High-throughput microhaplotype detection and typing system and method based on second-generation sequencing

Abstract

The present invention discloses a micro-haplotype detection and typing system and method based on second-generation sequencing, belonging to the technical field of bioinformatics. The system includes: a data input module, a database storage module, an MHParser typing module, an MHParser sample similarity calculation module, and may also include an MHParser multiple sequence alignment module and an MHParser sample clustering module. The method includes: obtaining a detection site list and a sample second-generation sequencing alignment file; using the detection site list, calculating the micro-haplotype site according to the sample second-generation sequencing alignment file, and obtaining the micro-haplotype typing result; calculating the similarity score between any two samples. Using the present invention, the similarity between any two samples can be accurately obtained, which is simple and reliable. Furthermore, the samples can be identified through multiple sequence alignment and cluster analysis, eliminating sample confusion and contamination problems, and further improving the accuracy of the alignment, which has important application value.

Description

[0001] Related patents

[0002] This application is a divisional application of the Chinese invention patent application with application number 202110128303.1, application date January 29, 2021, and invention name “A micro-haplotype detection and typing system and method based on second-generation sequencing”. Technical Field

[0003] The present invention belongs to the field of bioinformatics, and in particular, relates to a high-throughput micro-haplotype detection and typing system and method based on second-generation sequencing. Background Art

[0004] Haplotype refers to a linear combination of tightly linked alleles on a chromosome or mitochondria. Each combination is a haplotype. In recent years, haplotypes have been increasingly used in forensic medicine, mainly involving the study of STR and SNP polymorphisms on the Y chromosome, X chromosome, and mitochondria.

[0005] The fragment length of microhaplotype is shorter, which is a combination of 2 to 5 SNPs within the range of 200bp. Since the microhaplotype locus contains multiple SNP sites, the microhaplotype is a multi-allelic genetic marker and contains richer genetic information. Microhaplotype is a new type of genetic marker that has attracted extensive attention in the international forensic genetics community in recent years. It has shown great potential in the field of mixed DNA typing and supports forensic applications such as human ethnic regional inference, complex kinship identification, and trace degraded sample testing. It has the advantages of both STR and SNP genetic markers:

[0006] (1) Highly polymorphic. Usually, a SNP site has only two alleles. If n di-allelic SNPs constitute a micro-haplotype site, then the micro-haplotype site can theoretically have a maximum of 2n SNP combinations, that is, a maximum of 2n genotypes.

[0007] (2) Low mutation rate. The mutation rate of microhaplotypes is equivalent to that of SNPs, which is 10-9 to 10-8 per generation, which is one millionth to one hundred thousandth of the STR mutation rate. This has unique advantages in paternity testing.

[0008] (3) Detection without shadow bands. STR typing based on electrophoresis technology will produce shadow bands, which is not conducive to the analysis of complex mixed DNA samples. Micro-haplotypes are detected by sequencing, without shadow bands, and the second-generation sequencing has the advantages of high throughput and high sensitivity, which has great potential in the quantitative analysis of complex mixed DNA.

[0009] (4) Length advantage. The length of alleles of STR loci spans a large range, which can lead to amplification imbalance. Longer alleles are likely to be destroyed in degraded samples, and accurate typing results cannot be obtained. Microhaplotypes are relatively uniform in length, which can reduce amplification imbalance caused by length differences.

[0010] Micro-haplotype detection methods include second-generation sequencing, high-resolution melting curve, single-strand conformation polymorphism analysis, etc. Among them, second-generation sequencing, also known as next generation sequencing (NGS) or massively parallel sequencing (MPS), has been widely used in scientific research and clinical diagnosis. Since micro-haplotype is a detection technology that has only emerged in recent years, there are few methods for micro-haplotype analysis based on second-generation sequencing data, and the functions are relatively simple. For example, some micro-haplotype detection software based on amplicon platform can only perform single counting of micro-haplotypes. Summary of the invention

[0011] In order to solve at least one of the above technical problems, the technical solution adopted by the present invention is as follows:

