A nucleic acid vaccine and its preparation method and application

Abstract

The present invention belongs to the field of biotechnology, and specifically relates to a nucleic acid vaccine and a preparation method and application thereof. The nucleic acid vaccine involved in the present invention includes nucleic acid molecules and DNA nanostructures, wherein the DNA nanostructure includes a scaffold molecule and a complementary chain molecule, which, as a carrier, is combined with the nucleic acid molecule through the principle of base complementary pairing. The preparation method of this nucleic acid vaccine is: mixing the scaffold molecule with the complementary chain molecule, folding to form a DNA nanostructure; mixing the DNA nanostructure with the nucleic acid molecule, and hybridizing to form a stable double-stranded structure. The DNA nanostructure in this nucleic acid vaccine can stabilize the nucleic acid molecule, protect the nucleic acid molecule from being attacked by nucleases, improve the convenience of storage and transportation of the nucleic acid vaccine, and solve the practical problems that exist when the nucleic acid vaccine is widely put into use. Therefore, the nucleic acid vaccine described in the present invention can be used to prepare a vaccine for treating new coronavirus infection.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to a nucleic acid vaccine and a preparation method and application thereof. Background Art

[0002] Nucleic acid vaccines are vaccines that directly introduce foreign genes encoding certain antigenic proteins into animal cells, synthesize antigenic proteins through the expression system of host cells, and induce the host to produce an immune response to the antigenic protein to achieve the purpose of preventing and treating diseases. Since the production process of nucleic acid vaccines is unrelated to the encoded antigen, different vaccines based on the same nucleic acid can use the same production and purification methods, greatly reducing the cost and time of vaccine production; in addition, nucleic acid vaccines can be generated quickly. With the above advantages and the global prevalence of new coronavirus infections, nucleic acid vaccines are increasingly receiving widespread attention, especially RNA vaccines, which do not have the risk of integration into the human genome like DNA vaccines. RNA vaccines can directly translate antigenic proteins in cells after transfection into human cells, without affecting the cell genome itself, and are fully safe.

[0003] The basic guarantee for nucleic acid vaccines to work is that they are successfully delivered into cells after entering the human body. This process is somewhat challenging. First, nucleic acids are very likely to be degraded by nucleases before entering cells. Second, nucleic acids have a large molecular weight and are negatively charged, making it almost impossible for them to enter cells without a carrier. Therefore, nucleic acid vaccines usually need to be delivered into cells with the help of a carrier.

[0004] To date, many different drug delivery systems, including natural systems (such as viruses), biomimetic systems (such as red blood cell mimics), organic synthetic material systems (such as liposomes and cationic dendrimers), and inorganic synthetic material systems (such as gold nanoparticles), have bypassed the physical and chemical limitations and barriers of drug molecules, increased drug loading capacity, prolonged human circulation time, and improved cellular uptake efficiency. However, these drug carriers have certain limitations. For example, the mRNA-1273 vaccine developed by Moderna uses liposomes as carriers and can remain active for 30 days at 2°C to 8°C. However, because RNA is unstable, the vaccine can be attacked and degraded by various RNA enzymes in the complex blood environment after being injected into the body, thus losing its effectiveness.

[0005] DNA molecules are natural genetic materials with excellent biocompatibility and biodegradability. Through the principle of complementary base pairing, double-stranded DNA molecules can be folded into stable nanoscale structures, namely DNA origami nanostructures. DNA origami nanostructures have the advantages of predictable and controllable intermolecular interactions, convenient functional group modification, strong designability and flexibility; in addition, DNA origami nanostructures can be precisely controlled from one dimension to three dimensions through self-assembly reactions. Therefore, DNA origami nanostructures are expected to become a preferred in vivo drug delivery carrier. Summary of the invention

[0006] The present invention aims to solve at least one of the technical problems existing in the above-mentioned prior art. To this end, the present invention proposes a nucleic acid vaccine, which uses a DNA nanostructure as a delivery carrier, can stabilize nucleic acid molecules, not only allowing the nucleic acid molecules to be stably stored and transported at 2°C to 8°C, but also making them less susceptible to degradation by nucleases in the extracellular environment in the body, providing protection for their integrity when entering cells, and solving practical problems existing in the widespread use of nucleic acid vaccines.

[0007] The present invention also provides a method for preparing the nucleic acid vaccine.

[0008] The present invention also proposes the application of the nucleic acid vaccine.

[0009] According to one aspect of the present invention, a nucleic acid vaccine is provided, comprising a nucleic acid molecule and a DNA nanostructure, wherein the DNA nanostructure serves as a carrier and is combined with the nucleic acid molecule.

[0010] According to a preferred embodiment of the present invention, at least the following beneficial effects are achieved:

[0011] 1. Compared with commercial liposome carriers, the nucleic acid vaccine proposed in the present invention uses DNA nanostructures as carriers. DNA nanostructures can combine with nucleic acid molecules of different sequences and lengths to form a stable double-stranded structure, greatly improving the stability of nucleic acid molecules.

[0012] 2. Compared with the conventional method of improving the stability of nucleic acid molecules by introducing single-site base mutations, the DNA nanostructure provided by the present invention itself has extremely high stability, can resist the attack of nucleases to a large extent, and will not affect the efficacy of nucleic acid vaccines.

[0013] 3. The DNA nanostructures of the present invention can be folded into different three-dimensional structures through self-assembly, providing multiple possibilities for binding with nucleic acid molecules, thereby being able to produce different target nucleic acid vaccines.

[0014] 4. DNA is a naturally occurring macromolecule in living organisms; therefore, the extremely high bioavailability of DNA nanostructures can significantly improve the efficacy of nucleic acid vaccines.

[0015] 5. Compared with inorganic nanoparticle carriers and polymer nanoparticle carriers, DNA nanostructures as carriers have higher biosafety and can be completely degraded within cells after the treatment is completed, without causing any additional metabolic burden to the organism.

[0016] In some embodiments of the present invention, the DNA nanostructure binds to the nucleic acid molecule through the principle of complementary base pairing.

[0017] In some embodiments of the present invention, the nucleic acid molecule includes an RNA molecule encoding a specific antigenic protein.

[0018] In some embodiments of the present invention, the DNA nanostructure can be combined with the nucleic acid molecules of any length and sequence.

[0019] In some embodiments of the present invention, the DNA nanostructure comprises a scaffold molecule and a complementary strand molecule.

[0020] In some embodiments of the present invention, the scaffold molecule is a single-stranded DNA molecule with a base number of 500 to 10,000.

[0021] In some preferred embodiments of the present invention, the base number of the scaffold molecule is 7000-8000.

[0022] In some preferred embodiments of the present invention, the scaffold molecule is selected from bacteriophage genomic DNA.

[0023] In some preferred embodiments of the present invention, the scaffold molecule is selected from single-stranded phage genomic DNA.

[0024] In some preferred embodiments of the present invention, the scaffold molecule is selected from at least one of M13 phage genomic DNA, φX174 phage genomic DNA or fd phage genomic DNA.

[0025] In some preferred embodiments of the present invention, the scaffold molecule is selected from M13 phage genomic DNA.

[0026] In some more preferred embodiments of the present invention, the scaffold molecule is selected from M13mp18 phage genomic DNA.

[0027] In some embodiments of the present invention, the complementary chain molecule comprises a single-stranded DNA molecule having 20 to 60 bases.

[0028] In some preferred embodiments of the present invention, the complementary chain molecule has 25-55 bases.

[0029] In some embodiments of the present invention, the complementary chain molecule is designed according to the desired folded target structure using a specific algorithm.

