A new method for intelligent detection of fungal toxins using molecular logic gates

Abstract

The present invention discloses a novel method for intelligent detection of fungal toxins by molecular logic gates, the method comprising the following steps: (1) heating a hairpin probe group to 92-95°C and then cooling it to room temperature to form a hairpin structure; (2) incubating the test sample, the hairpin probe group forming the hairpin structure, the enzyme chain and the substrate chain at 25±2°C for 90-95 minutes, and detecting the fluorescence signal. The detection method and the detection kit of the present invention can accurately and intelligently detect whether the sample to be tested contains OTA, AFB1 and ZEN, and have good specificity, and will not produce false positives for other fungal toxins and the like. It also has high sensitivity, with a detection limit of up to 100pM, which is more sensitive and intelligent than conventional detection techniques.

Description

Technical Field

[0001] The invention belongs to the field of analysis and detection, and specifically relates to a new method for intelligently detecting fungal toxins using molecular logic gates. Background Art

[0002] Mycotoxins are secondary metabolites produced by fungi such as Fusarium, Penicillium, and Aspergillus under suitable temperature and humidity conditions. At present, the most common mycotoxins include aflatoxins B1 (AFB1), ochratoxin A (OTA), deoxynivalenol (DON), zearalenone (ZEN), T-2 toxin (T-2toxin, T-2) and fumonisin B1 (FB). Most mycotoxins can inhibit the synthesis of animal proteins and related enzymes, destroy cell structures, and damage animal liver, kidneys, nerves, hematopoiesis and other tissues and organs. They have carcinogenic, teratogenic, mutagenic, reproductive disorder and immunosuppressive effects. Moreover, mycotoxins are widely distributed, have small molecular weights, and generally have uniform and stable structures and chemical properties. They cannot be decomposed even by high-temperature cooking.

[0003] When agricultural products are contaminated by mycotoxins, they often contain multiple mycotoxins at the same time. Once these mycotoxins enter the human body through the food chain, they will seriously threaten human health. Therefore, it is particularly important to develop an intelligent method to detect the content of mycotoxins in agricultural products.

[0004] In the related art, the methods used to detect mycotoxins mainly include: high performance liquid chromatography (HPLC), thin layer chromatography (TLC), gas chromatography (GC) and liquid chromatography tandem mass spectrometry (LC-MS). However, these methods all have defects that are difficult to overcome, such as the need for large-scale instrument detection, which results in high detection costs. In addition, these detection methods are limited by the instruments themselves, are relatively time-consuming, and cannot meet the requirements of intelligent and efficient detection. Therefore, there is an urgent need to develop new methods for intelligent detection of mycotoxins using molecular logic gates to obtain intelligent detection results, thereby effectively controlling the hazards of mycotoxins. Summary of the invention

[0005] The present invention aims to solve at least one of the technical problems existing in the above-mentioned prior art. To this end, the present invention proposes a method for detecting fungal toxins based on molecular logic gates and its application. The molecular logic gate detection system realizes intelligent detection of multiple fungal toxins based on "OR-AND" and "OR-INHIBIT" cascade molecular logic gates, has stable detection effect, high detection accuracy, low detection limit, short detection time, and has excellent practical application value.

[0006] The first aspect of the present invention provides a mycotoxin detection reagent.

[0007] According to the first aspect of the present invention, in some embodiments of the present invention, the reagent contains a hairpin probe set.

[0008] In some preferred embodiments of the present invention, the hairpin probe group includes at least one of hairpin probe A, hairpin probe B, hairpin probe C, hairpin probe D, hairpin probe E, hairpin probe F, hairpin probe G and hairpin probe H.

[0009] In some preferred embodiments of the present invention, the hairpin probe group includes at least 5 of the following: hairpin probe A, hairpin probe B, hairpin probe C, hairpin probe D, hairpin probe E, hairpin probe F, hairpin probe G and hairpin probe H.

[0010] In some more preferred embodiments of the present invention, the hairpin probe group is a combination of hairpin probe A, hairpin probe B, hairpin probe C, hairpin probe D, and hairpin probe E, or a combination of hairpin probe D, hairpin probe E, hairpin probe F, hairpin probe G, and hairpin probe H.

