A surface plasmon-enhanced signal probe based on DNA origami nanoassembly and its preparation method and application

Abstract

The present invention belongs to the field of DNA nanotechnology and relates to a surface plasmon-enhanced signal probe constructed based on a DNA origami nanoassembly, and its preparation method and application. The probe includes a diamond-shaped DNA origami element and a silver-shell gold-core nanoparticle, wherein the surface of the silver-shell gold-core nanoparticle is modified with a 4-mercaptobenzoic acid signal molecule and thiol DNA; the diamond-shaped DNA origami element is composed of two triangular DNA origami units, and the silver-shell gold-core nanoparticle is fixed to the binding sites of the two triangular DNA origami units through base complementary pairing between the thiol DNA and the diamond-shaped DNA origami element. The present invention solves the problems of low assembly efficiency and poor stability of simultaneously labeling 4-mercaptobenzoic acid and thiol DNA on gold nanoparticles, enables functionalized metal nanoparticles to be more efficiently and orderly arranged on the DNA origami, and constructs a nano-optical material with high mechanical stability that enhances plasmon signals.

Description

Technical Field

[0001] The present invention belongs to the field of DNA nanotechnology, and specifically relates to a surface plasmon enhanced signal probe constructed based on a DNA origami nanoassembly, as well as a preparation method and application of the probe. Background Art

[0002] Surface enhanced Raman scattering (SERS) can perform highly sensitive structural detection of molecules, providing unique molecular fingerprints with sensitivity down to the single-molecule level. It boasts advantages such as rapidity, sensitivity, efficiency, resistance to photobleaching, low sample requirements, and the ability to simultaneously detect multiple components, offering broad application prospects in trace rapid detection. In recent years, the preparation of SERS substrates with high SERS effects, good stability, and reproducibility has become a research hotspot. Currently, SERS relies primarily on amplifying the electromagnetic field generated by localized surface plasmon resonance excitation on the surface of metal nanoparticles, primarily utilizing Au or Ag nanostructures. When two plasmonic metal nanoparticles approach each other, their surface plasmons couple at close range, generating a unique optical near-field effect. At this point, the electromagnetic field is concentrated in a very small, nanometer-sized volume, where the Raman signal is enhanced between the coupled nanostructures of the dimer nanoantenna, known as the SERS hotspot. Polymeric nanomaterials cannot precisely control nanogaps. The addressability of DNA molecules is similar to that of a test circuit board in electronics, where various components can be placed in predetermined locations. DNA origami technology can achieve precise control of the positioning accuracy of DNA self-assembled nanostructure components within 1 nm. Through special design, functionalized molecules or nanoparticles can be precisely positioned on the origami structure by coupling with DNA to construct a structurally controllable, highly efficient signal amplification probe, which will provide a detection technology with ultra-high sensitivity. Therefore, realizing multiple functionalizations on gold nanoparticles and improving their assembly efficiency and stability on DNA origami can greatly promote the utilization and development of DNA nanotechnology. Summary of the Invention

[0003] To address the aforementioned problems of the prior art, the present invention provides a surface plasmon-enhanced signal probe constructed based on DNA origami nanoassemblies, as well as its preparation method and application. This invention addresses the low assembly efficiency and poor stability issues associated with simultaneously labeling 4-mercaptobenzoic acid (4-MBA) and modified thiol DNA on gold nanoparticles. By enabling more efficient and orderly arrangement of functionalized metal nanoparticles on DNA origami, the invention creates a highly mechanically stable nano-optical material that enhances plasmon signals. This facilitates probe labeling and the generation of complex DNA origami assemblies for customized functional nano-optical assembly products.

[0004] The first aspect of the present invention provides a surface plasmon enhanced signal probe constructed based on a DNA origami nanoassembly, the probe comprising a rhombus-shaped DNA origami element and a silver-shell gold core nanoparticle, wherein the surface of the silver-shell gold core nanoparticle is modified with a 4-mercaptobenzoic acid (4-MBA) signal molecule and thiol DNA; the rhombus-shaped DNA origami element is composed of two triangular DNA origami units, and the silver-shell gold core nanoparticle is fixed to the binding sites of the two triangular DNA origami units through base complementary pairing of the thiol DNA with the rhombus-shaped DNA origami element.

[0005] The probe of the present invention uses 4-mercaptobenzoic acid (4-MBA) as a signal marker molecule and utilizes DNA origami self-assembly technology to orderly arrange metal nanoparticles in the symmetrical hollow positions of diamond origami, thereby achieving plasmon signal enhancement.

[0006] According to the present invention, preferably, the silver shell is a silver layer with a thickness of 2-3 nm deposited on the surface of the gold nanoparticles.

[0007] The present invention overcomes the difficulty that large-particle-size nano-gold has weak binding force but strong repulsive force, and the particle size of the gold nano-particles is preferably 50 nm.

[0008] According to the above principles of the present invention, a diamond-shaped DNA origami element can be constructed. Specifically, the diamond-shaped DNA origami element is formed by self-assembly of a triangular DNA origami unit A and a triangular DNA origami unit B.

[0009] Furthermore, the triangular DNA origami unit A is formed by annealing M13mp18 phage circular single-stranded DNA, a staple strand, a capture strand, and a first set of docking strands.

[0010] Furthermore, the triangular DNA origami unit B is formed by annealing M13mp18 phage circular single-stranded DNA, a staple strand, a capture strand, and a second set of docking strands.

[0011] According to the present invention, the M13mp18 phage circular single-stranded DNA is commercially available, and its specific sequence can be found in: Rothemund, P. Folding DNA to create nanoscale shapes and patterns. Nature 440, 297-302 (2006).

[0012] Preferably, the sequence of the staple chain is shown as SEQ ID NO: 1 to SEQ ID NO: 173.

[0013] Preferably, the sequence of the capture chain is shown in SEQ ID NO: 174 to SEQ ID NO: 191.

[0014] Preferably, the sequences of the first group of docking chains are shown as SEQ ID NO: 192 to SEQ ID NO: 201.

[0015] Preferably, the sequences of the second group of docking chains are shown as SEQ ID NO: 202 to SEQ ID NO: 211.

[0016] According to the present invention, in order to achieve good base complementary pairing, the sequence of the thiol DNA is as shown in SEQ ID NO: 212, wherein the thiol group is labeled at the 3' end.

[0017] 5'-TCGCAACGCTCGCTCATACTACACACCAAAGCATCCATCCTTCTTTTT-SH-3' (SEQ ID NO: 212)

[0018] Agarose gel electrophoresis and atomic force microscopy can be used to characterize the precise assembly of the probe structure of the present invention.

[0019] The present invention synthesizes a diamond-shaped DNA origami from two triangular DNA origami monomers through sticky end complementation. 36 capture chains extend from specific sites on the prepared diamond-shaped DNA origami, overcoming the difficulty of weak binding force and strong repulsion of large-particle gold nanoparticles. Gold nanoparticles or gold-silver core-shell nanoparticles modified with 4-MBA labeling molecules and thiol DNA are self-assembled into specific sites of the DNA origami according to the principle of base complementary pairing, constructing a nano-optical material with enhanced plasmon signals and high mechanical stability. Among them, the Au@4-MBA@Ag@DNA Origami assembly produces the strongest surface-enhanced Raman scattering signal.

[0020] The DNA origami self-assembled dimer metal particle nano signal amplification probe has a DNA origami structure composed of more than 200 DNA chains through folding and self-assembly techniques to form an organic nanostructure with a special geometric shape. DNA chains with special sequences extending from specific sites capture metal nanoparticles modified with thiol DNA.

[0021] The second aspect of the present invention provides a method for preparing the surface plasmon-enhanced signal probe constructed based on the DNA origami nanoassembly, comprising the following steps:

[0022] (1) Preparation of diamond-shaped DNA origami elements with specific recognition sites;

[0023] (2) Preparation of 4-mercaptobenzoic acid signal molecules and thiol DNA modified gold nanoparticles;

[0024] (3) depositing a silver layer on the surface of the modified gold nanoparticles obtained in step (2) to form gold-silver core-shell structure particles;

[0025] (4) The gold-silver core-shell structured particles obtained in step (3) are self-assembled with diamond-shaped DNA origami elements to construct a dimeric metal nanoparticle plasma, i.e., the surface plasmon enhanced signal probe constructed based on the DNA origami nanoassembly.

[0026] Furthermore, the diamond-shaped DNA origami element is prepared by splicing two triangular DNA origami by alternately extending (interchanging) sticky ends, comprising the following steps:

[0027] (1) Mix the M13mp18 phage circular single-stranded DNA, staple strand, capture strand, and the first set of docking strands, and add 1×TAE-Mg 2+ The buffer solution was shaken and the mixed solution was placed in a PCR instrument for annealing. After the reaction, the excess staple chains and by-products were removed by ultrafiltration to obtain the first triangular DNA origami.

