM et al. J Mol Neurosci. 1997; 8(1): 63-73), Hb9 gene promoter (Eur J Neurosci. 1997; 9: 452; J Neurosci Res. 2000; 59: 321), prion protein (Prnp) gene promoter (Weber P et al. Eur J Neurosci. 2001; 14: 1777), α-calcium-calmodulin-dependent kinase II (CaMKIIα) gene promoter (Dittgen T et al. Proc Natl Acad Sci U S A. 2004; 101: 18206-18211), methyl CpG-binding protein 2 (MECP2) gene promoter (Adachi M. et al. Hum Mol Genet. 2005; 14(23): 3709-3722; Gray S.J. et al. Hum Gene Ther. 2011; 22(9): 1143–1153), and tubulin a1 (Tal) gene promoter (Gloster A. et al. J Neurosci. 1994; 14: 7319).

[0076] Generally, such promoters (especially the neuron-specific promoters of the above-mentioned selected group) can be: a complete promoter, which includes core, proximal, and distal promoter elements; a fragment of a promoter, such as a core promoter, or any other fragment sufficient to direct gene expression in a target cell, tissue, or organ; or a chimeric or hybrid promoter, such as a promoter that includes a gene core promoter and a heterologous enhancer sequence from another gene or synthetic. The term "core promoter" as used herein refers to the minimal portion of a promoter required for correct initiation of transcription. It consists of the transcription start site and the functional sequence for binding to the transcription initiation complex (TATA box) in a cell or host organism. Non-limiting examples of suitable neuron-specific hybrid promoters are: a hybrid promoter based on the SYN1 promoter, such as a hybrid promoter generated by the fusion of promoter elements of SYN1 and the CMV gene (e.g., Matsuzaki Y. et al. J Neurosci Methods 2014; 223: 133-143); the Hb9 promoter, such as the mouse Hb9 enhancer fused with the Hsp68 minimal promoter (Singh NR et al. Exp Neurol. 2005; 196(2): 224-234) or the CMV minimal promoter (Lukashchuk V. et al. Mol Ther Methods Clin Dev. 2016; 3: 15055), etc.

[0077] In one embodiment of the nucleic acid construct of the present invention, the promoter operably linked to the nucleotide sequence encoding cPLA2e is the SYN1 promoter or a hybrid SYN1 promoter, such as a hybrid SYN1 promoter containing a core SYN1 promoter fused with a CMV gene promoter element.

[0078] In one embodiment, the nucleic acid construct of the present invention comprises a hybrid SYN1 promoter operably linked to a nucleotide sequence encoding cPLA2e (usually cPLA2e of SEQ ID NO: 1 or 3); wherein preferably, the coding nucleotide sequence is SEQ ID NO: 2 or 4.

[0079] All of these promoter sequences have the property of allowing the cPLA2e encoded by the nucleic acid construct to be expressed at least in hippocampal neurons.

[0080] In a specific embodiment, the promoter for the nucleic acid construct of the present invention can be a chemically inducible promoter. As used herein, a chemically inducible promoter is a promoter that is regulated by administering a chemical inducer to the body of the subject in need thereof. Examples of suitable chemically inducible promoters include, but are not limited to, the tetracycline / minocycline inducible promoter (Chtarto 2003, Neurosci Lett. 352:155–158) or the rapamycin inducible system (Sanftner 2006, Mol Ther. 13:167–174).

[0081] Polyadenylation signal

[0082] The nucleic acid construct embodiment may also comprise a polyadenylation signal sequence; and may or may not contain other optional nucleotide elements. As used herein, the term "polyadenylation signal" or "poly(A) signal" refers to a specific recognition sequence within the 3' untranslated region (3'UTR) of a gene, which is transcribed into a precursor mRNA molecule and guides the termination of gene transcription. The Poly(A) signal serves as a signal for endonucleotide cleavage of the newly formed precursor mRNA at its 3'-end and adds an RNA fragment consisting only of adenine bases to this 3'-end (the polyadenylation process; poly(A) tail). The poly(A) tail is important for the nuclear export, translation, and stability of mRNA. In the context of the present invention, the polyadenylation signal is a recognition sequence that can direct the polyadenylation of mammalian genes and / or viral genes in mammalian cells.

[0083] The Poly(A) signal generally consists of a) the consensus sequence AAUAAA and b) additional elements upstream and downstream of AAUAAA. The consensus sequence AAUAAA has been shown to be essential for 3'-end cleavage and polyadenylation of precursor messenger RNA (pre-mRNA) and for promoting downstream transcription termination. The additional elements control the efficiency of utilization of AAUAAA as a poly(A) signal. There is considerable variability in these motifs in mammalian genes.

[0084] In one embodiment, optionally in combination with one or more features of the various embodiments described above or below, the polyadenylation signal sequence of the nucleic acid construct of the present invention is a polyadenylation signal sequence of a mammalian gene or a viral gene. Suitable polyadenylation signals include the SV40 early polyadenylation signal, the SV40 late polyadenylation signal, the HSV thymidine kinase polyadenylation signal, the protamine gene polyadenylation signal, the adenovirus 5E1b polyadenylation signal, the growth hormone polyadenylation signal, the PBGD polyadenylation signal, computer-designed polyadenylation signals (synthetic), etc.

[0085] In a specific embodiment, the polyadenylation signal sequence of the nucleic acid construct is based on the polyadenylation signal sequence of the bovine growth hormone gene.

[0086] In a specific embodiment, the nucleic acid construct according to the present invention comprises a hybrid SYN1 promoter operably linked to a nucleotide sequence encoding cPLA2e of SEQ ID NO: 1 or 3 and a polyadenylation signal sequence of the bovine growth hormone gene; in a preferred embodiment, the nucleotide sequence encoding said cPLA2e is SEQ ID NO: 2 or 4.

[0087] Nucleic acid construct having an mRNA structure

[0088] In some embodiments, the nucleic acid construct of the present invention is RNA. In certain aspects, the nucleic acid construct has the structure of mRNA. In certain aspects, the mRNA can be modified. Modifications of mRNA nucleic acids are described in more detail in US Patent Publications US20140206752, US20150086614, and US20160304552 and PCT Publications WO2016011226, WO2016014846, and WO2016011203. Among them are chemically modified nucleobases, sugars, backbones, or any combination thereof, patterned untranslated regions (UTRs), microRNA (miRNA) binding sites, etc.

[0089] Thus, in some embodiments, a nucleic acid construct comprising a nucleotide sequence encoding cPLA2e may further comprise at least one of the following features: a) a 5' cap structure; b) a 5' UTR; or c) a 3' UTR. In one aspect, the polynucleotide further comprises two features. In one aspect, the polynucleotide may further comprise all three of these features. The UTR may be homologous or heterologous to the nucleotide sequence encoding cPLA2e.

[0090] The untranslated region (UTR) is the nucleic acid portion of a polynucleotide that is not translated before the start codon (5' UTR) and after the stop codon (3' UTR). In some embodiments, the nucleic acid construct of the present invention comprising a nucleotide sequence encoding cPLA2e further comprises a UTR (e.g., a 5' UTR or a functional fragment thereof, a 3' UTR or a functional fragment thereof, or a combination thereof).

[0091] In some embodiments, the nucleic acid construct comprises two or more 5'UTRs or functional fragments thereof, each having the same or a different nucleotide sequence. In some embodiments, the nucleic acid construct comprises two or more 3'UTRs or functional fragments thereof, each having the same or a different nucleotide sequence. In some embodiments, the 5'UTR or functional fragment thereof, 3'UTR or functional fragment thereof, or any combination thereof is sequence-optimized. In some embodiments, the 5'UTR or functional fragment thereof, 3'UTR or functional fragment thereof, or any combination thereof comprises at least one chemically modified nucleobase, such as 1-methylpseudouridine or 5-methoxyuridine. In some embodiments, the functional fragment of the 5'UTR or 3'UTR comprises one or more regulatory features of the full-length 5'UTR or 3'UTR, respectively.

[0092] By engineering features typically found in highly expressed genes in a particular target cell / tissue / organ, the stability of the polynucleotide and protein production in that particular target cell / tissue / organ can be enhanced.

[0093] In some embodiments, the 5'UTR and 3'UTR can be heterologous. In some examples, the 5'UTR can be derived from a different species than the 3'UTR.

[0094] Publication number WO / 2014 / 164253 (incorporated herein by reference in its entirety) provides a list of exemplary UTRs that can be used as flanking regions of the nucleotide sequence encoding cPLA2e in the polynucleotides of the present invention.

[0095] Wild-type UTRs from any gene or mRNA can be incorporated into the nucleic acid constructs of the present invention. In some embodiments, the UTR can be altered relative to the wild-type or native UTR to produce a variant UTR, for example, by altering the orientation or position of the UTR relative to the coding nucleotide sequence; or by including additional nucleotides, nucleotide deletions, nucleotide exchanges, or transpositions. In some embodiments, variants of the 5'UTR or 3'UTR can be utilized, such as mutants of the wild-type UTR, or variants in which one or more nucleotides are added to or removed from the end of the UTR. Additionally, one or more synthetic UTRs can be used in combination with one or more non-synthetic UTRs. See, e.g., Mandal and Rossi, Nat. Protoc. 2013 8(3):568-82, and the sequences available from www.addgene.org / Derrick_Rossi / , the contents of each being incorporated herein by reference in their entirety.

[0096] The 5' cap structure of native mRNA participates in nuclear export, increases mRNA stability and binds to mRNA cap-binding proteins (CBPs). This 5' cap structure is responsible for the stability and translational ability of mRNA in cells by forming mature circular mRNA-like structures through the linkage of CBPs with poly(A)-binding proteins. The cap also helps to remove 5'-proximal introns during mRNA splicing. Endogenous mRNA molecules can be 5'-capped, generating a 5'-ppp-5'-triphosphate bond between the guanosine cap residue at the end of the mRNA molecule and the sense nucleotide transcribed at the 5'-end. The 5'-guanylate cap can then be methylated to generate an N7-methyl-guanosine residue. The ribose of the terminal and / or pre-terminal transcribed nucleotides at the 5'-end of mRNA can also optionally be 2'-O-methylated. 5'-decapping through hydrolysis and cleavage of the guanylate cap structure can target nucleic acid molecules (e.g., mRNA molecules) for degradation.

[0097] In some embodiments, the nucleic acid construct of the present invention is incorporated as a 5' cap portion or structure.

[0098] In some embodiments, the nucleic acid construct of the present invention (i.e., the polynucleotide comprising the nucleotide sequence encoding cPLAe) further comprises a poly-A tail.

[0099] vector

[0100] The nucleic acid construct of the present invention can be included in an expression vector; thus, in one aspect, the present invention relates to an expression vector comprising the nucleic acid construct of the present invention.

[0101] As used herein, the term "expression vector" or "vector" refers to a nucleic acid molecule used as a vehicle to transfer genetic material, particularly to deliver nucleic acids into host cells, either in vitro or in vivo. An expression vector also refers to a nucleic acid molecule capable of achieving gene (transgene) expression in a host cell or host organism compatible with such sequences. An expression vector typically includes at least suitable transcriptional regulatory sequences and optional 3' transcriptional termination signals. There may also be other elements necessary or helpful for expression, such as enhancer elements capable of responding to precise induction signals (endogenous or chimeric transcription factors) or specific to certain cells, organs, or tissues. Vectors include, but are not limited to, plasmids, phagemids, cosmids, transposable elements, viruses, and artificial chromosomes (e.g., YACs). Preferably, the vector of the present invention is a vector suitable for gene or cell therapy, particularly suitable for targeting neuronal cells.

[0102] In some embodiments, the expression vector is a viral vector, such as: a vector derived from Moloney murine leukemia virus vector (MoMLV), MSCV, SFFV, MPSV or SNV; a lentiviral vector (e.g., derived from human immunodeficiency virus (HIV), simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV) or equine infectious anemia virus (EIAV)); an adenovirus (Ad) vector; an adeno-associated virus (AAV) vector; a simian virus 40 (SV-40) vector; a bovine papillomavirus vector; Epstein-Barr virus; a herpesvirus vector; a vaccinia virus vector; a Harvey murine sarcoma virus vector; a murine mammary tumor virus vector; a Rous sarcoma virus vector.

[0103] As is known in the art, depending on the particular viral vector under consideration, appropriate sequences should be introduced into the vectors of the present invention, such as AAV ITRs for AAV vectors, or LTRs for lentiviral vectors, to obtain a functional viral vector. In certain embodiments, optionally in combination with one or more features of the various embodiments described above or below, the vector is an AAV vector.