[0011] In some preferred embodiments of the present invention, the nucleotide sequences of the hairpin probes A to H are:

[0012] Hairpin Probe A:

[0013] Hairpin probe B:

[0014] Hairpin Probe C:

[0015] Hairpin probe D: 5′-GGGGTGTGGGTGGCGTAAAGGGAGCCCATGTATCGAGCTCCCTTTACGCCTGTGT-3′ (SEQ ID NO. 4);

[0016] Hairpin probe E: 5′-TGTGTGTGTGTAAGGGAGCTCGATACATGGGCTCCCTTTACGCCCCATGTATCGA-3′ (SEQ ID NO. 5);

[0017] Hairpin Probe F:

[0018] Hairpin Probe G:

[0019] Hairpin probe H:

[0020] Among them, the bold and underlined parts in the 7 hairpin probes are the sequences of different nucleic acid aptamers.

[0021] According to the first aspect of the present invention, in some embodiments of the present invention, the fungal toxins include aflatoxin B1, ochratoxin A and zearalenone toxin.

[0022] The second aspect of the present invention provides a mycotoxin detection kit.

[0023] According to the second aspect of the present invention, in some embodiments of the present invention, the kit includes the fungal toxin detection reagent, enzyme chain and substrate chain described in the first aspect of the present invention.

[0024] In some preferred embodiments of the present invention, the nucleotide sequence of the enzyme chain is: enzyme chain DNA1: 5-ACACAGGCGTAGACTCCGAGCCGGACGAAGTTACCCACACCCC-3 (SEQ ID NO.9).

[0025] In some preferred embodiments of the present invention, the nucleotide sequence of the substrate chain is: substrate chain DNA2: 5-TCGATACATGGAACTrAGGTCACACACACACA-3 (SEQ ID NO.10).

[0026] In some preferred embodiments of the present invention, rA in the substrate chain represents nucleic acid A modification.

[0027] In some preferred embodiments of the present invention, the substrate chain is modified with a fluorescent group and a quenching group, and the fluorescent group and the quenching group are modified on opposite sides of the enzyme cleavage site, respectively.

[0028] In some preferred embodiments of the present invention, the fluorescent group is modified at the 19th base T (5'-3') in the substrate chain, and the quenching group is modified at the 9th base T (5'-3') in the substrate chain.

[0029] In an embodiment of the present invention, the fluorescent group is BHQ2, and the quenching group is TAMRA.

[0030] Of course, those skilled in the art can reasonably replace the fluorescent group TAMRA and the quenching group BHQ2 with other fluorescent groups and quenching groups according to actual use requirements to achieve the effect of fluorescent labeling.

[0031] The third aspect of the present invention provides use of the mycotoxin detection reagent described in the first aspect of the present invention or the mycotoxin detection kit described in the second aspect of the present invention in food safety detection.

[0032] According to the third aspect of the present invention, in some embodiments of the present invention, the fungal toxins include aflatoxin B1, ochratoxin A and zearalenone toxin.

[0033] A fourth aspect of the present invention provides a method for detecting mycotoxins, comprising the following steps:

[0034] (1) heating the hairpin probe set to 92-95° C. and then cooling it to room temperature to form a hairpin structure;

[0035] (2) Incubate the test sample, the hairpin probe set forming the hairpin structure, the enzyme chain and the substrate chain at 25±2° C. for 90 to 95 minutes, and detect the fluorescence signal.

[0036] According to the fourth aspect of the present invention, in some embodiments of the present invention, the test sample is food.

[0037] According to the fourth aspect of the present invention, in some embodiments of the present invention, the detection method performs "OR-AND" and / or "OR-INHIBIT" molecular logic gates.

[0038] In some preferred embodiments of the present invention, the detection system of the "OR-AND" molecular logic gate is:

[0039]

[0040]

[0041] In some more preferred embodiments of the present invention, the detection system of the "OR-AND" molecular logic gate is:

[0042] Components Final content Test samples 10μL Hairpin Probe A 250nM Hairpin Probe B 250nM Hairpin Probe C 250nM Hairpin Probe D 250nM Hairpin Probe E 500nM Cas9 DNA1 250nM Substrate strand DNA2 250nM Magnesium chloride 10mM <![CDATA[ddH2O]]> Make up to 100 μL

[0043] The detection principle of the "OR-AND" molecular logic gate is:

[0044] When the test sample contains ochratoxin A (OTA), the aptamer sequence in the hairpin probe A will bind to OTA and release the trigger sequence 1 (i.e. Figure 1 When the sample contains aflatoxin B1 (AFB1), the aptamer sequence in the hairpin probe B will bind to it and release the trigger sequence 2 (i.e. Figure 1 OTA performs an “OR” logic function with AFB1.

[0045] When the test sample contains zearalenone toxin (ZEN), the aptamer sequence in the hairpin probe C will bind to it and release the trigger sequence 3 (i.e. Figure 1 The initiator sequence 3 hybridizes with the sequence s of any one of the initiator sequences 1 or 2 through the s* sequence to form OTA-A / ZEN-C or AFB1-B / ZEN-C, generating an "AND" logic function.