[0012] A micro-haplotype detection and typing system based on second-generation sequencing, comprising:

[0013] Data input module, used to accept sample second-generation sequencing comparison file input;

[0014] A database storage module, used for storing a list of detection sites;

[0015] The MHParser typing module is connected to the data input module and the database storage module respectively, and is used to calculate the micro-haplotype sites based on the detection site list and the input sample second-generation sequencing comparison file, and output the micro-haplotype typing result; wherein the micro-haplotype typing result includes haplotype information and counting information;

[0016] An MHParser sample similarity calculation module, connected to the MHParser typing module, is used to receive the micro-haplotype typing results output by the MHParser typing module, and calculate the similarity score between any two samples according to the micro-haplotype typing results;

[0017] The result output module is used to output the similarity score.

[0018] In the present invention, MHParser is a custom name and has no limiting effect on the corresponding module.

[0019] In some embodiments of the invention, the loci include microhaplotypes and individual SNP / InDel loci.

[0020] In some embodiments of the present invention, the detection site list format is shown in the following table:

[0021]

[0022]

[0023] In a specific embodiment of the present invention, the detection sites are listed as follows:

[0024]

[0025]

[0026]

[0027] In some embodiments of the present invention, the counting information refers to the number of reads supporting the corresponding site.

[0028] In some embodiments of the present invention, the MHParser sample similarity calculation module further outputs sample integrated micro-haplotype sequence information; the micro-haplotype detection typing system further comprises:

[0029] An MHParser multiple sequence alignment module, connected to the MHParser sample similarity calculation module, is used to receive the sample integrated micro-haplotype sequence information output by the MHParser sample similarity calculation module, and perform multiple sequence alignment according to the sample integrated micro-haplotype sequence information to obtain the sample multiple sequence alignment result;

[0030] An MHParser sample clustering module, connected to the MHParser multiple sequence alignment module, is used to receive the multiple sequence alignment results output by the MHParser multiple sequence alignment module, and perform clustering analysis based on the sample multiple sequence alignment results;

[0031] The result output module is also connected to the MHParser sample clustering module for outputting clustering analysis results of samples.

[0032] In some embodiments of the present invention, the integrated micro-haplotype sequence information refers to a sequence obtained by splicing the sequences of the detection sites together.

[0033] In some embodiments of the present invention, the database storage module is also used to store sequencing variation detection information.

[0034] Furthermore, the MHParser typing module outputs the genotype of the site.

[0035] Furthermore, the site is a SNP / InDel site.

[0036] The second aspect of the present invention provides a method for detecting and typing micro-haplotypes based on second-generation sequencing, comprising the following steps:

[0037] S1, obtain the detection site list and sample second-generation sequencing comparison file;

[0038] S2, using the detection site list, calculating the micro-haplotype site of the sample according to the sample second-generation sequencing comparison file, and obtaining the micro-haplotype typing result, wherein the micro-haplotype typing result includes haplotype information and count information;

[0039] S3, calculating the similarity score between any two samples according to the micro-haplotype typing results of step S2.

[0040] In some embodiments of the present invention, step S3 also obtains sample integrated micro-haplotype sequence information.

[0041] Furthermore, the method further comprises the following steps:

[0042] S4, performing multiple sequence alignment based on the sample integrated micro-haplotype sequence information to obtain the multiple sequence alignment results;

[0043] S5, performing cluster analysis based on the multiple sequence alignment results to obtain cluster analysis results.

[0044] In some embodiments of the present invention, in step S2, the microhaplotype typing result is obtained by specifically using the following steps:

[0045] S21, for any micro-haplotype site in the detection site list, traverse each sequence in the sample second-generation sequencing alignment file, extract the base combination of reads according to the coordinate information of the site, obtain the haplotype, and count the reads with the same haplotype;

[0046] S22, for the same haplotype, different base combinations were sorted according to the number of reads;

[0047] Thus, the micro-haplotype typing results described in the detection site list are obtained.