[0104] AAV has generated considerable interest as a potential vector for human gene therapy. The advantageous features of this virus include that it is not associated with any human disease, it is capable of infecting both dividing and non-dividing cells, and it can infect a wide range of cell lines from different tissues. The AAV genome consists of a linear single-stranded DNA molecule containing 4,681 bases (Berns and Bohenzky, 1987, Advances in Virus Research (Academic Press, Inc.) 32:243-307). Each end of the genome contains terminal inverted repeats (ITRs), and the inverted terminal repeats (ITRs) function as cis-acting elements for the origin of DNA replication and packaging signal of the virus. The length of the ITRs is approximately 145 bp. The internal non-repetitive part of the genome includes two large open reading frames, called the AAV rep and cap genes, respectively. These genes encode viral proteins involved in viral particle replication and packaging. In particular, at least four viral proteins are synthesized by the AAV rep gene, named Rep78, Rep68, Rep52, and Rep40 according to their apparent molecular weights. The AAV cap gene encodes at least three proteins, VP1, VP2, and VP3. For a detailed description of the AAV genome, see, for example, Muzyczka, N. 1992 Current Topics in Microbiol. and Immunol. 158:97-129.

[0105] Thus, in one embodiment, optionally in combination with one or more features of the various embodiments described above or below, the nucleic acid construct or expression vector of the present invention [comprising a nucleotide sequence encoding cPLA2e] further comprises 5' ITR and 3' ITR sequences, preferably the 5' ITR and 3' ITR sequences of adeno-associated virus.

[0106] As used herein, the term "inverted terminal repeat (ITR)" refers to the nucleotide sequences (5' ITR) located at the 5'-end of a virus and the nucleotide sequences (3' ITR) located at the 3'-end of a virus that contain palindromic sequences and can fold to form a T-shaped hairpin structure and function as primers during the initiation of DNA replication. The inverted terminal repeat (ITR) is also required for integration of the viral genome into the host genome, rescue from the host genome, and packaging of viral nucleic acids into mature viral particles. Cis-acting ITRs are required for replication of the vector genome and its packaging into viral particles.

[0107] The AAV ITRs for use in the viral vectors of the present invention can have wild-type nucleotide sequences or can be altered by insertion, deletion, or substitution. The serotype of the inverted terminal repeat (ITR) of AAV can be selected from any known human or non-human AAV serotype. In a specific embodiment, the nucleic acid construct or viral expression vector can be carried out by using the ITRs of any AAV serotype, including AAV1, AAV2, AAV3 (including types 3A and 3B), AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, and any other AAV serotype now known or later discovered.

[0108] In a preferred embodiment, the nucleic acid construct or expression vector further comprises the 5’ ITR and 3’ ITR of AAV of serotype AAV2.

[0109] In other embodiments, the nucleic acid constructs or expression vectors of the present invention can be achieved by using synthetic 5' ITRs and / or 3' ITRs and by using 5' ITRs and 3' ITRs from viruses of different serotypes. As described below, all other viral genes required for viral vector replication can be provided in trans in the virus-producing cells (packaging cells). Thus, they can optionally be included in the viral vector.

[0110] In one embodiment, the nucleic acid construct or viral vector of the present invention comprises the 5’ ITR, Ψ packaging signal, and 3’ ITR of a virus. The "ψ packaging signal" is a cis-acting nucleotide sequence of the viral genome that, in certain viruses (such as adenovirus, lentivirus...), is essential for the process of packaging the viral genome into the viral capsid during replication.

[0111] The construction of recombinant AAV viral particles is well known in the art and has been described, for example, in the following documents: US5,173,414 and US5,139,941; WO 92 / 01070, WO 93 / 03769, Lebkowski et al. (1988) Molec. Cell. Biol. 8:3988-3996; Vincent et al. (1990) Vaccines 90 (Cold Spring Harbor Laboratory Press); Carter, B. J. (1992) Current Opinion in Biotechnology 3:533-539; Muzyczka, N. (1992) Current Topics in Microbiol. and Immunol. 158:97-129; and Kotin, R. M. (1994) Human Gene Therapy 5:793-801.

[0112] Viral particle

[0113] The nucleic acid construct or expression vector of the present invention can be packaged into a viral capsid to produce a "viral particle", also referred to as a "viral vector particle".

[0114] Thus, in one aspect, the present invention relates to viral particles comprising the nucleic acid construct or expression vector of the present invention.

[0115] In one aspect, the present invention relates to viral particles that comprise a nucleic acid construct or expression vector, the nucleic acid construct or expression vector comprising a promoter operably linked to a nucleotide sequence encoding cPLA2e; and to viral particles comprising a nucleic acid construct or expression vector, the nucleic acid construct or expression vector comprising a) a promoter operably linked to a nucleotide sequence encoding cPLA2e, b) a polyadenylation signal sequence, and c) 5' ITR and 3' ITR; optionally in combination with one or more features of the various embodiments described above or below.

[0116] In a preferred embodiment, the viral particles of the present invention are AAV particles comprising an adeno-associated virus capsid protein, i.e., the nucleic acid construct or expression vector of the present invention is packaged into an AAV-derived capsid to produce "adeno-associated virus particles" or "AAV particles". The term AAV particles includes any recombinant AAV particles or mutant AAV particles that have been genetically engineered. Recombinant AAV particles can be prepared by encapsulating a nucleic acid construct or viral expression vector comprising ITRs derived from a specific AAV serotype within a viral particle formed from native Cap protein or mutant Cap protein corresponding to AAV of the same or a different serotype.

[0117] The viral capsid proteins of adeno-associated virus include capsid proteins VP1, VP2, and VP3. Differences between the capsid protein sequences of various AAV serotypes result in entry into cells using different cell surface receptors. In combination with alternative intracellular processing pathways, each AAV serotype exhibits tropism for different tissues.

[0118] In one embodiment, the AAV particles according to the present invention can be prepared by encapsulating a viral vector of an AAV vector / genome derived from a specific AAV serotype within a viral particle formed from native Cap protein corresponding to AAV of the same specific serotype. Nevertheless, several techniques have been developed to modify and improve the structural and functional properties of naturally occurring AAV viral particles (Bünning H et al. J Gene Med, 2008; 10:717–733; Paulk et al. Mol Ther. 2018; 26(1):289-303; Wang L et al. Mol Ther. 2015; 23(12):1877-87; Vercauteren et al. Mol Ther. 2016; 24(6):1042-1049; Zinn E et al., Cell Rep. 2015; 12(6):1056-68).

[0119] Thus, in another embodiment, the AAV viral particles according to the present invention comprise a nucleic acid construct that contains a nucleotide sequence encoding cPLA2e, flanked by ITRs specifying an AAV serotype, and the nucleic acid construct is packaged into, for example: a) viral particles composed of capsid proteins derived from the same or different AAV serotypes [such as AAV2 ITRs and AAV9 capsid proteins; AAV2 ITRs and AAV TT capsid proteins; etc.]; b) mosaic-like viral particles composed of a mixture of capsid proteins from different AAV serotypes or mutants [such as AAV2 ITRs and a capsid formed by proteins of two or more AAV serotypes]; c) chimeric viral particles composed of capsid proteins truncated by domain swapping between different AAV serotypes or variants [such as AAV2 ITRs and AAV5 capsid proteins and an AAV3 domain]; or d) target viral particles that are engineered to display a selective binding domain capable of stringent interaction with a target cell-specific receptor.

[0120] In a specific embodiment, examples of the AAV serotypes of the capsid proteins of the AAV particles according to the present invention include AAV2, AAV5, AAV9, and AAV TT. In a more preferred embodiment, the AAV serotype of the capsid protein is selected from the AAV9 and AAV TT serotypes.

[0121] In a particular embodiment, optionally in combination with one or more features of the various embodiments described above or below, the viral particles are AAV particles that include a nucleic acid construct or expression vector containing 5' ITR and 3' ITR sequences from an AAV virus; preferably, the AAV particles comprise capsid proteins of the AAV2, AAV5, AAV9, or AAV TT serotypes (more preferably capsid proteins of the AAV9 serotype or AAV TT serotype) and / or 5' ITR and 3' ITR sequences of the AAV2 serotype

[0122] In a particular embodiment, optionally in combination with one or more features of the various embodiments described above or below, the viral particle comprises a nucleic acid construct or expression vector that contains a nucleotide sequence encoding human cPLA2e of amino acid SEQ ID NO:1 or SEQ ID NO:3 under the control of a promoter that permits expression of the human cPLA2e at least in hippocampal neurons, and the viral particle is selected from viral particles that target at least hippocampal neurons, typically AAV particles, and the AAV particle comprises a capsid protein selected from the group consisting of AAV2, AAV5, AAV9, or AAV TT serotypes; preferably, the nucleotide sequence encoding human cPLA2e is SEQ ID NO:2 or SEQ ID NO:4, and / or the promoter is a neuron-specific promoter, more preferably the SYN1 promoter or a hybrid SYN1 promoter.

[0123] In a more particular embodiment, such recombinant AAV particles according to the invention comprise a capsid protein of the AAV9 or AAV TT serotype and an AAV vector, and the AAV vector comprises (i) a nucleic acid construct containing a hybrid SYN1 promoter operably linked to a nucleotide sequence SEQ ID NO:2 or 4 encoding human cPLA2e, and (ii) AAV ITRs, such as the 5' ITR and 3' ITR of AAV2, flanking the nucleic acid construct.

[0124] Those skilled in the art will understand that the AAV viral particles according to the invention may comprise a capsid protein from any AAV serotype, including: AAV1; AAV2; AAV3 (including types 3A and 3B); AAV4; AAV5; AAV6; AAV7; AAV8; AAV9; AAV10; AAV11; AAV12; avian AAV; bovine AAV; canine AAV; equine AAV; ovine AAV; synthetic AAV variants such as NP40, NP59, NP84 (Paulk et al. Mol ther. 2018. 26(1):289 - 303), LK03 (Wang L et al. Mol Ther. 2015. 23(12):1877 - 87), AAV3 - ST (Vercauteren et al. Mol Ther. 2016. 24(6):1042 - 1049), Anc80 (Zinn E et al., Cell Rep. 2015; 12(6):1056 - 68); and any other AAV serotype now known or later discovered.

[0125] Production of vectors and viral particles

[0126] The production of virus particles carrying the virus expression vector disclosed above can be carried out by conventional methods and protocols, and the selection of these methods and protocols should take into account the structural features selected for the actual implementation of the expression vector and the virus particles of the vector.

[0127] Briefly, virus particles can be produced in host cells, more particularly in specific virus-producing cells (packaging cells), which are transfected with the nucleic acid construct or expression vector to be packaged in the presence of a helper vector or virus or other DNA construct.

[0128] As used herein, the term "packaging cell" refers to a cell or cell line that can be transfected with the nucleic acid construct or expression vector of the present invention and trans-provides all the missing functions required for the complete replication and packaging of the viral vector. Usually, the packaging cell expresses one or more of the said missing viral functions in a constitutive or inducible manner. The packaging cell can be an adherent cell or a suspension cell.

[0129] Generally, the process for producing virus particles includes the following steps: a) culturing packaging cells containing the above nucleic acid construct or expression vector in a culture medium; and b) harvesting virus particles from the cell culture supernatant and / or inside the cells.

[0130] Conventional methods can be used to produce AAV virus particles, which include transient cells co-transfected with: a nucleic acid construct or expression vector (such as a plasmid) carrying the transgene of the present invention; a nucleic acid construct (such as an AAV helper plasmid) encoding the rep and cap genes but not carrying the ITR sequence; and a third nucleic acid construct (such as a plasmid) providing the adenovirus functions necessary for AAV replication. The viral genes necessary for AAV replication are referred to herein as viral helper genes. Generally, the said genes necessary for AAV replication are adenovirus helper genes, such as E1A, E1B, E2a, E4 or VA RNA. Preferably, the adenovirus helper gene is of Ad5 or Ad2 serotype.

[0131] Large-scale production of AAV particles according to the present disclosure can also be carried out, for example, by infecting insect cells with a combination of recombinant baculoviruses (Urabe et al. Hum. Gene Ther. 2002; 13: 1935-1943). SF9 cells are co-infected with two or three baculovirus vectors that express AAV rep, AAV cap, and the AAV vector to be packaged, respectively. The recombinant baculovirus vectors will provide the viral helper gene functions required for viral replication and / or packaging. Smith et al 2009 (Molecular Therapy, vol. 17, no. 11, pp 1888-1896) further describe a dual baculovirus expression system for large-scale production of AAV particles in insect cells.

[0132] Those skilled in the art are aware of suitable culture media. The components that make up such media may vary depending on the type of cells to be cultured. In addition to nutritional components, osmotic pressure and pH value are also considered important parameters of the medium. Cell growth media contain a variety of components well known to those skilled in the art, including amino acids, vitamins, organic and inorganic salts, carbohydrate sources, lipids, trace elements (CuSO4, FeSO4, Fe(NO3)3, ZnSO4...), each present in an amount that supports in vitro cell culture (i.e., cell survival and growth). The components may also include different auxiliary substances, such as buffering substances (e.g., sodium bicarbonate, Hepes, Tris...), oxidation stabilizers, stabilizers to counteract mechanical stress, protease inhibitors, animal growth factors, plant hydrolysates, anti-caking agents, antifoaming agents. The characteristics and composition of cell growth media vary depending on the specific cell requirements. Examples of commercially available cell growth media are: MEM (Minimum Essential Medium), BME (Basal Medium Eagle), DMEM (Dulbecco's modified Eagle's Medium), Iscoves DMEM (Iscove’s modification of Dulbecco’s Medium), GMEM, RPMI 1640, Leibovitz L-15, McCoy's, Medium 199, Ham (Ham’s Media) F10 and its derivatives, Ham F12, DMEM / F12, etc.

