Polypeptide with 4-aminobenzoic acid hydroxylation activity and use thereof

Abstract

The present invention provides a polypeptide having excellent 4-aminobenzoic acid hydroxylation activity and a method for utilizing the same. The polypeptide is a polypeptide having 4-aminobenzoic acid hydroxylation activity, wherein the amino acid residue at position 47 of the amino acid sequence of SEQ ID NO: 2 or a position corresponding thereto is leucine in an amino acid sequence having at least 47% identity thereto.

Description

Technical Field

[0001] The present invention relates to a polypeptide having 4-aminobenzoic acid hydroxylation activity and uses thereof. Background Art

[0002] Polybenzoxazole (PBO) is known as an engineering plastic having excellent heat resistance and mechanical strength and can be used for fiber materials, insulating films of semiconductor devices, and the like (Non-Patent Document 1).

[0003] The benzoxazole backbone is formed by the condensation of an o-aminophenol backbone and a carboxylic acid. Therefore, 4-amino-3-hydroxybenzoic acid (4,3-AHBA), which has these functional groups within the molecule, is expected to be useful as a PBO monomer. In fact, the synthesis and physical property evaluation of polybenzoxazoles using 4,3-AHBA have been studied (Non-Patent Document 2).

[0004] In recent years, methods for producing compounds using microbial fermentation using renewable energy as raw materials have attracted much attention, aiming to reduce the impact on the global environment. For example, research has been conducted on the microbial production and polymerization of 3-amino-4-hydroxybenzoic acid (3,4-AHBA), which has a similar structure to 4,3-AHBA (Patent Document 1).

[0005] Regarding the production of 4,3-AHBA, methods such as chemical synthesis by reducing nitroaromatic groups are known (Patent Document 2). As a strategy for the fermentative production of 4,3-AHBA using microbial methods, hydroxylation of the 3-position of 4-aminobenzoic acid (4-ABA), which can be biosynthesized in microorganisms, is considered. However, only weak activity of some 4-hydroxybenzoate hydroxylases has been reported for this reaction (Non-Patent Documents 3 and 4).

[0006] Patent Document 1: Japanese Patent No. 5445453

[0007] Patent Document 2: Japanese Patent No. 3821350

[0008] Non-patent document 1: Murase Hiroki, SENI GAKKAISHI (Fibers and Industry), Vol. 66, No. 6 (2010)

[0009] Non-patent document 2: Lon J. Mathias et al., Macromolecules, Vol. 18, No. 4, pp. 616-622 (1985)

[0010] Non-patent document 3: Barrie Entsch et al. The Journal of Biological Chemistry, Vol. 262, No. 13, pp. 6060-6068 (1987)

[0011] Non-patent document 4: Domenico L. Gatti et al., Biochemistry, Vol. 35, No. 2, pp. 567-578 (1996) Summary of the Invention

[0012] The present invention relates to the following 1) to 7).

[0013] 1) A polypeptide having 4-aminobenzoic acid hydroxylation activity as shown in the following A) to C).

[0014] A) A polypeptide having 4-aminobenzoic acid hydroxylation activity, wherein the amino acid residue at position 47 of the amino acid sequence set forth in SEQ ID NO: 2 or a position corresponding thereto is leucine in the amino acid sequence set forth in SEQ ID NO: 2 or an amino acid sequence having at least 47% identity thereto.

[0015] B) It is a polypeptide having 4-aminobenzoic acid hydroxylation activity, wherein the amino acid residue at position 201 or 222, or a position corresponding to position 201 or 222, of the amino acid sequence set forth in SEQ ID NO: 2, or an amino acid sequence having at least 51% identity thereto, is phenylalanine.

[0016] C) It is a polypeptide having 4-aminobenzoic acid hydroxylation activity, wherein the amino acid residue at position 47, 72, 210, 294 or 385 of the amino acid sequence shown in sequence number 2, or at a position corresponding to position 47, 72, 210, 294 or 385 in the amino acid sequence shown in sequence number 2 or an amino acid sequence having at least 90% identity thereto is the following amino acid.

[0017] (a) Position 47 or a position corresponding thereto: isoleucine, serine, threonine, cysteine, methionine, glutamine,

[0018] (b) Position 72 or a position corresponding thereto: alanine, methionine,

[0019] (c) Position 210 or a position corresponding thereto: methionine,

[0020] (d) Position 294 or a position corresponding thereto: alanine, glycine, cysteine, serine,

[0021] (e) Position 385 or a position corresponding thereto: valine, leucine, isoleucine, methionine.

[0022] 2) A method for producing a mutant polypeptide having 4-aminobenzoic acid hydroxylation activity, comprising substituting the amino acid residues shown in A') to C') below.

[0023] A′) In a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 or an amino acid sequence having at least 47% identity thereto and having 4-aminobenzoic acid hydroxylation activity, the amino acid residue at position 47 of the amino acid sequence set forth in SEQ ID NO: 2 or a position corresponding thereto is substituted with leucine.

[0024] B′) In a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 or an amino acid sequence having at least 51% identity thereto and having 4-aminobenzoic acid hydroxylation activity, the amino acid residue at position 201 or 222, or a position corresponding to position 201 or 222, of the amino acid sequence set forth in SEQ ID NO: 2 is substituted with phenylalanine.

[0025] C′) In a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity thereto and having 4-aminobenzoic acid hydroxylation activity, the amino acid residue at position 47, 72, 210, 294 or 385, or a position corresponding to position 47, 72, 210, 294 or 385, of the amino acid sequence set forth in SEQ ID NO: 2 is substituted with the following amino acid.

[0026] (a) Position 47 or a position corresponding thereto: isoleucine, serine, threonine, cysteine, methionine, glutamine,

[0027] (b) Position 72 or a position corresponding thereto: alanine, methionine,

[0028] (c) Position 210 or a position corresponding thereto: methionine,

[0029] (d) Position 294 or a position corresponding thereto: alanine, glycine, cysteine, serine,

[0030] (e) Position 385 or a position corresponding thereto: valine, leucine, isoleucine, methionine.

[0031] 3) A method for enhancing the hydroxylation activity of 4-aminobenzoic acid, comprising substituting the amino acid residues shown in A') to C') below.

[0032] A′) In a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 or an amino acid sequence having at least 47% identity thereto and having 4-aminobenzoic acid hydroxylation activity, the amino acid residue at position 47 of the amino acid sequence set forth in SEQ ID NO: 2 or a position corresponding thereto is substituted with leucine.

[0033] B′) In a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 or an amino acid sequence having at least 51% identity thereto and having 4-aminobenzoic acid hydroxylation activity, the amino acid residue at position 201 or 222, or a position corresponding to position 201 or 222, of the amino acid sequence set forth in SEQ ID NO: 2 is substituted with phenylalanine.

[0034] C′) In a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity thereto and having 4-aminobenzoic acid hydroxylation activity, the amino acid residue at position 47, 72, 210, 294 or 385, or a position corresponding to position 47, 72, 210, 294 or 385, of the amino acid sequence set forth in SEQ ID NO: 2 is substituted with the following amino acid.

[0035] (a) Position 47 or a position corresponding thereto: isoleucine, serine, threonine, cysteine, methionine, glutamine,

[0036] (b) Position 72 or a position corresponding thereto: alanine, methionine,

[0037] (c) Position 210 or a position corresponding thereto: methionine,

[0038] (d) Position 294 or a position corresponding thereto: alanine, glycine, cysteine, serine,

[0039] (e) Position 385 or a position corresponding thereto: valine, leucine, isoleucine, methionine.