[0048] In some embodiments of the present invention, in step S3, the similarity score is obtained by using the following formula:

[0049] S31, obtaining micro-haplotype typing results of multiple samples according to the method of step S2

[0050] S32, calculate the similarity score between any two samples according to the following formula:

[0051]

[0052] in,

[0053] S is the similarity score;

[0054] m is the number of sites;

[0055] C1 is a constant with a value of 1, which is the score when the base types of a certain site in two samples are the same;

[0056] C2 is a constant with a value of -1, which is the score when the base types of a certain site in the two samples are different;

[0057] G1 and G2 are the numbers of base combinations of sample 1 and sample 2 at a certain site, respectively, where sample 1 is the sample with fewer base combinations at the site, and sample 2 is the sample with more base combinations at the site; G1∩G2 means that the two samples at the site have the same number of base combinations.

[0058] In some specific embodiments of the present invention, for a certain site, if two samples have the same number of base combinations at the site, any one sample is sample 1 and the other sample is sample 2.

[0059] Regarding base combinations, for example, for a certain site, the reference site is T, G and A; but a certain sample has T, A and A; G, G and A; T, G and C; T, - (indicating deletion) and G; -, G and C. Then the base combination of the sample at this site is 5.

[0060] For example, for a certain site, if the base combinations of two samples are 5 and 6 respectively, then the base combination of 6 is sample 1, and the base combination of 5 is sample 2. If the base combination of the two samples at this site is 4, that is, 4, then the similarity for this site is C1*(G1∩G2)+C2*(G1-G1∩G2)=1*4-1*(6-4)=2.

[0061] In some embodiments of the present invention, in step S4, multiple sequence alignment is performed using mafft software.

[0062] In some embodiments of the present invention, in step S5, fasttree software is used to perform sample clustering.

[0063] In some embodiments of the present invention, the method further comprises using visualization software to identify the cluster analysis results obtained in step S5. In some specific embodiments of the present invention, the visualization software is MEGA software.

[0064] Beneficial effects of the present invention

[0065] Compared with the prior art, the present invention has the following beneficial effects:

[0066] The system and method of the present invention adopts the second generation sequencing technology. Compared with the traditional DNA sequencing technology, the second generation sequencing has significant advantages such as high throughput, high speed, integration, and low cost, and also has important application prospects in the field of forensic genetics. Sequencing is the best means of detecting sequence polymorphism genetic markers. Micro-haplotypes are linear combinations of SNPs, and their essence is still SNP. The second generation sequencing can obtain all the genotyping of SNP sites in the composite system at one time, and also obtain accurate typing of all micro-haplotype genetic markers at the same time. The present invention helps to promote the second generation sequencing technology to become the gold standard for micro-haplotype detection.

[0067] The system and method of the present invention can be applied to sequencing data generated by different capture methods, whether liquid phase capture or data generated by multiplex PCR amplification, and therefore has a wide range of application scenarios and is easy to promote.

[0068] In addition to detecting and counting micro-haplotypes, the system and method of the present invention can also detect, count and type SNP / InDel.

[0069] In addition to being able to detect micro-haplotypes composed of multiple SNPs, the system and method of the present invention can also tolerate the situation where the micro-haplotype contains InDel sites, with a wider detection range and a more universal algorithm.

[0070] The system and method of the present invention can utilize the micro-haplotype typing results of the samples to further determine the similarity of the samples, cluster the samples, and further perform strict quality control on the samples of the same batch to ensure the reliability of the detection process. BRIEF DESCRIPTION OF THE DRAWINGS

[0071] Figure 1 A schematic diagram of a microhaplotype detection and typing system according to Example 1 of the present invention is shown.

[0072] Figure 2 A schematic diagram of a microhaplotype detection and typing system according to Example 2 of the present invention is shown.

[0073] Figure 3 A schematic flow chart of the micro-haplotype detection and typing method according to Example 4 of the present invention is shown.