[0133] Additional guidance on the construction and production of viral vectors for use in accordance with the present disclosure can be found in the following literature: Viral Vectors for Gene Therapy, Methods and Protocols. Series: Methods in Molecular Biology, Vol. 737. Merten and Al-Rubeai (Eds.); 2011 Humana Press (Springer); Gene Therapy. M. Giacca. 2010 Springer-Verlag; Heilbronn R. and Weger S. Viral Vectors for Gene Transfer: Current Status of Gene Therapeutics. In: Drug Delivery, Handbook of Experimental Pharmacology 197; M. (Ed.). 2010 Springer-Verlag; pp. 143 - 170; Adeno-Associated Virus: Methods and Protocols. R.O. Snyder and P. Moulllier (Eds). 2011 Humana Press (Springer); Bünning H. et al. Recent developments in adeno-associated virus technology. J. Gene Med. 2008; 10: 717 - 733; Adenovirus: Methods and Protocols. M. Chillón and A. Bosch (Eds.); Third Edition. 2014 Humana Press (Springer).

[0134] On the other hand, the present invention relates to a host cell comprising the nucleic acid construct or expression vector of the present invention.

[0135] In one embodiment, the host cell according to the present invention is a specific virus-producing cell, also known as a packaging cell, which is transfected with the nucleic acid construct or expression vector according to the present invention in the presence of a helper vector or virus or other DNA construct, and trans - provides all the missing functions required for the complete replication and packaging of viral particles. The packaging cell can be an adherent cell or a suspension cell.

[0136] For example, the packaging cell can be a eukaryotic cell, such as a mammalian cell, including simian, human, dog, and rodent cells. Examples of human cells are PER.C6 cells (WO01 / 38362), MRC-5 (ATCC CCL-171), WI-38 (ATCC CCL-75), HEK-293 cells (ATCC CRL-1573), HeLa cells (ATCC CCL2), and rhesus monkey embryo lung cells (ATCC CCL-160). Examples of non-human primate cells are Vero cells (ATCC CCL81), COS-1 cells (ATCC CRL-1650), or COS-7 cells (ATCC CRL-1651). Examples of dog cells are MDCK cells (ATCC CCL-34). Examples of rodent cells are hamster cells, such as BHK21-F, HKCC cells, or CHO cells.

[0137] As an alternative to mammalian sources, the packaging cells for producing virus particles can be derived from avian sources, such as chickens, ducks, geese, quails, or pheasants. Examples of avian cell lines include: avian embryonic stem cells (WO01 / 85938 and WO03 / 076601); immortalized duck retina cells (WO2005 / 042728); and avian embryonic stem cell-derived cells, including chicken cells (WO2006 / 108846) or duck cells, such as the EB66 cell line (WO2008 / 129058 and WO2008 / 142124).

[0138] In another embodiment, the cell can be any cell that permits the infection and replication of baculovirus in the packaging cell. In a particular embodiment, the cell is an insect cell, such as SF9 cells (ATCC CRL-1711), Sf21 cells (IPLB-Sf21), MG1 cells (BTI-TN-MG1), or High Five TM cells (BTI-TN-5B1-4).

[0139] Thus, in a particular embodiment, the host cell includes: a nucleic acid construct or expression vector (e.g., an AAV vector according to the present invention) comprising a nucleotide sequence encoding cPLA2e; a nucleic acid construct encoding AAV rep and / or cap genes that do not carry ITR sequences, such as a plasmid; and / or a nucleic acid construct comprising viral helper genes, such as a plasmid or a virus.

[0140] In another aspect, the present invention relates to a host cell transduced with the expression vector or virus particle of the present invention. As used herein, the term "host cell" refers to any cell line that is sensitive to infection by the virus of interest and can withstand in vitro culture tests.

[0141] In other embodiments, the host cells of the invention can be used for therapeutic purposes, e.g., for the therapeutic uses disclosed herein.

[0142] Pharmaceutical composition

[0143] Another aspect of the invention is a pharmaceutical composition comprising the above nucleic acid construct, the above vector, the above host cell or the above viral particle, and one or more pharmaceutically acceptable excipients.

[0144] In another aspect, the invention also relates to a pharmaceutical composition comprising a cPLA2e inducer in any of the embodiments disclosed above or below, which is used for treating cognitive impairment and / or diseases associated with cognitive impairment or is administered in such treatment.

[0145] As used herein, the term "pharmaceutically acceptable" means approved by a regulatory agency or recognized pharmacopoeia, such as the European Pharmacopoeia, for use in animals and / or humans. The term "excipient" means a diluent, adjuvant, carrier or vehicle administered together with a therapeutic agent.

[0146] The pharmaceutical compositions or medicaments of the invention generally comprise an effective amount of a therapeutic agent (e.g., a vector or viral particle of the invention) sufficient to provide the desired therapeutic effect and a pharmaceutically acceptable carrier or excipient.

[0147] In a preferred embodiment, optionally in combination with one or more features of the various embodiments described above or below, the invention relates to a pharmaceutical composition comprising a vector or viral particle as disclosed above and a pharmaceutically acceptable carrier.

[0148] Any suitable pharmaceutically acceptable carrier or excipient can be used to prepare the pharmaceutical composition (see, e.g., Remington: The Science and Practice of Pharmacy, Alfonso R. Gennaro (Editor) Mack Publishing Company, April 1997). The pharmaceutical composition is generally sterile and stable under the manufacturing and storage conditions. The pharmaceutical composition can be formulated as a solution (e.g., saline, glucose solution or buffer solution, or other pharmaceutically acceptable sterile fluid), microemulsion, liposome or other ordered structure suitable for accommodating a high product concentration (e.g., microparticles or nanoparticles). The carrier can be a solvent or dispersion medium comprising, for example, water, ethanol, polyols (such as glycerol, propylene glycol and liquid polyethylene glycol, etc.) and their suitable mixtures. Fluidity can be maintained, for example, by using coatings such as lecithin, by maintaining the desired particle size in the case of dispersion, and by using surfactants. In many cases, it is preferred to include an isotonic agent in the composition, such as sugar, polyols such as mannitol, sorbitol or sodium chloride. Preferably, the pharmaceutical composition is formulated as a solution, more preferably as an optionally buffered saline solution.

[0149] Preferably, the pharmaceutical composition is formulated as a solution, more preferably as an optionally buffered saline solution. Supplementary active compounds can also be incorporated into the pharmaceutical composition of the present invention. For example, guidelines for co-administering additional therapies can be found in the Compendium of Pharmaceutical and Specialties (CPS) of the Canadian Pharmacists Association.

[0150] In one embodiment, the pharmaceutical composition is a composition suitable for intrasubstance, intracerebral, intravenous or intrathecal administration. These pharmaceutical compositions are merely exemplary and are not limited to pharmaceutical compositions suitable for other parenteral and non-parenteral administration routes. The pharmaceutical compositions described herein can be packaged in single unit dose or multi-dose forms.

[0151] Therapeutic Use

[0152] The inventors used animal models of Alzheimer's disease (APP / PS1 mice) and aged WT mice and surprisingly found that enhanced AAV-mediated cPLA2e expression improved the memory impairment in APP / PS1 mice and the memory function in aged WT animals.

[0153] These results provide strong evidence for potential therapeutic strategies for treating cognitive impairment and / or diseases associated with cognitive impairment in a subject, more specifically for treating dementia, such as age-related dementia or Alzheimer's disease.

[0154] Accordingly, another aspect of the present invention relates to a method for treating cognitive impairment and / or diseases associated with cognitive impairment (such as dementia, particularly age-related dementia or Alzheimer's disease) in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a cPLA2e inducer.

[0155] In another aspect, the present invention relates to a cPLA2e inducer which is used as a medicament for a subject in need thereof, more specifically for treating cognitive impairment and / or diseases associated with cognitive impairment in a subject in need thereof, such as dementia, more specifically age-related dementia or Alzheimer's disease.

[0156] In a related aspect, the present invention relates to the use of a cPLA2e inducer in the manufacture of a medicament which is more specifically for treating cognitive impairment and / or diseases associated with cognitive impairment, such as dementia, more specifically age-related dementia or Alzheimer's disease.

[0157] The cPLA2e inducer for use in or administered for treating cognitive impairment and diseases associated with cognitive impairment according to the present invention may, among other things, be selected from the group consisting of: a) the nucleic acid construct of the present invention as mentioned above; b) a vector comprising the nucleic acid construct of the present invention as mentioned above; c) a viral particle comprising the nucleic acid construct or vector of the present invention as mentioned above; d) a host cell comprising the nucleic acid construct or vector according to the present invention; e) a cPLA2e polypeptide or protein; and f) a pharmaceutical composition comprising any one of the nucleic acid construct, the vector comprising the nucleic acid construct, the viral particle comprising the nucleic acid construct or vector, and the cPLA2e polypeptide or protein.

[0158] Regarding the cPLA2e polypeptide or protein, any and all embodiments and preferred embodiments mentioned above for cPLA2e encoded by the nucleotide sequence contained in the nucleic acid construct of the present invention are embodiments within the scope of the cPLA2e polypeptide or protein for use in or administered for treatment according to the present invention; in particular, cPLA2e comprising amino acid SEQ ID NO: 1 or 3 or consisting of amino acid SEQ ID NO: 1 or 3 or a variant having at least 70% sequence identity thereto; optionally as a fusion protein with another polypeptide (such as a tag or carrier polypeptide).

[0159] In a preferred embodiment, the cPLA2e inducer for the therapeutic use of the present invention is the vector of the present invention, more preferably a viral vector, or a viral particle (such as an AAV particle), or a pharmaceutical composition comprising the same.

[0160] As used herein, the terms "cognitive disease" and "cognitive disorder" are used interchangeably to refer to any cognitive impairment, such as a disorder characterized by one or more of the following behaviors: inhibition of at least one form of learning (e.g., associative learning), inhibition of at least one form of memory function (e.g., executive function), inhibition of learning, inhibition of memory acquisition, inhibition of memory recall, inhibition of long-term potentiation (LTP) in the hippocampus, or a combination thereof. In humans, any suitable hippocampal or brain function tests and neuroimaging methods can be used to determine or evaluate cognition and its potential impairment. For example, cognition (e.g., memory or learning) and its potential impairment can be measured using any suitable psychological tests, including but not limited to: the "Kiel Locomotor Maze" which incorporates features of the radial arm maze and the Morris water maze, for assessing spatial memory and orientation, which has been optimized for school-aged children; or the Cambridge Neuropsychological Automated Battery (CANTAB), which is a computerized, visually presented, non-verbal neuropsychological battery designed to test spatial memory span, spatial working memory, and spatial recognition. In addition, the results of the methods disclosed herein related to cognitive impairment can be demonstrated by comparative tests using the same compositions administered to humans in animals (such as rats or mice).

[0161] The cPLA2e inducer of the present invention is particularly useful for treating cognitive impairments associated with conditions that impair or otherwise affect the normal function of the central nervous system and diseases associated with cognitive impairments, such as dementia (e.g., age-related dementia (Alzheimer's disease)), vascular dementia, and / or neurodegenerative dementias with abnormal protein aggregation, such as in particular Alzheimer's disease, Parkinson's disease, ALS, or prion diseases, such as Creutzfeldt-Jakob disease or Gerstmann-Straussler-Scheinher disease; mild cognitive impairment, attention deficit disorders, etc. Thus, the cPLA2e inducer of the present invention is particularly useful for treating cognitive impairments associated with one of these conditions.

[0162] In a preferred embodiment, the cPLA2e inducer is particularly useful for treating cognitive impairment in patients with Alzheimer's disease. As used herein, Alzheimer's disease (AD) refers to a progressive neurodegenerative disease of the central nervous system of unknown origin. In the context of AD, the most typical feature is cognitive impairment. AD is defined as a neurodegenerative disease and is the main common form of dementia in the elderly: it is characterized by the accumulation of two abnormal proteins in the brain: β-amyloid peptide and hyperphosphorylated tau, which appear in the form of amyloid plaques and neurofibrillary tangles, respectively. The AD diagnostic criteria published by the National Institute of Neurological and Communicative Disorders and Stroke (NINCDS) and the Alzheimer's Disease and Related Disorders Association (ARRDA) in 1984 include: (1) involving two or more regions; (2) the presence of progressive dementia; (3) absence of altered consciousness; (4) onset between 40 and 90 years of age; and (5) cannot be explained by other causes. Now, unique and reliable AD biomarkers can be obtained through structural MRI, PET molecular neuroimaging, and cerebrospinal fluid analysis for the confirmation of AD. In addition, the pre-Alzheimer's prodromal state called mild cognitive impairment (MCI) is defined as objective abnormal memory loss relative to the age and educational level of the subject. The criteria for MCI include: (1) a memory complaint confirmed by family members; (2) normal other cognitive functions; (3) normal daily activities; (4) abnormal age-related memory; and (5) no dementia.