[0046] The sequence ab generated by OTA-A / ZEN-C or AFB1-B / ZEN-C will further initiate the hairpin assembly mediated by hairpin probes D and E, generating a large number of double-stranded DE complexes. The double-stranded DE complexes synergistically hybridize with enzyme chain DNA1 and substrate chain DNA2 to form a supramolecular complex [B / C / DNA1 / DNA2]n. When magnesium ions are present in the system, the supramolecular complex [B / C / DNA1 / DNA2]n will hydrolyze the substrate chain DNA2, resulting in the separation of the quenching group and the fluorescent group, generating a fluorescent signal.

[0047] Therefore, for the "OR-AND" logic gate, its intelligent detection criteria for toxins are:

[0048] When strong fluorescence is detected, it indicates the presence of any of the following conditions (a) to (c) in the sample:

[0049] (a) The test sample contains both OTA and ZEN;

[0050] (b) The test sample contains both AFB1 and ZEN;

[0051] (c) The detected samples contained OTA, AFB1 and ZEN at the same time.

[0052] When no strong fluorescence is detected, it indicates that any of the following conditions (d) to (h) exist in the test sample:

[0053] (d) The tested samples did not contain mycotoxins (OTA, AFB1 and ZEN);

[0054] (e) The test sample only contained OTA;

[0055] (f) The test sample contained only AFB1;

[0056] (g) The test sample contains only ZEN;

[0057] (h) The detected sample contains both OTA and AFB1 but no ZEN.

[0058] In some preferred embodiments of the present invention, the detection system of the "OR-INHIBIT" molecular logic gate is:

[0059] Components Final content Test samples 10μL Hairpin Probe F 200~300nM Hairpin Probe G 200~300nM Hairpin Probe H 200~300nM Hairpin Probe D 200~300nM Hairpin Probe E 400~600nM Cas9 DNA1 200~300nM Substrate strand DNA2 200~300nM Magnesium chloride 10mM <![CDATA[ddH2O]]> Make up to 100 μL

[0060] In some preferred embodiments of the present invention, the detection system of the "OR-INHIBIT" molecular logic gate is:

[0061]

[0062]

[0063] The detection principle of the "OR-INHIBIT" molecular logic gate is:

[0064] When the test sample contains OTA, the aptamer sequence of the hairpin probe F will bind to OTA and release the trigger sequence 1 (i.e. Figure 2 When the sample contains AFB1, the aptamer sequence in the hairpin probe G will bind to it and release the trigger sequence 2 (i.e. Figure 2 OTA performs an “OR” logic function with AFB1.

[0065] When the test sample contains ZEN, the aptamer sequence in the hairpin probe H will bind to it and release the trigger sequence 3 (i.e. Figure 2 The initiator sequence 3 will hybridize with the initiator sequence 1 or the initiator sequence 2 to form OTA-F / ZEN-H or AFB1-G / ZEN-H, which will cause the initiator sequence 1 or the initiator sequence 2 to be unable to trigger subsequent reactions, resulting in the "INHIBIT" logic function.

[0066] When the test sample does not contain ZEN, the initiator sequence 3 will not be generated. The initiator sequence 1 or the initiator sequence 2 (sequences ab1 and ab2 generated by OTA-F or AFB1-G) will initiate the initiator hairpin assembly mediated by the hairpin probes D and E, generating a large number of double-stranded DE complexes. The double-stranded DE complexes synergistically hybridize with the enzyme chain DNA1 and the substrate chain DNA2 to form a supramolecular complex [F / G / DNA1 / DNA2]n. When magnesium ions are present in the system, the magnesium ions will trigger the catalytic reaction of DNAzyme, that is, the supramolecular complex [F / G / DNA1 / DNA2]n will hydrolyze the substrate chain DNA2 to generate a fluorescent signal.

[0067] Therefore, for the "OR-INHIBIT" logic gate, its intelligent detection criteria for toxins are:

[0068] When strong fluorescence is detected, it indicates the presence of any of the following conditions (a) to (c) in the sample:

[0069] (a) The test sample only contains OTA;

[0070] (b) The test sample contained only AFB1;

[0071] (c) The test sample contains both OTA and AFB1 but no ZEN;

[0072] When no strong fluorescence is detected, it indicates that any of the following conditions (d) to (h) exist in the test sample:

[0073] (d) The tested samples did not contain mycotoxins (OTA, AFB1 and ZEN);

[0074] (e) The test sample contained only ZEN;

[0075] (f) The test sample contains both OTA and ZEN;

[0076] (g) The test sample contains both AFB1 and ZEN;

[0077] (h) The detected samples contained OTA, AFB1 and ZEN at the same time.