[0030] In some embodiments of the present invention, the storage temperature of the nucleic acid vaccine is -20°C to 4°C, and the storage time is 1 to 3 months.

[0031] According to another aspect of the present invention, a method for preparing the nucleic acid vaccine is provided, which specifically comprises the following steps:

[0032] S1: Mix the scaffold molecule with the complementary chain molecule and fold it to form a DNA nanostructure;

[0033] S2: Mixing the DNA nanostructure described in step S1 with the nucleic acid molecule to form a stable double-stranded structure through hybridization.

[0034] According to a preferred embodiment of the present invention, at least the following beneficial effects are achieved:

[0035] 1. The scaffold molecules are easy to obtain and can be obtained in large quantities at low cost, making them suitable for large-scale production.

[0036] 2. After the scaffold molecules are mixed with complementary chain molecules, they can self-assemble and fold into different three-dimensional structures (i.e., DNA nanostructures), providing multiple possibilities for binding with nucleic acid molecules, thereby enabling the production of nucleic acid vaccines of different purposes.

[0037] 3. DNA nanostructures can combine with nucleic acid molecules of different sequences and lengths to form a stable double-stranded structure, greatly improving the stability of nucleic acid molecules.

[0038] In some embodiments of the present invention, the scaffold molecule is obtained by extracting phage genomic DNA.

[0039] In some embodiments of the present invention, the bacteriophage is obtained from host bacteria culture.

[0040] In some embodiments of the present invention, the complementary strand molecule is prepared by commercial DNA synthesis.

[0041] In some embodiments of the present invention, in step S1, the scaffold molecule and the complementary chain molecule are mixed and reacted at a temperature of 25°C to 92°C.

[0042] In some embodiments of the present invention, in step S1, the scaffold molecule and the complementary chain molecule are mixed and reacted for a reaction time of 24 hours to 240 hours.

[0043] In some embodiments of the present invention, in step S1, after the scaffold molecules and the complementary chain molecules are mixed and reacted, magnesium ions are further added, and the concentration of the magnesium ions is 2 mM to 40 mM.

[0044] In some embodiments of the present invention, the nucleic acid molecule in step S2 is obtained by replication or in vitro transcription of a DNA template of a specific sequence.

[0045] In some embodiments of the present invention, the DNA template of the specific sequence is prepared by using a plasmid as a vector, culturing Escherichia coli on a large scale, purifying the plasmid, and then digesting it with a restriction endonuclease.

[0046] In some embodiments of the present invention, the nucleotide sequence of the scaffold molecule is fixed, and there are multiple complementary chain molecules, each of which is designed to be complementary to certain sections of the scaffold molecule and naturally form a three-dimensional structure with the scaffold molecule.

[0047] In some embodiments of the present invention, in the three-dimensional structure, the nucleic acid molecule can be combined with the scaffold molecule or the complementary chain molecule to hybridize to form the stable double-stranded structure; if it is combined with the complementary chain molecule, the complementary chain molecule can be modified, and the modified complementary chain molecule has a sequence that is complementary to the nucleic acid molecule.

[0048] According to the third aspect of the present invention, the use of the nucleic acid vaccine in the preparation of a vaccine for the treatment of novel coronavirus infection is proposed. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein:

[0050] Figure 1 This is a comparison chart of the mRNA stability of the RNA vaccines prepared in Example 1 of the present invention and Comparative Example 1 at 4°C;

[0051] Figure 2 This is a comparison chart of the mRNA stability of the RNA vaccines prepared in Example 1 of the present invention and Comparative Example 1 at 25°C;

[0052] Figure 3 This is a comparison chart of the changes in the production amount of the corresponding angiotensin converting enzyme 2 receptor binding domain protein after the RNA vaccines prepared in Example 1 of the present invention and Comparative Example 1 act on cells;

[0053] Figure 4 This is a comparison chart of mRNA activity of the RNA vaccines prepared in Example 1 of the present invention and Comparative Example 1 in the presence of RNase. DETAILED DESCRIPTION

[0054] Embodiments of the present invention are described in detail below. The embodiments described with reference to the accompanying drawings are exemplary and are only used to explain the present invention, but should not be construed as limiting the present invention.

[0055] In the description of the present invention, unless otherwise clearly defined, words such as centrifugation and cultivation should be understood in a broad sense, and technicians in the relevant technical field can reasonably determine the specific meanings of the above words in the present invention in combination with the specific content of the technical solution.

[0056] In the description of the present invention, the description with reference to the terms "one embodiment", "some embodiments", etc. means that the materials or methods described in conjunction with the embodiment are included in at least one embodiment of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment. Moreover, the described materials or methods can be combined in any one or more embodiments in a suitable manner.

[0057] Unless otherwise specified, the experimental methods used in the examples are all conventional methods; the materials and reagents used are all reagents and materials that can be obtained from commercial channels unless otherwise specified.

[0058]

[0059] In an embodiment of the present invention, the nucleotide sequences of all complementary chain molecules bound to the scaffold molecule are SEQ ID NO: 2 to SEQ ID NO: 121, as shown in Table 1.

[0060] Table 1

[0061]

[0062]

[0063]

[0064]

[0065] Example 1

[0066] This example prepares an angiotensin converting enzyme 2 receptor binding domain RNA vaccine, and the specific process is as follows:

[0067] (1) Preparation of scaffold molecules: Take a single colony of Escherichia coli carrying the F' plasmid and inoculate 5 mL of enriched culture medium, and culture at 37°C with gentle shaking for 12 hours; then take 0.1 mL of the culture and inoculate 5 mL of 2xYT culture medium (SIGMA aldrich, Y2377), and culture at 37°C with vigorous shaking for 2 hours. After the culture is completed, add 45 mL of 2xYT culture medium to dilute the culture, and then add 1 mL of M13mp18 phage suspension to infect the Escherichia coli culture, and culture at 37°C with gentle shaking for 5 hours to 8 hours. After the culture is completed, transfer the culture solution to a sterile centrifuge tube, centrifuge at 16000 rpm at room temperature for 10 minutes to 15 minutes, and transfer the supernatant to a new centrifuge tube to obtain the phage suspension. The phage suspension was precipitated with a 20% polyethylene glycol solution, incubated on ice for 30 minutes, and then centrifuged at 6000 rpm for 20 minutes at 4°C. The resulting precipitate was the phage virus particles; the phage virus particles were lysed on ice for 15 minutes using an alkaline lysis solution. After the lysis was completed, the phage virus particles were neutralized with a sodium acetate solution and diluted to 50 mL, and centrifuged at 6000 rpm for 20 minutes at 4°C. The supernatant was transferred to a new centrifuge tube, and anhydrous ethanol 1 times the volume of the supernatant was added. The tube was incubated with ice water for 30 minutes, and centrifuged again at 6000 rpm for 20 minutes at 4°C. The resulting precipitate was the M13mp18 phage genomic DNA (scaffold molecule).

[0068] (2) Preparation of DNA nanostructures: Take TAE solution (composed of tris(hydroxymethyl)aminomethane, acetic acid and ethylenediaminetetraacetic acid) as a buffer for preparing DNA nanostructures, prepare 10 nM scaffold molecule solution prepared in step (1), and 100 nM complementary chain molecule solution (i.e., the 120 nucleotide sequences listed above: SEQ ID NO: 2 to SEQ ID NO: 121, these nucleotide sequences are commercially synthesized, and these complementary chain molecules are mixed with the scaffold molecules at the same molar concentration), add the above solution into a microcentrifuge tube, with a total volume of 100 μL, mix well, place in a PCR thermal cycler, set the temperature and time, and gradually cool the above reaction system from 95°C to room temperature over 25 hours. During this annealing process, the DNA molecules can complete complementary hybridization and fold into the designed three-dimensional nanostructure.