[0040] 4) A polynucleotide encoding the polypeptide of 1) or 2).

[0041] 5) A vector or DNA fragment comprising the polynucleotide of 4).

[0042] 6) A transformed cell comprising the vector or DNA fragment of 5).

[0043] 7) A method for producing 4-amino-3-hydroxybenzoic acids, comprising culturing the transformed cells according to 6). DETAILED DESCRIPTION

[0044] The present invention relates to a polypeptide having excellent 4-aminobenzoic acid hydroxylation activity and a utilization method thereof.

[0045] The inventors of the present invention have discovered that a mutant of 4-hydroxybenzoate hydroxylase having a specific amino acid sequence has excellent 4-aminobenzoic acid hydroxylation activity and can be effectively used to produce 4-amino-3-hydroxybenzoic acids.

[0046] Since the polypeptide having 4-aminobenzoic acid hydroxylation activity of the present invention has excellent 4-aminobenzoic acid hydroxylation activity, 4-amino-3-hydroxybenzoic acids can be efficiently produced from 4-aminobenzoic acids by using the polypeptide.

[0047] In this specification, amino acid sequence or nucleotide sequence identity is calculated using the Lipman-Pearson method (Science, 1985, 227: 1435-1441). Specifically, the identity analysis (Search Homology) program of the genetic information processing software GENETYX Ver. 12 is used to perform analysis and calculation using a unit size to compare (ktup) of 2.

[0048] In this specification, "corresponding positions" on an amino acid sequence or nucleotide sequence can be determined by arranging (aligning) the target sequence and the reference sequence (e.g., the amino acid sequence shown in SEQ ID NO: 2) in a manner that maximizes their identity. The alignment of amino acid sequences or nucleotide sequences can be performed using a known algorithm, and the steps are well known to those skilled in the art. For example, the alignment can be performed using the Clustal W multiple sequence alignment program (Thompson, J.D. et al., 1994, Nucleic Acids Res. 22: 4673-4680) in a system setting. Alternatively, Clustal W2 or Clustal omega, which are revised versions of Clustal W, can also be used. Clustal W, Clustal W2, and Clustal Omega are available, for example, on the websites of the European Bioinformatics Institute (EBI [www.ebi.ac.uk / index.html]) or the DNA Data Bank of Japan (DDBJ [www.ddbj.nig.ac.jp / searches-j.html]) operated by the National Institute of Genetics, Japan. By the above alignment, a position of the target sequence that aligns with any position of the reference sequence is considered to be the "corresponding position" to that position.

[0049] Those skilled in the art can further make fine adjustments to optimize the comparison of the amino acid sequences obtained above. This optimal comparison is preferably determined by considering the similarity of the amino acid sequences and the frequency of the inserted gaps. Here, the similarity of amino acid sequences refers to the ratio (%) of the number of positions at which identical or similar amino acid residues are present in the two sequences relative to the number of total amino acid residues when two amino acid sequences are compared. Similar amino acid residues refer to amino acid residues that have similar properties to each other in terms of polarity and charge among the 20 amino acids that constitute proteins, and that undergo so-called conservative substitutions. Groups composed of such similar amino acid residues are well known to those skilled in the art, and for example, the following combinations can be cited respectively: arginine with lysine or glutamine, glutamic acid with aspartic acid or glutamine, serine with threonine or alanine, glutamine with aspartic acid or arginine, leucine with isoleucine, etc., but are not limited to these.

[0050] In this specification, "amino acid residue" refers to the 20 amino acid residues that constitute proteins, namely alanine (Ala or A), arginine (Arg or R), aspartic acid (Asn or N), aspartic acid (Asp or D), cysteine (Cys or C), glutamine (Gln or Q), glutamic acid (Glu or E), glycine (Gly or G), histidine (His or H), isoleucine (Ile or I), leucine (Leu or L), lysine (Lys or K), methionine (Met or M), phenylalanine (Phe or F), proline (Pro or P), serine (Ser or S), threonine (Thr or T), tryptophan (Trp or W), tyrosine (Tyr or Y) and valine (Val or V).

[0051] As used herein, "operably linked" a control region, such as a promoter, to a gene means that the gene and the control region are linked so that the gene can be expressed under the control of the control region. The steps for "operably linking" a gene to a control region are well known to those skilled in the art.

[0052] In this specification, the terms "upstream" and "downstream" with respect to a gene refer to the upstream and downstream regions of the gene in the transcription direction. For example, "a gene located downstream of a promoter" means that the gene is located on the 3' side of the promoter in the sense strand of DNA, and upstream of a gene refers to the region on the 5' side of the gene in the sense strand of DNA.

[0053] In this specification, the term "originally" used for a function, trait, or characteristic of a cell is used to indicate that the cell originally has the function, trait, or characteristic. In contrast, the term "exogenous" is not originally present in the cell, but is used to indicate a function, trait, or characteristic introduced from the outside. For example, a "exogenous" gene or polynucleotide is a gene or polynucleotide introduced into a cell from the outside. The exogenous gene or polynucleotide may be derived from an organism of the same species as the cell into which it is introduced, or from an organism of a different species (i.e., a heterologous gene or polynucleotide). <Polypeptide having 4-aminobenzoic acid hydroxylation activity>

[0054] The polypeptide having 4-aminobenzoic acid hydroxylation activity of the present invention (referred to as "the polypeptide of the present invention") is represented by the following A) to C).

[0055] A) A polypeptide wherein the amino acid residue at position 47 of the amino acid sequence set forth in SEQ ID NO: 2 or a position corresponding thereto is leucine in the amino acid sequence set forth in SEQ ID NO: 2 or an amino acid sequence having at least 47% identity thereto.

[0056] B) A polypeptide wherein the amino acid residue at position 201 or 222, or a position corresponding to position 201 or 222, of the amino acid sequence set forth in SEQ ID NO: 2 or an amino acid sequence having at least 51% identity thereto is phenylalanine.

[0057] C) It is a polypeptide in which the amino acid residue at position 47, 72, 210, 294 or 385 of the amino acid sequence set forth in SEQ ID NO: 2, or an amino acid sequence having at least 90% identity thereto, or at a position corresponding to position 47, 72, 210, 294 or 385 of the amino acid sequence set forth in SEQ ID NO: 2, is the following amino acid.

[0058] (a) Position 47 or a position corresponding thereto: isoleucine, serine, threonine, cysteine, methionine, glutamine,

[0059] (b) Position 72 or a position corresponding thereto: alanine, methionine,

[0060] (c) Position 210 or a position corresponding thereto: methionine,

[0061] (d) Position 294 or a position corresponding thereto: alanine, glycine, cysteine, serine,

[0062] (e) Position 385 or a position corresponding thereto: valine, leucine, isoleucine, methionine.

[0063] The polypeptide shown in A) is a mutant polypeptide having 4-aminobenzoic acid hydroxylation activity, in which the amino acid residue at position 47 of the amino acid sequence shown in SEQ ID NO: 2 or a position corresponding thereto is substituted with leucine, in a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 47% identity thereto, serving as a reference polypeptide.