[0074] Figure 4 The diagram shows the cluster analysis results of micro-haplotype detection and typing of 11 samples in Example 6 of the present invention. DETAILED DESCRIPTION

[0075] In order to make the technical problems, technical solutions and beneficial effects solved by the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments.

[0076] Example

[0077] The following examples are used to demonstrate preferred embodiments of the present invention. It will be appreciated by those skilled in the art that the techniques disclosed in the following examples represent techniques discovered by the inventors that can be used to implement the present invention and therefore can be considered as preferred embodiments of the present invention. However, it will be appreciated by those skilled in the art based on this specification that many modifications may be made to the specific embodiments disclosed herein and still achieve the same or similar results without departing from the spirit or scope of the present invention.

[0078] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs, and the disclosure and materials cited therein are hereby incorporated by reference.

[0079] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many technical equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the claims.

[0080] The experimental methods in the following examples are conventional methods unless otherwise specified. The instruments and equipment used in the following examples are conventional laboratory instruments and equipment unless otherwise specified; the experimental materials used in the following examples are purchased from conventional biochemical reagent stores unless otherwise specified.

[0081] Example 1 Microhaplotype detection and typing system based on second-generation sequencing

[0082] Combination Figure 1 This embodiment provides a micro-haplotype detection and typing system based on second-generation sequencing, which includes:

[0083] Data input module 101, used to accept sample second generation sequencing comparison file input;

[0084] A database storage module 102 is used to store a list of detection sites;

[0085] The MHParser typing module 103 is connected to the data input module 101 and the database storage module 102, respectively, and is used to calculate the micro-haplotype site according to the input sample second-generation sequencing comparison file, and output the micro-haplotype typing result, which includes haplotype information and counting information;

[0086] MHParser sample similarity calculation module 104, connected to MHParser typing module 103, used to receive the micro-haplotype typing result output by MHParser typing module 103, and calculate the similarity score between any two samples according to the micro-haplotype typing result;

[0087] The result output module 105 is used to output the similarity score.

[0088] The format of the detection site list stored in the database storage module 102 is shown in Table 1:

[0089] Table 1 Format description of detection site list

[0090]

[0091]

[0092] The format of the micro-haplotype typing result output by the MHParser typing module 103 is shown in Table 2:

[0093] Table 2 Microhaplotype typing result format

[0094]

[0095] The output result format of the MHParser sample similarity calculation module 104 is shown in Table 3:

[0096] Table 3 Sample similarity result format

[0097]

[0098]

[0099] Example 2 Improvement of the micro-haplotype detection typing system in Example 1

[0100] This embodiment 1 provides another micro-haplotype detection typing system based on second-generation sequencing, such as Figure 2 As shown, it includes all the modules of the micro-haplotype detection and typing system described in Example 1, which is equivalent to an improvement of the micro-haplotype detection and typing system of Example 1. The difference from the micro-haplotype detection and typing system described in Example 1 is that the MHParser sample similarity calculation module 104 can also output sample integrated micro-haplotype sequence information; further, the micro-haplotype detection and typing system also includes:

[0101] MHParser multiple sequence alignment module 106, connected to MHParser sample similarity calculation module 104, used to receive the sample integrated micro-haplotype sequence information output by MHParser sample similarity calculation module 104, and perform multiple sequence alignment according to the sample integrated micro-haplotype sequence information to obtain a multiple sequence alignment result;

[0102] MHParser sample clustering module 107, connected to MHParser multiple sequence alignment module 106, for receiving the multiple sequence alignment result output by MHParser multiple sequence alignment module 106, and performing cluster analysis according to the multiple sequence alignment result;

[0103] The result output module 105 is also connected to the MHParser sample clustering module 107 and is used to output the sample clustering results.

[0104] Example 3 Improvement of the microhaplotype detection typing system of Example 1 or Example 2

[0105] This embodiment provides an improvement on the micro-haplotype detection and typing system of Embodiment 1 or Embodiment 2, and the modules included therein are exactly the same as the micro-haplotype detection and typing system of Embodiment 1 or Embodiment 2, except that: the database storage module 102 is also used to store sequencing variation detection information in order to determine the genotype information of the SNP / InDel site.