[0078] In some preferred embodiments of the present invention, the specific steps of the method for detecting mycotoxins are:

[0079] (1) The hairpin probe set (hairpin probe AE or DH) is heated to 95°C in Tris-HCl buffer (pH 8.0, 120 mM NaCl, 10 mM MgCl2, 5 mM KCl, 20 mM CaCl2) for 5 min, and then cooled to room temperature to obtain a hairpin probe set with a hairpin structure.

[0080] (2) Incubate the test sample, the hairpin probe set forming the hairpin structure, the enzyme chain and the substrate chain at 25±2° C. for 90 to 95 minutes, and detect the fluorescence signal.

[0081] The beneficial effects of the present invention are:

[0082] 1. The present invention provides a detection reagent and a detection kit for intelligent detection of fungal toxins, which can detect fungal toxins including OTA, AFB1 and ZEN. The detection kit is based on DNAzyme and logic gate driven by catalytic hairpin assembly, and can accurately and intelligently detect whether OTA, AFB1 and ZEN are contained in the sample to be tested, and has good specificity, and will not produce false positives for other fungal toxins and the like.

[0083] 2. The intelligent mycotoxin detection method of the present invention has high sensitivity, with a detection limit of up to 100pM, which is more sensitive and intelligent than conventional detection technologies. BRIEF DESCRIPTION OF THE DRAWINGS

[0084] Figure 1 Schematic diagram of the principle of an “OR-AND” logic gate in an embodiment of the present invention.

[0085] Figure 2 Schematic diagram of the principle of the "OR-INHIBIT" logic gate in an embodiment of the present invention.

[0086] Figure 3 This is the actual detection result of the “OR-AND” logic gate in the embodiment of the present invention.

[0087] Figure 4 This is the actual detection result of the “OR-INHIBIT” logic gate in the embodiment of the present invention. DETAILED DESCRIPTION

[0088] In order to make the invention purpose, technical solution and technical effect of the present invention clearer, the present invention is further described in detail below in conjunction with specific implementation methods. It should be understood that the specific implementation methods described in this specification are only for explaining the present invention, not for limiting the present invention.

[0089] Unless otherwise specified, the experimental materials and reagents used are consumables and reagents that can be obtained from conventional commercial channels.

[0090] Intelligent detection system of fungal toxins using molecular logic gates

[0091] In the present embodiment, the molecular logic gate intelligent detection system for detecting fungal toxins mainly constructs "OR-AND" and "OR-INHIBIT" molecular logic gates based on DNAzyme driven by catalytic hairpin assembly, thereby realizing rapid, highly sensitive and intelligent detection of various fungal toxins.

[0092] The molecular logic gate intelligent detection system for detecting fungal toxins in this embodiment mainly includes: a hairpin probe group (composed of 7 hairpin probes AH), an enzyme chain group (DNA1) and a substrate chain group (DNA2).

[0093] Among them, the hairpin probe group consists of 7 hairpin probes (hairpin probe A, hairpin probe B, hairpin probe C, hairpin probe D, hairpin probe E, hairpin probe F, hairpin probe G and hairpin probe H).

[0094] The nucleotide sequences of the above 7 hairpin probes are as follows:

[0095] Hairpin Probe A:

[0096] Hairpin probe B:

[0097] Hairpin Probe C:

[0098] Hairpin probe D: 5′-GGGGTGTGGGTGGCGTAAAGGGAGCCCATGTATCGAGCTCCCTTTACGCCTGTGT-3′ (SEQ ID NO. 4);

[0099] Hairpin probe E: 5′-TGTGTGTGTGTAAGGGAGCTCGATACATGGGCTCCCTTTACGCCCCATGTATCGA-3′ (SEQ ID NO. 5);

[0100] Hairpin Probe F:

[0101] Hairpin Probe G:

[0102] Hairpin probe H:

[0103] Among them, the bold and underlined parts in the 7 hairpin probes are the sequences of different nucleic acid aptamers.

[0104] The enzyme chain group consists of 1 enzyme chain (DNA1), and its nucleotide sequence is:

[0105] Enzyme chain DNA 1: 5'-ACACAGGCGTAGACTCCGAGCCGGACGAAGTTACCCACAACCC-3' (SEQ ID NO. 9).