[0064] The polypeptide shown in B) is a mutant polypeptide having 4-aminobenzoic acid hydroxylation activity, in which the amino acid residue at position 201 or 222, or a position corresponding to position 201 or 222, of the amino acid sequence shown in SEQ ID NO: 2 is substituted with phenylalanine in a polypeptide serving as a reference, i.e., a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 51% identity thereto.

[0065] The polypeptide shown in C) is a mutant polypeptide having 4-aminobenzoic acid hydroxylation activity, in which the amino acid residues at positions 47, 72, 210, 294 or 385 of the amino acid sequence shown in SEQ ID NO: 2, or at positions corresponding to positions 47, 72, 210, 294 or 385, of the amino acid sequence shown in SEQ ID NO: 2, or at positions corresponding to positions 47, 72, 210, 294 or 385, are substituted with the amino acids (a) to (e) above, in a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity thereto.

[0066] In the present invention, "4-aminobenzoic acid hydroxylation activity" refers to the activity of catalyzing the hydroxylation of 4-aminobenzoic acids, preferably the activity of catalyzing the hydroxylation at the 3-position of 4-aminobenzoic acids.

[0067] The 4-aminobenzoic acid hydroxylation activity can be determined by culturing a microorganism that produces the polypeptide of the present invention and measuring the amount of 4-amino-3-hydroxybenzoic acid produced by HPLC or the like, as described in the Examples below.

[0068] The polypeptide represented by A) of the present invention can be produced by substituting leucine for the amino acid residue at position 47 or a position corresponding to the amino acid sequence represented by SEQ ID NO: 2 in a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 2 or an amino acid sequence having at least 47% identity thereto and having 4-aminobenzoic acid hydroxylation activity.

[0069] Here, a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 47% identity thereto and having 4-aminobenzoic acid hydroxylation activity is the "parent" polypeptide of the polypeptide shown in A) of the present invention.

[0070] The parent polypeptide refers to a reference polypeptide that becomes the polypeptide shown in A) of the present invention by undergoing predetermined mutations in its amino acid residues.

[0071] In addition, the polypeptide shown in B) of the present invention can be produced by substituting phenylalanine for the amino acid residue at position 201 or 222, or at a position corresponding to position 201 or 222, of the amino acid sequence shown in SEQ ID NO: 2, in a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 51% identity thereto and having 4-aminobenzoic acid hydroxylation activity.

[0072] Here, a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 51% identity thereto and having 4-aminobenzoic acid hydroxylation activity is the "parent" polypeptide of the polypeptide shown in B) of the present invention.

[0073] The parent polypeptide refers to a reference polypeptide that becomes the polypeptide shown in B) of the present invention by undergoing predetermined mutations in its amino acid residues.

[0074] In addition, the polypeptide shown in C) of the present invention can be produced by substituting the amino acid residues at positions 47, 72, 210, 294 or 385 of the amino acid sequence shown in SEQ ID NO: 2, or an amino acid sequence having at least 90% identity thereto, and having 4-aminobenzoic acid hydroxylation activity, with the following amino acids.

[0075] (a) Position 47 or a position corresponding thereto: isoleucine, serine, threonine, cysteine, methionine, glutamine,

[0076] (b) Position 72 or a position corresponding thereto: alanine, methionine,

[0077] (c) Position 210 or a position corresponding thereto: methionine,

[0078] (d) Position 294 or a position corresponding thereto: alanine, glycine, cysteine, serine,

[0079] (e) Position 385 or a position corresponding thereto: valine, leucine, isoleucine, methionine.

[0080] Here, a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity thereto and having 4-aminobenzoic acid hydroxylation activity is the "parent" polypeptide of the polypeptide shown in C) of the present invention.

[0081] The parent polypeptide refers to a reference polypeptide that becomes the polypeptide shown in C) of the present invention by undergoing predetermined mutations in its amino acid residues.

[0082] In the present invention, the polypeptide HFM122 consisting of the amino acid sequence set forth in SEQ ID NO: 2 (NCBI Reference Sequence: WP_010920262.1) is known as 4-hydroxybenzoate 3-monooxygenase (EC 1.14.13.2). 4-Hydroxybenzoate 3-monooxygenase is an enzyme that has catalytic activity promoting either or both the hydroxylation of the 3-position of 4-hydroxybenzoate to produce protocatechuate and the reverse reaction. It is a type of enzyme that catalyzes the hydroxylation of 4-hydroxybenzoates (4-hydroxybenzoate hydroxylase).

[0083] The applicant discovered that HFM122 has 4-aminobenzoic acid hydroxylation activity (Japanese Patent Application No. 2018-171849).

[0084] <Parent polypeptide among the polypeptides shown in A)>

[0085] Among the polypeptides shown in A), examples of polypeptides having 4-aminobenzoic acid hydroxylation activity that are composed of an amino acid sequence having at least 47% identity with the amino acid sequence shown in SEQ ID NO: 2 include polypeptides having 4-aminobenzoic acid hydroxylation activity that are composed of an amino acid sequence having at least 47% identity with the amino acid sequence shown in SEQ ID NO: 2, specifically 47% or more, more preferably 50% or more, more preferably 60% or more, more preferably 70% or more, more preferably 80% or more, more preferably 90% or more, more preferably 95% or more, more preferably 96% or more, further preferably 97% or more, further preferably 98% or more, and further preferably 99% or more identity. Specific examples include HFM388 (SEQ ID NO: 4: 62% amino acid sequence identity with SEQ ID NO: 2, NCBI Reference Sequence: WP_010976283.1), HFM339 (SEQ ID NO: 6: 61% amino acid sequence identity with SEQ ID NO: 2, NCBI Reference Sequence: WP_011157287.1), HFM77 (SEQ ID NO: 8: 51% amino acid sequence identity with SEQ ID NO: 2, NCBI Reference Sequence: WP_011089160.1), HFM737 (SEQ ID NO: 10: 51% amino acid sequence identity with SEQ ID NO: 2, NCBI Reference Sequence: WP_011519894.1), and HFMss0-1 (SEQ ID NO: 12: 47% amino acid sequence identity with SEQ ID NO: 2, NCBI Reference Sequence: WP_027494688.1). Among them, from the viewpoint of the 4-aminobenzoic acid hydroxylation activity possessed by the polypeptide of the present invention, HFM737 and HFMss0-1 are preferred.

[0086] Suitable "parent" polypeptides include, in addition to the amino acid sequence set forth in SEQ ID NO: 2, polypeptides comprising an amino acid sequence having an identity of 90% or more, more preferably 95% or more, more preferably 96% or more, and more preferably 98% or more to the amino acid sequence set forth in SEQ ID NO: 2, and having 4-aminobenzoic acid hydroxylation activity. Other examples include polypeptides comprising the amino acid sequence set forth in SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, or SEQ ID NO: 12, or amino acid sequences having an identity of 90% or more, preferably 95% or more, more preferably 96% or more, and more preferably 98% or more to each of these, and having 4-aminobenzoic acid hydroxylation activity.

[0087] The parent polypeptide preferably has a valine residue at position 47 or a corresponding position of the amino acid sequence shown in SEQ ID NO: 2, and the polypeptide shown in A) of the present invention more preferably has the valine at position 47 or a corresponding position substituted with leucine.