[0106] Example 4 A method for detecting and typing microhaplotypes based on second-generation sequencing

[0107] This embodiment provides a micro-haplotype detection and typing method based on second-generation sequencing, which is a supporting method for the micro-haplotype detection and typing system of Example 1. Figure 3 As shown, the following steps are included:

[0108] S1, obtain the detection site list and sample second-generation sequencing comparison file;

[0109] S2, using the detection site list, calculate the micro-haplotype site according to the sample second-generation sequencing comparison file to obtain the micro-haplotype typing result, which includes haplotype information and count information;

[0110] S3, calculating the similarity score between any two samples according to the micro-haplotype typing results of step S2.

[0111] Example 5 An improved method for microhaplotype detection and typing based on second-generation sequencing

[0112] This embodiment provides an improvement on the method for detecting and typing micro-haplotypes described in Embodiment 4, which is a supporting method for using the micro-haplotype detection and typing system of Embodiment 2, such as Figure 4 As shown, the difference is that: step S3 can obtain the integrated micro-haplotype sequence information of the sample;

[0113] Accordingly, the improved method further comprises the following steps in addition to the above steps S1-S3:

[0114] S4, performing multiple sequence alignment based on the sample integrated micro-haplotype sequence information to obtain the multiple sequence alignment results;

[0115] S5, performing cluster analysis based on the multiple sequence alignment results to obtain cluster analysis results.

[0116] Example 6 Application of microhaplotype detection typing system

[0117] This embodiment provides an application of the micro-haplotype detection and typing system of embodiment 2, or an application of the micro-haplotype detection and typing system improved from embodiment 2 in embodiment 3. The difference lies in whether the database storage module 102 stores sequencing variation detection information.

[0118] 1. List of detection sites

[0119] The detection site list information of this embodiment is shown in Table 4:

[0120] Table 4 List of detection sites

[0121]

[0122]

[0123]

[0124] 2. Sequencing variant detection information

[0125] The sequencing variation detection information (the improved system of Example 3 to Example 2) is set to determine the genotype of the SNP / InDel site. In this system, the storage file of the sequencing variation detection information is in vcf format, which is detected by the germline mutation detection software GAT Khaplotyper. The index file with the suffix tbi is also stored with the vcf file.

[0126] The sequencing variation detection information of this embodiment is shown in Table 5:

[0127] Table 5 Sequencing variation detection information

[0128]

[0129] The vcf file has the header comment information at the beginning, and each line starts with '##'. The example is as follows:

[0130]

[0131] The above vcf format information is an example, and those skilled in the art are familiar with its meaning.

[0132] If there is no sequencing variation detection information (the system of Example 2), the system will not output the genotype information of the SNP / InDel variation, but will also output the base depth and count information of the SNP / InDel variation.

[0133] 3. Sample Next Generation Sequencing Comparison File

[0134] In this example, the second generation sequencing information of 11 samples to be compared is obtained, and the information of the 11 samples to be compared is shown in Table 7:

[0135] Table 7 Information of 11 samples to be compared

[0136] Serial number Sample name Sample Group Sample source 1 O1 Group O Human EDTA anticoagulated whole blood 2 O2 Group O Human EDTA anticoagulated whole blood 3 O3 Group O Human EDTA anticoagulated whole blood 4 O4 Group O Human EDTA anticoagulated whole blood 5 O5 Group O Human EDTA anticoagulated whole blood 6 Mix_1 MIX group, mixed with O5 Human EDTA anticoagulated whole blood 7 Mix_2 MIX group, mixed with O5 Human EDTA anticoagulated whole blood 8 Mix_3 MIX group, mixed with O5 Human EDTA anticoagulated whole blood 9 Mix_4 MIX group, mixed with O5 Human EDTA anticoagulated whole blood 10 NA12878_01 NA12878 Group Cell line genomic DNA 11 NA12878_02 NA12878 Group Cell line genomic DNA

[0137] The next-generation sequencing genome alignment file of the sample to be compared is input into the system in bam format, which is the alignment file obtained by aligning the sample next-generation sequencing result (FASTQ format) to the human reference genome; a corresponding bai format index file is also input at the same time. The bam format file is in binary form in sam format.