[0106] The substrate chain group consists of 1 substrate chain (DNA2), and its nucleotide sequence is:

[0107] Substrate strand DNA 2: 5′-TCGATACATGGAACT(BHQ2)rAGGT(TAMRA)CACACACACACA-3′ (SEQ ID NO. 10).

[0108] Among them, in the substrate chain, T(BHQ2) is the quenching group BHQ2 modified on the T base; rA represents the modification of nucleic acid A, which is the enzyme cleavage site; T(TAMRA) is the fluorescent group TAMRA modified on the T base.

[0109] Method for using molecular logic gate intelligent detection system for fungal toxins

[0110] The molecular logic gate intelligent fungal toxin detection system in the above embodiment can detect samples based on two logic gates, "OR-AND" and "OR-INHIBIT". The specific detection steps are as follows:

[0111] (1) Preparation and pretreatment of test materials:

[0112] The hairpin probe set (hairpin probe AH) was heated to 95°C in Tris-HCl buffer (pH 8.0, 120 mM NaCl, 10 mM MgCl2, 5 mM KCl, 20 mM CaCl2) for 5 min, and then cooled to room temperature to obtain a hairpin probe set with a hairpin structure.

[0113] (2) Intelligent detection of mycotoxins:

[0114] In this embodiment, the intelligent detection of mycotoxins is implemented based on logic gates ("OR-AND" and "OR-INHIBIT").

[0115] The specific construction method of each logic gate is as follows:

[0116] (2.1) Use the "OR-AND" logic gate to test the test sample. The specific detection method is:

[0117] The test sample, the hairpin probe set, the enzyme chain set, and the substrate chain were incubated at room temperature (25±2°C) for 90 min (the reaction system is shown in Table 1), and the fluorescence signal at a wavelength of 585 nm was recorded. The fungal toxins in the sample were intelligently detected based on the fluorescence signal.

[0118] Table 1

[0119] Components Final content Test samples 10μL Hairpin Probe A 250nM Hairpin Probe B 250nM Hairpin Probe C 250nM Hairpin Probe D 250nM Hairpin Probe E 500nM Cas9 DNA1 250nM Substrate strand DNA2 250nM Magnesium ion (magnesium chloride) 10mM <![CDATA[ddH2O]]> Make up to 100 μL

[0120] The principle diagram of the "OR-AND" logic gate is as follows Figure 1 shown.

[0121] When the test sample contains ochratoxin A (OTA), the aptamer sequence in the hairpin probe A will bind to OTA and release the trigger sequence 1 (i.e. Figure 1 When the sample contains aflatoxin B1 (AFB1), the aptamer sequence in the hairpin probe B will bind to it and release the trigger sequence 2 (i.e. Figure 1 OTA performs an “OR” logic function with AFB1.

[0122] When the test sample contains zearalenone toxin (ZEN), the aptamer sequence in the hairpin probe C will bind to it and release the trigger sequence 3 (i.e. Figure 1The initiator sequence 3 hybridizes with the sequence s of any one of the initiator sequences 1 or 2 through the s* sequence to form OTA-A / ZEN-C or AFB1-B / ZEN-C, generating an "AND" logic function.

[0123] The sequence ab generated by OTA-A / ZEN-C or AFB1-B / ZEN-C will further initiate the hairpin assembly mediated by hairpin probes D and E, generating a large number of double-stranded DE complexes. The double-stranded DE complexes synergistically hybridize with enzyme chain DNA1 and substrate chain DNA2 to form a supramolecular complex [B / C / DNA1 / DNA2]n. When magnesium ions are present in the system, the supramolecular complex [B / C / DNA1 / DNA2]n will hydrolyze the substrate chain DNA2, resulting in the separation of the quenching group and the fluorescent group, generating a fluorescent signal.

[0124] Therefore, for the "OR-AND" logic gate, its intelligent detection criteria for toxins are:

[0125] When strong fluorescence is detected, it indicates the presence of any of the following conditions (a) to (c) in the sample:

[0126] (a) The test sample contains both OTA and ZEN;

[0127] (b) The test sample contains both AFB1 and ZEN;

[0128] (c) The detected samples contained OTA, AFB1 and ZEN at the same time.

[0129] When no strong fluorescence is detected, it indicates that any of the following conditions (d) to (h) exist in the test sample:

[0130] (d) The tested samples did not contain mycotoxins (OTA, AFB1 and ZEN);

[0131] (e) The test sample only contained OTA;

[0132] (f) The test sample contained only AFB1;

[0133] (g) The test sample contains only ZEN;

[0134] (h) The detected sample contains both OTA and AFB1 but no ZEN.