[0028] (2) Mix the M13mp18 phage circular single-stranded DNA, staple strand, capture strand, and the second set of docking strands, and add 1×TAE-Mg 2+ Buffer solution was added and shaken to mix well. The mixed solution was placed in a PCR instrument for annealing. After the reaction, the excess staple chains and by-products were removed by ultrafiltration to obtain the second triangular DNA origami.

[0029] (3) The two triangular DNA origami were mixed in a molar ratio of 1:1 and 1×TAE-Mg was added. 2+ Buffer solution was added and shaken to mix well. The mixed solution was placed in a PCR instrument for annealing to synthesize diamond-shaped DNA origami.

[0030] Furthermore, the specific preparation process of triangular DNA origami is as follows: M13mp18 phage circular single-stranded DNA and primer chains, including staple chains, capture chains, and docking chains, are mixed at a molar concentration ratio of 1:10, and 1×TAE-Mg 2+ Buffer, the final volume is 100μL. Shake well and place the mixed solution in a PCR instrument for annealing. Set the instrument annealing program as follows: maintain at 95℃ for 5min to allow the formed secondary structure to fully melt. The annealing rate is 1℃ / 100s, and the reactants are annealed from 95℃ to 15℃. After the reaction is completed, ultrafiltration is used to remove excess staple chains and by-products, and the mixture is stored at 4℃ for use. The specific preparation process of diamond DNA origami is as follows: the concentration of the two triangular DNA origami is calculated according to the formula C=10.0A (nM), where A is the ultraviolet absorbance value of the triangular DNA origami at 260nm. The two triangular DNA origami are mixed at a molar concentration ratio of 1:1 (such as 10nM:10nM), and 1×TAE-Mg is added. 2+Buffer solution, final volume 100 μL. Shake thoroughly and place the mixed solution in a PCR instrument for annealing. Set the instrument annealing program to: 45°C for 5 min, annealing rate 0.1°C / 100 s, annealing the reactants from 45°C to 15°C, and store at 4°C until use.

[0031] Furthermore, the process of preparing 4-mercaptobenzoic acid signal molecules and thiol DNA modified gold nanoparticles includes:

[0032] (1) adding an appropriate amount of 4-mercaptobenzoic acid to the gold nanoparticle solution, shaking and incubating, adding dihydrated bis(p-sulfonylphenyl)phenylphosphine dipotassium salt to the incubated sample, continuing incubation, and centrifuging and washing with ultrapure water to remove excess signal molecules to obtain gold nanoparticles with surface modified 4-mercaptobenzoic acid signal molecules;

[0033] (2) Incubating gold nanoparticles with surface modified 4-mercaptobenzoic acid signal molecules with thiol DNA to obtain gold nanoparticles modified with 4-mercaptobenzoic acid signal molecules and thiol DNA.

[0034] Furthermore, the specific preparation process of the 4-mercaptobenzoic acid (4-MBA) signal molecule and thiol DNA modified gold nanoparticles is as follows:

[0035] An appropriate amount of 4-mercaptobenzoic acid (4-MBA) was added to 30 mL of the gold nanoparticle solution, shaken, and incubated for 12 hours. 9 mg of BSPP (bis(p-sulfonylphenyl)phenylphosphine) dihydrate, dipotassium salt, was added to the incubated sample and incubated for another 12 hours. The sample was then washed three times with ultrapure water to remove excess signal molecules, resulting in concentrated gold nanoparticles surface-modified with the 4-mercaptobenzoic acid (4-MBA) signal molecule. The pretreated thiol DNA and AuNP solution were mixed at a molar ratio of 5000:1, followed by the addition of 5 μL of 1% SDS and an appropriate amount of 0.5× TBE buffer. The solution was shaken and incubated for 8 hours. Afterward, NaCl solution was added four times to a final concentration of 300 mM. The sample was incubated at 37°C for another 8 hours. After three washes with centrifugation, the gold nanoparticles surface-modified with the 4-mercaptobenzoic acid (4-MBA) signal molecule and thiol DNA were obtained.

[0036] The thiol DNA pretreatment is preferably activated with 20 mM TCEP for 1 hour, and then desalted by filtering column G-25 (GE Healthcare, 27-5325-01).

[0037] Furthermore, a silver layer was deposited on the surface of the modified gold nanoparticles to form a gold-silver core-shell structure, which was obtained by reacting the modified gold nanoparticles with the Nanoprobes HQ Silver kit.

[0038] Furthermore, the specific preparation process of constructing dimeric metal nanoparticle plasma by self-assembly of gold-silver core-shell structure particles and diamond-shaped DNA origami is as follows:

[0039] The diamond-shaped DNA origami was uniformly mixed with 4-mercaptobenzoic acid (4-MBA) signal molecules and thiol-DNA modified gold and silver core-shell nanoparticles in 1×TAE-Mg 2+ The buffer solution was placed in a PCR instrument for annealing. The instrument annealing program was set as follows: 45°C for 5 minutes, an annealing rate of 0.1°C / 30 seconds, and the reactants were annealed from 45°C to 20°C. This was repeated three times to allow complete hybridization of the DNA origami and the metal nanoparticles. The samples were then stored at 4°C for later use.

[0040] Furthermore, the mixing molar ratio of the diamond-shaped DNA origami to the nano-metal particles modified with 4-mercaptobenzoic acid (4-MBA) signal molecules and thiol DNA is 1:2-4, preferably 1:3.

[0041] The surface plasmon enhanced signal probe constructed based on the DNA origami nanoassembly described in the present invention can be used as a plasma sensor in surface enhanced Raman scattering detection.

[0042] According to the present invention, a portable handheld Raman instrument can be used to detect surface-enhanced Raman scattering of plasmon-enhanced signal probes. Detecting surface-enhanced Raman scattering of metal nanoparticles self-assembled from DNA origami using the portable handheld Raman instrument revealed that the Raman signals, from strong to weak, were ranked as follows: Au@4-MBA@Ag@DNA origami assembly > Au@4-MBA@DNA origami assembly > Au@4-MBA. The nano-optical assembly constructed from metal nanoparticles positioned on the diamond-shaped DNA origami exhibited stronger resonant coupling, enhancing the plasmon signal. The Au@4-MBA@Ag@DNA origami assembly produced a stronger surface-enhanced Raman scattering signal than the Au@4-MBA@DNA origami assembly.

[0043] The advantages of the present invention are:

[0044] 1. 4-Mercaptobenzoic acid has a thiol group in its molecular structure and can be efficiently assembled onto the surface of gold nanoparticles. However, excessive 4-mercaptobenzoic acid will occupy more binding sites on the gold nanoparticle surface, thereby affecting the subsequent modification of thiol DNA. The BSPP introduced in the present invention can not only be used to phosphorylate gold nanoparticles, reserving some binding sites for thiol DNA, but also serve as a protective agent and dispersant to improve the stability of large-sized nanometal particles.

[0045] 2. The present invention overcomes the difficulty of weak binding force and strong repulsion force of large-particle gold nanoparticles. By designing a capture chain, the spatial addressability is used to efficiently and accurately assemble large-particle nanometal particles onto diamond-shaped DNA origami, forming an assembly of stable dimer metal particles and DNA origami with a specific configuration.

[0046] 3. The DNA origami-based self-assembled dimer metal particles of the present invention can significantly enhance plasmon signals, providing a good plasma sensor for surface-enhanced Raman scattering. This structure can be widely used as a signal amplification probe in the high-sensitivity detection of various targets.

[0047] Other features and advantages of the present invention will be described in detail in the following detailed description. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] The above and other objects, features and advantages of the present invention will become more apparent through a more detailed description of exemplary embodiments of the present invention with reference to the accompanying drawings.

[0049] Figure 1 Schematic diagram of the two-step synthesis of diamond-shaped DNA origami.

[0050] Figure 2 This is a transmission electron microscopy characterization of metal nanoparticles with a gold-silver core-shell structure and a silver layer with a thickness of 2-3nm.

[0051] Figure 3 Agarose gel electrophoresis characterization diagram for the separation and purification of Au@4-MBA@DNA Origami assembly structure.

[0052] Figure 4 This is the atomic force microscopy characterization image of the purified Au@4-MBA@DNA Origami assembly.

[0053] Figure 5 Surface enhanced Raman scattering (SERS) spectrum for detecting the assembly structure.

[0054] Figure 6 The metal nanoparticles at the same molar concentration are positioned on the diamond DNA origami before and after 1075 cm -1 Raman enhancement intensity curve at . DETAILED DESCRIPTION

[0055] The preferred embodiments of the present invention will be described in more detail below. Although the preferred embodiments of the present invention are described below, it should be understood that the present invention can be implemented in various forms and should not be limited by the embodiments set forth herein. In the examples, where specific conditions are not specified, all are carried out according to conventional conditions or the conditions recommended by the manufacturer. Reagents or instruments used where the manufacturer is not specified are conventional products that can be purchased commercially.