[0163] As used herein, the term "subject" or "patient" refers to a mammal. Mammalian species that can benefit from the disclosed treatment methods include, but are not limited to: humans; non-human primates, such as apes, chimpanzees, monkeys, and orangutans; domesticated animals, including dogs and cats; and livestock, such as horses, cows, pigs, sheep, and goats; or other mammalian species, including but not limited to mice, rats, guinea pigs, rabbits, hamsters, etc.

[0164] As used herein, "treatment", "remedy", or "cure" means: (i) preventing or delaying the occurrence of a disease, disorder, or condition in a subject who may be susceptible to the disease, disorder, and / or condition but has not been diagnosed as having the disease, disorder, or condition; (ii) inhibiting the disease, disorder, and / or condition, i.e., preventing or slowing its development or progression; and / or (iii) alleviating the disease, disorder, and / or condition, i.e., causing the disease, disorder, and / or condition to subside. In certain embodiments, the term refers to the improvement or eradication of a disease or disease-related symptoms.

[0165] With respect to cognitive impairment, "treatment", "treatment", or "therapy" means: (i) preventing or delaying the onset of cognitive impairment in a subject who may be predisposed to cognitive impairment but has not been diagnosed with cognitive impairment; (ii) suppressing cognitive impairment, i.e., preventing or slowing its development or progression; (iii) alleviating cognitive impairment, i.e., causing it to regress; and / or (iv) enhancing cognitive ability. Unless otherwise specified herein, the term "treating cognitive impairment" means reducing cognitive impairment, improving at least one symptom associated with or caused by cognitive impairment (e.g., symptoms of a disease or disorder that may lead to cognitive impairment), or both. Treatment of cognitive impairment particularly relates to the treatment of learning and memory impairments and to enhancing learning and memory ability. "Enhancing learning and memory ability" means improving or enhancing the intellect for recording, retaining, or recalling past experiences, knowledge, ideas, sensations, thoughts, or impressions.

[0166] As used herein, a "therapeutically effective amount" means an amount effective within the dose and time period required to achieve the desired therapeutic result, such as one or more of the following therapeutic results: a significant delay in the onset or progression of the disease; a significant reduction in the severity of one or more symptoms; a significant reduction in AD marker amyloid and / or tau pathologies; a significant increase in synaptic plasticity; a significant reduction in mortality associated with aging and / or AD.

[0167] A therapeutically effective amount is also generally an amount in which the beneficial effects of treatment outweigh any toxic or detrimental effects of the product or pharmaceutical composition.

[0168] In one embodiment, a nucleic acid construct, expression vector, viral particle, host cell, cPLA2e polypeptide or protein, or pharmaceutical composition for its therapeutic use according to the invention is administered to a subject or patient by a parenteral route, such as by an intrastromal, intracerebral, intracerebroventricular (icv), intrathecal, intranasal, intravenous, or subcutaneous route.

[0169] Generally, a therapeutically effective amount of the nucleic acid construct, expression vector, viral particle, host cell, cPLA2e polypeptide or protein, or pharmaceutical composition is preferably administered by an intrathecal or intrastromal route, the latter preferably being administered to a brain region, such as the hippocampal formation or cerebral cortex. The intrastromal route can facilitate preferential local administration to the hippocampus and cortex relative to other regions of the brain. As used herein, "preferably locally administered to the hippocampus" does not mean that all cPLA2e inducer is administered to the brain region, but rather that a majority, e.g., at least 50%, at least 60%, at least 70%, or at least 80% of the cPLA2e inducer is administered to the region.

[0170] A therapeutically effective amount of a cPLA2e inducer (such as a nucleic acid construct, an expression vector, a viral particle, a host cell, or a cPLA2e polypeptide or protein) or a pharmaceutical composition comprising a cPLA2e inducer can vary depending on factors such as the individual's disease state, age, sex, and weight, as well as the ability of the product or pharmaceutical composition to elicit the desired response in the individual. The dosage regimen can be adjusted to provide the optimal therapeutic response.

[0171] For any particular subject, the specific dosage regimen can be adjusted over time according to the individual needs and the professional judgment of the person administering the composition or supervising the administration of the composition. The dosage ranges described herein are only exemplary and do not limit the dosage ranges available to the physician.

[0172] In one embodiment, the AAV viral particles according to the present invention can be administered to a human subject or patient in an amount or dose within the following ranges to treat cognitive impairment or a disease associated with cognitive impairment, such as Alzheimer's disease: 10 8 vg / kg to 10 14 vg / kg (vg: viral genome; kg: body weight of the subject or patient), for example, 1×10 10 vg / kg to 5×10 14 vg / kg. In a more specific embodiment, an amount within the range of 1×10 12 vg / kg to 1×10 13 vg / kg is administered. In an alternative embodiment, an amount or dose within the range of 1×10 9 iu / kg to 1×10 11 iu / kg (iu: infectious unit of the vector) is administered.

[0173] In another aspect, the present invention further relates to a kit in one or more containers, comprising a nucleic acid construct, an expression vector, a host cell, a viral particle according to the present invention, or a pharmaceutical composition comprising the nucleic acid construct, vector, host cell, or viral particle. The kit can include instructions or packaging materials describing how to administer the nucleic acid construct, expression vector, viral particle, host cell, or pharmaceutical composition contained in the kit to a patient. The containers of the kit can be any suitable material, such as glass, plastic, metal, etc., and can be of any suitable size, shape, or configuration. In certain embodiments, the kit can include one or more ampoules or syringes containing the product of the present invention in a suitable liquid or solution form.

[0174] The following examples are provided by way of illustration and are not intended to limit the present invention. In addition, the present invention encompasses all possible combinations of the specific and preferred embodiments described herein.

[0175] Method for screening new medicaments useful for treating cognitive disorders and / or diseases associated with cognitive disorders.

[0176] The inventors have also worked on developing systems for screening compound candidates, such as peptide, polypeptide (e.g., antibody) or small molecule candidates, taking advantage of the fact that cPLA2e induces or increases a very significant increase in the activity of calcium-dependent N-acyltransferase (Ca-NAT).

[0177] Accordingly, the present invention also provides a method for identifying a compound as a candidate for treating cognitive disorders and / or diseases associated with cognitive disorders, the method comprising the steps of:

[0178] a) contacting the compound with mammalian test cells;

[0179] b) checking whether an effect associated with the induction or increase of cPLA2e has occurred;

[0180] c) if such an effect has occurred compared to a control, identifying the compound as a candidate for treating cognitive disorders and / or diseases associated with cognitive disorders.

[0181] One possible embodiment of the method of the present invention is to perform an in vitro method, wherein the cells assayed are mammalian cells, such as HEK293T cells. These cells are cultured (e.g., for 30 minutes or 1 hour) in a medium suitable for cell growth and proliferation in the presence of a candidate compound, with or without ionomycin (e.g., 2 μm), and the activity of Ca-NAT is tested relative to a control that has not been contacted with the candidate compound (e.g., by targeted metabolic profiling). If an increase in Ca-NAT activity is found relative to the activity of control cells, the compound is identified as a possible candidate for treating cognitive disorders and / or diseases associated with cognitive disorders.

[0182] In some embodiments, cells transfected with cPLA2e (e.g., with the nucleic acid construct of the present invention) can be used as a positive control for the induction of cPLA2e activity.

[0183] As used herein, the term "induce or increase" can refer to the ability to cause an overall increase, preferably 20% or more, more preferably 50% or more, most preferably 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more.

[0184] Examples

[0185] To determine whether PLA2G4E plays a role in learning and memory functions, the inventors overexpressed PLA2G4E in the brains of a) APP / PS1 mice (AD model) and b) (aged wild-type animals), both of which are affected by cognitive impairment. For this purpose, they constructed an AAV vector carrying the transgenic house mouse (Mus musculus) cPLA2e and administered it to the animals. Then, learning and memory functions were evaluated by the MWM method.

[0186] Example 1. Preparation of AAV2 / 9-mPLA2G4E

[0187] Construct an AAV2 / 9-mPLA2G4E vector, which includes the nucleotide sequence SEQ ID NO: 5 encoding murine PLA2G4E as a transgene, and this sequence is fused with a flag sequence through a linker.

[0188] First, a 3108 bp fragment containing murine PLA2G4E fused with the FLAG sequence was excised from the plasmid pRK5-PLA2G4E (gift from BJCravatt; disclosed in Ogura Y et al. Nat. Chem. Biol. 2016; 12(9): 669–671) by digestion with XmnI and SacI (both in buffer), separated by 1% agarose gel electrophoresis; then extracted from the gel by the Gel Extraction kit (QUIAGEN) and purified by the PCR Purification kit (QUIAGEN).

[0189] Second, a 4163 bp backbone fragment was obtained from the plasmid pAAV-hα-synucleinA53T (kindly provided by Dr. J. Gerez) by digestion with Xhol (in buffer) and subsequent treatment with Klenow polymerase, dNTP, and NEB2.1 buffer. After purification, the 4163 bp backbone fragment was then digested with SacI (in buffer) and dephosphorylated using Shrimp alkaline phosphatase rSAP (New England Biolabs, MA, USA; W Weissig, H. et al. Biochem. J. 1993; 290: 503-508) to avoid vector religation. The 4163 pb backbone fragment was finally isolated, extracted, and purified as described above for the 3108 bp fragment.

[0190] Finally, to obtain plasmid pAAV2-mPLA2G4E, the 3108 bp fragment was cloned into the 4163 bp backbone fragment by treatment with T4 DNA ligase (Invitrogen).

[0191] Once pAAV2-mPLA2G4E with the desired construct was generated, it was subjected to several amplification steps to produce an adequate amount of plasmid for final virus production. Initially, chemically competent bacteria of Escherichia coli were transformed with the plasmid using TOP10 electrocompetent cells (Invitrogen), and bacteria incorporating the plasmid were selected by plating on LB medium containing ampicillin (50 μg / ml). Then, the Spin Miniprep kit (QUIAGEN) was used to obtain and purify the plasmid from the bacteria. After checking for the presence of the insert fragment and the correct orientation, as well as the presence of the AAV2 ITR, the desired amount of plasmid was obtained and purified from the ampicillin-resistant clones using a commercial Plasmid Maxi kit (QUIAGEN).

[0192] Once the vector plasmid was constructed and purified, AAV vector particles were generated by co-transfecting plasmid pAAV2-mPLA2G4E and the pDP9 helper plasmid, which expresses the adenoviral molecules required for AAV:AAV9 cap and AAV2 rep production and packaging, into HEK-293T cells (Durocher, Y., S. Perret, and A. Kamen., 2002, Nucleic Acids Research, 30(2):9e–9).

[0193] The vector particles were finally purified by iodixanol gradient and titrated by quantitative PCR. The viral titer was obtained by quantitative PCR (q-PCR) using primers specific for murine PLA2G4E and was expressed as viral particles (vp) / ml,

[0194] Forward primer: ATGGTGACAGACTCCTTCGAG (SEQ ID NO:6); and

[0195] Reverse primer: CCTCTGCGTAAAGCTGTGG (SEQ ID NO:7).

[0196] The viral titer obtained was 2.6×10 11 vp / ml.

[0197] Example 2. General methods

[0198] Mouse

[0199] APP / PS1 mice。The APP / PS1 mouse model expresses human transgenes of amyloid precursor protein (APP) carrying the Swedish mutation (K595N / M596L) and PSEN1 containing the L166P mutation, both driven by the Thy1 promoter. These mice have a C57BL / 6J inbred genetic background. The AD mouse model APP / PS1 is a more accelerated amyloidosis model than Tg2576. In these mice, the expression of the human APP transgene is approximately three times that of endogenous mouse APP, and human Aβ42 is produced preferentially over Aβ40. In addition, amyloid plaques begin to deposit in the hippocampus at 3 - 4 months (Radde et al., 2006, EMBO reports; 7(9):940–946)(Maia LF et al., 2013, Science translational medicine; 5(194):94 - 194) and cognitive impairment appears from 7 months (Serneels L et al., 2009, Science; 324(5927):639–642). In the case of APP / PS1 and its corresponding negative littermates, male and female mice 16 - 19 months old were used.

[0200] Aged wild-type mice 。Wild - type mice exhibit age - related memory deficits. Specifically, in the Morris water maze, aged wild - type mice do not form a stable memory of the platform location during the hidden phase, as their performance during the probe trial is significantly worse than that of young mice. These mice have a C57BL / 6 / SJL inbred genetic background.

[0201] Two - month - old male wild - type (WT) C57BL / 6 mice were also used to test the effect of PLA2G4E on synaptic activity.