[0135] (2.2) Use the "OR-INHIBIT" logic gate to test the test sample. The specific detection method is:

[0136] The test sample, the hairpin probe group, the enzyme chain group, and the substrate chain group were incubated at room temperature (25±2°C) for 90 min (the reaction system is shown in Table 2), and the fluorescence signal at a wavelength of 585 nm was recorded. The fungal toxins in the sample were intelligently detected based on the fluorescence signal.

[0137] Table 2

[0138]

[0139]

[0140] The principle diagram of the "OR-INHIBIT" logic gate is as follows Figure 2 shown.

[0141] When the test sample contains OTA, the aptamer sequence of the hairpin probe F will bind to OTA and release the trigger sequence 1 (i.e. Figure 2 When the sample contains AFB1, the aptamer sequence in the hairpin probe G will bind to it and release the trigger sequence 2 (i.e. Figure 2 OTA performs an “OR” logic function with AFB1.

[0142] When the test sample contains ZEN, the aptamer sequence in the hairpin probe H will bind to it and release the trigger sequence 3 (i.e. Figure 2 The initiator sequence 3 will hybridize with the initiator sequence 1 or the initiator sequence 2 to form OTA-F / ZEN-H or AFB1-G / ZEN-H, which will cause the initiator sequence 1 or the initiator sequence 2 to be unable to trigger subsequent reactions, resulting in the "INHIBIT" logic function.

[0143] When the test sample does not contain ZEN, the initiator sequence 3 will not be generated. The initiator sequence 1 or the initiator sequence 2 (sequences ab1 and ab2 generated by OTA-F or AFB1-G) will initiate the initiator hairpin assembly mediated by the hairpin probes D and E, generating a large number of double-stranded DE complexes. The double-stranded DE complexes synergistically hybridize with the enzyme chain DNA1 and the substrate chain DNA2 to form a supramolecular complex [F / G / DNA1 / DNA2]n. When magnesium ions are present in the system, the magnesium ions will trigger the catalytic reaction of DNAzyme, that is, the supramolecular complex [F / G / DNA1 / DNA2]n will hydrolyze the substrate chain DNA2 to generate a fluorescent signal.

[0144] Therefore, for the "OR-AND" logic gate, its intelligent detection criteria for toxins are:

[0145] When strong fluorescence is detected, it indicates the presence of any of the following conditions (a) to (c) in the sample:

[0146] (a) The test sample only contains OTA;

[0147] (b) The test sample contained only AFB1;

[0148] (c) The test sample contains both OTA and AFB1 but no ZEN;

[0149] When no strong fluorescence is detected, it indicates that any of the following conditions (d) to (h) exist in the test sample:

[0150] (d) The tested samples did not contain mycotoxins (OTA, AFB1 and ZEN);

[0151] (e) The test sample contained only ZEN;

[0152] (f) The test sample contains both OTA and ZEN;

[0153] (g) The test sample contains both AFB1 and ZEN;

[0154] (h) The detected samples contained OTA, AFB1 and ZEN at the same time.

[0155] Combining the results of the "OR-AND" and "OR-INHIBIT" logic gates, we get:

[0156] When "OR-AND" detects strong fluorescence, but "OR-INHIBIT" does not detect strong fluorescence, it indicates that any of the conditions (a) to (c) exists in the test sample:

[0157] (a) The test sample contains both OTA and ZEN;

[0158] (b) The test sample contains both AFB1 and ZEN;

[0159] (c) The detected samples contained OTA, AFB1 and ZEN at the same time.

[0160] When “OR-AND” does not detect strong fluorescence, but “OR-INHIBIT” detects strong fluorescence, it indicates that any of the conditions (d) to (f) exists in the test sample:

[0161] (d) The test sample only contained OTA;

[0162] (e) The test sample contained only AFB1;

[0163] (f) The tested sample contained both OTA and AFB1 but no ZEN.

[0164] When “OR-AND” does not detect strong fluorescence, and “OR-INHIBIT” also does not detect strong fluorescence, it indicates that any of the conditions (g) to (h) exists in the test sample:

[0165] (g) The test sample contains only ZEN;

[0166] (h) The tested samples did not contain mycotoxins (OTA, AFB1 and ZEN).

[0167] When "OR-AND" detects strong fluorescence and "OR-INHIBIT" also detects strong fluorescence, retesting is required. Verification of the actual detection effect of the molecular logic gate intelligent detection system for mycotoxins

[0168] The inventors added different fungal toxin samples to test and verify the molecular logic gate detection system.

[0169] In this example, the mycotoxin samples were 10 nM OTA, AFB1 and ZEN, respectively.