[0088] <B) Parent polypeptide among the polypeptides shown>

[0089] Among the polypeptides shown in B), examples of polypeptides having 4-aminobenzoic acid hydroxylation activity that are composed of an amino acid sequence having at least 51% identity with the amino acid sequence shown in SEQ ID NO: 2 include polypeptides having 4-aminobenzoic acid hydroxylation activity that are composed of an amino acid sequence having at least 51% identity with the amino acid sequence shown in SEQ ID NO: 2, specifically 51% or more, preferably 60% or more, more preferably 70% or more, more preferably 80% or more, more preferably 90% or more, more preferably 95% or more, more preferably 96% or more, further preferably 97% or more, further preferably 98% or more, and further preferably 99% or more. Specific examples include HFM388 (SEQ ID NO: 4: 62% amino acid sequence identity with SEQ ID NO: 2, NCBI Reference Sequence: WP_010976283.1), HFM339 (SEQ ID NO: 6: 61% amino acid sequence identity with SEQ ID NO: 2, NCBI Reference Sequence: WP_011157287.1), and HFM77 (SEQ ID NO: 8: 51% amino acid sequence identity with SEQ ID NO: 2, NCBI Reference Sequence: WP_011089160.1). Among these, HFM388 and HFM339 are preferred from the perspective of the 4-aminobenzoic acid hydroxylation activity of the polypeptide of the present invention.

[0090] Suitable "parent" polypeptides include, in addition to the amino acid sequence set forth in SEQ ID NO: 2, polypeptides comprising an amino acid sequence having 90% or greater, more preferably 95% or greater, more preferably 96% or greater, and more preferably 98% or greater identity to the amino acid sequence set forth in SEQ ID NO: 2, and having 4-aminobenzoic acid hydroxylation activity. Other examples include polypeptides comprising the amino acid sequence set forth in SEQ ID NO: 4, SEQ ID NO: 6, or SEQ ID NO: 8, or amino acid sequences having 90% or greater, preferably 95% or greater, more preferably 96% or greater, and more preferably 98% or greater identity to each of these sequences, and having 4-aminobenzoic acid hydroxylation activity.

[0091] The parent polypeptide preferably has a tyrosine residue at position 201 or 222, or at a position corresponding to position 201 or 222, of the amino acid sequence set forth in SEQ ID NO: 2. The polypeptide set forth in B) of the present invention is more preferably a mutant polypeptide in which the tyrosine at position 201 or 222, or at a position corresponding to position 201 or 222, is substituted with phenylalanine. Examples of positions corresponding to position 201 or 222 of SEQ ID NO: 2 include positions 201 and 222 in SEQ ID NO: 4, positions 201 and 222 in SEQ ID NO: 6, and positions 203 and 224 in SEQ ID NO: 8.

[0092] Therefore, the parent polypeptide preferably has a tyrosine residue at position 201 or 222, or at a position corresponding to position 201 or 222, of the amino acid sequence shown in SEQ ID NO: 4, and the polypeptide shown in B) of the present invention is more preferably a mutant polypeptide in which the tyrosine at position 201 or 222, or at a position corresponding to position 201 or 222, is substituted with phenylalanine.

[0093] In addition, the parent polypeptide preferably has a tyrosine residue at position 201 or 222, or at a position corresponding to position 201 or 222, of the amino acid sequence shown in SEQ ID NO: 6, and the polypeptide shown in B) of the present invention is more preferably a mutant polypeptide in which the tyrosine at position 201 or 222, or at a position corresponding to position 201 or 222, is substituted with phenylalanine.

[0094] In addition, the parent polypeptide preferably has a tyrosine residue at position 203 or 224, or at a position corresponding to position 203 or 224, of the amino acid sequence shown in SEQ ID NO: 8, and the polypeptide shown in B) of the present invention is more preferably a mutant polypeptide in which the tyrosine at position 203 or 224, or at a position corresponding to position 203 or 224, is substituted with phenylalanine.

[0095] <Parent polypeptide among the polypeptides shown in C)>

[0096] Among the polypeptides shown in C), examples of polypeptides having 4-aminobenzoic acid hydroxylation activity that are composed of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 2 include polypeptides having 4-aminobenzoic acid hydroxylation activity that are composed of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 2, specifically 90% or more, preferably 95% or more, more preferably 96% or more, further preferably 97% or more, further preferably 98% or more, and further preferably 99% or more.

[0097] The parent polypeptide preferably has a valine residue at position 47 or a position corresponding thereto, preferably a histidine residue at position 72 or a position corresponding thereto, preferably a leucine residue at position 210 or a position corresponding thereto, preferably a threonine residue at position 294 or a position corresponding thereto, and preferably a tyrosine residue at position 385 or a position corresponding thereto of the amino acid sequence set forth in SEQ ID NO: 2. The polypeptide set forth in C) of the present invention more preferably has the valine at position 47 or a position corresponding thereto substituted with isoleucine, serine, threonine, cysteine, methionine or glutamine, the histidine at position 72 or a position corresponding thereto substituted with alanine or methionine, the leucine at position 210 or a position corresponding thereto substituted with methionine, the threonine at position 294 or a position corresponding thereto substituted with alanine, glycine, cysteine or serine, and the tyrosine at position 385 or a position corresponding thereto substituted with valine, leucine, isoleucine or methionine. More preferably, the threonine at position 294 or a position corresponding thereto is substituted with serine, the valine at position 47 or a position corresponding thereto is substituted with isoleucine, threonine, methionine or glutamine, and the histidine at position 72 or a position corresponding thereto is substituted with methionine. Still more preferably, the threonine at position 294 or a position corresponding thereto is substituted with serine, and the valine at position 47 or a position corresponding thereto is substituted with isoleucine.

[0098] <Polynucleotide Encoding the Polypeptide of the Present Invention>

[0099] In the present invention, various mutation introduction techniques known in the art can be used as a means for mutating the amino acid residues of a parent polypeptide. For example, in a polynucleotide encoding the amino acid sequence of a parent polypeptide (hereinafter also referred to as a parent gene), the nucleotide sequence encoding the amino acid residue to be mutated is mutated to a nucleotide sequence encoding the mutated amino acid residue, thereby obtaining a polynucleotide encoding the polypeptide of the present invention.

[0100] The target mutation can be introduced into the parental gene by various site-directed mutagenesis methods known to those skilled in the art. Site-directed mutagenesis methods can be performed using any method such as inverse PCR or annealing. Commercially available site-directed mutagenesis kits (such as QuikChange II Site-Directed Mutagenesis Kit or QuikChange Multi Site-Directed Mutagenesis Kit from Agilent Technologies, Inc.) can also be used.

[0101] Site-directed mutagenesis into a parent gene is most commonly performed using a mutagenesis primer containing the nucleotide mutation to be introduced. The mutagenesis primer is designed to anneal to a region containing a nucleotide sequence encoding the amino acid residue to be mutated in the parent gene and to contain a nucleotide sequence (codon) encoding the amino acid residue after the mutation instead of the nucleotide sequence (codon) encoding the amino acid residue to be mutated. Nucleotide sequences (codons) encoding the amino acid residues before and after the mutation can be appropriately identified and selected by a person skilled in the art based on common textbooks. Alternatively, site-directed mutagenesis can also be performed using SOE (splicing by overlap extension)-PCR (Gene, 1989, 77(1): p61-68) by ligating DNA fragments amplified upstream and downstream of the mutation site using two complementary primers containing the nucleotide mutation to be introduced.