[0069] (3) Preparation of mRNA molecules: Order a plasmid vector (pcDNA3-SARS-CoV-2-S-RBD-Fc) containing a T7 promoter for the mRNA sequence from a nucleic acid vector preparation company (AddGene), and prepare a DNA template by PCR (see the sequence agacccaagctggctagcgc in SEQ ID NO: 122); prepare a transcription reaction system: 2 μL DNA template solution, 2 μL T7 transcriptase, 8 μL ribonucleotide (NTP) mixed solution and 8 μL in vitro transcription buffer; carry out the above reaction system at 37° C. for 2 h to 4 h to obtain angiotensin converting enzyme 2 receptor binding domain mRNA product.

[0070] Since this mRNA product needs to hybridize with a DNA nanostructure containing the No. 24 complementary chain molecule (SEQ ID NO: 25), the No. 24 complementary chain molecule needs to be modified, and the sequence complementary to the mRNA molecule is connected to the No. 24 complementary chain molecule to achieve the combination of the mRNA molecule and the DNA nanostructure. See SEQ ID NO: 123 (No. 24 molecule: atcggaacgagggtagagcagcgaaccgat) and SEQ ID NO: 124 (No. 24 molecule after modification: atcggaacgagggtagagcagcgaaccgatttttttttctgggttcgaccgatcgcg, ttttttttctgggttcgaccgatcgcg is added after the original sequence, wherein tctgggttcgaccgatcgcg is a sequence complementary to the mRNA molecule).

[0071] (4) Binding of the DNA nanostructure to the mRNA molecule: The DNA nanostructure prepared in step (2) and the angiotensin converting enzyme 2 receptor binding domain mRNA molecule prepared in step (3) are mixed at a concentration ratio of 1:5, and the solution is gradually cooled from 42°C to room temperature over 4 hours using a PCR thermal cycler. During the annealing process, the mRNA molecule can complete complementary hybridization with the single-stranded DNA portion extending from the DNA nanostructure, thereby forming a stable double-stranded structure to stabilize the mRNA.

[0072] Comparative Example 1

[0073] This comparative example prepares an angiotensin converting enzyme 2 receptor binding domain RNA vaccine. The difference from Example 1 is that this comparative example only prepares mRNA molecules without combining with DNA nanostructures. The specific process is as follows:

[0074] A plasmid vector (pcDNA3-SARS-CoV-2-S-RBD-Fc) containing a T7 promoter targeting the mRNA sequence was ordered from a nucleic acid vector preparation company (AddGene), and a DNA template was prepared by PCR (see the sequence agacccaagctggctagcgc in SEQ ID NO: 122); a transcription reaction system was prepared: 2 μL DNA template solution, 2 μL T7 transcriptase, 8 μL ribonucleotide (NTP) mixed solution and 8 μL in vitro transcription buffer; the above reaction system was carried out at 37° C. for 2 h to 4 h to obtain angiotensin converting enzyme 2 receptor binding domain mRNA product.

[0075] Test example

[0076] 1. The stability of the mRNA molecules in the vaccines prepared in Example 1 and Comparative Example 1 was tested.

[0077] The test was performed by reverse transcription-amplification (RT-PCR) method, the specific method is as follows:

[0078] Reverse transcription: prepare a 20 μL reaction system, including 2 μL of mRNA sample solution, 1 μL of reverse transcriptase (mutated Moloney murine leukemia virus (M-MLV) reverse transcriptase, GeneCopoeia), 1 μL of 10 mM deoxyribonucleotide (dNTP) mixed solution, 1 μL of fixed primer, and 15 μL of in vitro reverse transcription buffer; mix the above reaction system and incubate at 42°C for 30 minutes. After the reaction is completed, heat the system to 85°C to inactivate the reverse transcriptase;

[0079] PCR: Prepare a 50 μL reaction system, including 2 μL of reverse transcription product, 1 μL of forward and reverse primers, 25 μL of DNA polymerase, and 21 μL of PCR amplification reaction buffer; mix the above reaction system and place it in a PCR thermal cycler. After 30 rounds of standard PCR thermal cycling, observe the image by agarose gel electrophoresis.

[0080] (1) The stability of the mRNA molecules of the RNA vaccines prepared in Example 1 and Comparative Example 1 after being stored at 4° C. for a certain period of time was tested. The test results are as follows: Figure 1 shown. Figure 1In the experiment, taking the initial activity of each group of mRNA as 100%, the RNA vaccine prepared in Comparative Example 1 (without DNA nanostructure as a carrier) was easily degraded when stored at 4°C, and the activity of the mRNA molecules decreased to about 60% after one week of storage, while the mRNA activity in the vaccine prepared in Example 1 (DNA nanostructure as a carrier) could be maintained at more than 90% after one week; the activity of the mRNA molecules in the RNA vaccine prepared in Comparative Example 1 could not be determined after two weeks of storage, while the activity of the mRNA molecules in the vaccine prepared in Example 1 could still be maintained at more than 90% at 30 days.

[0081] (2) The stability of the mRNA molecules of the RNA vaccines prepared in Example 1 and Comparative Example 1 after being stored at 25° C. for a certain period of time was tested. The test results are as follows: Figure 2 shown. Figure 2 In the experiment, taking the initial activity of each group of mRNA as 100%, the RNA vaccine prepared in Comparative Example 1 was easily degraded when stored at 25°C, and the activity of the mRNA molecules decreased to about 15% after one week of storage, while the mRNA activity in the vaccine prepared in Example 1 could be maintained above 85% after one week.

[0082] 2. The changes in the production of the corresponding angiotensin converting enzyme 2 receptor binding domain protein after the vaccines prepared in Example 1 and Comparative Example 1 acted on cells were tested.

[0083] Specific methods:

[0084] Cultured cells: Human kidney cell line HEK-293T was cultured in DMEM mixed medium (Thermo Fisher Scientific) supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin at 37°C in an incubator containing 5% CO2 for 72 h;

[0085] The vaccine prepared in Example 1 and Comparative Example 1 (mRNA concentration of 2 μg / mL) was transfected into HEK-293T cells with Lipofactamine 2000 reagent (Thermo Fisher Scientific). After the transfected cells were cultured for 48 h, the proteins in the cells were extracted and the production of angiotensin converting enzyme 2 receptor binding domain protein from 0 h to 48 h was detected by Western blotting. The results are as follows: Figure 3 shown.

[0086] Figure 3 In the figure, the protein production of cells treated with the vaccine in Example 1 (with DNA nanostructure as a carrier) after 48 hours was taken as 100% for evaluation and comparison. The vaccine prepared in Comparative Example 1 (without DNA nanostructure as a carrier) produced only about 75% of the protein after 48 hours.

[0087] The above indicates that the DNA nanostructure involved in the present invention can not only significantly improve the stability of nucleic acid vaccines, but also enhance their effect on cells, which may be due to the enhanced effect of resisting nuclease attacks outside cells.

[0088] 3. The protective effect of the vaccines prepared in Example 1 and Comparative Example 1 against RNase was tested.

[0089] Specific methods:

[0090] A 10 μL reaction system was prepared, including the vaccine prepared in Example 1 (containing about 800 ng of mRNA) or Comparative Example 1 (containing about 800 ng of mRNA), and RNaseA (full gold, GE101). Depending on the concentration of RNaseA, multiple reaction systems can be prepared, incubated at 37°C for 40 min, and then the activity of mRNA was detected according to the reverse transcription-amplification (RT-PCR) method in 1. The results are as follows: Figure 4 shown.