[0056] M13mp18 phage circular single-stranded DNA was purchased from NEB (Beijing) Co., Ltd. / New England Biolabs (Beijing) LTD.

[0057] The synthesis of other sequences was commissioned to Sangon Biotechnology (Shanghai) Co., Ltd.

[0058] Example 1: Preparation of diamond-shaped DNA origami with specific recognition sites

[0059] like Figure 1 As shown, a two-step method is used to synthesize diamond-shaped DNA origami. First, two triangular origami are synthesized. The specific steps are:

[0060] (1) M13mp18 phage circular single-stranded DNA and primer chain (including staple chain, capture chain, and docking chain mixed in an equimolar ratio, wherein the staple chain is an equimolar mixture of sequences shown in SEQ ID NO: 1 to SEQ ID NO: 173, the capture chain is an equimolar mixture of sequences shown in SEQ ID NO: 174 to SEQ ID NO: 191, and the docking chain is an equimolar mixture of sequences shown in SEQ ID NO: 192 to SEQ ID NO: 201 or an equimolar mixture of sequences shown in SEQ ID NO: 202 to SEQ ID NO: 211) are mixed at a molar concentration ratio of 1:10, and 1×TAE-Mg is added. 2+ The buffer solution was added to a final volume of 100 μL and shaken to obtain a concentration of 0.004 μM of M13mp18 phage circular single-stranded DNA.

[0061] (2) The mixed solution of step (1) was placed in a PCR instrument for annealing. The instrument annealing program was set as follows: 95°C for 5 min to allow the formed secondary structure to fully melt, and the annealing rate was 1°C / 100s to anneal the reactants from 95°C to 15°C.

[0062] The extended sequence of the docking chain in the primer chain is as follows:

[0063] 5'-GAAGGATGGATGCTTTGGTGTGTAGTATGAGCGAGCGTTGCGATTTT-3' (SEQ ID NO: 213)

[0064] (3) According to steps (1) and (2), two triangular origami samples were prepared respectively, and each was placed in a Millipore 400 μL / 100 kD ultrafiltration tube. The samples were centrifuged at 8000 r and 4 °C for 8 min. The filtrate was discarded after the centrifugation and filtered with 1×TAE-Mg 2+ The buffer solution (40 mM Tris, 20 mM glacial acetic acid, 2 mM EDTA and 12.5 mM magnesium acetate) was added to 400 μL and the excess primer chains were removed by repeated washing three times. For the last time, the inner tube of the ultrafiltration tube was inverted into the replaced outer tube, and the tube was centrifuged at 4000 r for 8 min. The filtrate was collected and stored at 4°C for later use.

[0065] (4) The concentrations of the two triangular DNA origami were calculated according to the formula C = 10.0A (nM), where A is the UV absorbance of the triangular DNA origami measured at 260 nm using a 50 μL ultra-micro cuvette. The molar ratio of the two triangular DNA origami mixtures was 1:1, i.e., (10 nM:10 nM), and 1×TAE-Mg was added. 2+ Buffer solution, final volume 100 μL. Shake thoroughly and place the mixed solution in a PCR instrument for annealing. Set the instrument annealing program to: 45°C for 5 min, annealing rate 0.1°C / 100 s, annealing the reactants from 45°C to 15°C, and store at 4°C until use.

[0066] Example 2: Preparation of 4-Mercaptobenzoic Acid (4-MBA) Signal Molecule and Thiol DNA-Modified Gold Nanoparticles

[0067] Gold nanoparticles with a particle size of 50 nm were synthesized by the gold seed growth method. The 4-mercaptobenzoic acid (4-MBA) signal molecule was first modified, and then thiol DNA was assembled using the traditional salt aging method to obtain gold nanoparticles with the surface modified with both 4-mercaptobenzoic acid (4-MBA) signal molecules and thiol DNA.

[0068] (1) Add 30 μL of 10 -2 M of 4-mercaptobenzoic acid (4-MBA) was added, shaken and incubated at 20°C and 300r for 12h. 9mg of BSPP, i.e., dihydrated bis(p-sulfonylphenyl)phenylphosphine dipotassium salt, was added to the incubated sample, and the incubation was continued at 20°C and 300r for 12h. After the reaction, the sample was centrifuged and washed three times with ultrapure water to remove excess signal molecules. The supernatant was removed by centrifugation at 8500r and the nanogold solution was concentrated to 200μL to obtain gold nanoparticles with surface modified 4-mercaptobenzoic acid (4-MBA) signal molecules.

[0069] (2) The pretreated thiol DNA (sequence shown in SEQ ID NO: 212, wherein the thiol group is labeled at the 3' end) was mixed with the AuNPs solution at a molar concentration ratio of 5000:1. 5 μL of 1% SDS and an appropriate amount of 0.5×TBE (89 mM Tris, 89 mM boric acid, 2 mM EDTA) buffer solution were added to a final volume of 180 μL. The mixture was shaken and incubated at 37°C, 300 rpm for 8 h. Then, 20 μL of 3 M NaCl solution was added to the sample in four portions, with 1 h intervals between each addition. 2 μL, 4 μL, 6 μL, and 8 μL of NaCl solution were added in sequence. The final concentration of the NaCl solution was 300 mM. The mixture was incubated at 37°C for another 8 h. After the reaction was completed, the mixture was centrifuged and washed three times with 0.5×TBE at 8500 r. The supernatant was discarded for the last time to obtain gold nanoparticles with surface modified 4-mercaptobenzoic acid (4-MBA) signal molecules and thiol DNA.

[0070] The specific operation of the thiol DNA pretreatment is to activate it with 20mM TCEP at 37°C and 300r for 1h, and then desalt it on a G-25 filtration column (GE Healthcare, 27-5325-01).

[0071] Example 3: Preparation of a gold-silver core-shell structure by depositing a 2-3 nm thick silver layer on the surface of gold nanoparticles

[0072] The gold nanoparticles surface-modified with 4-mercaptobenzoic acid (4-MBA) signal molecules and thiol DNA prepared in Example 2 were fixed to a volume of 200 μL, 2 nM. Under strict light protection conditions, two drops of reagent A, reagent B, and reagent C from the Nanoprobes HQ Silver kit were added sequentially. Each reagent was repeatedly mixed with the gold nanoparticles. After the addition of the three reagents, the mixture was allowed to stand for 20 minutes. After the reaction was completed, the mixture was centrifuged and washed three times with 0.5× TBE at 8500 r. to obtain gold-silver core-shell metal nanoparticles with a silver layer 2-3 nm thick, as shown in FIG. Figure 2 shown.

[0073] Example 4: Preparation of dimeric metal nanoparticle plasmas constructed by self-assembly of thiol-DNA-modified metal particles and diamond-shaped DNA origami

[0074] Diamond DNA origami, 4-mercaptobenzoic acid (4-MBA) signal molecules, and thiol DNA-modified gold nanoparticles or gold-silver core-shell nanoparticles were uniformly mixed in a 1×TAE-Mg 2+The final volume of the buffer solution was 100 μL. The mixed solution was annealed in a PCR instrument. The instrument annealing program was set as follows: 45°C for 5 minutes, with an annealing rate of 0.1°C / 30 seconds. The reaction mixture was annealed from 45°C to 20°C. This was repeated three times to ensure complete hybridization between the DNA origami and the metal nanoparticles. The mixture was then stored at 4°C until use.

[0075] Example 5: Characterization of precise structural assembly using agarose gel electrophoresis and atomic force microscopy

[0076] In order to fully combine the metal nanoparticles with the diamond-shaped DNA origami, the added metal nanoparticles are excessive. Moreover, during the long PCR annealing process, some diamond-shaped DNA origami will re-dissociate into triangular DNA origami. Therefore, agarose gel electrophoresis is required to separate and purify the Au@4-MBA@DNA Origami assembly and the Au@4-MBA@Ag@DNA Origami assembly. The specific operation is as follows:

[0077] (1) Use an electronic balance to take 0.5g of agarose and place it in a conical flask. Add 100mL of 0.5×TBE solution, shake well, and heat it twice in a microwave oven until the agarose is completely dissolved. Then, place the gel caster, insert the baffle, and slowly pour the agarose solution into the gel tank. Place a comb in a fixed place, skim off the bubbles, and make two gel plates. Let it stand at room temperature for forty minutes. After the gel cools and solidifies, remove the baffle and place the gel plate in a horizontal electrophoresis tank containing 0.5×TBE buffer. 20μL of Au@4-MBA, Au@4-MBA-DNA, and Au@4-MBA@DNA Origami assemblies are mixed with 4μL of 60% sucrose solution, and 20μL is injected into the gel well. Au@4-MBA and Au@4-MBA-DNA are used as blank controls to determine the target bands. Set the voltage to 100V and perform electrophoresis for 60 minutes under ice bath conditions. After the electrophoresis is completed, remove the gel, take a picture, and save it. Figure 3 The target band Au@4-MBA@DNA Origami assembly was cut out, the assembly band was cut into gel, and the recovered gel block was placed on a clean sealing film. The sealing film was folded, and the assembly solution was squeezed out with a glass slide. The recovered gel block was stored at 4°C for later use.