[0202] Stereotactic surgery for virus administration

[0203] To overexpress PLA2G4E in hippocampal neurons, AAV2 / 9-mPLA2G4E was administered to mice in the hippocampal CA1 region through stereotactic surgery. This procedure is based on a three-dimensional spatial coordinate system that takes two easily identifiable points in the brain, the bregma or lambda, as references, allowing for the localization of specific points in the mouse brain (three-dimensional distances in millimeters (mm)). Using the mouse atlas (G. Paxinos and K. B. J. Franklin, The mouse brain in stereotaxic coordinates, Academic Press, 1997) as a reference, the coordinates selected for hippocampal CA1 injection were: anteroposterior -2.0 mm using the bregma point (formed by the intersection between the sagittal and coronal sutures); lateral ±1.7 mm; dorsoventral -2.0 mm. Before administering the virus or sham surgery (surgery only, without injecting anything), the animals were anesthetized with an intraperitoneal (ip) dose of 80 / 10 mg / Kg ketamine / xylazine and treated with an analgesic dose of 0.1 mg / Kg buprenorphine. After complete anesthesia, the mice were placed in a stereotactic apparatus with their heads fully fixed. After disinfecting the area with 96° alcohol, an anteroposterior incision was made on the skin using a scalpel to remove the skull from its periosteum and make the bregma and lambda reference points visible. Next, a hole was drilled in the skull with the help of a drill bit, and a 5-μl Hamilton syringe was placed on the stereotactic arm containing the vector viral particles (2.6×10E8 genome copies) or unloaded (for sham surgery). Once positioned at the precise coordinates, 1 μl of the solution was injected at 0.2 μl / min, and then the syringe was kept there for another 2 minutes to allow the virus to spread properly, and then the syringe was slowly withdrawn. For mice with sham injection, the syringe was kept in the brain for 5 minutes before withdrawal. The same steps were repeated for the other hemisphere. After bilateral injection in the animals, the wound was sutured and povidone iodine was applied topically. Then, the animals were placed on an electric blanket to avoid heat loss until they woke up. Finally, they were individually housed in clean cages with easy access to food softened in water to facilitate food intake after surgery. Throughout the intervention, physiological serum was continuously applied to the mice's eyes to avoid their drying and consequent vision loss.

[0204] MWM test

[0205] The Morris water maze test was used to test spatial memory. This Morris water maze test analyzes spatial and working memory, and thus it is considered a consistent test for hippocampal damage assessment, which is one of the main features of human AD (D’Hooge and Deyn, 2001, Brain research reviews; 36(1):60 - 90).

[0206] The test was conducted in a circular pool (1.2 m in diameter) filled with water at 20 °C and made opaque by adding non - toxic white paint. The pool was divided into four imaginary quadrants, and one of them was a platform that the mice had to learn to locate in order to escape from the water and stay safe. In each of the four walls surrounding the pool, there were geometric picture images that could serve as a guide for the mice and would be covered or uncovered depending on the test phase. During the whole test, the behavior of the mice was monitored by a camera fixed on the ceiling above the pool and recorded with an HVS system to allow subsequent analysis of escape latency, swimming speed, path length, and the percentage of time spent in each quadrant of the pool using the software SMART - LD (Panlab).

[0207] Three different phases can be distinguished in the MWM test:

[0208] 1) Visible platform phase: In this phase, the platform was located in the center of a quadrant, 1 cm above the water level, and was identified by making a part of it clearly visible to the animals to facilitate its location. Here, the mice were supposed to get familiar with the pool and learn to go to the platform to escape the water, so the visual cues were still hidden. For the visible platform phase, the mice were trained 8 times a day for 3 consecutive days. At each trial, the mice had 60 seconds to locate the platform; if they could not reach it within this period, they were placed on the platform. Once the animal was on the platform, it was allowed to inspect the platform for 15 seconds and then returned to its cage.

[0209] 2) Hidden platform phase: In the second phase of the test, the platform was located in the quadrant opposite to the visible platform phase. The platform was submerged 1 cm below the water level and had no part above the water level. In this phase, the mice were supposed to learn how to locate the platform with the help of the cues provided on the walls, which were now uncovered. For this purpose, the mice were trained four times a day for 7 days. As in the previous phase, the mice had 60 seconds to reach the platform. If the mice could not locate the platform within 60 seconds, they were taken to the platform. In both cases, they stayed on the platform for 15 seconds. Three random starting positions were established in each quadrant not occupied by the platform to avoid trajectory preference in the mice.

[0210] 3) Probe trial: Memory retention was evaluated in the probe trials conducted on days 6 and 8 of the hidden platform phase, and then the hidden platform trials for those days were initiated. In this test, the platform was removed from the pool and the animals were allowed to swim for 60 seconds. The time that the mice spent in the quadrant where the platform was located during the hidden platform phase was considered an estimate of the degree of memory retention. A retention rate higher than 25% was considered an indicator of learning, while a retention rate lower than 25% was considered random. The time spent in the correct quadrant during the first 15 seconds and the entire 60 seconds of the test was analyzed because it has been suggested that increasing the sensitivity of the MWM test can be achieved by providing a shorter probe trial (Gerlai, 2001, Behavioural Brain Research; 125(1–2):269–277).

[0211] Dendritic spine density was measured by Golgi-Cox staining

[0212] To analyze dendritic spine density and morphology, the modified Golgi-Cox method (Glaser, Edmund M. and Hendrik Van der Loos, 1981, Journal of Neuroscience Methods 4(2):117–25) was used. First, after removing the half-brain from the skull, it was incubated in Golgi-Cox solution (1% potassium dichromate, 1% mercuric chloride, 0.8% potassium chromate) in the dark at room temperature for 48 hours. After that, the solution was changed and the tissue was kept there for another 3 weeks. Thereafter, the brains were washed with distilled water and kept in 90° ethanol for 30 minutes until they were processed into 200 μm thick coronal sections using a vibratome. Then, the sections were incubated in 70° ethanol, washed with distilled water, reduced in 16% ammonia for 1 hour, and then fixed in 1% sodium thiosulfate for 7 minutes. After washing again, the sections were placed on microscope slides, dehydrated in alcohol with gradually increasing scales and mounted with DPX mounting medium (VWR, BDH ).

[0213] Determine the spine density in the secondary apical dendrites of pyramidal cells located within the CA1 region of the hippocampus. Each selected neuron was captured using a Nikon Eclipse E600 optical microscope, and images were recorded using a digital camera (Nikon DXM 1200F) at a resolution of 1000 - 1500 dots per inch (dpi). Secondary dendrites 100 - 200 μm from the soma, where the spine density of CA1 pyramidal neurons is relatively uniform (Megías, M., Z. Emri, T.F. Freund, and A.I. Gulyás, 2001, Neuroscience 102(3):527–40), were used for quantification. For each mouse (n = 4 per group), three dendrites from nine different neurons were analyzed.

[0214] Fear conditioning test (FC)

[0215] The FC paradigm was used to analyze the effect of PLA2G4E expression on fear memory. This behavioral test consisted of three phases: habituation, training, and testing. It was conducted in a StartFear system (Panlab). During the habituation phase, mice were allowed to acclimate to the conditioning chamber for 3 minutes without the presence of a stimulus. Twenty-four hours later, during the training phase, the mice were placed back in the same chamber and allowed to explore for 2 minutes. After that, they received two 2 s foot shocks (0.3 mA) separated by 30 s and were returned to their respective cages 30 s later. The next day, the mice were returned to the conditioning chamber and allowed to explore the environment for 2 minutes. Freezing behavior was recorded during this period, and the freezing score was expressed as a percentage. The T24 group was sacrificed 24 hours after training, and the TT group was sacrificed 1 hour after testing. The untreated group ( group) was sacrificed without performing any of the paradigm steps.

[0216] Protein extract

[0217] To obtain total protein extracts, brain samples were homogenized in lysis buffer (10 mM Tris-HCl pH = 7.5, 1 mM NaF, 0.1 mM Na3VO4, 2% SDS) containing protease inhibitors, sonicated for 2 minutes, placed on ice for 20 minutes, and then centrifuged at 15700 g for 13 minutes at 8 °C. The supernatant was stored at -80 °C. The total protein concentration was determined using a Pierce TM BCA Protein Assay Kit (Thermo Scientific).

[0218] Immunoblotting

[0219] Protein samples were mixed with 6× Laemmli sample buffer, boiled at 95 °C for 5 minutes, resolved on SDS-polyacrylamide gels, and transferred to nitrocellulose membranes.

[0220] Then, the membrane was blocked with 5% milk in TBS solution and incubated overnight with the following primary antibodies in the corresponding buffer: rabbit polyclonal anti-pGluA1-Ser831 (1:1000, Millipore), rabbit monoclonal anti-pCREB (Ser133) (1:1000, Cell Signaling), mouse monoclonal anti-synapsin I (1:1000, Synaptic Systems), rabbit polyclonal anti-PLA2G4E (1:1000, Proteintech), and mouse monoclonal anti-β-actin (1:100000, Synaptic Systems). After washing twice in TBS / Tween-20 and once in separate TBS, the immunolabeled protein bands were detected with HRP-conjugated anti-rabbit or anti-mouse antibodies (1:5000, Santa Cruz). Then, the antibody binding was visualized by enhanced chemiluminescence system (ECL, GE Healthcare Bioscience) and autoradiography exposure to Hyperfilm TM ECL (GE Healthcare Bioscience) to observe the antibody binding. Protein quantification was performed using Quantity One TM software version 4.6.3 (Bio-Rad).

[0221] Knockout of PLA2G4E in primary neuron cultures

[0222] We used specific small interfering RNA (siRNA) to inhibit the expression of PLA2G4E in primary neuron cultures. To identify the effective targeting sequences for RNAi, the full-length coding sequence of murine PLA2G4E was analyzed using different algorithms. After probing for high potency in inhibiting PLA2G4E expression, candidate sequences were used to design constructs carrying the H1 promoter, which was operably linked to the shRNA sequence (SEQ ID NO:8; i.e., the sense and antisense sequences of 21 bases linked to the hairpin loop (TCAAGAGA)), followed by a poly(T) termination signal. Then, the constructs with shRNA were cloned into adeno-associated virus serotype 9 (AAV9-shPLA2G4E) for stable siRNA delivery (Unitat de Producció de Vectors, Barcelona).

[0223] To evaluate the selective inhibition of PLA2G4E on activity-dependent signal transduction, we used primary neuron cultures as a model to study the synaptic responses of evoked burst signals in functional neural networks. Primary neuron cultures were obtained from the hippocampus and cortex of wild-type (WT) mice at embryonic day 16 (E16) (A. Ricobaraza Neuropsychopharmacology, (2009); 34:1721-1732) and infected in vitro at day in vitro (DIV) 1 with AAV9-shPLA2G4E or AAV9-shScrambled control. Then, to trigger action potential burst firing, these cultures were treated with the GABA A receptor antagonist bicuculline (50 μM, 1 hour) at DIV 14 (Arnold et al., 2005 J. Physiol. 564:3-19) (Rao et al., Nat. Neurosci., 2006; 9:887-895). Proteins were extracted in 2% SDS buffer and the activation of CREB (phosphorylated at Ser133), the expression of pGluA1 and synapsin I in the lysates were tested by immunoblotting.

[0224] Example 3. Effect of AAV2 / 9-mPLA2G4E on memory function in APP / PS1 mice

[0225] The first group (n = 9) of male and female 16-19-month-old APP / PS1 mice were treated with AAV2 / 9-mPLA2G4E by stereotaxic surgery as described above. In the same manner, a second group (n = 6) of 16-19-month-old APP / PS1 mice (sham injection) and a third group (n = 9) of non-transgenic mice of the same age (n = 9) were included as positive (memory-deficient) and negative controls (no AD-related memory impairment). Two months after stereotaxic surgery, spatial memory was tested by the MWM test as described above. Mice underwent a 3-day visible platform phase followed by a 7-day hidden platform phase. Memory retention was tested in the probe trials conducted on days 6 and 8, starting the corresponding hidden platform phase trials.

[0226] In the last trial of the visible platform phase, no significant differences were observed between groups (data not shown), indicating that all animals were able to perform the task under the same conditions.

[0227] In the hidden platform phase, as expected, the performance of APP / PS1 mice was significantly worse than that of WT mice, confirming the spatial memory impairment associated with this AD mouse model ( Figure 1 A). Interestingly, AAV2 / 9-mPLA2G4E treatment rescued the spatial working memory impairment ( Figure 1 A).

[0228] In addition, as Figure 1 shown in B, during the probe trial on day 6, mice treated with AAV2 / 9-mPLA2G4E spent more time in the correct quadrant than sham-injected mice. Similar results were obtained in the probe trial conducted on day 8 (data not shown), indicating that PLA2G4E overexpression also reversed the memory retention deficit presented in aged APP / PS1 mice.

[0229] On the other hand, a 33% mortality rate was observed in sham-injected APP / PS1 mice, compared with 10% and 0% in APP / PS1 and non-transgenic mice injected with AAV2 / 9-mPLA2G4E, respectively.