[0102] Template DNA containing the parent gene can be prepared by extracting genomic DNA from the aforementioned 4-hydroxybenzoate hydroxylase-producing microorganisms using conventional methods, or by extracting RNA and synthesizing cDNA by reverse transcription. Alternatively, a nucleotide sequence corresponding to the amino acid sequence of the parent polypeptide can be chemically synthesized and used as template DNA. DNA sequences encoding the base sequences of HFM122, HFM388, HFM339, HFM77, HFM737, and HFMss0-1, which have been described as polypeptides having 4-aminobenzoic acid hydroxylation activity, are denoted as SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, and SEQ ID NO: 11, respectively.

[0103] Mutation primers can be prepared by known oligonucleotide synthesis methods such as the phosphoramidite method (Nucleic Acids Research, 1989, 17: 7059-7071). Such primer synthesis can also be performed using, for example, a commercially available oligonucleotide synthesizer (e.g., an apparatus manufactured by ABI). Using a primer set including these mutagenesis primers, the parental gene is used as a template DNA to perform site-directed mutagenesis as described above, thereby obtaining a polynucleotide encoding the polypeptide of the present invention having the desired mutation.

[0104] The polynucleotide encoding the polypeptide of the present invention may comprise single-stranded or double-stranded DNA, cDNA, RNA, or other artificial nucleic acid. The DNA, cDNA, and RNA may be obtained by chemical synthesis. Furthermore, in addition to the open reading frame (ORF), the polynucleotide may also comprise the nucleotide sequence of the untranslated region (UTR). Furthermore, the polynucleotide may be codon-optimized by matching the type of transformant used to produce the mutant polypeptide of the present invention. Information on the codons used by various organisms can be obtained from the Codon Usage Database ([www.kazusa.or.jp / codon / ]).

[0105] <Vector or DNA fragment>

[0106] The resulting polynucleotide encoding the polypeptide of the present invention can be recombined into a vector. The vector containing the polynucleotide is an expression vector. In addition, the vector is preferably an expression vector capable of introducing the polynucleotide encoding the polypeptide of the present invention into a host microorganism and expressing the polynucleotide within the host microorganism. The vector preferably comprises the polynucleotide encoding the polypeptide of the present invention and a control region operably linked thereto. The vector can be a vector capable of self-propagation and replication outside the chromosome, such as a plasmid, or a vector that is recombined inside the chromosome.

[0107] Specific examples of the vector include pBluescript II SK(-) (Stratagene), pUC18 / 19, pUC118 / 119 and other pUC vectors (Takara Bio), pET vectors (Takara Bio), pGEX vectors (GE Healthcare), pCold vectors (Takara Bio), pHY300PLK (Takara Bio), pUB110 (Mckenzie, T. et al., 1986, Plasmid 15(2):93-103), pBR322 (Takara Bio), pRS403 (Stratagene), pMW218 / 219 (Nippon Gene), pRI vectors such as pRI909 / 910 (Takara Bio), pBI vectors (Clontech), IN3 vectors (Inplanta Innovations), pPTR1 / 2 (Takara Bio), pDJB2 (DJBallance et al.), and pDJB3 (DJBallance et al.). al., Gene, 36, 321-331, 1985), pAB4-1 (van Hartingsveldt W et al., Mol Gen Genet, 206, 71-75, 1987), pLeu4 (MIGRoncero et al., Gene, 84, 335-343, 1989), pPyr225 (CD Skory et al., Mol Genet) Genomics, 268, 397-406, 2002), pFG1 (Gruber, F. et al., Curr Genet, 18, 447-451, 1990), etc.

[0108] Furthermore, the polynucleotide encoding the polypeptide of the present invention may also be constructed as a DNA fragment comprising the polynucleotide. Examples of such DNA fragments include PCR amplified DNA fragments and restriction endonuclease-cleaved DNA fragments. Preferably, the DNA fragment may be an expression cassette comprising the polynucleotide encoding the polypeptide of the present invention and a control region operably linked thereto.

[0109] The control region contained in the above-mentioned vector or DNA fragment is a sequence for expressing a polynucleotide encoding a polypeptide of the present invention in a host cell into which the vector or DNA fragment has been introduced. Examples thereof include expression regulatory regions such as promoters and terminators, and replication origins. The type of the control region can be appropriately selected depending on the type of host microorganism into which the vector or DNA fragment is introduced. If desired, the vector or DNA fragment may also contain a selective marker such as an antibiotic resistance gene or a gene related to amino acid synthesis (e.g., drug resistance genes such as ampicillin, neomycin, kanamycin, and chloramphenicol).

[0110] The vector or DNA fragment may contain a polynucleotide sequence encoding a polypeptide required for the biosynthesis of 4-aminobenzoic acids. Examples of polypeptides required for the biosynthesis of 4-aminobenzoic acids include 4-amino-4-deoxychorismate synthase (pabAB) and 4-amino-4-deoxychorismate lyase (pabC).

[0111] The polynucleotide encoding the polypeptide of the present invention can be linked to the above-mentioned control region or marker gene sequence by methods such as the above-mentioned SOE-PCR method. The steps for introducing the gene sequence into the vector are well known in the art. The types of control regions such as the promoter region, terminator, and secretion signal region are not particularly limited, and commonly used promoters or secretion signal sequences can be appropriately selected and used according to the host to be introduced.

[0112] Preferred examples of the control region include strong control regions that can enhance expression compared to the wild type, such as the T7 promoter, lac promoter, tac promoter, and trp promoter, which are well-known high-expression promoters, but are not limited to these. <Transformed Cells>

[0113] The transformed cell of the present invention can be obtained by introducing a vector containing a polynucleotide encoding the polypeptide of the present invention into a host, or by introducing a DNA fragment containing a polynucleotide encoding the polypeptide of the present invention into the genome of the host.

[0114] The transformed cell is a cell into which a polynucleotide encoding the polypeptide of the present invention has been introduced so as to be expressible, and can be said to be a cell in which expression of the polynucleotide, and furthermore, expression of the polypeptide of the present invention, has been enhanced.

[0115] As the host cell, any of fungi, yeast, actinomycetes, Escherichia coli, Bacillus subtilis, etc. can be used, preferably Escherichia coli and actinomycetes. As actinomycetes, Corynebacterium, Mycobacterium, Rhodococcus, Streptomyces, Propionibacterium, etc. can be mentioned, preferably Corynebacterium, more preferably Corynebacterium glutamicum.

[0116] Among these, microorganisms that can provide 4-aminobenzoic acids, which serve as substrates for the biosynthesis of 4-amino-3-hydroxybenzoic acids, are preferred, and microorganisms whose ability to provide 4-aminobenzoic acids has been enhanced are more preferred. Examples of methods for enhancing a microorganism's ability to provide 4-aminobenzoic acids include: introducing into the microorganism a vector comprising a polynucleotide encoding a polypeptide required for the biosynthesis of 4-aminobenzoic acids and an operably linked control region; and replacing the control region of a polynucleotide encoding a polypeptide required for the biosynthesis of 4-aminobenzoic acids, already possessed by the microorganism, with a strong expression promoter.

[0117] As a method for introducing a vector or a DNA fragment into a host, for example, electroporation, transformation, transfection, splicing, protoplast method, particle gun method, Agrobacterium method and the like can be used.