[0078] (2) Take 10 μL of the purified and recovered sample and drop it onto a newly peeled mica sheet. After settling for 10 minutes, rinse it twice with 200 μL of deionized water to prevent the buffer solution in the sample from crystallizing and affecting the characterization results. Then, blow it dry quickly with nitrogen gas and then use atomic force microscopy to characterize and image it. Figure 4 shown.

[0079] Example 6: Portable Handheld Raman Analyzer for Detecting Plasmon Surface Enhanced Raman Scattering

[0080] (1) The purified and recovered Au@4-MBA@DNA Origami assemblies and Au@4-MBA@Ag@DNA Origami assemblies were fixed to 0.3 nM with 0.5×TBE. The portable handheld Raman spectroscopy was used to detect 100 μL of 0.5×TBE, 10 -5 Spectral data for 0.3 nM Au@4-MBA, 0.3 nM Au@4-MBA nanoparticles, 0.3 nM Au@4-MBA@DNA origami assembly, and 0.3 nM Au@4-MBA@Ag@DNA origami assembly. Using a Raman excitation wavelength of 785 nm, 50% excitation power, and 3 s integration time, three replicates were performed for each sample, and the average was taken. The surface-enhanced Raman scattering (SERS) spectral data for the resulting assembly structures are shown in Figure 2. Figure 5 shown.

[0081] (2) The collected Raman spectrum showed that the signal molecule of 4-mercaptobenzoic acid (4-MBA) was at 1075 cm -1 、1585cm -1 There are two characteristic peaks at the Raman shift of Au@4-MBA nanoparticles, Au@4-MBA@DNA Origami assembly, and Au@4-MBA@Ag@DNA Origami assembly at 1075 cm -1 The Raman signal intensity at the position is statistically analyzed. The Raman intensities of the three structures are as follows: Figure 6 As shown, the values ​​are 3212 A.U., 6475 A.U., and 10343 A.U., respectively, increasing in order. It can be concluded that the order of Raman signals from surface-enhanced Raman scattering (SERS) of metal nanoparticles assembled from DNA origami is as follows: Au@4-MBA@Ag@DNA Origami assembly > Au@4-MBA@DNA Origami assembly > Au@4-MBA. Nano-optical assemblies constructed from metal nanoparticles positioned on diamond-shaped DNA origami exhibit stronger resonant coupling, enhancing the plasmon signal. The Au@4-MBA@Ag@DNA Origami assembly, with its 2-3 nm thick silver coating on the gold nanoparticles, has a smaller gap between the dimer metal particles. Furthermore, the rough silver shell facilitates the generation of a stronger coupling electric field, resulting in a stronger SERS signal than the Au@4-MBA@DNA Origami assembly.

[0082] The present invention provides a good plasma sensor for surface enhanced Raman scattering. This structure can be widely used as a signal amplification probe in the high-sensitivity detection of various targets and as an effective method for the application of DNA nanotechnology.