[0230] In summary, overexpression of PLA2G4E in the hippocampus of aged APP / PS1 mice mediated by AAV2 / 9-mPLA2G4E treatment significantly rescued spatial memory impairment two months after stereotaxic injection.

[0231] The Golgi-Cox method was used to analyze whether the behavioral recovery induced by PLA2G4E overexpression was reflected in the structural changes of dendritic spine density. Specifically, the apical dendrites of pyramidal neurons from the CA1 region of the hippocampus were studied.

[0232] As Figure 2 shown in A and Figure 2 B, the 2 / 9-PLA2G4E virus was able to significantly increase dendritic spine density relative to WT and APP / PS1 sham mice. No differences were found between WT and APP / PS1 sham mice.

[0233] These results suggest that the changes in spine density may account for the memory recovery observed in the group of PLA2G4E-overexpressing APP / PS1 mice.

[0234] Example 4. Effects of AAV2 / 9-mPLA2G4E on memory function in aged wild-type mice

[0235] The effects of PLA2G4E overexpression on the memory function of female 17-month-old C57BL / 6 / SJL WT mice were also evaluated. The first group (n = 5) of C57BL / 6 / SJL WT mice was treated with AAV2 / 9-mPLA2G4E by stereotaxic surgery; the second control group (n = 4) of C57BL / 6 / SJL WT mice was given a sham injection. Three months after stereotaxic surgery, spatial memory was tested by the MWM as described above. In this case, the hidden platform phase lasted only 6 days, and the probe trials were conducted on days 5 and 7.

[0236] No significant differences were observed between groups during the visible platform phase (data not shown), indicating that all mice were able to perform the task similarly.

[0237] Although there were no significant differences between the two groups during the hidden platform phase ( Figure 3 A), during the probe trials conducted on day 5 ( Figure 3 B) and day 7 (data not shown), mice treated with AAV2 / 9-mPLA2G4E spent more time in the correct quadrant than sham-injected mice, indicating that viral PLA2G4E overexpression in the hippocampus improved memory retention in aged WT mice.

[0238] In summary, AAV2 / 9-mPLA2G4E treatment-mediated overexpression of PLA2G4E in the hippocampus improved memory retention in aged C57BL / 6 / SJL WT mice three months after injection.

[0239] Example 5. Role of PLA2G4E in memory function: upregulation of PLA2G4E expression after fear-conditioned memory recovery

[0240] To obtain more direct evidence for the functional role of PLA2G4E in learning and memory, we tested whether PLA2G4E expression was regulated in the fear conditioning (FC) test. This task requires hippocampus-dependent transcription and protein synthesis and has been widely used to characterize the biochemical requirements for memory formation (Huff et al., 2006 J. Neurosci., 26, pp. 1616-1623).

[0241] After fear memory consolidation in 2-month-old C57BL / 6J WT mice sacrificed 1 hour after testing in the FC paradigm (TT group; n = 8), the expression of pCREB and PLA2G4E in the brain was analyzed by immunoblotting and compared with mice sacrificed 24 hours after the FC training phase (T24 group; n = 7) and mice that did not undergo any aspect of the FC test (untreated group; n = 8).

[0242] As expected, the freezing time (indicating memory formation) of mice reintroduced into the cage (TT group) during the test phase increased significantly relative to the freezing time during the training phase (P < 0.001) ( Figure 4 A).

[0243] Since CREB-mediated transcription is necessary for the consolidation and reconsolidation of contextual fear memory (Kida et al., 2002 Nat. Neurosci., 5, pp. 348-355), pCREB, which is indicative of neural plasticity in the animal's hippocampus, was first analyzed. An upregulation of pCREB in the hippocampus was observed in the group of mice reintroduced into the cage.

[0244] Surprisingly, PLA2G4E expression in these two regions was also stronger in this group of mice compared to other mice ( Figure 4 C).

[0245] In summary, these data indicate that PLA2G4E increases in the hippocampus during contextual memory retention after restored consolidated memory. Example 6. Role of PLA2G4E in synaptic plasticity: Knockdown of PLA2G4E blocks the activation of synaptic proteins involved in synaptic transmission Considering the plausible role of PLA2G4E in memory function, in vitro assays were performed to further characterize its role in synaptic activity.

[0246] A well-characterized protocol was used with cortical and hippocampal primary neurons on the basis of exposure to the GABA(A) receptor antagonist bicuculline (50 μM, 1 h) that can induce and / or increase the synaptic efficacy of excitatory synapses (Rao et al., 2006 Nat. Neurosci., 9:887 - 895).

[0247] To demonstrate NMDA receptor activation, CREB activation (phosphorylation of CREB at the activation site residue Ser 133) was analyzed (Ginty et al., 1993 Science 260:238 - 241). As Figure 5 shown and described by several authors (Hardingham et al., 2002 Nat. Neurosci., 5:405 - 414), we demonstrated that bicuculline (by activating NMDA receptors) caused sustained CRE phosphorylation at Ser133, as well as an increase in AMPA receptor activation (Rao et al., 2006 Nat. Neurosci., 9:887 - 895), and the increase in AMPA receptor activation was analyzed by measuring pGluA1 levels.

[0248] The synapsin I level was also analyzed because this presynaptic protein increases in the hippocampus during long-term potentiation (LTP) (Sato et al., 2000 Brain Res., 872:219 - 222) and plays a fundamental role in the formation, maintenance, and rearrangement of synaptic contacts (reviewed in Cesca et al., 2010 Prog. Neurobiol., 91:313 - 348). A significant increase in synapsin I was also observed in bicuculline-activated neuronal cultures.

[0249] Next, PLA2G4E expression was analyzed under the same conditions, and interestingly, we observed that it was strongly induced by bicuculline, indicating that neuronal activation does upregulate PLA2G4E expression.

[0250] Then, the effects of chronic PLA2G4E knockdown using AAV-shPLA2G4E were analyzed. In primary neuronal cultures, we demonstrated that treatment with AAV-shPLA2G4E blocked bicuculline-induced PLA2G4E expression and effectively blocked bicuculline-driven activation of CREB and GluA1( Figure 5 ). Similarly, acute PLA2G4E knockdown no longer increased synapsin I expression in response to bicuculline.

[0251] Collectively, these data suggest that PLA2G4E knockdown may alter synapse formation and / or stability.

[0252] The sequences of the present disclosure

[0253] SEQ ID NO:1 Human cytosolic phospholipase A2ε (isoform 1)

[0254] MSLQASEGCPGLGTNVFVPQSPQTDEEGSRSGRSFSEFEDTQDLDTPGLPPFCPMAPWGSEEGLSPCHLLTVRVIRMKNVRQADMLSQTDCFVSLWLPTASQKKLRTRTISNCPNPEWNESFNFQIQSRVKNVLELSVCDEDTVTPDDHLLTVLYDLTKLCFRKKTHVKFPLNPQGMEELEVEFLLEESPSPPETLVTNGVLVSRQVSCLEVHAQSRRRRKREKMKDLLVMVNESFENTQRVRPCLEPCCPTSACFQTAACFHYPKYFQSQVHVEVPKSHWSCGLCCRSRKKGPISQPLDCLSDGQVMTLPVGESYELHMKSTPCPETLDVRLGFSLCPAELEFLQKRKVVVAKALKQVLQLEEDLQEDEVPLIAIMATGGGTRSMTSMYGHLLGLQKLNLLDCASYITGLSGATWTMATLYRDPDWSSKNLEPAIFEARRHVVKDKLPSLFPDQLRKFQEELRQRSQEGYRVTFTDFWGLLIETCLGDERNECKLSDQRAALSCGQNPLPIYLTINVKDDVSNQDFREWFEFSPYEVGLQKYGAFIPSELFGSEFFMGRLVKRIPESRICYMLGLWSSIFSLNLLDAWNLSHTSEEFFHRWTREKVQDIEDEPILPEIPKCDANILETTVVIPGSWLSNSFREILTHRSFVSEFHNFLSGLQLHTNYLQNGQFSRWKDTVLDGFPNQLTESANHLCLLDTAFFVNSSYPPLLRPERKADLIIHLNYCAGSQTKPLKQTCEYCTVQNIPFPKYELPDENENLKECYLMENPQEPDAPIVTFFPLINDTFRKYKAPGVERSPEELEQGQVDIYGPKTPYATKELTYTEATFDKLVKLSEYNILNNKDTLLQALRLAVEKKKRLKGQCPS

[0255] The nucleotide sequence encoding human cPLA2e isoform 1 of SEQ ID NO:2

[0256]

[0257] SEQ ID NO:3 Human isoform 2 of cytosolic phospholipase A2ε

[0258] MATGGGTRSMTSMYGHLLGLQKLNLLDCASYITGLSGATWTMATLYRDPDWSSKNLEPAIFEARRHVVKDKLPSLFPDQLRKFQEELRQRSQEGYRVTFTDFWGLLIETCLGDERNECKLSDQRAALSCGQNPLPIYLTINVKDDVSNQDFREWFEFSPYEVGLQKYGAFIPSELFGSEFFMGRLVKRIPESRICYMLGLWSSIFSLNLLDAWNLSHTSEEFFHRWTREKVQDIEDEPILPEIPKCDANILETTVVIPGSWLSNSFREILTHRSFVSEFHNFLSGLQLHTNYLQNGQFSRWKDTVLDGFPNQLTESANHLCLLDTAFFVNSSYPPLLRPERKADLIIHLNYCAGSQTKPLKQTCEYCTVQNIPFPKYELPDENENLKECYLMENPQEPDAPIVTFFPLINDTFRKYKAPGVERSPEELEQGQVDIYGPKTPYATKELTYTEATFDKLVKLSEYNILNNKDTLLQALRLAVEKKKRLKGQCPS

[0259] SEQ ID NO:4 Nucleotide sequence encoding human cPLA2e isoform 2

[0260]

[0261] Nucleotide sequence of mouse PLA2G4E with SEQ ID NO:5 encoding fused to the flag sequence

[0262]