[0138] The sam example file of this embodiment is shown in Table 6:

[0139] Table 6 SAM sample file

[0140]

[0141]

[0142] 4.MHParser site typing

[0143] Taking sample Mix_1 as an example, the following steps are used to obtain the microhaplotype results of the SNP / InDel variant sites:

[0144] 1) Taking the detection site list, sample second-generation sequencing comparison file and sequencing variation detection information as input, calculate and output the initial micro-haplotype typing results. The specific calculation method is:

[0145] For a certain micro-haplotype or SNP / InDel site in the detection site list, by traversing each sequence in the sample second-generation sequencing alignment file, extracting the base combination of reads according to the coordinate information of the site, obtaining the haplotype information, and counting the reads with the same haplotype, for SNP / InDel sites, if there is a vcf file for variation detection, the genotype information of the site can also be read from it.

[0146] 2) For the same haplotype, different base combinations are sorted from high to low according to the number of reads to obtain the sorting results;

[0147] 3) Convert the sorted typing text file into an Excel file for easy reference.

[0148] The microhaplotype typing results of sample Mix_1 are shown in Table 7:

[0149] Table 7 Microhaplotype typing results of sample Mix_1

[0150]

[0151]

[0152]

[0153] The same method can be used to obtain microhaplotype typing results of other samples.

[0154] 5.MHParser sample similarity calculation

[0155] After obtaining the micro-haplotype typing results of multiple samples, the sample similarity can be calculated and the haplotype sequence can be output. The specific steps are as follows:

[0156] 1) Take the result list of micro-haplotype typing of multiple samples as input file;

[0157] 2) Use the similarity calculation program to output the similarity score between any two samples. The specific calculation method is:

[0158]

[0159] in,

[0160] S is the similarity score;

[0161] m is the number of sites;

[0162] C1 is a constant with a value of 1, which is the score when the base types of a certain site in two samples are the same;

[0163] C2 is a constant with a value of -1, which is the score when the base types of a certain site in the two samples are different;

[0164] G1 and G2 are the base combination numbers of sample 1 and sample 2 at a certain site, respectively, where sample 1 is the sample with fewer base combinations at the site, and sample 2 is the sample with more base combinations at the site; if the number of base combinations of two samples is the same for a certain site, then any one sample is sample 1 and the other is sample 2. G1∩G2 means that the two samples at the site have the same number of base combinations.

[0165] The similarity scores of the samples thus obtained are output as shown in Table 8:

[0166] Table 8 Similarity information of samples

[0167]

[0168] Note: The value is similarity_score, i.e. the similarity score. The higher the score, the more similar.

[0169] At the same time, this step also outputs the sample haplotype sequence information (sample micro-haplotype site merged sequence file), as shown below:

[0170] >O1

[0171] ATGCGCGGTCTTCCAGGCCTGATCTGAAGCAACTGATAATGTTACTGGGTGGTCCGTCACC

[0172] >O2

[0173] ATGCGCGGTCTTCCAGGAGATCTGAAGCAACTAATGTTGGGTGGTTCACCGCC

[0174] >O3

[0175] ATGCACGTCCAGATTTGGCCTGAAGAAACTGGTACTGTTGGTTGGGCCGCTGCC

[0176] >O4

[0177] ATGCGCGGTCTTCCTTCAGATCTGACCTGAAGCAACTAATGGTGTTGGGCCGTCACC

[0178] >O5

[0179] ACGGTTTTCCAGGCCTGAAACTGATAATACGAAGTGGGCCACTGCC

[0180] >Mix_1

[0181] ACGGACCTCCTTTTTCAGGCCTGATCTGAAACAGATGATGATAATGGTACTGTGAAGTGGGTGGTCCACTGTCACCTT

[0182] >Mix_2

[0183] ACGGACGCTCCTTTAGGCCTGATCTGAAACAGATGATGATAATGGTACTGTGAAGTGGGTGGTCCACTGTCACCTT

[0184] >Mix_3

[0185] ACGGACCTCCTTTAGGCCTGAAACAGATGATGATAATACGAAGTGGGTGGTCCACTGTCACCTT

[0186] >Mix_4

[0187] ACGGTCCTTTAGGCCTGAAACTGATAATACGAAGTGGGTGGTCCACTGCC>NA12878_01

[0188] ACGCGCCGTCTTCAAGAAGGTTTGATTTTAAACTGATAATATTGTTGGGTGGTCCGCCACCTT

[0189] >NA12878_02

[0190] ACGCGCCGTCTTCATATAGAAGGTTTGATTTTAAACTGATAATATTGTTGGGTGGTCCGCCACCTT

[0191] 6.MHParser multiple sequence alignment

[0192] Based on the haplotype sequences of the above samples, multiple sequence alignment is performed using the mafft software. This step will do an alignment and obtain a multiple sequence alignment file in fasta format, as shown below:

[0193] >O1

[0194] ATGCGCGGTCTTCC------AGGCCTGATCTGAAGCAACTGA------TAATGTTAC----TGGGTGGTCCGTCACC-----

[0195] >O2

[0196] ATGCGCGGTCTTCC------AGG--AGATCTGAAGCAACTAA------------TGT----TGGGTGGTTCACCGCC-----

[0197] >O3

[0198] ATGCACGTCC---------AGATTTGGCCTGAAGAAACTGG---------TACTGT----TGGTTGGGCCGCTGCC-----

[0199] >O4

[0200] ATGCGCGGTCTTCC---TTCAGATCTGACCTGAAGCAACTAA---------TGGTGT----TGGG----CCGTCACC-----

[0201] >O5

[0202] ----ACGGTTTTCC-----------AGGCCTGAAAC------------TGATAATACGAAGTGGG----CCACTGCC-----

[0203] >Mix_1

[0204] ACGGACGCTCCTTT---TTCAGGCCTGATCTGAAACAGATGATGATAATGGTACTGTGAAGTGGGTGGTCCACTGTCACCTT

[0205] >Mix_2

[0206] ACGGACGCTCCTTT------AGGCCTGATCTGAAACAGATGATGATAATGGTACTGTGAAGTGGGTGGTCCACTGTCACCTT

[0207] >Mix_3

[0208] ACGGACGCTCCTTT-----------AGGCCTGAAACAGATGA------TGATAATACGAAGTGGGTGGTCCACTGTCACCTT

[0209] >Mix_4

[0210] ----ACGGTCCTTT-----------AGGCCTGAAAC------------TGATAATACGAAGTGGGTGGTCCACTGCC-----

[0211] >NA12878_01

[0212] ACGCGCCGTCTTCA---AGAAGGTTTGATTTTAAACTGATAA---------TATTGT----TGGGTGGTCCGCCACCTT---

[0213] >NA12878_02

[0214] ACGCGCCGTCTTCATATAGAAGGTTTGATTTTAAACTGATAA---------TATTGT----TGGGTGGTCCGCCACCTT---

[0215] 7. MHParser Sample Clustering

[0216] Fasttree software was used to cluster samples based on the results of multiple sequence alignment of sample haplotypes. The sample clustering results in nwk format were obtained. The visualization software MEGA was used to identify the sample clustering results. The results after importing the visualization are as follows: Figure 4 shown.