[0091] Figure 4 In the experiment, 16 U / L of RNaseA can reduce the activity of mRNA in Comparative Example 1 to nearly 50%, while even 400 U / L of RNaseA can only reduce the activity of mRNA to about 75% in Example 1. This indicates that the resistance of mRNA in Example 1 to RNaseA under the protection of DNA nanostructure is more than 25 times that of mRNA in Comparative Example 1.

[0092] The above tests show that the nucleic acid vaccine involved in the present invention is protected by DNA nanostructures, and can maintain storage activity, comparable to the storage activity of the mRNA-1273 vaccine developed by Moderna; it can also resist the attack of nucleases, which is better than the resistance of the mRNA-1273 vaccine to nucleases and has better stability.

[0093] The embodiments of the present invention are described in detail above in conjunction with the accompanying drawings, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict. Sequence Listing <110> Shenzhen Children's Hospital; Shenzhen University <120> A nucleic acid vaccine and its preparation method and application <140> 2022100833838 <141> 2022-01-24 <160> 124 <170> SIPO Sequence Listing 1.0 <210> 1 <211> 7247 <212> DNA <213> Artificial Sequence <400> 1 aatgctacta ctattagtag aattgatgcc accttttcag ctcgcgcccc aaatgaaaat 60 atagctaaac aggttattga ccatttgcga aatgtatcta atggtcaaac taaatctact 120 cgttcgcaga attgggaatc aactgttata tggaatgaaa cttccagaca ccgtacttta 180 gttgcatatt taaaacatgt tgagctacag cattatattc agcaattaag ctctaagcca 240 tccgcaaaaa tgacctctta tcaaaaggag caattaaagg tactctctaa tcctgacctg 300 ttggagtttg cttccggtct ggttcgcttt gaagctcgaa ttaaaacgcg atatttgaag 360 tctttcgggc ttcctcttaa tctttttgat gcaatccgct ttgcttctga ctataatagt 420 cagggtaaag acctgatttt tgatttatgg tcattctcgt tttctgaact gtttaaagca 480 tttgaggggg attcaatgaa tatttatgac gattccgcag tattggacgc tatccagtct 540 aaacatttta ctattacccc ctctggcaaa acttcttttg caaaagcctc tcgctatttt 600 ggtttttatc gtcgtctggt aaacgagggt tatgatagtg ttgctcttac tatgcctcgt 660 aattcctttt ggcgttatgt atctgcatta gttgaatgtg gtattcctaa atctcaactg 720 atgaatcttt ctacctgtaa taatgttgtt ccgttagttc gttttattaa cgtagatttt 780 tcttcccaac gtcctgactg gtataatgag ccagttctta aaatcgcata aggtaattca 840 caatgattaa agttgaaatt aaaccatctc aagcccaatt tactactcgt tctggtgttt 900 ctcgtcaggg caagccttat tcactgaatg agcagctttg ttacgttgat ttgggtaatg 960 aatatccggt tcttgtcaag attactcttg atgaaggtca gccagcctat gcgcctggtc 1020 tgtacaccgt tcatctgtcc tctttcaaag ttggtcagtt cggttccctt atgattgacc 1080 gtctgcgcct cgttccggct aagtaacatg gagcaggtcg cggatttcga cacaatttat 1140 caggcgatga tacaaatctc cgttgtactt tgtttcgcgc ttggtataat cgctggggt 1200 caaagatgag tgttttagtg tattcttttg cctctttcgt tttaggttgg tgccttgta 1260 gtggcattac gtattttacc cgtttaatgg aaacttcctc atgaaaaagt ctttagtcct 1320 caaagcctct gtagccgttg ctaccctcgt tccgatgctg tctttcgctg ctgagggtga 1380 cgatcccgca aaagcggcct ttaactccct gcaagcctca gcgaccgaat atatcggtta 1440 tgcgtgggcg atggttgttg tcattgtcgg cgcaactatc ggtatcaagc tgtttaagaa 1500 attcacctcg aaagcaagct gataaaccga tacaattaaa ggctcctttt ggagcctttt 1560 ttttggagat tttcaacgtg aaaaaattat tattcgcaat tcctttagtt gttcctttct 1620 attctcactc cgctgaaact gttgaaagtt gtttagcaaa atcccataca gaaaattcat 1680 ttactaacgt ctggaaagac gacaaaactt tagatcgtta cgctaactat gagggctgtc 1740 tgtggaatgc tacaggcgtt gtagtttgta ctggtgacga aactcagtgt tacggtacat 1800 gggttcctat tgggcttgct atccctgaaa atgagggtgg tggctctgag ggtggcggtt 1860 ctgagggtgg cggttctgag ggtggcggta ctaaacctcc tgagtacggt gatacaccta 1920 ttccgggcta tacttatatc aaccctctcg acggcactta tccgcctggt actgagcaaa 1980 accccgctaa tcctaatcct tctcttgagg agtctcagcc tcttaatact ttcatgtttc 2040 agaataatag gttccgaaat aggcaggggg cattaactgt ttatacgggc actgttactc 2100 aaggcactga ccccgttaaa acttattacc agtacactcc tgtatcatca aaagccatgt 2160 atgacgctta ctggaacggt aaattcagag actgcgcttt ccattctggc tttaatgagg 2220 atttatttgt ttgtgaatat caaggccaat cgtctgacct gcctcaacct cctgtcaatg 2280 ctggcggcgg ctctggtggt ggttctggtg gcggctctga gggtggtggc tctgagggtg 2340 gcggttctga gggtggcggc tctgagggag gcggttccgg tggtggctct ggttccggtg 2400 attttgatta tgaaaagatg gcaaacgcta ataagggggc tatgaccgaa aatgccgatg 2460 aaaacgcgct acagtctgac gctaaaggca aacttgattc tgtcgctact gattacggtg 2520 ctgctatcga tggtttcatt ggtgacgttt ccggccttgc taatggtaat ggtgctctgg 2580 tgattttgct ggctctaatt cccaaatggc tcaagtcggt gacggtgata attcaccttt 2640 aatgaataat ttccgtcaat atttaccttc cctccctcaa tcggttgaat gtcgcccttt 2700 tgtctttggc gctggtaaac catatgaatt ttctattgat tgtgacaaaa taaacttatt 2760 ccgtggtgtc tttgcgtttc ttttatatgt tgccaccttt atgtatgtat tttctacgtt 2820 tgctaacata ctgcgtaata aggagtctta atcatgccag ttcttttggg tattccgtta 2880 ttattgcgtt tcctcggttt cttctggta actttgttcg gctatctgct tacttttctt 2940 aaaaagggct tcggtaagat agctattgct atttcattgt ttcttgctct tattattggg 3000 cttaactcaa ttcttgtggg ttatctctct gatattagcg ctcaattacc ctctgacttt 3060 gttcagggtg ttcagttaat tctcccgtct aatgcgcttc cctgttttta tgttattctc 3120 tctgtaaagg ctgctatttt catttttgac gttaaacaaa aaatcgtttc ttatttggat 3180 tgggataaat aatatggctg tttattttgt aactggcaaa ttaggctctg gaaagacgct 3240 cgttagcgtt ggtaagattc aggataaaat tgtagctggg tgcaaatag caactaatct 3300 tgatttaagg cttcaaaacc tcccgcaagt cgggaggttc gctaaaacgc ctcgcgttct 3360 tagaataccg gataagcctt ctatatctga tttgcttgct attgggcgcg gtaatgattc 3420 ctacgatgaa aataaaaacg gcttgcttgt tctcgatgag tgcggtactt ggtttaatac 3480 ccgttcttgg aatgataagg aaagacagcc gattattgat tggtttctac atgctcgtaa 3540 attaggatgg gatattattt ttcttgttca ggacttatct attgttgata aacaggcgcg 3600 ttctgcatta gctgaacatg ttgtttattg tcgtcgtctg gacagaatta cttaccttt 3660 tgtcggtact ttatatctc ttattactgg ctcgaaaatg cctctgccta aattacatgt 3720 tggcgttgtt aaattggcg attctcaatt aagccctact gttgagcgtt ggctttatac 3780 tggtaagaat ttgtataacg catatgatac taaacaggct ttttctagta attatgattc 3840 cggtgttat tcttatttaa cgccttattt atcacacggt cggtatttca aaccattaaa 3900 tttaggtcag aagatgaaat taactaaaat atatttgaaa aagttttctc gcgttctttg 3960 tcttgcgatt ggatttgcat cagcatttac atatagttat ataacccaac ctaagccgga 4020 ggttaaaaag gtagtctctc agacctatga ttttgataaa ttcactattg actcttctca 4080 gcgtcttaat ctaagctatc gctatgtttt caaggattct aagggaaaat taattaatag 4140 cgacgattta cagaagcaag gttattcact cacatatatt