[0118] In addition, as the method for importing the polynucleotide into the genome of the host, there is no particular limitation, and for example, a double exchange method using a DNA fragment comprising the polynucleotide can be enumerated. The DNA fragment can be imported into the downstream of the promoter sequence of the gene with the highest expression level in the above-mentioned host cell, or a fragment formed by operatively connecting the DNA fragment and the above-mentioned control region can be prepared in advance, and the connected fragment is imported into the genome of the host. In addition, the DNA fragment can also be connected in advance to a marker (drug resistance gene or auxotrophic complementation gene, etc.) for selecting the cell into which the polynucleotide of the present invention has been correctly imported.

[0119] Transformed cells into which the target vector or DNA fragment has been introduced can be selected using a selection marker. For example, when the selection marker is an antibiotic resistance gene, by culturing in a culture medium supplemented with the antibiotic, transformed cells into which the target vector or DNA fragment has been introduced can be selected. Alternatively, when the selection marker is a gene related to amino acid synthesis, after introducing the gene into a host microorganism that requires the amino acid, the presence or absence of the amino acid requirement can be used as an indicator to select transformed cells into which the target vector or DNA fragment has been introduced. Alternatively, by studying the DNA sequence of the transformed cells using PCR or the like, the introduction of the target vector or DNA fragment can also be confirmed.

[0120] When the transformed cells thus obtained are cultured in an appropriate culture medium, the polynucleotide introduced into the cells is expressed, producing the polypeptide of the present invention. That is, the transformed cells become a strain producing the polypeptide having 4-aminobenzoic acid hydroxylation activity. Furthermore, as shown in the examples described below, when the transformed cells of the present invention are cultured, the productivity of 4-amino-3-hydroxybenzoic acid is improved compared to when using transformed cells that produce the parent polypeptide.

[0121] That is, in a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 47% identity thereto and having 4-aminobenzoic acid hydroxylation activity, a mutation in which the amino acid residue at position 47 of the amino acid sequence shown in SEQ ID NO: 2 or a position corresponding thereto is substituted with leucine is useful for enhancing the 4-aminobenzoic acid hydroxylation activity and, in turn, is useful for improving the productivity of 4-amino-3-hydroxybenzoic acids.

[0122] In addition, in a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 51% identity thereto and having 4-aminobenzoic acid hydroxylation activity, a mutation in which the amino acid residue at position 201 or 222, or at a position corresponding to position 201 or 222, of the amino acid sequence shown in SEQ ID NO: 2 is replaced by phenylalanine is useful for enhancing the 4-aminobenzoic acid hydroxylation activity and, in turn, for improving the productivity of 4-amino-3-hydroxybenzoic acids.

[0123] In addition, in a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity thereto and having 4-aminobenzoic acid hydroxylation activity, a mutation in which the amino acid residues at positions 47, 72, 210, 294 or 385 of the amino acid sequence shown in SEQ ID NO: 2, or at positions corresponding to positions 47, 72, 210, 294 or 385, are substituted with the following amino acids is useful for enhancing the 4-aminobenzoic acid hydroxylation activity and, in turn, for improving the productivity of 4-amino-3-hydroxybenzoic acids.

[0124] (a) Position 47 or a position corresponding thereto: isoleucine, serine, threonine, cysteine, methionine, glutamine,

[0125] (b) Position 72 or a position corresponding thereto: alanine, methionine,

[0126] (c) Position 210 or a position corresponding thereto: methionine,

[0127] (d) Position 294 or a position corresponding thereto: alanine, glycine, cysteine, serine,

[0128] (e) Position 385 or a position corresponding thereto: valine, leucine, isoleucine, methionine.

[0129] Therefore, the transformed cell of the present invention is a strain that produces a polypeptide having enhanced 4-aminobenzoic acid hydroxylation activity, and is a useful strain for producing 4-amino-3-hydroxybenzoic acids.

[0130] <Production of 4-amino-3-hydroxybenzoic acids>

[0131] The method for producing 4-amino-3-hydroxybenzoic acids of the present invention includes the step of culturing the transformed cells of the present invention, and 4-amino-3-hydroxybenzoic acids can be obtained by recovering the 4-amino-3-hydroxybenzoic acids from the culture medium.

[0132] In the present invention, specific examples of 4-amino-3-hydroxybenzoic acids include 4-amino-3-hydroxybenzoic acid derivatives represented by the following general formula (1).

[0133]

[0134] 〔where R 1 represents a hydrogen atom, a hydroxyl group (-OH), a methoxy group (-OCH3), an amino group (-NH2), a fluorine atom (-F), a chlorine atom (-Cl), a bromine atom (-Br), an iodine atom (-I), a carboxyl group (-COOH), a methyl group (-CH3), an ethyl group (-CH2CH3), R 2 represents a hydrogen atom, a hydroxyl group (-OH), a methoxy group (-OCH3), an amino group (-NH2), a fluorine atom (-F), a chlorine atom (-Cl), a bromine atom (-Br), an iodine atom (-I), a carboxyl group (-COOH), a methyl group (-CH3), or an ethyl group (-CH2CH3), X 1 and X 2 is a hydrogen atom or a hydroxyl group, and at least one of them represents a hydroxyl group.]

[0135] As R 1 The functional group shown is preferably a hydrogen atom, a hydroxyl group (-OH), a methoxy group (-OCH3), a fluorine atom (-F) or a methyl group (-CH3).

[0136] As R 2 The functional group shown is preferably a hydrogen atom, a hydroxyl group (-OH), a methoxy group (-OCH3), a fluorine atom (-F) or a methyl group (-CH3).

[0137] More preferably R 1 and R 2 All are hydrogen atoms.

[0138] In addition, X 1 and X 2They can all be hydroxyl groups, but X is preferably 1 and X 2 Any one of them is a hydroxyl group.

[0139] Furthermore, 4-aminobenzoic acid, which is a biosynthetic substrate of 4-amino-3-hydroxybenzoic acid, may be present in the culture medium as needed.

[0140] Here, examples of 4-aminobenzoic acids include 4-aminobenzoic acid derivatives represented by the following general formula (2).

[0141]

[0142] 〔where R 1 and R 2 The meaning is the same as above.

[0143] As long as the culture medium for culturing the transformed cells contains a carbon source, a nitrogen source, an inorganic salt, etc. and can efficiently cultivate the transformed cells of the present invention, any of natural culture medium and synthetic culture medium can be used. As the carbon source, for example, sugars such as glucose, polyols such as glycerol, alcohols such as ethanol, or organic acids such as pyruvic acid, succinic acid or citric acid can be used. In addition, as the nitrogen source, for example, alkylamines such as peptone, meat extract, yeast extract, casein hydrolyzate, soybean meal alkaline extract, methylamine, or ammonia or its salt can be used. In addition, salts such as phosphate, carbonate, sulfate, magnesium, calcium, potassium, iron, manganese, zinc, specific amino acids, specific vitamins, defoaming agents, etc. can also be used as needed.

[0144] Cultivation can be generally performed at 10° C. to 40° C. for 6 to 72 hours, preferably 9 to 60 hours, and more preferably 12 to 48 hours, with stirring or shaking as needed. Furthermore, antibiotics such as ampicillin and kanamycin may be added to the culture medium as needed.