[0170] According to the method for using the molecular logic gate intelligent fungal toxin detection system in the above embodiment, 10 nM OTA, AFB1 and ZEN were respectively used as samples for detection.

[0171] (1) Detection effect of performing “OR-AND” logic gate on samples:

[0172] According to the "OR-AND" logic gate detection system in the above embodiment, 10 nM OTA, AFB1 and ZEN were detected, and the detection wavelength was set to 585 nm.

[0173] The results are as follows Figure 3 And as shown in Table 3.

[0174] Table 3 shows different sample inputs and fluorescence output results, where 0 and 1 are both binary representations, 1 represents presence (based on different situations, it can represent addition or fluorescence), and 0 represents absence (based on different situations, it can represent no addition or no fluorescence). A represents OTA, B represents AFB1, and C represents ZEN.

[0175] Table 3

[0176]

[0177]

[0178] from Figure 3It can be found from Table 3 that, with a specific detection wavelength as the threshold (585nm), only the (1,0,1), (0,1,1) and (1,1,1) groups can show fluorescence signals. Corresponding to the results, it can be known that the following situations may exist in the test sample: (a) the test sample contains both OTA and ZEN; (b) the test sample contains both AFB1 and ZEN; (c) the test sample contains both OTA, AFB1 and ZEN. Corresponding to the actual delivery situation, it can be found that the detection method in the above embodiment is accurate.

[0179] (2) Detection effect of executing “OR-INHIBIT” logic gate on the sample:

[0180] The "OR-INHIBIT" logic gate detection system in the above embodiment was used to detect 10 nM OTA, AFB1 and ZEN, and the detection wavelength was set to 585 nm.

[0181] The results are as follows Figure 4 And as shown in Table 4.

[0182] Table 4 shows different sample inputs and fluorescence output results, where 0 and 1 are both binary representations, 1 represents presence (based on different situations, it can represent addition or fluorescence), and 0 represents absence (based on different situations, it can represent no addition or no fluorescence). A represents OTA, B represents AFB1, and C represents ZEN.

[0183] Table 4

[0184]

[0185] from Figure 4 It can be found from Table 4 that, with a specific detection wavelength as a threshold value (585nm), only the (1,0,0), (0,1,0) and (1,1,0) groups can show fluorescence signals. Corresponding to the results, it can be known that the following situations may exist in the test sample: (a) the test sample contains only OTA; (b) the test sample contains only AFB1; (c) the test sample contains both OTA and AFB1, and does not contain ZEN. Corresponding to the actual delivery situation, it can be found that the detection method in the above embodiment is accurate.

[0186] In order to further verify the effectiveness of the above method, the inventors added OTA, AFB1, and ZEN standard solutions into vegetable juice (the vegetables were bok choy purchased from a supermarket in Guangzhou, and the juice was squeezed using a blender, and the final concentrations of fungal toxins were 100 pM, 1 nM, and 10 nM), detected using the above method, and verified using LC-MC / MS.

[0187] The results are shown in Table 5.

[0188] Table 5

[0189] Mycotoxins concentration Fluorescence signal The method detection situation in the above embodiment LC-MC / MS detection value OTA 10nM have Checkout 9.97nM OTA 1nM have Checkout 0.98nM OTA 100pM have Checkout 99.1pM AFB1 10nM have Checkout 9.87nM AFB1 1nM have Checkout 0.92nM AFB1 100pM have Checkout 100.29pM ZEN 10nM have Checkout 10.01nM ZEN 1nM have Checkout 0.91nM ZEN 100pM have Checkout 99.85pM

[0190] In summary, the molecular logic gate detection system of the present invention is mainly used to analyze the presence of mycotoxins and viruses in agricultural products, so as to effectively determine the type and content of toxins in specific agricultural products. The minimum detection amount can reach 100pM to avoid harm to human health.