[0083] While various embodiments of the present invention have been described above, the above description is intended to be illustrative, not exhaustive, and not limited to the disclosed embodiments. Many modifications and variations will be apparent to those skilled in the art without departing from the scope and spirit of the described embodiments. Sequence Listing <110> Institute of Environmental Medicine and Occupational Medicine, Academy of Military Medical Sciences, Academy of Military Sciences <120> A surface plasmon-enhanced signal probe based on DNA origami nanoassembly and its preparation method and application <130> 2200001 <160> 213 <170> SIPOSequenceListing 1.0 <210> 1 <211> 32 <212> DNA <213> Artificial Sequence <400> 1 agcgtcatgt ctctgaattt accgactacc tt 32 <210> 2 <211> 32 <212> DNA <213> Artificial Sequence <400> 2 ttcataatcc ccttattagc gtttttctta cc 32 <210> 3 <211> 32 <212> DNA <213> Artificial Sequence <400> 3 atggtttatg tcacaatcaa tagatattaa ac 32 <210> 4 <211> 40 <212> DNA <213> Artificial Sequence <400> 4 tttgatgatt aagaggctga gacttgctca gtaccaggcg 40 <210> 5 <211> 32 <212> DNA <213> Artificial Sequence <400> 5 ccggaaccca gaatggaaag cgcaacatgg ct 32 <210> 6 <211> 32 <212> DNA <213> Artificial Sequence <400> 6 aaagacaaca ttttcggtca tagccaaaat ca 32 <210> 7 <211> 32 <212> DNA <213> Artificial Sequence <400> 7 tgtactggaa atcctcatta aagcagagcc ac 32 <210> 8 <211> 32 <212> DNA <213> Artificial Sequence <400> 8 caccggaaag cgcgttttca tcggaagggc ga 32 <210> 9 <211> 40 <212> DNA <213> Artificial Sequence <400> 9 tttaacggtt cggaacctat tattagggtt gatataagta 40 <210> 10 <211> 32 <212> DNA <213> Artificial Sequence <400> 10 ctcagagcat attcacaaac aaattaataa gt 32 <210> 11 <211> 32 <212> DNA <213> Artificial Sequence <400> 11 ggagggaatt tagcgtcaga ctgtccgcct cc 32 <210> 12 <211> 40 <212> DNA <213> Artificial Sequence <400> 12 gtcagagggt aattgatggc aacatataaa agcgattgag 40 <210> 13 <211> 32 <212> DNA <213> Artificial Sequence <400> 13 ccttgagtca gacgattggc cttgcgccac cc 32 <210> 14 <211> 32 <212> DNA <213> Artificial Sequence <400> 14 tcagaaccca gaatcaagtt tgccggtaaa ta 32 <210> 15 <211> 40 <212> DNA <213> Artificial Sequence <400> 15 ttgacggaa tacatacata aagggcgcta atatcagaga <210> 16 <211> 35 <212> DNA <213> Artificial Sequence <400> 16 cagagccagg aggttgaggc aggtaacagt gcccg <210> 17 <211> 32 <212> DNA <213> Artificial Sequence <400> 17 attack gtaatcagta gcgagccacc ct <210> 18 <211> 24 <212> DNA <213> Artificial Sequence <400> 18 gccgccagca ttgacaccac cctc <210> 19 <211> 32 <212> DNA <213> Artificial Sequence <400> 19 stirring catcgatagc stirring at <210> 20 <211> 35 <212> DNA <213> Artificial Sequence <400> 20 agccatttaa acgtcacca tgaacaccag aacca <210> 21 <211> 40 <212> DNA <213> Artificial Sequence <400> twenty one ataagagcaa gaaacatggc atgattaaga ctccgacttg 40 <210> twenty two <211> twenty four <212> DNA <213> Artificial Sequence <400> twenty two ccattagcaa ggccggggga atta 24 <210> twenty three <211> 40 <212> DNA <213> Artificial Sequence <400> twenty three gagccagcga atacccaaaa gaacatgaaa tagcaatagc 40 <210> twenty four <211> 43 <212> DNA <213> Artificial Sequence <400> twenty four cagaaggaaa ccgaggtttt taagaaaagt aagcagatag ccg 43 <210> 25 <211> 32 <212> DNA <213> Artificial Sequence <400> 25 tttaacctat cataggtctg agagttccag ta 32 <210> 26 <211> 32 <212> DNA <213> Artificial Sequence <400> 26 agtataaaat atgcgttata caaagccatc tt 32 <210> 27 <211> 32 <212> DNA <213> Artificial Sequence <400> 27 caagtacctc attccaagaa cgggaaattc at 32 <210> 28 <211> 32 <212> DNA <213> Artificial Sequence <400> 28 agagaataac ataaaaacag ggaagcgcat ta 32 <210> 29 <211> 40 <212> DNA <213> Artificial Sequence <400> 29 aaaacaaaat taattaaatg gaaacagtac attagtgaat 40 <210> 30 <211> 32 <212> DNA <213> Artificial Sequence <400> 30 ttatcaaacc ggcttaggtt gggtaagcct gt 32 <210> 31 <211> 32 <212> DNA <213> Artificial Sequence <400> 31 ttagtatcgc caacgctcaa cagtcggctg tc 32 <210> 32 <211> 40 <212> DNA <213> Artificial Sequence <400> 32 agagtcaaaa atcaatatat gtgatgaaac aaacatcaag 40 <210> 33 <211> 32 <212> DNA <213> Artificial Sequence <400> 33 actagaaata tataactata tgtacgctga ga 32 <210> 34 <211> 32 <212> DNA <213> Artificial Sequence <400> 34 tcaataatag ggcttaattg agaatcataa tt 32 <210> 35 <211> 32 <212> DNA <213> Artificial Sequence <400> 35 gattaagaaa tgctgatgca aatcagaata aa 32 <210> 36 <211> 32 <212> DNA <213> Artificial Sequence <400> 36 caccggaatc gccatattta acaaaattta cg 32 <210> 37 <211> 40 <212> DNA <213> Artificial Sequence <400> 37 agcatgtatt tcatcgtagg aatcaaacga ttttttgttt 40 <210> 38 <211> 40 <212> DNA <213> Artificial Sequence <400> 38 acatagcgct gtaaatcgtc gctattcatt tcaattacct 40 <210> 39 <211> 32 <212> DNA <213> Artificial Sequence <400> 39 gttaaataca atcgcaagac aaagccttga aa 32 <210> 40 <211> 32 <212> DNA <213> Artificial Sequence <400> 40 cccatcctcg ccaacatgta atttaataag gc 32 <210> 41 <211> 40 <212> DNA <213> Artificial Sequence <400> 41 tcccaatcca aataagatta ccgcgcccaa taaataatat 40 <210> 42 <211> 35 <212> DNA <213> Artificial Sequence <400> 42 tcccttagaa taacgcgaga aaacttttac cgacc 35 <210> 43 <211> 32 <212> DNA <213> Artificial Sequence <400> 43 gtgtgataag gcagaggcat tttcagtcctga 32 <210> 44 <211> twenty four <212> DNA <213> Artificial Sequence <400> 44 gtttgaaatt caaatatatt ttag 24 <210> 45 <211> 32 <212> DNA <213> Artificial Sequence <400> 45 aatagataga gccagtaata agagatttaa tg 32 <210> 46 <211> 35 <212> DNA <213> Artificial Sequence <400> 46 ttctgaccta aaatataaag taccgactgc agaac 35 <210> 47 <211> 40 <212> DNA <213> Artificial Sequence <400> 47 gcgcctgtta ttctaagaac gcgattccag agcctaattt 40 <210> 48 <211> twenty four <212> DNA <213> Artificial Sequence <400> 48 tcagctaaaa aaggtaaagt aatt 24 <210> 49 <211> 40 <212> DNA <213> Artificial Sequence <400> 49 acgctaacga gcgtctggcg ttttagcgaa cccaacatgt 40 <210> 50 <211> 43 <212> DNA <213> Artificial Sequence <400> 50 tgctattttg cacccagcta caattttgtt ttgaagcctt aaa 43 <210> 51 <211> 32 <212> DNA <213> Artificial Sequence <400> 51 gtgagaaaat gtgtaggtaa agatacaact tt 32 <210> 52 <211> 32 <212> DNA <213> Artificial Sequence <400> 52 ggcatcaaat ttggggcgcg agctagttaa ag 32 <210> 53 <211> 32 <212> DNA <213> Artificial Sequence <400> 53 ttcgagctaa gacttcaaat atcgggaacg ag 32 <210> 54 <211> 40 <212> DNA <213> Artificial Sequence <400> 54 acagtcaaag agaatcgatg aacgaccccg gttgataatc 40 <210> 55 <211> 32 <212> DNA <213> Artificial Sequence <400> 55 atagtagtat gcaatgcctg agtaggccgg ag 32 <210> 56 <211> 32 <212> DNA <213> Artificial Sequence <400> 56 aaccagacgtttagctatattttcttctac ta 32 <210> 57 <211> 40 <212> DNA <213> Artificial Sequence <400> 57 gaataccaca ttcaacttaa gaggaagccc gatcaaagcg 40 <210> 58 <211> 32 <212> DNA <213> Artificial Sequence <400> 58 caatatgacc ctcatatatt ttaaagcatt aa 32 <210> 59 <211> 32 <212> DNA <213> Artificial Sequence <400> 59 catccaataa atggtcaata acctcggaag ca 32 <210> 60 <211> 40 <212> DNA <213> Artificial Sequence <400> 60 aactccaaga ttgcatcaaa aagataatgc agatacataa 40 <210> 61 <211> 40 <212> DNA <213> Artificial Sequence <400> 61 cgttctagtc aggtcattgc ctgacaggaa gattgtataa 40 <210> 62 <211> 32 <212> DNA <213> Artificial Sequence <400> 62 caggcaagat aaaaattttt agaatattca ac 32 <210> 63 <211> 32 <212> DNA <213> Artificial Sequence <400> 63 gattagagat tagatacatt tcgcaaatca ta 32 <210> 64 <211> 40 <212> DNA <213> Artificial Sequence <400> 64 cgccaaaagg aattacagtc agaagcaaag cgcaggtcag 40 <210> 65 <211> 32 <212> DNA <213> Artificial Sequence <400> 65 ttaatgcctt atttcaacgc aagggcaaag aa 32 <210> 66 <211> 32 <212> DNA <213> Artificial Sequence <400> 66 ttagcaaata gatttagttt gaccagtacc tt 32 <210> 67 <211> 40 <212> DNA <213> Artificial Sequence <400> 67 taattgcttt accctgacta ttatgaggca tagtaagagc 40 <210> 68 <211> 35 <212> DNA <213> Artificial Sequence <400> 68 ataaagcctt tgcgggagaa gcctggagag ggtag 35 <210> 69 <211> 32 <212> DNA <213> Artificial Sequence <400> 69 taagaggtca attctgcgaa cgagattaag ca 32 <210> 70 <211> 40 <212> DNA <213> Artificial Sequence <400> 70 aacactatca taacccatca aaaatcaggtctccttttga 40 <210> 71 <211> twenty four <212> DNA <213> Artificial