[0145] The recovery and purification methods of 4-amino-3-hydroxybenzoic acids from the culture are not particularly limited. Specifically, the recovery and purification methods can be implemented by combining known ion exchange resin methods, precipitation methods, crystallization methods, recrystallization methods, concentration methods, or other methods. For example, after removing the bacterial cells by centrifugation, ionic substances are removed using cation and anion exchange resins, and then concentrated to obtain 4-amino-3-hydroxybenzoic acids. The 4-amino-3-hydroxybenzoic acids accumulated in the culture can be used directly without isolation.

[0146] In addition, the present invention includes the following products, production methods, uses, methods, etc. as exemplary embodiments, but the present invention is not limited to these embodiments.

[0147] <1> A polypeptide having 4-aminobenzoic acid hydroxylation activity as shown in the following A) to C).

[0148] A) A polypeptide having 4-aminobenzoic acid hydroxylation activity, wherein the amino acid residue at position 47 of the amino acid sequence set forth in SEQ ID NO: 2 or a position corresponding thereto is leucine in the amino acid sequence set forth in SEQ ID NO: 2 or an amino acid sequence having at least 47% identity thereto.

[0149] B) It is a polypeptide having 4-aminobenzoic acid hydroxylation activity, wherein the amino acid residue at position 201 or 222 of the amino acid sequence set forth in SEQ ID NO: 2, or a position corresponding to position 201 or 222 of the amino acid sequence set forth in SEQ ID NO: 2, or an amino acid sequence having at least 51% identity thereto, is phenylalanine.

[0150] C) It is a polypeptide having 4-aminobenzoic acid hydroxylation activity, wherein the amino acid residue at position 47, 72, 210, 294 or 385 of the amino acid sequence shown in sequence number 2, or at a position corresponding to position 47, 72, 210, 294 or 385 in the amino acid sequence shown in sequence number 2 or an amino acid sequence having at least 90% identity thereto, is the following amino acid.

[0151] (a) Position 47 or a position corresponding thereto: isoleucine, serine, threonine, cysteine, methionine, glutamine,

[0152] (b) Position 72 or a position corresponding thereto: alanine, methionine,

[0153] (c) Position 210 or a position corresponding thereto: methionine,

[0154] (d) Position 294 or a position corresponding thereto: alanine, glycine, cysteine, serine,

[0155] (e) Position 385 or a position corresponding thereto: valine, leucine, isoleucine, methionine.

[0156] <2> A polypeptide having 4-aminobenzoic acid hydroxylation activity as shown in the following A") to C").

[0157] A″) A mutant polypeptide having 4-aminobenzoic acid hydroxylation activity, wherein the amino acid residue at position 47 of the amino acid sequence set forth in SEQ ID NO: 2 or a position corresponding thereto in the amino acid sequence set forth in SEQ ID NO: 2 or an amino acid sequence having at least 47% identity thereto is substituted with leucine.

[0158] B″) A polypeptide having 4-aminobenzoic acid hydroxylation activity, wherein the amino acid residue at position 201 or 222, or a position corresponding to position 201 or 222, of the amino acid sequence set forth in SEQ ID NO: 2, or an amino acid sequence having at least 51% identity thereto, is substituted with phenylalanine.

[0159] C″) A polypeptide having 4-aminobenzoic acid hydroxylation activity, wherein the amino acid residue at position 47, 72, 210, 294 or 385 of the amino acid sequence set forth in SEQ ID NO: 2, or an amino acid sequence having at least 90% identity thereto, or a position corresponding to position 47, 72, 210, 294 or 385 of the amino acid sequence set forth in SEQ ID NO: 2, is substituted with the following amino acids.

[0160] (a) Position 47 or a position corresponding thereto: isoleucine, serine, threonine, cysteine, methionine, glutamine,

[0161] (b) Position 72 or a position corresponding thereto: alanine, methionine,

[0162] (c) Position 210 or a position corresponding thereto: methionine,

[0163] (d) Position 294 or a position corresponding thereto: alanine, glycine, cysteine, serine,

[0164] (e) Position 385 or a position corresponding thereto: valine, leucine, isoleucine, methionine.

[0165] <3> The mutant polypeptide according to <2>, wherein the substitution of the amino acid residue represented by A") is a substitution from valine to leucine, the substitution of the amino acid residue represented by B") is a substitution from tyrosine to phenylalanine, and the substitution of the amino acid residue represented by C") is a substitution from threonine at position 294 or a corresponding position to serine, a substitution from valine at position 47 or a corresponding position to isoleucine, threonine, methionine or glutamine, or a substitution from histidine at position 72 or a corresponding position to methionine.

[0166] <4> A method for producing a mutant polypeptide having 4-aminobenzoic acid hydroxylation activity, comprising substituting the amino acid residues shown in A') to C') below.

[0167] A′) In a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 or an amino acid sequence having at least 47% identity thereto and having 4-aminobenzoic acid hydroxylation activity, the amino acid residue at position 47 of the amino acid sequence set forth in SEQ ID NO: 2 or a position corresponding thereto is substituted with leucine.

[0168] B′) In a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 or an amino acid sequence having at least 51% identity thereto and having 4-aminobenzoic acid hydroxylation activity, the amino acid residue at position 201 or 222, or a position corresponding to position 201 or 222, of the amino acid sequence set forth in SEQ ID NO: 2 is substituted with phenylalanine.

[0169] C′) In a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity thereto and having 4-aminobenzoic acid hydroxylation activity, the amino acid residue at position 47, 72, 210, 294 or 385 of the amino acid sequence set forth in SEQ ID NO: 2, or at a position corresponding to position 47, 72, 210, 294 or 385, is substituted with the following amino acid.

[0170] (a) Position 47 or a position corresponding thereto: isoleucine, serine, threonine, cysteine, methionine, glutamine,

[0171] (b) Position 72 or a position corresponding thereto: alanine, methionine,

[0172] (c) Position 210 or a position corresponding thereto: methionine,

[0173] (d) Position 294 or a position corresponding thereto: alanine, glycine, cysteine, serine,

[0174] (e) Position 385 or a position corresponding thereto: valine, leucine, isoleucine, methionine.

[0175] <5> The method as described in <4>, wherein the substitution of the amino acid residue represented by A′) is a substitution from valine to leucine, the substitution of the amino acid residue represented by B′) is a substitution from tyrosine to phenylalanine, and the substitution of the amino acid residue represented by C′) is a substitution from threonine at position 294 or a corresponding position to serine, a substitution from valine at position 47 or a corresponding position to isoleucine, threonine, methionine or glutamine, or a substitution from histidine at position 72 or a corresponding position to methionine.

[0176] <6> A method for enhancing the hydroxylation activity of 4-aminobenzoic acid, comprising substituting the amino acid residues shown in the following A') to C').

[0177] A′) In a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 or an amino acid sequence having at least 47% identity thereto and having 4-aminobenzoic acid hydroxylation activity, the amino acid residue at position 47 of the amino acid sequence set forth in SEQ ID NO: 2 or a position corresponding thereto is substituted with leucine.

[0178] B′) In a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 or an amino acid sequence having at least 51% identity thereto and having 4-aminobenzoic acid hydroxylation activity, the amino acid residue at position 201 or 222, or a position corresponding to position 201 or 222, of the amino acid sequence set forth in SEQ ID NO: 2 is substituted with phenylalanine.