gatttatgta ctgtttccat 4200 taaaaaggt aattcaaatg aaattgttaa atgtaattaa ttttgttttc ttgatgtttg 4260 tttcatcatc ttcttttgct caggtaattg aaatgaataa ttcgcctctg cgcgattttg 4320 taacttggta ttcaaagcaa tcaggcgaat ccgttattgt ttctcccgat gtaaaaggta 4380 ctgttactgt atattcatct gacgttaaac ctgaaaatct acgcaatttc tttatttctg 4440 ttttacgtgc aaatattt gatatggtag gttctaaccc ttccattatt cagaagtata 4500 atccaaacaa tcaggattat attgatgaat tgccatcatc tgataatcag gaatatgatg 4560 ataattccgc tccttctggt ggtttctttg ttccgcaaaa tgataatgtt actcaaactt 4620 ttaaaattaa taacgttcgg gcaaaggatt tatacgagt tgtcgaattg tttgtaaagt 4680 ctaatacttc taaatcctca aatgtattat ctattgacgg ctctaatcta ttagttgtta 4740 gtgctcctaa agatatttta gataaccttc ctcaattcct ttcaactgtt gatttgccaa 4800 ctgaccagat attgattgag ggtttgatat ttgaggttca gcaaggtgat gctttagatt 4860 tttcatttgc tgctggctct cagcgtggca ctgttgcagg cggtgttaat actgaccgcc 4920 tcacctctgt tttatcttct gctggtggtt cgttcggtat ttttaatggc gatgttttag 4980 ggctatcagt tcgcgcatta aagactaata gccattcaaa aatattgtct gtgccacgta 5040 ttcttacgct ttcaggtcag aagggttcta tctctgttgg ccagaatgtc ccttttatta 5100 ctggtcgtgt gactggtgaa tctgccaatg taaataatcc atttcagacg attgagcgtc 5160 aaaatgtagg tatttccatg agcgtttttc ctgttgcaat ggctggcggt aatattgttc 5220 tggatattac cagcaaggcc gatagtttga gttcttctac tcaggcaagt gatgttatta 5280 ctaatcaaag aagtattgct acaacggtta atttgcgtga tggacagact cttttactcg 5340 gtggcctcac tgattataaa aacacttctc aggattctgg cgtaccgttc ctgtctaaaa 5400 tccctttaat cggcctcctg tttagctccc gctctgattc taacgaggaa agcacgttat 5460 acgtgctcgt caaagcaacc atagtacgcg ccctgtagcg gcgcattaag cgcggcgggt 5520 gtggtggtta cgcgcagcgt gaccgctaca cttgccagcg ccctagcgcc cgctcctttc 5580 gctttcttcc cttcctttct cgccacgttc gccggctttc cccgtcaagc tctaaatcgg 5640 gggctccctt tagggttccg atttagtgct ttacggcacc tcgaccccaa aaaacttgat 5700 ttgggtgatg gttcacgtag tgggccatcg ccctgataga cggtttttcg ccctttgacg 5760 ttggagtcca cgttctttaa tagtggactc ttgttccaaa ctggaacaac actcaaccct 5820 atctcgggct attcttttga tttataaggg attttgccga tttcggaacc accatcaaac 5880 aggattttcg cctgctgggg caaaccagcg tggaccgctt gctgcaactc tctcagggcc 5940 aggcggtgaa gggcaatcag ctgttgcccg tctcactggt gaaaagaaaa accaccctgg 6000 cgcccaatac gcaaaccgcc tctccccgcg cgttggccga ttcattaatg cagctggcac 6060 gacaggtttc ccgactggaa agcgggcagt gagcgcaacg caattaatgt gagttagctc 6120 actcattagg caccccaggc tttacacttt atgcttccgg ctcgtatgtt gtgtggaatt 6180 gtgagcggat aacaatttca cacaggaaac agctatgacc atgattacga attcgagctc 6240 ggtacccggg gatcctctag agtcgacctg caggcatgca agcttggcac tggccgtcgt 6300 tttacaacgt cgtgactggg aaaaccctgg cgttacccaa cttaatcgcc ttgcagcaca 6360 tccccctttc gccagctggc gtaatagcga agaggcccgc accgatcgcc cttcccaaca 6420 gttgcgcagc ctgaatggcg aatggcgctt tgcctggttt ccggcaccag aagcggtgcc 6480 ggaaagctgg ctggagtgcg atcttcctga ggccgatact gtcgtcgtcc cctcaaactg 6540 gcagatgcac ggttacgatg cgcccatcta caccaacgtg acctatccca ttacggtcaa 6600 tccgccgttt gttcccacgg agaatccgac gggttgttac tcgctcacat ttaatgttga 6660 tgaaagctgg ctacaggaag gccagacgcg aattattttt gatggcgttc ctattggtta 6720 aaaaatgagc tgatttaaca aaaatttaat gcgaatttta acaaaatatt aacgtttaca 6780 atttaaatat ttgcttatac aatcttcctg tttttggggc ttttctgatt atcaaccggg 6840 gtacatatga ttgacatgct agttttacga ttaccgttca tcgattctct tgtttgctcc 6900 agactctcag gcaatgacct gatagccttt gtagatctct caaaaatagc taccctctcc 6960 ggcattaatt tatcagctag aacggttgaa tatcatattg atggtgattt gactgtctcc 7020 ggcctttctc acccttttga atctttacct acacattact caggcattgc atttaaaata 7080 7140. tatgaggttc taaaatttt tatccttgcg ttgaaataaa ggcttctccc gcaaaagtat 7200. tacagggtca taatgttttt ggtacaaccg atttagcttt atgctctgag gctttattgc ttaattttgc taattctttg ccttgcctgt atgatttatt ggatgtt <210> 2 <211> 30 <212> DNA <213> Artificial Sequence <400> 2 30. snow cggaaaattg aggttgtcac <210> 3 <211> 30 <212> DNA <213> Artificial Sequence <400> 3 ccgaacaaag ttaccaaaaa gtataagccc <210> 4 <211> 30 <212> DNA <213> Artificial Sequence <400> 4 tgaatcggcc aacgcggtgc cagaatgagt <210> 5 <211> 30 <212> DNA <213> Artificial Sequence <400> 5 aatcgtaaaa ctagcaaga tcggggtagc <210> 6 <211> 30 <212> DNA <213> Artificial Sequence <400> 6 agaagccttt atttcagtaa tacgcaaaat 30 <210> 7 <211> 30 <212> DNA <213> Artificial Sequence <400> 7 attgtgaatt accttaaatt tcatcagtga 30 <210> 8 <211> 30 <212> DNA <213> Artificial Sequence <400> 8 atagaaagga acaacttttc agctagcgta 30 <210> 9 <211> 30 <212> DNA <213> Artificial Sequence <400> 9 catgtaattt aggcagtatt taatgcgtta 30 <210> 10 <211> 30 <212> DNA <213> Artificial Sequence <400> 10 acgttgtaaa acgacgggttttcaagggcg 30 <210> 11 <211> 30 <212> DNA <213> Artificial Sequence <400> 11 gacttcaaat atcgcgaaga ggaaatcaaa 30 <210> 12 <211> 30 <212> DNA <213> Artificial Sequence <400> 12 caaataagaa acgattatta tttgaatctt 30 <210> 13 <211> 30 <212> DNA <213> Artificial Sequence <400> 13 gagtgaataa ccttgcataa atctcaagaa 30 <210> 14 <211> 30 <212> DNA <213> Artificial Sequence <400> 14 attgcgtaga ttttcaaaac agattgtttg 30 <210> 15 <211> 30 <212> DNA <213> Artificial Sequence <400> 15 gtccactatt aaagaaccag ttttggttcc 30 <210> 16 <211> 30 <212> DNA <213> Artificial Sequence <400> 16 cccaattctg cgaacgcata taaaatataa 30 <210> 17 <211> 30 <212> DNA <213> Artificial Sequence <400> 17 atttaccgtt ccagtaaaag cgcttgaggc 30 <210> 18 <211> 30 <212> DNA <213> Artificial Sequence <400> 18 ggcttttgca aaagaaaacc aaacaaaagg 30 <210> 19 <211> 30 <212> DNA <213> Artificial Sequence <400> 19 aactttttca aatataacaa agattttaac 30 <210> 20 <211> 30 <212> DNA <213> Artificial Sequence <400> 20 cgtactcagg aggtttggaa tagtcctcaa 30 <210> twenty one <211> 30 <212> DNA <213> Artificial Sequence <400> twenty one ccgtaatggg ataggtacaa acgaaaataa 30 <210> twenty two <211> 30 <212> DNA <213> Artificial Sequence <400> twenty two taatcaaaat caccgggttt gccgtttgcc 30 <210> twenty three <211> 30 <212> DNA <213> Artificial Sequence <400> twenty three agccgttttt attttctcat cgacctaatt 30 <210> twenty four <211> 30 <212> DNA <213> Artificial Sequence <400> twenty four agccggaacg aggcgcctgc tcccaagcgc 30 <210> 25 <211> 30 <212> DNA <213> Artificial Sequence <400> 25 atcggaacga gggtagagca gcgaaccgat 30 <210> 26 <211> 42 <212> DNA <213> Artificial Sequence <400> 26 aaaaatgagt tacagcgtct ttccagagaa tcatcatatt cc 42 <210> 