[0263] Forward primer fwPLA2G4E of SEQ ID NO:6

[0264] ATGGTGACAGACTCCTTCGAG

[0265] Reverse primer rvPLA2G4E of SEQ ID NO:7

[0266] CCTCTGCGTAAAGCTGTGG

[0267] shRNA of PLA2G4E (shPLA2G4E) of SEQ ID NO:8

[0268] GGTCTATGGTCTCCTTGTATCAAGAGTACAAGGAGACCATAGACC Sequence Listing <110> Foundation for Basic and Applied Medical Research University of Navarra <120> cPLA2e Inducer and Its Use <130> 905 326 <160> 8 <170> BiSSAP 1.3.6 <210> 1 <211> 868 <212> PRT <213> Homo sapiens <220> <223> Cytosolic phospholipase A2 epsilon (Isoform 1) <400> 1 Met Ser Leu Gln Ala Ser Glu Gly Cys Pro Gly Leu Gly Thr Asn Val 1 5 10 15 Phe Val Pro Gln Ser Pro Gln Thr Asp Glu Glu Gly Ser Arg Ser Gly 20 25 30 Arg Ser Phe Ser Glu Phe Glu Asp Thr Gln Asp Leu Asp Thr Pro Gly 35 40 45 Leu Pro Pro Phe Cys Pro Met Ala Pro Trp Gly Ser Glu Glu Gly Leu 50 55 60 Ser Pro Cys His Leu Leu Thr Val Arg Val Ile Arg Met Lys Asn Val 65 70 75 80 Arg Gln Ala Asp Met Leu Ser Gln Thr Asp Cys Phe Val Ser Leu Trp 85 90 95 Leu Pro Thr Ala Ser Gln Lys Lys Leu Arg Thr Arg Thr Ile Ser Asn 100 105 110 Cys Pro Asn Pro Glu Trp Asn Glu Ser Phe Asn Phe Gln Ile Gln Ser 115 120 125 Arg Val Lys Asn Val Leu Glu Leu Ser Val Cys Asp Glu Asp Thr Val 130 135 140 Thr Pro Asp Asp His Leu Leu Thr Val Leu Tyr Asp Leu Thr Lys Leu 145 150 155 160 Cys Phe Arg Lys Lys Thr His Val Lys Phe Pro Leu Asn Pro Gln Gly 165 170 175 Met Glu Glu Leu Glu Val Glu Phe Leu Leu Glu Glu Ser Pro Ser Pro 180 185 190 Pro Glu Thr Leu Val Thr Asn Gly Val Leu Val Ser Arg Gln Val Ser 195 200 205 Cys Leu Glu Val His Ala Gln Ser Arg Arg Arg Arg Lys Arg Glu Lys 210 215 220 Met Lys Asp Leu Leu Val Met Val Asn Glu Ser Phe Glu Asn Thr Gln 225 230 235 240 Arg Val Arg Pro Cys Leu Glu Pro Cys Cys Pro Thr Ser Ala Cys Phe 245 250 255 Gln Thr Ala Ala Cys Phe His Tyr Pro Lys Tyr Phe Gln Ser Gln Val 260 265 270 His Val Glu Val Pro Lys Ser His Trp Ser Cys Gly Leu Cys Cys Arg 275 280 285 Ser Arg Lys Lys Gly Pro Ile Ser Gln Pro Leu Asp Cys Leu Ser Asp 290 295 300 Gly Gln Val Met Thr Leu Pro Val Gly Glu Ser Tyr Glu Leu His Met 305 310 315 320 Lys Ser Thr Pro Cys Pro Glu Thr Leu Asp Val Arg Leu Gly Phe Ser 325 330 335 Leu Cys Pro Ala Glu Leu Glu Phe Leu Gln Lys Arg Lys Val Val Val 340 345 350 Ala Lys Ala Leu Lys Gln Val Leu Gln Leu Glu Glu Asp Leu Gln Glu 355 360 365 Asp Glu Val Pro Leu Ile Ala Ile Met Ala Thr Gly Gly Gly Thr Arg 370 375 380 Ser Met Thr Ser Met Tyr Gly His Leu Leu Gly Leu Gln Lys Leu Asn 385 390 395 400 Leu Leu Asp Cys Ala Ser Tyr Ile Thr Gly Leu Ser Gly Ala Thr Trp 405 410 415 Thr Met Ala Thr Leu Tyr Arg Asp Pro Asp Trp Ser Ser Lys Asn Leu 420 425 430 Glu Pro Ala Ile Phe Glu Ala Arg Arg His Val Val Lys Asp Lys Leu 435 440 445 Pro Ser Leu Phe Pro Asp Gln Leu Arg Lys Phe Gln Glu Glu Leu Arg 450 455 460 Gln Arg Ser Gln Glu Gly Tyr Arg Val Thr Phe Thr Asp Phe Trp Gly 465 470 475 480 Leu Leu Ile Glu Thr Cys Leu Gly Asp Glu Arg Asn Glu Cys Lys Leu 485 490 495 Ser Asp Gln Arg Ala Ala Leu Ser Cys Gly Gln Asn Pro Leu Pro Ile 500 505 510 Tyr Leu Thr Ile Asn Val Lys Asp Asp Val Ser Asn Gln Asp Phe Arg 515 520 525 Glu Trp Phe Glu Phe Ser Pro Tyr Glu Val Gly Leu Gln Lys Tyr Gly 530 535 540 Ala Phe Ile Pro Ser Glu Leu Phe Gly Ser Glu Phe Phe Met Gly Arg 545 550 555 560 Leu Val Lys Arg Ile Pro Glu Ser Arg Ile Cys Tyr Met Leu Gly Leu 565 570 575 Trp Ser Ser Ile Phe Ser Leu Asn Leu Leu Asp Ala Trp Asn Leu Ser 580 585 590 His Thr Ser Glu Glu Phe Phe His Arg Trp Thr Arg Glu Lys Val Gln 595 600 605 Asp Ile Glu Asp Glu Pro Ile Leu Pro Glu Ile Pro Lys Cys Asp Ala 610 615 620 Asn Ile Leu Glu Thr Thr Val Val Ile Pro Gly Ser Trp Leu Ser Asn 625 630 635 640 Ser Phe Arg Glu Ile Leu Thr His Arg Ser Phe Val Ser Glu Phe His 645 650 655 Asn Phe Leu Ser Gly Leu Gln Leu His Thr Asn Tyr Leu Gln Asn Gly 660 665 670 Gln Phe Ser Arg Trp Lys Asp Thr Val Leu Asp Gly Phe Pro Asn Gln 675 680 685 Leu Thr Glu Ser Ala Asn His Leu Cys Leu Leu Asp Thr Ala Phe Phe 690 695 700 Val Asn Ser Ser Tyr Pro Pro Leu Leu Arg Pro Glu Arg Lys Ala Asp 705 710 715 720 Leu Ile Ile His Leu Asn Tyr Cys Ala Gly Ser Gln Thr Lys Pro Leu 725 730 735 Lys Gln Thr Cys Glu Tyr Cys Thr Val Gln Asn Ile Pro Phe Pro Lys 740 745 750 Tyr Glu Leu Pro Asp Glu Asn Glu Asn Leu Lys Glu Cys Tyr Leu Met 755 760 765 Glu Asn Pro Gln Glu Pro Asp Ala Pro Ile Val Thr Phe Phe Pro Leu 770 775 780 Ile Asn Asp Thr Phe Arg Lys Tyr Lys Ala Pro Gly Val Glu Arg Ser 785 790 795 800 Pro Glu Glu Leu Glu Gln Gly Gln Val Asp Ile Tyr Gly Pro Lys Thr 805 810 815 Pro Tyr Ala Thr Lys Glu Leu Thr Tyr Thr Glu Ala Thr Phe Asp Lys 820 825 830 Leu Val Lys Leu Ser Glu Tyr Asn Ile Leu Asn Asn Lys Asp Thr Leu 835 840 845 Leu Gln Ala Leu Arg Leu Ala Val Glu Lys Lys Lys Arg Leu Lys Gly 850 855 860 Gln Cys Pro Ser 865 <210> 2 <211> 2607 <212> DNA <213> Homo sapiens <220> <223> Nucleotide Sequence encoding human cPLA2e isoform 1 <400> 2 atgagtctcc aggcctcgga aggctgtcct ggcctgggaa ctaatgtgtt tgtcccacag 60 agcccacaaa cggatgaaga aggcagcagg tcaggaagaa gtttcagtga gttcgaggat 120 acacaggacc tggacactcc tggtctccca cctttctgtc ctatggctcc ttggggctct 180 gaggaggggc tgtctccatg ccacctgttg acagtgaggg tcatccggat gaaaaatgtc 240 cggcaggctg atatgctgag ccagacagac tgttttgtga gcctctggct gcccaccgcc 300 tctcagaaga agctgaggac aaggaccatc tccaactgcc caaatccaga gtggaatgaa 360 agcttcaact tccagatcca gagccgagtg aagaacgtgc tagagttgag tgtctgtgat 420 gaagacacag tgacaccaga tgaccatctc ctgacagttc tctatgacct caccaagctc 480 tgtttccgaa agaaaaccca cgtgaagttt ccactcaacc cgcagggcat ggaagagctg 540 gaggtggagt tcctgctgga ggagagtccc tctccacctg agaccctcgt caccaatggc 600 gtgctggtgt ctcgacaagt ctcctgcctg gaggttcatg cacaatccag gaggcggagg 660 aagagggaga aaatgaagga cctcctggtg atggtgaacg aatcctttga gaacacccag 720 cgtgtccggc cctgcttgga accctgctgc ccaacctctg cctgcttcca aaccgctgcc 780 tgcttccact accccaagta cttccagtcc caggtgcacg tggaagtgcc caagagtcac 840 tggagctgtg ggctttgctg ccgctctcgc aagaagggcc ccatcagcca gcccctcgac 900 tgcctttccg atggtcaggt gatgaccctg cctgtgggtg agagttatga attacacatg 960 aagtctacac cctgccctga gacactggac gtgcggctgg gcttcagcct gtgcccagca 1020 gagctggagt ttctgcagaa gcggaaggtc gtggtggcca aggccctgaa gcaggtgctg 1080 cagctggagg aagacctgca ggaggacgag gtgccgctga tagccatcat ggccactggg 1140 ggtggaacaa gatccatgac ctccatgtat ggccacctgc tggggctgca gaagctgaac 1200 ctcctggact gtgccagcta catcaccggt ctatcagggg ccacctggac catggctacc 1260 ttgtaccgtg accctgactg gtcctccaaa aacttggagc ctgctatctt tgaggctcgg 1320 agacatgtgg taaaggacaa gctaccctcc ctgttcccag accagctccg caaattccag 1380 gaggagctcc ggcagcgcag ccaggaaggc tacagggtca cctttacaga cttctggggc 1440 ctgctgatag agacctgcct gggggacgag agaaatgaat gcaaactgtc agatcagcgt 1500 gctgctttga gctgcggcca gaaccccctg cccatctacc tcaccatcaa tgtcaaggat 1560 gatgtaagca accaggactt cagagagtgg ttcgagttct ccccctacga ggtgggcctg 1620 cagaagtatg gggccttcat cccctccgag ctcttcggct ccgagttctt catggggcgg 1680 ctggtgaaga ggatcccgga gtctcgaatc tgctacatgc taggcctgtg gagcagcatc 1740 ttctccctga acctgctgga tgcctggaac ctgtcacaca cctcggagga gtttttccac 1800 aggtggacaa gggagaaagt gcaggacatc gaagacgagc cgatcctgcc tgaaatcccc 1860 aaatgtgatg ctaacatcct ggagaccacg gtagtgatcc cagggtcatg gctgtccaat 1920 tctttccgag aaatccttac ccatcggtcc ttcgtgtctg agtttcacaa cttcctgtct 1980 gggctgcagc tgcacaccaa ctacctccag aatggccagt tctctaggtg gaaagacaca 2040 gtgctagatg gtttcccaaa ccagctgacc gagtccgcga accacctgtg cctgctggac 2100 actgcgttct ttgtcaactc cagctacccg cccctcctca ggccagagcg aaaagccgac 2160 ctcatcatcc acctcaacta ctgtgctggg tcccagacaa agcccctgaa acaaacctgt 2220 gagtactgca ctgtgcagaa catccccttc cccaaatacg agctgccaga tgagaatgaa 2280 aatctcaagg aatgctacct gatggagaac ccccaggaac ccgatgcccc catcgtgact 2340 ttcttcccac tcatcaatga cactttccga aaatacaagg caccaggtgt agagcgaagc 2400 cctgaggagc tggagcaggg ccaggtggac atttatggtc ccaaaactcc ctatgccacc 2460 aaggagctga catacacaga ggccaccttt gacaagctgg tgaaactctc agagtataac 2520 atcctgaata ataaggacac tctcctccag gctctgcggc tcgcagtgga gaagaagaag 2580 cgcctgaagg gccagtgtcc ctcctag 2607 <210> 3 <211> 492 <212> PRT <213> Homo sapiens <220> <223> Isoform 2 of Cytosolic phospholipase A2 epsilon <400> 3 Met Ala Thr Gly Gly Gly Thr Arg Ser Met Thr Ser Met Tyr Gly His 1 5 10 15 Leu Leu Gly Leu Gln Lys Leu Asn Leu Leu Asp Cys Ala Ser Tyr Ile 20 25 30 Thr Gly Leu Ser Gly Ala Thr Trp Thr Met Ala Thr Leu Tyr Arg Asp 35 40 45 Pro Asp Trp Ser Ser Lys Asn Leu Glu Pro Ala Ile Phe Glu Ala Arg 50 55 60 Arg His Val Val Lys Asp Lys Leu Pro Ser Leu Phe Pro Asp Gln Leu 65 70 75 80 Arg Lys Phe Gln Glu Glu Leu Arg Gln Arg Ser Gln Glu Gly Tyr Arg 85 90 95 Val Thr Phe Thr Asp Phe Trp Gly Leu Leu Ile Glu Thr Cys Leu Gly 100 105 110 Asp Glu Arg Asn Glu Cys Lys Leu Ser Asp Gln Arg Ala Ala Leu Ser 115 120 125 Cys Gly Gln Asn Pro Leu Pro Ile Tyr Leu Thr Ile Asn Val Lys Asp 130 135 140 Asp Val Ser Asn Gln Asp Phe Arg Glu Trp Phe Glu Phe Ser Pro Tyr 145 150 155 160 Glu Val Gly Leu Gln Lys Tyr Gly Ala Phe Ile Pro Ser Glu Leu Phe 165 170 175 Gly Ser Glu Phe Phe Met Gly Arg Leu Val Lys Arg Ile Pro Glu Ser 180 185 190 Arg Ile Cys Tyr Met Leu Gly Leu Trp Ser Ser Ile Phe Ser Leu Asn 195 200 205 Leu Leu Asp Ala Trp Asn Leu Ser His Thr Ser Glu Glu Phe Phe His 210 215 220 Arg Trp Thr Arg Glu Lys Val Gln Asp Ile Glu Asp Glu Pro Ile Leu 225 230 235 240 Pro Glu Ile Pro Lys Cys Asp Ala Asn Ile Leu Glu Thr Thr Val Val 245 250 255 Ile Pro Gly Ser Trp Leu Ser Asn Ser Phe Arg Glu Ile Leu Thr His 260 265 270 Arg Ser Phe Val Ser Glu Phe His Asn Phe Leu Ser Gly Leu Gln Leu 275 280 285 His Thr Asn Tyr Leu Gln Asn Gly Gln Phe Ser Arg Trp Lys Asp Thr 290 295 300 Val Leu Asp Gly Phe Pro Asn Gln Leu Thr Glu Ser Ala Asn His Leu 305 310 315 320 Cys Leu Leu Asp Thr Ala Phe Phe Val Asn Ser Ser Tyr Pro Pro Leu 325 330 335 Leu Arg Pro Glu Arg Lys Ala Asp Leu Ile Ile His Leu Asn Tyr Cys 340 345 350 Ala Gly Ser Gln Thr Lys Pro Leu Lys Gln Thr Cys Glu Tyr Cys Thr 355 360 365 Val Gln Asn Ile Pro Phe Pro Lys Tyr Glu Leu Pro Asp Glu Asn Glu 370 375 380 Asn Leu Lys Glu Cys Tyr Leu Met Glu Asn Pro Gln Glu Pro Asp Ala 385 390 395 400 Pro Ile Val Thr Phe Phe Pro Leu Ile Asn Asp Thr Phe Arg Lys Tyr 405 410 415 Lys Ala Pro Gly Val Glu Arg Ser Pro Glu Glu Leu Glu Gln Gly Gln 420 425 430 Val Asp Ile Tyr Gly Pro Lys Thr Pro Tyr Ala Thr Lys Glu Leu Thr 435 440 445 Tyr Thr Glu Ala Thr Phe Asp Lys Leu Val Lys Leu Ser Glu Tyr Asn 450 455 460 Ile Leu Asn Asn Lys Asp Thr Leu Leu Gln Ala Leu Arg Leu Ala Val 465 470 475 480 Glu Lys Lys Lys Arg Leu Lys Gly Gln Cys Pro Ser 485 490 <210> 4 <211> 1479 <212> DNA <213> Homo sapiens <220> <223> Nucleotide Sequence encoding human cPLA2e isoform 2 <400> 4 atggccactg ggggtggaac aagatccatg acctccatgt atggccacct gctggggctg 60 cagaagctga acctcctgga ctgtgccagc tacatcaccg gtctatcagg ggccacctgg 120 accatggcta ccttgtaccg tgaccctgac tggtcctcca aaaacttgga gcctgctatc 180 tttgaggctc ggagacatgt ggtaaaggac aagctaccct ccctgttccc agaccagctc 240 cgcaaattcc aggaggagct ccggcagcgc agccaggaag gctacagggt cacctttaca 300 gacttctggg gcctgctgat agagacctgc ctgggggacg agagaaatga atgcaaactg 360 tcagatcagc gtgctgcttt gagctgcggc cagaaccccc tgcccatcta cctcaccatc 420 aatgtcaagg atgatgtaag caaccaggac ttcagagagt ggttcgagtt ctccccctac 480 gaggtgggcc tgcagaagta tggggccttc atcccctccg agctcttcgg ctccgagttc 540 ttcatggggc ggctggtgaa gaggatcccg gagtctcgaa tctgctacat gctaggcctg 600 tggagcagca tcttctccct gaacctgctg gatgcctgga acctgtcaca cacctcggag 660 gagtttttcc acaggtggac aagggagaaa gtgcaggaca tcgaagacga gccgatcctg 720 cctgaaatcc ccaaatgtga tgctaacatc ctggagacca cggtagtgat cccagggtca 780 tggctgtcca attctttccg agaaatcctt acccatcggt ccttcgtgtc tgagtttcac 840 aacttcctgt ctgggctgca gctgcacacc aactacctcc agaatggcca gttctctagg 900 tggaaagaca cagtgctaga tggtttccca aaccagctga ccgagtccgc gaaccacctg 960 tgcctgctgg acactgcgtt ctttgtcaac tccagctacc cgcccctcct caggccagag 1020 cgaaaagccg acctcatcat ccacctcaac tactgtgctg ggtcccagac aaagcccctg 1080 aaacaaacct gtgagtactg cactgtgcag aacatcccct tccccaaata cgagctgcca 1140 gatgagaatg aaaatctcaa ggaatgctac ctgatggaga acccccagga acccgatgcc 1200 cccatcgtga ctttcttccc actcatcaat gacactttcc gaaaatacaa ggcaccaggt 1260 gtagagcgaa gccctgagga gctggagcag ggccaggtgg acatttatgg tcccaaaact 1320 ccctatgcca ccaaggagct gacatacaca gaggccacct ttgacaagct ggtgaaactc 1380 tcagagtata acatcctgaa taataaggac actctcctcc aggctctgcg gctcgcagtg 1440 gagaagaaga agcgcctgaa gggccagtgt ccctcctag 1479 <210> 5 <211> 2673 <212> DNA <213> Artificial Sequence <220> <223> Nucleotide Sequence encoding murine PLA2G4E fused to a flag sequence <400> 5 atgcagtcta ttccacactc cgatgaagca gacgtggctg ggatgaccca cgcctcagaa 60 ggccaccatg gcctggggac cagcaccatgctt gtcccaaga acccacagg gggaagac 120 agcaagctag gagaaactg cagtggattt gaagatgcac agcaccaca gactgctgtg 180 ccctcctcac ctttacttc catggcttct tgcagttc aggaggttc atctccatgc 240 catctgttga cattgtgagat cattggcatg aaaaacgtcc ggcaggctga tatactgagt 300 cagacagact gctttgtgac cctctggctg cctactgcct ctcagaagaa gctgaagacc 360 agaaccatct ccaactgcct agaacccagag tgggacgaa gctcacctt tcagatccag 420 actcaagtaa agaatgtgct agagctgagc gtctgtgacg aagacaccct gandacaaat 480 gaccatctct tgacagtcct ctatgacctc tctaagctt gcctccggaa taaaacccat 540 gtgaagttcc cactcaaccc agagggcatg gagaactgg aggtggatt cctactcgaa 600 gagaatttct cctcatcaga gaccctcatc accaacggcg tgctggtgtc tcgccaagtc 660 tcttgcctgg aggttcatgc agaatccagg aggccgagga agaggaagaa aaacaaagac 720 cttctggtga tggtgacaga ctccttcgag aacacccagc gtgtcccgcc ttgccaggag 780 ccctgctacc ccaattctgc ctgcttccac taccccaagt actcccagcc acagctttac 840 gcagaggcgc ctaagagcca ctgtaacttt aggctttgct gctgcggaac acacaggaat 900 gaccctgtct gccagcccct caattgcctt tctgatggcc aggtgacaac cctgcctgtg 960 ggagagaact atgagctaca catgaagtcc tcaccctgct ctgacacact ggatgtgcgg 1020 cttggattca gcctgtgcca ggaagaggtg gagtttgtgc agaagcggaa gatggtggtg 1080 gccaagacac taagtcagat gctgcagctg gaggaaggcc tgcatgagga tgaggtaccg 1140 ataatagcca tcatggccac aggaggtggc acaaggtcta tggtctcctt gtatggccac 1200 ctgctggggt tgcagaagct gaactttctg gacgcttcta cttacatcac cggcttgtca 1260 ggtgcaacct ggactatggc taccttgtac agtgatcctg agtggtcctc caaaaacctg 1320 gagactgttg tctttgaggc ccggagacat gttgtcaaag acaagatgcc tgccctgttc 1380 ccagatcagc tctacaaatg gcgagaggac ctccaaaagc atagccagga gggctataag 1440 accacgttta cagacttttg gggcaagctg atcgagtaca gtctgggaga taaaaaaaac 1500 gaatgcaagc tgtcagatca gcgagctgct ctgtgcaggg gacagaaccc tctgcccatc 1560 tacctcacca tcaatgtcaa ggatgatgta agcaaccagg atttcagaga atggttcgag 1620 ttctccccct acgaggtggg catgcagaag tacggagcct tcatccccag cgagttattt 1680 ggctccgagt tcttcatggg gcggctgatg aagaggattc ctgagccgga gatgtgctac 1740 atgctagggt tgtggagtag catcttttcc ctgaacctgc ttgatgcctg gaatttgtct 1800 cacacctcag aggagttttt ctataggtgg acaagggaga gactgcatga catcgaagat 1860 gatcccatcc tgcctgaaat ccctaggtgt gacgataacc ccctagagac cacagtagtg 1920 atcccaacga catggctgtc caacaccttc cgagaaatcc tcacacgcag gcccttcgtg 1980 tctgagttcc acaacttcct gtacgggatg cagctgcata ctgactactt acagaacagg 2040 cagttctcta tgtggaaaga cacagtactg gacaccttcc caaaccagct gacacagttt 2100 gcaaaacacc tgaacctgct ggacactgcg ttctttgtca actccagcta cgcacccctc 2160 cttaggccag agagaaaagt cgaccttatc atccacctca attactgcgc aggatcccag 2220 acaaagcccc tgaaacaaac ctgtgagtac tgtaccgagc agaagatccc cttccccagc 2280 ttctccatcc tggaagatga caacagtctc aaggagtgct acgtgatgga gaatccccag 2340 gagcccgacg cccccatcgt ggcttacttc ccactcatca gtgacacctt ccagaagtac 2400 aaggctccag gtgtagagcg aagtcctgac gagctggaac tgggccagct gaacatctat 2460 ggaccaaagt ctccctatgc caccaaggag ctgacgtaca cagaggccgc cttcgacaag 2520 ctggtgaagc tctcagaata taatatcctc aataacagag ataagctcat tcaggccttg 2580 agactagcaa tggagaagaa acgcatgagg agccagtgtc cctccgcggc cgcaggaggt 2640 ggaggtgact acaaggatga cgatgacaag tga 2673 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Forward primer fwPLA2G4E <400> 6 atggtgacag actccttcga g 21 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer rvPLA2G4E <400> 7 cctctgcgta aagctgtgg 19 <210> 8 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> shRNA for PLA2G4E (shPLA2G4E) <400> 8 ggtctatggt ctccttgtat caagagtaca aggagaccat agacc 45