Sequence <400> 71 atgaccctgt aatacttcag agca 24 <210> 72 <211> 32 <212> DNA <213> Artificial Sequence <400> 72 taaagctata taacagttga ttcccatttt tg 32 <210> 73 <211> 40 <212> DNA <213> Artificial Sequence <400> 73 cggatggcac gagaatgacc ataatcgttt accagacgac 40 <210> 74 <211> 35 <212> DNA <213> Artificial Sequence <400> 74 taattgcttg gaagtttcat tccaaatcgg ttgta 35 <210> 75 <211> 40 <212> DNA <213> Artificial Sequence <400> 75 gataaaaacc aaaatattaa acagttcaga aattagagct 40 <210> 76 <211> twenty four <212> DNA <213> Artificial Sequence <400> 76 actaaagtac ggtgtcgaat ataa 24 <210> 77 <211> 40 <212> DNA <213> Artificial Sequence <400> 77 tgctgtagatccccctcaaa tgctgcgaga ggcttttgca 40 <210> 78 <211> 43 <212> DNA <213> Artificial Sequence <400> 78 aaagaagttt tgccagcata aatattcatt gactcaacat gtt 43 <210> 79 <211> 45 <212> DNA <213> Artificial Sequence <400> 79 aatactgcgg aatcgtaggg ggtaatagta aaatgtttag actcg 45 <210> 80 <211> 32 <212> DNA <213> Artificial Sequence <400> 80 caacagttta tgggattttg ctaatcaaaa gg 32 <210> 81 <211> 32 <212> DNA <213> Artificial Sequence <400> 81 gccgctttgc tgaggcttgc aggggaaaag gt 32 <210> 82 <211> 32 <212> DNA <213> Artificial Sequence <400> 82 gcgcagactc catgttactt agcccgtttt aa 32 <210> 83 <211> 32 <212> DNA <213> Artificial Sequence <400> 83 acaggtagaa agattcatca gttgagattt ag 32 <210> 84 <211> 40 <212> DNA <213> Artificial Sequence <400> 84 cctcagaacc gccacccaag cccaatagga acgtaaatga 40 <210> 85 <211> 32 <212> DNA <213> Artificial Sequence <400> 85 attttctgtc agcggagtga gaataccgat at 32 <210> 86 <211> 32 <212> DNA <213> Artificial Sequence <400> 86 attcggtctg cgggatcgtc acccgaaatc cg 32 <210> 87 <211> 40 <212> DNA <213> Artificial Sequence <400> 87 cgacctgcgg tcaatcataa gggaacggaa caacattatt 40 <210> 88 <211> 40 <212> DNA <213> Artificial Sequence <400> 88 agacgttacc atgtaccgta acacccctca gaaccgccac 40 <210> 89 <211> 32 <212> DNA <213> Artificial Sequence <400> 89 cacgcataag aaaggaacaa ctaagtcttt cc 32 <210> 90 <211> 32 <212> DNA <213> Artificial Sequence <400> 90 attgtgtctc agcagcgaaa gacaccatcg cc 32 <210> 91 <211> 40 <212> DNA <213> Artificial Sequence <400> 91 ttaataaaac gaactaaccg aactgaccaa ctcctgataa 40 <210> 92 <211> 32 <212> DNA <213> Artificial Sequence <400> 92 gttttgtcag gaattgcgaa taatccgaca at 32 <210> 93 <211> 32 <212> DNA <213> Artificial Sequence <400> 93 gacaacaagc atcggaacga gggtgagatt tg 32 <210> 94 <211> 40 <212> DNA <213> Artificial Sequence <400> 94 tatcatcgtt gaaagaggac agatggaaga aaaatctacg 40 <210> 95 <211> 40 <212> DNA <213> Artificial Sequence <400> 95 agcgtaacta caaactacaa cgcctatcac cgtactcagg 40 <210> 96 <211> 32 <212> DNA <213> Artificial Sequence <400> 96 tagttgcgaa ttttttcacg ttgatcatag tt 32 <210> 97 <211> 32 <212> DNA <213> Artificial Sequence <400> 97 gtacaacgag caacggctac agaggatacc ga 32 <210> 98 <211> 40 <212> DNA <213> Artificial Sequence <400> 98 accagtcagg acgttggaac ggtgtacaga ccgaaacaaa 40 <210> 99 <211> 35 <212> DNA <213> Artificial Sequence <400> 99 acagacagcc caaatctcca aaaaaaaatt tctta 35 <210> 100 <211> 32 <212> DNA <213> Artificial Sequence <400> 100 aacagcttgc tttgaggact aaagcgatta ta 32 <210> 101 <211> 40 <212> DNA <213> Artificial Sequence <400> 101 ccaagcgcag gcgcataggc tggcagaact ggctcattat 40 <210> 102 <211> twenty four <212> DNA <213> Artificial Sequence <400> 102 cgaggtgagg ctccaaaagg agcc 24 <210> 103 <211> 32 <212> DNA <213> Artificial Sequence <400> 103 acccccagac tttttcatga ggaacttgct tt 32 <210> 104 <211> 40 <212> DNA <213> Artificial Sequence <400> 104 accttatgcg attttatgac cttcatcaag agcatctttg 40 <210> 105 <211> 35 <212> DNA <213> Artificial Sequence <400> 105 cggtttatca ggtttccatt aaacgggaat acact 35 <210> 106 <211> 40 <212> DNA <213> Artificial Sequence <400> 106 aaaacactta atcttgacaa gaacttaatc attgtgaatt 40 <210> 107 <211> twenty four <212> DNA <213> Artificial Sequence <400> 107 ggcaaaagta aaatacgtaa tgcc 24 <210> 108 <211> 40 <212> DNA <213> Artificial Sequence <400> 108 tggtttaatt tcaactcgga tattcattacccacgaaaga 40 <210> 109 <211> 43 <212> DNA <213> Artificial Sequence <400> 109 accaacctaa aaaatcaacg taacaaataa attgggcttg aga 43 <210> 110 <211> 43 <212> DNA <213> Artificial Sequence <400> 110 cctgacgaga aacaccagaa cgagtaggct gctcattcag tga 43 <210> 111 <211> 32 <212> DNA <213> Artificial Sequence <400> 111 cctgattaaa ggagcggaat tatctcggcc tc 32 <210> 112 <211> 32 <212> DNA <213> Artificial Sequence <400> 112 gcaaatcacc tcaatcaata tctgcaggtc ga 32 <210> 113 <211> 32 <212> DNA <213> Artificial Sequence <400> 113 cgaccagtac attggcagat tcacctgatt gc 32 <210> 114 <211> 40 <212> DNA <213> Artificial Sequence <400> 114 tggcaatttt taacgtcaga tgaaaacaat aacggattcg 40 <210> 115 <211> 32 <212> DNA <213> Artificial Sequence <400> 115 aaggaattac aaagaaacca ccagtcagat ga 32 <210> 116 <211> 32 <212> DNA <213> Artificial Sequence <400> 116 ggacattcac ctcaaatatc aaacacagtt ga 32 <210> 117 <211> 32 <212> DNA <213> Artificial Sequence <400> 117 taatcctgat tatcattttg cggagaggaa gg 32 <210> 118 <211> 32 <212> DNA <213> Artificial Sequence <400> 118 ttatctaaag catcaccttg ctgatggcca ac 32 <210> 119 <211> 40 <212> DNA <213> Artificial Sequence <400> 119 gattatacac agaaataaag aaataccaag ttacaaaatc 40 <210> 120 <211> 32 <212> DNA <213> Artificial Sequence <400> 120 taggagcata aaagtttgag taacattgtt tg 32 <210> 121 <211> 32 <212> DNA <213> Artificial Sequence <400> 121 tgacctgaca aatgaaaaat ctaaaatatc tt 32 <210> 122 <211> 40 <212> DNA <213> Artificial Sequence <400> 122 agaatcagag cgggagatgg aaatacctac ataacccttc 40 <210> 123 <211> 32 <212> DNA <213> Artificial Sequence <400> 123 aatggaagcg aacgttatta atttctaaca ac 32 <210> 124 <211> 32 <212> DNA <213> Artificial Sequence <400> 124 taatagatcg ctgagagcca gcagaagcgt aa 32 <210> 125 <211> 40 <212> DNA <213> Artificial Sequence <400> 125 gaatacgtaa caggaaaaac gctcctaaac aggaggccga 40 <210> 126 <211> 35 <212> DNA <213> Artificial Sequence <400> 126 tcaatagata ttaaatcctt tgccggttag aacct 35 <210> 127 <211> 32 <212> DNA <213> Artificial Sequence <400> 127 caatatttgc ctgcaacagt gccatagagc cg 32 <210> 128 <211> twenty four <212> DNA <213> Artificial Sequence <400> 128 acaattcgac aactcgtaat acat 24 <210> 129 <211> 32 <212> DNA <213> Artificial Sequence <400> 129 ttgaggatgg tcagtattaa caccttgaat gg 32 <210> 130 <211> 35 <212> DNA <213> Artificial Sequence <400> 130 cgcgaactaa aacagaggtg aggcttagaa gtatt 35 <210> 131 <211> 40 <212> DNA <213> Artificial Sequence <400> 131 gaatcctgag aagtgtatcg gccttgctgg tactttaatg 40 <210> 132 <211> twenty four <212> DNA <213> Artificial Sequence <400> 132 accaccagca gaagatgata gccc 24 <210> 133 <211> 40 <212> DNA <213> Artificial Sequence <400> 133 taaaacatta gaagaactca aactttttat aatcagtgag 40 <210> 134 <211> 43 <212> DNA <213> Artificial Sequence <400> 134 tctttgatta gtaatagtct gtccatcacg caaattaacc gtt 43 <210> 135 <211> 32 <212> DNA <213> Artificial Sequence <400> 135 aggaagatgg ggacgacgac agtaatcata tt 32 <210> 136 <211> 32 <212> DNA <213> Artificial Sequence <400> 136 ctctagagca agcttgcatg cctggtcagt tg 32 <210> 137 <211> 32 <212> DNA <213> Artificial Sequence <400> 137 ccttcaccgt gagacgggca acagcagtca ca 32 <210> 138 <211> 32 <212> DNA <213> Artificial Sequence <400> 138 cgagaaagga agggaagcgt actatggttg ct 32 <210> 139 <211> 40 <212> DNA <213> Artificial Sequence <400> 139 gctcattttt taaccagcct tcctgtagcc aggcatctgc 40 <210> 140 <211> 32 <212> DNA <213> Artificial Sequence <400> 140 cagtttgacg cactccagcc agctaaacga cg 32 <210> 141 <211> 32 <212> DNA <213> Artificial Sequence <400> 141 gccagtgcga tccccgggta ccgagttttt ct 32 <210> 142 <211> 40 <212> DNA <213> Artificial Sequence <400> 142 gtaaccgtct ttcatcaaca ttaaaatttt tgttaaatca 40 <210> 143 <211> 32 <212> DNA <213> Artificial Sequence <400> 143 acgttgtatt ccggcaccgc ttctggcgca tc 32 <210> 144 <211> 32 <212> DNA <213> Artificial Sequence <400> 144 ccagggtggc tcgaattcgt aatccagtca cg 32 <210> 145 <211> 32 <212> DNA <213> Artificial Sequence <400> 145 tgtagatggg tgccggaaac caggaacgcc ag 32 <210> 146 <211> 32 <212> DNA <213> Artificial Sequence <400> 146 ggttttccat ggtcatagct gtttgagagg cg 32 <210> 147 <211> 40 <212> DNA <213> Artificial Sequence <400> 147 gtttgcgtca cgctggtttg ccccaaggga gcccccgatt 40 <210> 148 <211> 40 <212> DNA <213> Artificial Sequence <400> 148 ggataggtac ccgtcggatt ctcctaaacg ttaatatttt 40 <210> 149 <211> 32 <212> DNA<​​​​​​​​​​​​​​​​​​​​<211> 40 <212> DNA <213> Artificial Sequence <400> 151 ctaaatcgga accctaagca ggcgaaaatc cttcggccaa 40 <210> 152 <211> 35 <212> DNA <213> Artificial Sequence <400> 152 cggcggattg aattcaggct gcgcaacggg ggatg 35 <210> 153 <211> 32 <212> DNA <213> Artificial Sequence <400> 153 tgctgcaaat ccgctcacaa ttcccagctg ca 32 <210> 154 <211> twenty four <212> DNA <213> Artificial Sequence <400> 154 tggcgaaatg ttgggaaggg cgat 24 <210> 155 <211> 32 <212> DNA <213> Artificial Sequence <400> 155 tgtcgtgcac acaacatacg agccacgcca gc 32 <210> 156 <211> 35 <212> DNA <213> Artificial Sequence <400> 156 tcttcgctat tggaagcata aagtgtatgc ccgct 35 <210> 157 <211> 40 <212> DNA <213> Artificial Sequence <400> 157 ttccagtccttataaatcaaaagagaaccatcacccaaat 40 <210> 158 <211> twenty four <212> DNA <213> Artificial Sequence <400> 158 gcgctcacaa gcctggggtg ccta 24 <210> 159 <211> 40 <212> DNA <213> Artificial Sequence <400> 159 cgatggccca ctacgtatag cccgagatag ggattgcgtt 40 <210> 160 <211> 43 <212> DNA <213> Artificial Sequence <400> 160 acgtggactc caacgtcaaa gggcgaattt ggaacaagag tcc 43 <210> 161 <211> 25 <212> DNA <213> Artificial Sequence <400> 161 ttaattaatt ttttaccata tcaaa 25 <210> 162 <211> twenty four <212> DNA <213> Artificial Sequence <400> 162 ttaatttcat cttagacttt acaa 24 <210> 163 <211> twenty three <212> DNA <213> Artificial Sequence <400> 163 ctgtccagac gtataccgaa cga 23 <210> 164 <211> twenty two <212> DNA <213> Artificial Sequence <400> 164 tcaagattag tgtagcaata ct 22 <210> 165 <211> 25 <212> DNA <213> Artificial Sequence <400> 165 tgtagcattc cttttataaa cagtt 25 <210> 166 <211> twenty four <212> DNA <213> Artificial Sequence <400> 166 tttaattgta tttccaccag agcc 24 <210> 167 <211> twenty three <212> DNA <213> Artificial Sequence <400> 167 actacgaagg cttagcacca tta 23 <210> 168 <211> twenty two <212> DNA <213> Artificial Sequence <400> 168 ataaggcttg caacaaagtt ac 22 <210> 169 <211> 25 <212> DNA <213> Artificial Sequence <400> 169 gtgggaacaa atttctattt ttgag 25 <210> 170 <211> twenty four <212> DNA <213> Artificial Sequence <400> 170 cggtgcgggc cttccaaaaa catt 24 <210> 171 <211> twenty three <212> DNA <213> Artificial Sequence <400> 171 atgagtgagc ttttaaatat gca 23 <210> 172 <211> twenty two <212> DNA <213> Artificial Sequence <400> 172 actattaaag aggatagcgt cc 22 <210> 173 <211> twenty four <212> DNA <213> Artificial Sequence <400> 173 gcgcttaatg cgccgctaca gggc 24 <210> 174 <211> 80 <212> DNA <213> Artificial Sequence <400> 174 agaaggatgg atgctttggt gtgtagtatg agcgagcgtt gcgattttcg gggtttcctc 60 aagagaagga ttttgaatta 80 <210> 175 <211> 88 <212> DNA <213> Artificial Sequence <400> 175 agaaggatgg atgctttggt gtgtagtatg agcgagcgtt gcgattttga taagtgccgt 60 cgagctgaaa catgaaagta tacaggag 88 <210> 176 <211> 88 <212> DNA <213> Artificial Sequence <400> 176 agaaggatgg atgctttggt gtgtagtatg agcgagcgtt gcgattttta gcccggaata 60 ggtgaatgcc ccctgcctat ggtcagtg 88 <210> 177 <211> 80 <212> DNA <213> Artificial Sequence <400> 177 agaaggatgg atgctttggt gtgtagtatg agcgagcgtt gcgattttcc ttttttcatt 60 taacaatttc ataggattag 80 <210> 178 <211> 88 <212> DNA <213> Artificial Sequence <400> 178 agaaggatgg atgctttggt gtgtagtatg agcgagcgtt gcgattttaa aacaaaatta 60 attaaatgga aacagtacat tagtgaat 88 <210> 179 <211> 88 <212> DNA <213> Artificial Sequence <400> 179 agaaggatgg atgctttggt gtgtagtatg agcgagcgtt gcgattttga gcaaaagaag 60 atgagtgaat aaccttgctt atagctta 88 <210> 180 <211> 80 <212> DNA <213> Artificial Sequence <400> 180 agaaggatgg atgctttggt gtgtagtatg agcgagcgtt gcgatttttc atatgtgtaa 60 tcgtaaaact agtcattttc 80 <210> 181 <211> 88 <212> DNA <213> Artificial Sequence <400> 181 agaaggatgg atgctttggt gtgtagtatg agcgagcgtt gcgattttag aaaagcccca 88. aaaagagtct ggagcaaaca atcaccat <210> 182 <211> 88 <212> DNA <213> Artificial Sequence <400> 182 agaaggatgg atgctttggt gtgtagtatg agcgagcgtt gcgattttgc aaatatttaa attgagatct acaaaggcta ctgataaa <210> 183 <211> 80 <212> DNA <213> Artificial Sequence <400> 183 agaaggatgg atgctttggt gtgtagtatg agcgagcgtt gcgattttag ggatagctca gagccaccac cccatgtcaa <210> 184 <211> 88 <212> DNA <213> Artificial Sequence <400> 184 agaaggatgg atgctttggt gtgtagtatg agcgagcgtt gcgattttcc tcagaaccgc cacccaagcc cataggac gtaatga <210> 185 <211> 88 <212> DNA <213> Artificial Sequence <400> 185 agaaggatgg atgctttggt gtgtagtatg agcgagcgtt gcgattttag gtttagtacc 60 gccatgagtt tcgtcaccag gatctaaa 88 <210> 186 <211> 80 <212> DNA <213> Artificial Sequence <400> 186 agaaggatgg atgctttggt gtgtagtatg agcgagcgtt gcgatttttc gggagatata 60 cagtaacagt acaaataatt 80 <210> 187 <211> 88 <212> DNA <213> Artificial Sequence <400> 187 agaaggatgg atgctttggt gtgtagtatg agcgagcgtt gcgattttcc tgattgcttt 60 gaattgcgta gattttcagg catcaata 88 <210> 188 <211> 88 <212> DNA <213> Artificial Sequence <400> 188 agaaggatgg atgctttggt gtgtagtatg agcgagcgtt gcgattttgc gcagaggcga 60 attaattatt tgcacgtaaa ttctgaat 88 <210> 189 <211> 80 <212> DNA <213> Artificial Sequence <400> 189 agaaggatgg atgctttggt gtgtagtatg agcgagcgtt gcgattttcg cgtctgatag 60 gaacgccatc aacttttaca 80 <210> 190 <211> 88 <212> DNA <213> Artificial Sequence <400> 190 agaaggatgg atgctttggt gtgtagtatg agcgagcgtt gcgattttgc tcatttttta 60 accagccttc ctgtagccag gcatctgc 88 <210> 191 <211> 88 <212> DNA <213> Artificial Sequence <400> 191 agaaggatgg atgctttggt gtgtagtatg agcgagcgtt gcgattttgt taaaattcgc 60 attaatgtga gcgagtaaca cacgttgg 88 <210> 192 <211> 32 <212> DNA <213> Artificial Sequence <400> 192 aattaactcg gaataagttt atttccagcg cc 32 <210> 193 <211> 48 <212> DNA <213> Artificial Sequence <400> 193 cattcaacaa acgcaaagac accagaacac cctgaacaaa tagagctt 48 <210> 194 <211> 32 <212> DNA <213> Artificial Sequence <400> 194 acaagaatgt tagcaaacgt agaaaattat tc 32 <210> 195 <211> 48 <212> DNA <213> Artificial Sequence <400> 195 caccgtcacc ttattacgca gtattgagtt aagcccaata caagtttt 48 <210> 196 <211> 35 <212> DNA <213> Artificial Sequence <400> 196 cgaagcccaa acgcaataat aacgaaaatc accag 35 <210> 197 <211> 48 <212> DNA <213> Artificial Sequence <400> 197 tttccttagc actcatcgag aacaatagca gcctttacag ttgacgag 48 <210> 198 <211> 32 <212> DNA <213> Artificial Sequence <400> 198 aaatgaaaag caagccgttt ttatgaaacc aa 32 <210> 199 <211> 48 <212> DNA <213> Artificial Sequence <400> 199 acaagaaagc aagcaaatca gataacagcc atattattta ttaaaggg 48 <210> 200 <211> 32 <212> DNA <213> Artificial Sequence <400> 200 caaaataata gaaggctttat ccggttatca ac 32 <210> 201 <211> 51 <212> DNA <213> Artificial Sequence <400> 201 acgacaataa atcccgactt gcgggagatc ctgaatctta ccagccaccg a 51 <210> 202 <211> 32 <212> DNA <213> Artificial Sequence <400> 202 cacgtatact gaaatggatt atttaataaa ag 32 <210> 203 <211> 48 <212> DNA <213> Artificial Sequence <400> 203 agagatagtt tgacgctcaa tcgtacgtgc tttcctcgtt aacgtcaa 48 <210> 204 <211> 32 <212> DNA <213> Artificial Sequence <400> 204 attttagata ccgccagcca ttgcggcaca ga 32 <210> 205 <211> 48 <212> DNA <213> Artificial Sequence <400> 205 cttatagtat atccagaaca atatcaggaa cggtacgcca gccagtta 48 <210> 206 <211> 35 <212> DNA <213> Artificial Sequence <400> 206 gtaaaagaac atcacttgcc tgagcgccat taaaa 35 <210> 207 <211> 48 <212> DNA <213> Artificial Sequence <400> 207 tttcaccagc ctggccctga gagaaagccg gcgaacgtgg gacggggag 48 <210> 208 <211> 32 <212> DNA <213> Artificial Sequence <400> 208 gacggggagt tgcagcaagc ggtcattggg cg 32 <210> 209 <211> 48 <212> DNA <213> Artificial Sequence <400> 209 ttaatgaagt ttgatggtgg ttccgaggtg ccgtaaagca gataaccc 48 <210> 210 <211> 32 <212> DNA <213> Artificial Sequence <400> 210 ttggggtcga aatcggcaaa atccgggaaa cc 32 <210> 211 <211> 51 <212> DNA <213> Artificial Sequence <400> 211 aactcacatt attgagtgtt gttccagaaa ccgtctatca gggtatctta c 51 <210> 212 <211> 48 <212> DNA <213> Artificial Sequence <400> 212 tcgcaacgct cgctcatact acacaccaaa gcatccatcc ttcttttt 48 <210> 213 <211> 47 <212> DNA <213> Artificial Sequence <400> 213 gaaggatgga tgctttggtg tgtagtatga gcgagcgttg cgatttt 47