27 <211> 42 <212> DNA <213> Artificial Sequence <400> 27 gaattacatt ctagaggatc cccgggtaat ccgctcacaa tt 42 <210> 28 <211> 42 <212> DNA <213> Artificial Sequence <400> 28 aagcaaagac atctgccagt ttgaggggcc gcttctggtg ag 42 <210> 29 <211> 42 <212> DNA <213> Artificial Sequence <400> 29 accccggtga gagtctacaa aggctatctc gcaagcggtc ca 42 <210> 30 <211> 42 <212> DNA <213> Artificial Sequence <400> 30 gagaagggcc tgtaccatgt accgtaaccc accctccacc ct 42 <210> 31 <211> 42 <212> DNA <213> Artificial Sequence <400> 31 tgaatattat caaaataatg gaagggttgc gcctgtttat ca 42 <210> 32 <211> 42 <212> DNA <213> Artificial Sequence <400> 32 cctaccaaca gtaatataaa gtaccgacaa tgcagaacgc tc 42 <210> 33 <211> 42 <212> DNA <213> Artificial Sequence <400> 33 gattataata agtccaacat gttcagctaa aaggtcgtca ga 42 <210> 34 <211> 42 <212> DNA <213> Artificial Sequence <400> 34 cctgataccg aactcaccga cttgagccgg ccggaaacgt cg 42 <210> 35 <211> 42 <212> DNA <213> Artificial Sequence <400> 35 aaacgcactt accggaaaca atgaaatata caccatcaat at 42 <210> 36 <211> 42 <212> DNA <213> Artificial Sequence <400> 36 taccgcggta ttaaaaccaa tcaataattc gccttaaatc aa 42 <210> 37 <211> 42 <212> DNA <213> Artificial Sequence <400> 37 taataatttg ctaatgtcgt ctttccagat gcttgatacc ga 42 <210> 38 <211> 42 <212> DNA <213> Artificial Sequence <400> 38 gaaacaaagc agcaattacc attagcaaat ttgggcaatc at 42 <210> 39 <211> 42 <212> DNA <213> Artificial Sequence <400> 39 aggtcagaaa cacttacgaa ggcaccaagg aagtttacat gg 42 <210> 40 <211> 42 <212> DNA <213> Artificial Sequence <400> 40 cattgccttg ataaccaggg tggtttttga gagagttgca ac 42 <210> 41 <211> 42 <212> DNA <213> Artificial Sequence <400> 41 taagcaagaa acgctagcaa acgtagaaga actgggataa aa 42 <210> 42 <211> 42 <212> DNA <213> Artificial Sequence <400> 42 atattcgtct gaaaccgtat aaacagttat aagtttacag ag 42 <210> 43 <211> 42 <212> DNA <213> Artificial Sequence <400> 43 taaagtaaga tacacagtca ggacgttggt agaaagattc ac 42 <210> 44 <211> 42 <212> DNA <213> Artificial Sequence <400> 44 agaacggccc aatagcaagc ctccctcaca cttatcattc ca 42 <210> 45 <211> 42 <212> DNA <213> Artificial Sequence <400> 45 tgctgtatac cacacaacat tattacagggg aagaattagt tt 42 <210> 46 <211> 42 <212> DNA <213> Artificial Sequence <400> 46 cagaaccggg ttgattagcg gggttttgta caccagtaca aa 42 <210> 47 <211> 42 <212> DNA <213> Artificial Sequence <400> 47 gaaatcgaat atcaaattaa ctgaacacag aataatccaa cg 42 <210> 48 <211> 42 <212> DNA <213> Artificial Sequence <400> 48 cagtaatggg cttaagtata aagccaacag gcgaattatt ca 42 <210> 49 <211> 42 <212> DNA <213> Artificial Sequence <400> 49 atcttcttga tgcagggtta tataactact cagtaccagg cc 42 <210> 50 <211> 42 <212> DNA <213> Artificial Sequence <400> 50 ataaggccca ataactgaaa aggtggcaaa taaccttaag aa 42 <210> 51 <211> 42 <212> DNA <213> Artificial Sequence <400> 51 aagggaaaat tgtgcggaga tttgtatcag caccaatgaa ac 42 <210> 52 <211> 42 <212> DNA <213> Artificial Sequence <400> 52 tgggattttt ttcacgttga aaatgtttcc gaattttctg ta 42 <210> 53 <211> 42 <212> DNA <213> Artificial Sequence <400> 53 gagtagtatt atactttcgc aaatggtctc aattctacta ac 42 <210> 54 <211> 42 <212> DNA <213> Artificial Sequence <400> 54 tcaaagcgcg gattcctgac tattatagtt catcaacatt ta 42 <210> 55 <211> 42 <212> DNA <213> Artificial Sequence <400> 55 gagctaaagc tcataacgtt aatattttaa aacagaggcg gt 42 <210> 56 <211> 42 <212> DNA <213> Artificial Sequence <400> 56 ttcgcgtcca ttcgccagct ttccggcaac gacgagtgta ga 42 <210> 57 <211> 42 <212> DNA <213> Artificial Sequence <400> 57 aacagtaaag agaacagtac cttttacaaa tcgcgcagag aa 42 <210> 58 <211> 42 <212> DNA <213> Artificial Sequence <400> 58 ccggaacggt catagtagcg cgttttcacg gctgtctttc cc <210> 59 <211> 42 <212> DNA <213> Artificial Sequence <400> 59 gctattactt ttttcattta acaatttcca gctggcgaaa aa <210> 60 <211> 42 <212> DNA <213> Artificial Sequence <400> 60 taaccctgta aaatctccaa aaaaaggat ttcttaaaca ca <210> 61 <211> 42 <212> DNA <213> Artificial Sequence <400> 61 ctggctcaaa ttgggacgag aaacaccaca 42 <210> 62 <211> 42 <212> DNA <213> Artificial Sequence <400> 62 tcggttgga ccctcggat acccaaaaaa tacatacata aa <210> 63 <211> 42 <212> DNA <213> Artificial Sequence <400> 63 cttttgatcc tcatgccttg atattcactt gaggcaaaag aa 42 <210> 64 <211> 42 <212> DNA <213> Artificial Sequence <400> 64 tagctatata ataacatata ttttaaatag acagtcaaat aa 42 <210> 65 <211> 42 <212> DNA <213> Artificial Sequence <400> 65 taaatgcgaa ccgccaccct cagagccaac tgagtttcgt tg 42 <210> 66 <211> 42 <212> DNA <213> Artificial Sequence <400> 66 accaacgcag atgaagaaac caccagaatt taaaataacg tc 42 <210> 67 <211> 42 <212> DNA <213> Artificial Sequence <400> 67 ccaaagatca ccgtgaccaa ctttgaaaca agagtaatct cg 42 <210> 68 <211> 42 <212> DNA <213> Artificial Sequence <400> 68 tacgagctgc tattcctccc gacttgcgtt atccggaatc at 42 <210> 69 <211> 42 <212> DNA <213> Artificial Sequence <400> 69 cattttccgc aaatcagata tagaaggcgg aggttttgaa gg 42 <210> 70 <211> 42 <212> DNA <213> Artificial Sequence <400> 70 atcggtgcgg aagctgtgtg aaattgttcc gagctccaag ct 42 <210> 71 <211> 42 <212> DNA <213> Artificial Sequence <400> 71 ggtaatacgt ttacgtaaga gcaacactac gttagtaaat ct 42 <210> 72 <211> 42 <212> DNA <213> Artificial Sequence <400> 72 atttgccaaa atagaccgtc tatcaaatgg agcggaatta ga 42 <210> 73 <211> 42 <212> DNA <213> Artificial Sequence <400> 73 tttagcgcca ccagaccctc agagccgcga gccgcgccac ca 42 <210> 74 <211> 42 <212> DNA <213> Artificial Sequence <400> 74 tatttttttg cccccaccgc ctggccctct tttcacatat gt 42 <210> 75 <211> 42 <212> DNA <213> Artificial Sequence <400> 75 atttttatac caaatcagag cataaagcgc aaggtggcaa ca 42 <210> 76 <211> 42 <212> DNA <213> Artificial Sequence <400> 76 acgatctgcc gacatgcttt cgaggtgact ccaaattgcg aa 42 <210> 77 <211> 42 <212> DNA <213> Artificial Sequence <400> 77 aatcaatatt accctggctg accttcatga ggacattaaa gg 42 <210> 78 <211> 42 <212> DNA <213> Artificial Sequence <400> 78 aataataaac cgttgtgaga aaggccgggc aatgcaccga gg 42 <210> 79 <211> 42 <212> DNA <213> Artificial Sequence <400> 79 tgggcgcccc gtcgtcctgt agccagcttc ccggaaacca gg 42 <210> 80 <211> 42 <212> DNA <213> Artificial Sequence <400> 80 aacaaaattt atcagacgct gagaagagct tagaaaatcg tc 42 <210> 81 <211> 42 <212> DNA <213> Artificial Sequence <400> 81 tcaaagggag atagccctta taaatcaacc