Claims

1. An adeno-associated virus (AAV) vector comprising a nucleic acid construct, the nucleic acid construct comprising a nucleotide sequence encoding cytosolic phospholipase A2ε (cPLA2ε), the nucleic acid construct further comprising a neuron-specific promoter, the neuron-specific promoter being operably linked to the nucleotide sequence encoding cPLA2ε.

2. The AAV vector of claim 1, wherein the cPLA2ε is human cPLA2ε.

3. The AAV vector of claim 2, wherein the cPLA2ε is the human cPLA2ε of SEQ ID NO: 1 or SEQ ID NO: 3; or the nucleotide sequence encoding cPLA2ε is SEQ ID NO: 2 or SEQ ID NO:

4.

4. The AAV vector of any one of claims 1-3, wherein the promoter operably linked to the nucleotide sequence encoding cPLA2ε is the SYN1 promoter or a hybrid SYN1 promoter.

5. The AAV vector of any one of claims 1-3, wherein the nucleic acid construct further comprises a polyadenylation signal sequence.

6. The AAV vector of any one of claims 1-3, wherein the nucleic acid construct further comprises the 5’ ITR and 3’ ITR sequences of adeno-associated virus.

7. The AAV vector of claim 6, wherein the 5’ ITR and 3’ ITR sequences are from the AAV2 serotype.

8. An AAV viral particle, the viral particle comprising the AAV vector of any one of claims 1-7.

9. The viral particle of claim 8, wherein the viral particle comprises a capsid protein selected from the group consisting of the AAV2, AAV5, AAV9, and AAVTT serotypes.

10. A host cell, the host cell comprising the AAV vector of any one of claims 1-7.

11. A method for producing viral particles, the method comprising: a) culturing packaging cells comprising the AAV vector of any one of claims 1-7 in a culture medium; and b) harvesting viral particles from the cell culture supernatant and / or inside the cells.

12. A pharmaceutical composition, the pharmaceutical composition comprising: The AAV vector of any one of claims 1-7, the viral particle of any one of claims 8-9, or the host cell of claim 10; and a pharmaceutically acceptable carrier or excipient.

13. Use of the AAV vector of any one of claims 1-7, the viral particle of any one of claims 8-9, the host cell of claim 10, or the pharmaceutical composition of claim 12 in the preparation of a medicament for treating a disease associated with age-related dementia and / or Alzheimer's disease.

14. The use of claim 13, wherein the disease is Alzheimer's disease.

15. The use of claim 13, wherein the disease is age-related dementia. Use of a cPLA2e inducer in the preparation of a medicament for treating age-related dementia and / or Alzheimer's disease in a subject in need thereof, wherein the cPLA2e inducer is: a viral vector comprising a nucleic acid construct, the nucleic acid construct comprising a nucleotide sequence encoding cytosolic phospholipase A2ε (cPLA2e); a viral particle comprising the viral vector; a host cell comprising the viral vector; or a pharmaceutical composition comprising at least one of the viral vector, the viral particle, and the host cell and further comprising a pharmaceutically acceptable carrier or excipient.

17. The use according to claim 16, wherein the disease is Alzheimer's disease.

18. The use according to claim 16, wherein the disease is age-related dementia.

19. A method for identifying a compound as a candidate for treating age-related dementia and / or Alzheimer's disease, the method comprising the steps of: a. contacting the compound with mammalian neuronal cells; b. checking whether cPLA2e activity is increased or whether cPLA2e expression is increased; C. If cPLA2e activity or expression is increased, identifying the compound as a candidate for treating cognitive impairment and / or a disease associated with cognitive impairment.

Images