Claims

1. A surface plasmon enhanced signal probe constructed based on DNA origami nanoassembly, characterized in that: The probe includes a diamond-shaped DNA origami element and a silver-shell gold-core nanoparticle. The surface of the silver-shell gold-core nanoparticle is modified with a 4-mercaptobenzoic acid signal molecule and thiol DNA. The diamond-shaped DNA origami element is composed of two triangular DNA origami units. The silver-shell gold-core nanoparticle is fixed to the binding sites of the two triangular DNA origami units through base complementary pairing between the thiol DNA and the diamond-shaped DNA origami element. The preparation method of silver-shell gold-core nanoparticles whose surfaces are modified with 4-mercaptobenzoic acid signal molecules and thiol DNA comprises the following steps: (1) adding an appropriate amount of 4-mercaptobenzoic acid to the gold nanoparticle solution, shaking and incubating, adding dihydrated bis(p-sulfonylphenyl)phenylphosphine dipotassium salt to the incubated sample, continuing incubation, and centrifuging and washing with ultrapure water to remove excess signal molecules to obtain gold nanoparticles with surface modified 4-mercaptobenzoic acid signal molecules; (2) incubating the gold nanoparticles with the surface modified 4-mercaptobenzoic acid signal molecules with thiol DNA to obtain gold nanoparticles modified with 4-mercaptobenzoic acid signal molecules and thiol DNA; (3) A silver layer is deposited on the surface of the modified gold nanoparticles to form gold-silver core-shell structure particles.

2. The probe according to claim 1, characterized in that The silver shell is a silver layer with a thickness of 2-3 nm deposited on the surface of the gold nanoparticles; the particle size of the gold nanoparticles is 50 nm.

3. The probe according to claim 1, wherein The diamond-shaped DNA origami element is formed by self-assembly of a triangular DNA origami unit A and a triangular DNA origami unit B; The triangular DNA origami unit A is formed by annealing M13mp18 phage circular single-stranded DNA, a staple strand, a capture strand, and a first set of docking strands; The triangular DNA origami unit B is formed by annealing M13mp18 phage circular single-stranded DNA, a staple strand, a capture strand, and a second set of docking strands; The sequence of the staple chain is shown as SEQ ID NO: 1 to SEQ ID NO: 173; The capture strand sequences are shown in SEQ ID NO: 174 to SEQ ID NO: 191; The sequences of the first group of docking strands are shown in SEQ ID NO: 192 to SEQ ID NO: 201; The sequences of the second group of docking strands are shown in SEQ ID NO: 202 to SEQ ID NO:

211.

4. The probe according to claim 3, characterized in that The sequence of the thiol DNA is shown in SEQ ID NO: 212, wherein the thiol group is labeled at the 3' end.

5. The method for preparing a surface plasmon-enhanced signal probe based on a DNA origami nanoassembly according to any one of claims 1 to 4, characterized in that: The following steps are involved: (1) Preparation of diamond-shaped DNA origami elements with specific recognition sites; (2) Preparation of 4-mercaptobenzoic acid signal molecules and thiol DNA modified gold nanoparticles; The method comprises the following steps: adding an appropriate amount of 4-mercaptobenzoic acid to a nanogold solution, shaking and incubating, adding dihydrated dipotassium bis(p-sulfonylphenyl)phenylphosphine to the incubated sample, continuing the incubation, and washing by centrifugation with ultrapure water to remove excess signal molecules, thereby obtaining gold nanoparticles with surface modified 4-mercaptobenzoic acid signal molecules; incubating the gold nanoparticles with surface modified 4-mercaptobenzoic acid signal molecules with thiol DNA, thereby obtaining gold nanoparticles modified with 4-mercaptobenzoic acid signal molecules and thiol DNA; (3) depositing a silver layer on the surface of the modified gold nanoparticles obtained in step (2) to form gold-silver core-shell structure particles; (4) The gold-silver core-shell structure particles obtained in step (3) are self-assembled with diamond-shaped DNA origami elements to construct a dimeric metal nanoparticle plasma, that is, the surface plasmon enhanced signal probe constructed based on the DNA origami nanoassembly.

6. The method according to claim 5, characterized in that The diamond-shaped DNA origami element is prepared by splicing two triangular DNA origami by alternately extending the sticky ends, including the following steps: (1) Mix the M13mp18 phage circular single-stranded DNA, staple strand, capture strand, and the first set of docking strands, and add 1×TAE-Mg 2+ The buffer solution was shaken and the mixed solution was placed in a PCR instrument for annealing. After the reaction, the excess staple chains and by-products were removed by ultrafiltration to obtain the first triangular DNA origami. (2) Mix the M13mp18 phage circular single-stranded DNA, staple strand, capture strand, and the second set of docking strands, and add 1×TAE-Mg 2+ Buffer solution was added and shaken to mix well. The mixed solution was placed in a PCR instrument for annealing. After the reaction, the excess staple chains and by-products were removed by ultrafiltration to obtain the second triangular DNA origami. (3) The two triangular DNA origami were mixed in a molar ratio of 1:1 and 1×TAE-Mg was added. 2+ Buffer solution was added and shaken to mix well. The mixed solution was placed in a PCR instrument for annealing to synthesize diamond-shaped DNA origami.

7. The method according to claim 5, characterized in that A silver layer was deposited on the surface of the modified gold nanoparticles to form a gold-silver core-shell structure, which was obtained by reacting the modified gold nanoparticles with the Nanoprobes HQ Silver kit.

8. Use of the surface plasmon enhanced signal probe constructed based on the DNA origami nanoassembly according to any one of claims 1 to 4 as a plasmon sensor in surface enhanced Raman scattering detection.

9. The use according to claim 8, characterized in that A portable handheld Raman instrument was used to detect the surface-enhanced Raman scattering of the plasmon-enhanced signal probe.

Images