cagagggtaa tt 42 <210> 82 <211> 42 <212> DNA <213> Artificial Sequence <400> 82 tacaaattac ctgaatacca agttacaatc gggagttcga gc 42 <210> 83 <211> 42 <212> DNA <213> Artificial Sequence <400> 83 aggccgcgga ctaaggagtg tactggtaaa tgccccctgc ac 42 <210> 84 <211> 42 <212> DNA <213> Artificial Sequence <400> 84 aattacgttt aaactattca ttgaatccag actggcagag gg 42 <210> 85 <211> 42 <212> DNA <213> Artificial Sequence <400> 85 gcaaggcctg caggtcgact aattttcctc gggggatgtg ct 42 <210> 86 <211> 42 <212> DNA <213> Artificial Sequence <400> 86 gctttgattt tgcgaggctt gcagggagaa ctatttcgga ac 42 <210> 87 <211> 42 <212> DNA <213> Artificial Sequence <400> 87 gtcgagagcc accctcagac ctaaatttca cggataagtg cc 42 <210> 88 <211> 42 <212> DNA <213> Artificial Sequence <400> 88 ttgcgtattt ccagtaattg cgttgcgcag attaaatttt tg 42 <210> 89 <211> 42 <212> DNA <213> Artificial Sequence <400> 89 gtaacaaatc gtaaccgtga ccagaccgga aaatgtgagc ga 42 <210> 90 <211> 42 <212> DNA <213> Artificial Sequence <400> 90 aatcaggatt tttgtaattg ctccttttga agcaatcgag ct 42 <210> 91 <211> 42 <212> DNA <213> Artificial Sequence <400> 91 tgaattacaa aaggtcatat ggtttaccat tgacaagaac cg 42 <210> 92 <211> 42 <212> DNA <213> Artificial Sequence <400> 92 ctccggctaa ttaactaaata agaataaaaa tggtttaatt tc 42 <210> 93 <211> 42 <212> DNA <213> Artificial Sequence <400> 93 gaccattcgg tgtcatgttt taaatatgga atcagttgag at 42 <210> 94 <211> 42 <212> DNA <213> Artificial Sequence <400> 94 aaataaatga tacaagactttttcatgacc taaaacgaaa aa 42 <210> 95 <211> 42 <212> DNA <213> Artificial Sequence <400> 95 atagcccgcg aaaacagcctttacagagcc tgaacaaagt ta 42 <210> 96 <211> 42 <212> DNA <213> Artificial Sequence <400> 96 tgcccgcttg ggcgtcagaa aagccccagt taaaattcgc gt 42 <210> 97 <211> 42 <212> DNA <213> Artificial Sequence <400> 97 tgcatgcgat taagcttcgc tattacgcat ttccacacaa ca 42 <210> 98 <211> 54 <212> DNA <213> Artificial Sequence <400> 98 acaatagctt ctgaattatt tgcacgtagg tttaaaaagt aattctgtcc agac 54 <210> 99 <211> 54 <212> DNA <213> Artificial Sequence <400> 99 tagtgaatta attaaatgga aacagtactt ctgtatcctt gaaaacatag cgat 54 <210> 100 <211> 54 <212> DNA <213> Artificial Sequence <400> 100 agaaccatca gactgccccc ttattagcaa ccagacaccc tcagaaccgc cacc 54 <210> 101 <211> 54 <212> DNA <213> Artificial Sequence <400> 101 agaggtctct ttacgcatca aaaagatttt ttaatactcc aacaggtcag gatt 54 <210> 102 <211> 54 <212> DNA <213> Artificial Sequence <400> 102 tagttgcaaa gtttacaact ttcaacagaa aggaaaggag cctttaattg tatc 54 <210> 103 <211> 54 <212> DNA <213> Artificial Sequence <400> 103 gatattcaga gcaaaagccc tttttaagga aggaactgag taatgtgtag gtaa 54 <210> 104 <211> 54 <212> DNA <213> Artificial Sequence <400> 104 tgattatcta acgaaaataa acagccattt ttgttgtttg agtaacatta tcat 54 <210> 105 <211> 54 <212> DNA <213> Artificial Sequence <400> 105 caaatgcagg catacagacg acgataaagt tttgcatagc gtccaatact gcgg 54 <210> 106 <211> 54 <212> DNA <213> Artificial Sequence <400> 106 ttaaatcctc acattcggga aacctgtccg gggaggaaga ttgtataagc aaat 54 <210> 107 <211> 54 <212> DNA <213> Artificial Sequence <400> 107 ttaggaagct caactggaag tttcattcag tagataaatc tacgttaata aaac 54 <210> 108 <211> 54 <212> DNA <213> Artificial Sequence <400> 108 ctattatgtc gctggggatcg tcaccctcca acggcttaac ggggtcagtg cctt 54 <210> 109 <211> 54 <212> DNA <213> Artificial Sequence <400> 109 catcgatagt acaatcgaaa tccgcgacag acggtaatta gagccagcaa aatc 54 <210> 110 <211> 54 <212> DNA <213> Artificial Sequence <400> 110 gatattcaga aaatgcgaca ttcaaccgtt attcagatga acggtgtaca gacc 54 <210> 111 <211> 54 <212> DNA <213> Artificial Sequence <400> 111 ttaacatttg ccctgcttga gatggttttg cgatttgttt agctatattt tcat 54 <210> 112 <211> 54 <212> DNA <213> Artificial Sequence <400> 112 tttcaattct taccattgag aatcgccaag gcattaaaca ataacggatt cgcc 54 <210> 113 <211> 54 <212> DNA <213> Artificial Sequence <400> 113 caaagcgctg gcctgattct ccgtgggaca cgttgcagta tcggcctcag gaag <210> 114 <211> 54 <212> DNA <213> Artificial Sequence <400> 114 gagcgctgca aaatggttga gtgttgttcg tggaccataa aaacagggga gcgc <210> 115 <211> 54 <212> DNA <213> Artificial Sequence <400> 115 ggaatcatta ggttaatcca atcgcaagtt ttagttgaaa taccgaccgt gtga <210> 116 <211> 54 <212> DNA <213> Artificial Sequence <400> 116 father agccaacatt atgaccctac gcaagcatga ttaagactcc ttat <210> 117 <211> 54 <212> DNA <213> Artificial Sequence <400> 117 ctacaacatt snow snow snow snow snow snow snow 54 snow snow <210> 118 <211> 54 <212> DNA <213> Artificial Sequence <400> 118 gattagtatg tagaaccaag taccgcacat cgtaggtatt ctaagaacgc gagg 54 <210> 119 <211> 54 <212> DNA <213> Artificial Sequence <400> 119 tacactaacg attgtaaagc cagaatggag cgtcatccat taaacgggta aaat 54 <210> 120 <211> 54 <212> DNA <213> Artificial Sequence <400> 120 tacgagccgg gcctttgggt aacgccaggc cagtgcgaat tcgtaatcat ggtc 54 <210> 121 <211> 54 <212> DNA <213> Artificial Sequence <400> 121 cgctggtgag agatctggag caaacaagtg tcaatccagt gagacgggca acag 54 <210> 122 <211> 848 <212> DNA <213> Artificial Sequence <400> 122 taatacgact cactataggg agacccaagc tggctagcgc caccatgaag accatcatcg 60 ccctgagcta catcttctgc ctggtgttcg ccactaatct ttgtccgttc ggtgaggttt 120 ttaacgcgac aaggttcgct agtgtatatg cttggaaccg aaagagaatc tccaattgcg 180 tagctgatta ctccgttctc tataacagtg cgtccttttc aacctttaag tgttacggcg 240 tttctccaac gaagctgaat gatctctgtt ttacgaacgt gtatgctgac tctttcgtta 300 tacgggggga cgaagtgaga cagatagcac caggtcagac tgggaagata gcggattaca 360 actataagtt gcccgatgat tttacggggt gcgtaatcgc atggaactca aacaacctcg 420 actccaaagt aggtggtaat tataattact tgtatcgcct gtttcgaaag agcaatttga 480 agccttttga gcgggatatt tcaaccgaaa tttaccaagc aggcagtacg ccatgtaacg 540 gagtagaggg atttaattgc tactttcctc ttcaatctta tggctttcaa ccaacaaacg 600 gagtggggta tcaaccttat agagtggtag tattgtcctt tgagctcctc cacgccccgg 660 ctacagtttg tgggcccaaa aagggatccg acaaaactca cacatgccca ccgtgcccag 720 cacctgaact cctgggggga ccgtcagtct tcctcttccc cccaaaaccc aaggacaccc 780 tcatgatctc ccggacccct gaggtcacat gcgtggtggt ggacgtgagc cacgaagacc 840 ctgaggtc 848 <210> 123 <211> 30 <212> DNA <213> Artificial Sequence <400> 123 atcggaacga gggtagagca gcgaaccgat 30 <210> 124 <211> 57 <212> DNA <213> Artificial Sequence <400> 124 atcggaacga gggtagagca gcgaaccgat ttttttttct gggttcgacc gatcgcg 57