[0191] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention. SEQUENCE LISTING <110> Institute of Ecology, Environment and Soil, Guangdong Academy of Sciences <120> Mycotoxin detection method based on molecular logic gate and its application <130> <160> 10 <170> PatentIn version 3.5 <210> 1 <211> 58 <212> DNA <213> Artificial sequence <400> 1 gatcgggtgt gggtggcgta aagggagcat cggacagctc cctttacaaa aaaaaaaa 58 <210> 2 <211> 80 <212> DNA <213> Artificial sequence <400> 2 gttgggcacg tgttgtctct ctgtgtctcg tgcccttcgc taggcccaca gctcccttta 60 caaaaaaaaa aatgcccaac 80 <210> 3 <211> 68 <212> DNA <213> Artificial sequence <400> 3 tcatctatct atggtacatt actatctgta atgtgatatg tttttttttt gccacccaca 60 catagatg 68 <210> 4 <211> 55 <212> DNA <213> Artificial sequence <400> 4 ggggtgtggg tggcgtaaag ggagcccatg tatcgagctc cctttacgcc tgtgt 55 <210> 5 <211> 55 <212> DNA <213> Artificial sequence <400> 5 tgtgtgtgtg taagggagct cgatacatgg gctcccttta cgccccatgt atcga 55 <210> 6 <211> 58 <212> DNA <213> Artificial sequence <400> 6 gatcgggtgt gggtggcgta aagggagcat cggacagctc cctttacgcc acccacac 58 <210> 7 <211> 80 <212> DNA <213> Artificial sequence <400> 7 gttgggcacg tgttgtctct ctgtgtctcg tgcccttcgc taggcccaca gctcccttta 60 cgccacccac actgcccaac 80 <210> 8 <211> 71 <212> DNA <213> Artificial sequence <400> 8 tcatctatct atggtacatt actatctgta atgtgatatg gtgtgggtgg cgtaaaggga 60 gcatta ca t 71 <210> 9 <211> 43 <212> DNA <213> Artificial sequence <400> 9 acacaggcgt agactccgag ccggacgaag ttacccacac ccc 43 <210> 10 <211> 31 <212> DNA <213> Artificial sequence <400> 10 tcgatacatg gaactaggtc acacacacac a 31

Claims

1. A mycotoxin detection reagent, characterized in that: The reagent contains a hairpin probe set; The hairpin probe group includes hairpin probe A, hairpin probe B, hairpin probe C, hairpin probe D, hairpin probe E, hairpin probe F, hairpin probe G and hairpin probe H; The nucleotide sequences of the hairpin probes A to H are: Hairpin probe A: 5′-GATCGGGTGTGGGTGGCGTAAAGGGAGCATCGGACAGCTCCCTTTACAAAAAAAAAAA-3′; Hairpin probe B: 5′-GTTGGGCACGTGTTGTCTCTCTGTGTCTCGTGCCCTTCGCTAGGCCCACAGCTCCCTTTACAAAAAAAAAAATGCCCAAC-3′; Hairpin probe C: 5′- TCATCTATCTATGGTACATTACTATCTGTAATGTGATATGTTTTTTTTTTGCCACCCACACATAGATG-3′; Hairpin probe D: 5′-GGGGTGTGGGTGGCGTAAAGGGAGCCCATGTATCGAGCTCCCTTTACGCCTGTGT-3′; Hairpin probe E: 5′-TGTGTGTGTGTAAGGGAGCTCGATACATGGGCTCCCTTTACGCCCCATGTATCGA-3′; Hairpin probe F: 5′- GATCGGGTGTGGGTGGCGTAAAGGGAGCATCGGACAGCTCCCTTTACGCCACCCACAC-3′; Hairpin probe G: 5'-GTTGGGCACGTGTTGTCTCTCTGTGTCTCGTGCCCTTCGCTAGGCCCACAGCTCCCTTTACGCCACCCACACTGCCCAAC-3'; Hairpin probe H: 5′-TCATCTATCTATGGTACATTACTATCTGTAATGTGATATGGTGTGGGTGGCGTAAAGGGAGCATTACAGAT-3′.

2. The mycotoxin detection reagent according to claim 1, characterized in that: The mycotoxins include aflatoxin B1, ochratoxin A and zearalenone toxin.

3. A mycotoxin detection kit, characterized in that: The kit comprises the mycotoxin detection reagent, enzyme chain and substrate chain according to claim 1 or 2.

4. The mycotoxin detection kit according to claim 3, characterized in that: The nucleotide sequence of the enzyme chain is: Enzyme strand DNA1: 5'-ACACAGGCGTAGACTCCGAGCCGGACGAAGTTACCCACACCCC-'3.

5. The mycotoxin detection kit according to claim 3, characterized in that: The nucleotide sequence of the substrate strand is: Substrate strand DNA2: 5′-TCGATACATGGAACTrAGGTCACACACACACA-′3; Among them, rA represents nucleic acid A modification.

6. The mycotoxin detection kit according to claim 5, characterized in that: The substrate chain is modified with a fluorescent group and a quenching group, and the fluorescent group and the quenching group are respectively modified on the opposite sides of the enzyme cleavage site.

7. Use of the mycotoxin detection reagent according to any one of claims 1 to 2 or the mycotoxin detection kit according to any one of claims 3 to 6 in food safety detection.

Images