[0217] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. A micro-haplotype detection and typing system based on second-generation sequencing, characterized in that: include: Data input module, used to accept sample second-generation sequencing comparison file input; The database storage module is used to store a list of detection sites, wherein the detection sites include micro-haplotypes and individual SNP / InDel sites. The list of detection sites is as follows: ； The MHParser typing module is connected to the data input module and the database storage module respectively, and is used to calculate the micro-haplotype site according to the input sample second-generation sequencing comparison file, and output the micro-haplotype typing result; wherein the micro-haplotype typing result includes haplotype information and count information, and the count information refers to the number of reads supporting the corresponding detection site; An MHParser sample similarity calculation module, connected to the MHParser typing module, is used to receive the micro-haplotype typing results output by the MHParser typing module, and calculate the similarity score between any two samples according to the micro-haplotype typing results; The result output module is used to output the similarity score.

2. The microhaplotype detection and typing system according to claim 1, characterized in that: The MHParser sample similarity calculation module also outputs sample integrated micro-haplotype sequence information; the micro-haplotype detection typing system also includes: An MHParser multiple sequence alignment module, connected to the MHParser sample similarity calculation module, is used to receive the sample integrated micro-haplotype sequence information output by the MHParser sample similarity calculation module, and perform multiple sequence alignment according to the sample integrated micro-haplotype sequence information to obtain the sample multiple sequence alignment result; An MHParser sample clustering module, connected to the MHParser multiple sequence alignment module, is used to receive the multiple sequence alignment results output by the MHParser multiple sequence alignment module, and perform clustering analysis based on the sample multiple sequence alignment results; The result output module is also connected to the MHParser sample clustering module for outputting clustering analysis results of samples.

3. The microhaplotype detection and typing system according to claim 1 or 2, characterized in that: The database storage module is also used to store sequencing variation detection information.

4. The microhaplotype detection and typing system according to claim 3, characterized in that: The MHParser typing module outputs the genotype of the locus.

5. A method for detecting and typing micro-haplotypes based on second-generation sequencing, characterized in that: The following steps are involved: S1, obtain the detection site list and sample second-generation sequencing comparison file, the detection site includes micro-haplotypes and individual SNP / InDel sites, the detection site list is as follows: ； S2, using the detection site list, calculate the micro-haplotype site of the sample according to the sample second-generation sequencing comparison file to obtain the micro-haplotype typing result, wherein the micro-haplotype typing result includes haplotype information and count information, wherein the count information refers to the number of reads supporting the corresponding detection site; S3, calculating the similarity score between any two samples according to the micro-haplotype typing results of step S2.

6. The microhaplotype detection and typing method according to claim 5, characterized in that: Step S3 also obtains sample integrated micro-haplotype sequence information.

7. The microhaplotype detection and typing method according to claim 6, characterized in that: The following steps are also included: S4, performing multiple sequence alignment based on the sample integrated micro-haplotype sequence information to obtain the multiple sequence alignment results; S5, performing cluster analysis based on the multiple sequence alignment results to obtain cluster analysis results.

8. The microhaplotype detection and typing method according to any one of claims 5 to 7, characterized in that: In step S2, the microhaplotype typing result is obtained by specifically using the following steps: S21, for any micro-haplotype site in the detection site list, traverse each sequence in the sample second-generation sequencing alignment file, extract the base combination of reads according to the coordinate information of the site, obtain the haplotype, and count the reads with the same haplotype; S22, for the same haplotype, different base combinations were sorted according to the number of reads; Thus, the micro-haplotype typing results described in the detection site list are obtained.

9. The microhaplotype detection and typing method according to any one of claims 5 to 7, characterized in that: In step S3, the similarity score is obtained by using the following formula: S31, obtaining microhaplotype typing results of multiple samples according to the method of step S2; S32, calculate the similarity score between any two samples according to the following formula: in, S is the similarity score; m is the number of sites; C 1 is a constant, with a value of 1, which is the score when the base types of a certain site in two samples are the same; C 2 is a constant with a value of -1, which is the score when the base types of a certain site in the two samples are different; G 1 and G 2 are the base combination numbers of sample 1 and sample 2 at a certain site, where sample 1 is the sample with fewer base combinations at the site, and sample 2 is the sample with more base combinations at the site; Indicates the number of base combinations that are identical between the two samples at this site.

Images