Claims

1. A DNA nanostructure-mRNA complex, characterized in that: It includes a nucleic acid molecule and a DNA nanostructure, wherein the DNA nanostructure serves as a carrier and is combined with the nucleic acid molecule; the DNA nanostructure includes a scaffold molecule and a complementary chain molecule; the nucleotide sequences of all complementary chain molecules combined with the scaffold molecule are shown in SEQ ID NO:2 to SEQ ID NO:23, SEQ ID NO:25 to SEQ ID NO:121, and SEQ ID NO:124; the nucleic acid molecule is an mRNA molecule obtained by transcription of a DNA with a sequence as shown in SEQ ID NO:122; and the sequence of the scaffold molecule is shown in SEQ ID NO:

1.

2. The DNA nanostructure-mRNA complex according to claim 1, characterized in that: The DNA nanostructure is combined with the nucleic acid molecule through the principle of base complementary pairing.

3. The method for preparing the DNA nanostructure-mRNA complex according to any one of claims 1 to 2, characterized in that: The following steps are involved: S1: Mix the scaffold molecule with the complementary chain molecule and fold it to form a DNA nanostructure; S2: Mixing the DNA nanostructure described in step S1 with the nucleic acid molecule to form a stable double-stranded structure through hybridization.

4. The preparation method according to claim 3, characterized in that: In step S1, the scaffold molecule and the complementary chain molecule are mixed and reacted at a temperature of 25° C. to 92° C. for a reaction time of 24 h to 240 h.

5. The preparation method according to claim 3, characterized in that: In step S1, the scaffold molecules and the complementary chain molecules are mixed and reacted, and magnesium ions are added. The concentration of the magnesium ions is 2 mM to 40 mM.

Images