[0179] C′) In a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity thereto and having 4-aminobenzoic acid hydroxylation activity, the amino acid residue at position 47, 72, 210, 294 or 385 of the amino acid sequence set forth in SEQ ID NO: 2, or at a position corresponding to position 47, 72, 210, 294 or 385, is substituted with the following amino acid.

[0180] (a) Position 47 or a position corresponding thereto: isoleucine, serine, threonine, cysteine, methionine, glutamine,

[0181] (b) Position 72 or a position corresponding thereto: alanine, methionine,

[0182] (c) Position 210 or a position corresponding thereto: methionine,

[0183] (d) Position 294 or a position corresponding thereto: alanine, glycine, cysteine, serine,

[0184] (e) Position 385 or a position corresponding thereto: valine, leucine, isoleucine, methionine.

[0185] <7> The method as described in <6>, wherein the substitution of the amino acid residue represented by A′) is a substitution from valine to leucine, the substitution of the amino acid residue represented by B′) is a substitution from tyrosine to phenylalanine, and the substitution of the amino acid residue represented by C′) is a substitution from threonine at position 294 or a corresponding position to serine, a substitution from valine at position 47 or a corresponding position to isoleucine, threonine, methionine or glutamine, or a substitution from histidine at position 72 or a corresponding position to methionine.

[0186] <8> A method for improving the productivity of 4-amino-3-hydroxybenzoic acids, comprising substituting the amino acid residues shown in the following A') to C').

[0187] A′) When using a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 or an amino acid sequence having at least 47% identity thereto and having 4-aminobenzoic acid hydroxylation activity to produce 4-amino-3-hydroxybenzoic acids, the amino acid residue at position 47 of the amino acid sequence set forth in SEQ ID NO: 2 or a position corresponding thereto is substituted with leucine.

[0188] B′) In a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 or an amino acid sequence having at least 51% identity thereto and having 4-aminobenzoic acid hydroxylation activity, the amino acid residue at position 201 or 222, or a position corresponding to position 201 or 222, of the amino acid sequence set forth in SEQ ID NO: 2 is substituted with phenylalanine.

[0189] C′) In a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity thereto and having 4-aminobenzoic acid hydroxylation activity, the amino acid residue at position 47, 72, 210, 294 or 385 of the amino acid sequence set forth in SEQ ID NO: 2, or at a position corresponding to position 47, 72, 210, 294 or 385, is substituted with the following amino acid.

[0190] (a) Position 47 or a position corresponding thereto: isoleucine, serine, threonine, cysteine, methionine, glutamine,

[0191] (b) Position 72 or a position corresponding thereto: alanine, methionine,

[0192] (c) Position 210 or a position corresponding thereto: methionine,

[0193] (d) Position 294 or a position corresponding thereto: alanine, glycine, cysteine, serine,

[0194] (e) Position 385 or a position corresponding thereto: valine, leucine, isoleucine, methionine.

[0195] <9> The method as described in <8>, wherein the substitution of the amino acid residue represented by A′) is a substitution from valine to leucine, the substitution of the amino acid residue represented by B′) is a substitution from tyrosine to phenylalanine, and the substitution of the amino acid residue represented by C′) is a substitution from threonine at position 294 or a corresponding position to serine, a substitution from valine at position 47 or a corresponding position to isoleucine, threonine, methionine or glutamine, or a substitution from histidine at position 72 or a corresponding position to methionine.

[0196] <10> A polynucleotide encoding the polypeptide according to any one of <1> to <3>.

[0197] <11> A vector or DNA fragment comprising the polynucleotide described in <10>.

[0198] <12> A transformed cell comprising the vector or DNA fragment described in <11>.

[0199] <13> The transformed cell according to <12>, which is Escherichia coli or a Corynebacterium bacterium.

[0200] <14> A transformed cell according to <12> or <13>, which is a microorganism capable of producing 4-aminobenzoic acids.

[0201] <15> The transformed cell according to <12> or <13>, wherein the ability of the transformed cell to provide 4-aminobenzoic acid is enhanced.

[0202] <16> A method for producing 4-amino-3-hydroxybenzoic acids, comprising the step of culturing the transformed cell according to any one of <12> to <15>.

[0203] <17> The method according to <16>, wherein the culture is carried out using a medium containing a sugar as a carbon source.

[0204] <18> The method according to <16> or <17>, comprising the step of recovering 4-amino-3-hydroxybenzoic acids from the culture medium.

[0205] <19> The method according to any one of <16> to <18>, wherein the culture is performed in the presence of a 4-aminobenzoic acid compound.

[0206] <20> The method according to any one of <16> to <19>, wherein the 4-amino-3-hydroxybenzoic acid is a 4-amino-3-hydroxybenzoic acid derivative represented by the following general formula (1).

[0207]

[0208] 〔where R 1 represents a hydrogen atom, a hydroxyl group, a methoxy group, an amino group, a fluorine atom, a chlorine atom, a bromine atom, an iodine atom, a carboxyl group, a methyl group, an ethyl group, and R 2 represents a hydrogen atom, a hydroxyl group, a methoxy group, an amino group, a fluorine atom, a chlorine atom, a bromine atom, an iodine atom, a carboxyl group, a methyl group, or an ethyl group, and X 1 and X 2 is a hydrogen atom or a hydroxyl group, and at least one of them represents a hydroxyl group.]

[0209] <21> The method according to <19> or <20>, wherein the 4-aminobenzoic acid is a 4-aminobenzoic acid derivative represented by the following general formula (2).

[0210]

[0211] 〔where R 1 represents a hydrogen atom, a hydroxyl group, a methoxy group, an amino group, a fluorine atom, a chlorine atom, a bromine atom, an iodine atom, a carboxyl group, a methyl group, an ethyl group, and R 2represents a hydrogen atom, a hydroxyl group, a methoxy group, an amino group, a fluorine atom, a chlorine atom, a bromine atom, an iodine atom, a carboxyl group, a methyl group, or an ethyl group.]

[0212] Example

[0213] Hereinafter, the present invention will be described in more detail based on examples, but the present invention is not limited thereto.

[0214] Example A1 Production of 4-amino-3-hydroxybenzoic acid

[0215] In the following Examples, PCR was performed using Prime STAR Max Premix (Takara Bio).

[0216] (1) Preparation of a plasmid containing a gene encoding a wild-type enzyme

[0217] (a) Preparation of plasmid pECsf_gapS_pabABC

[0218] The genome extracted from Corynebacterium glutamicum ATCC13032 strain according to conventional methods was used as a template, and primers GN14_127 (sequence number 13, TATTAATTAAATGCGCGTTTTAATTATTGATAATTATGATTC) and GN14_133 (sequence number 14, TTGCGGCCGCTTGTTTAAACCTCCTTACAGAAAAATGGTTGGGCG) were used to amplify the DNA fragment containing the genes encoding 4-amino-4-deoxychorismate synthase and 4-amino-4-deoxychorismate lyase by PCR, and the fragment was inserted between the PacI site and the NotI site of the plasmid pECsf_gapS (see Japanese Patent Application No. 2015-25491), thereby obtaining the plasmid pECsf_gapS_pabABC.

[0219] (b) Preparation of plasmid pECsf_gapS_pabABC_HFM122

[0220] The vector DNA fragment was synthesized by PCR using the plasmid pECsf_gapS_pabABC obtained above as a template and primers pabABCcory vec R (SEQ ID NO: 15, AAATTTAAACCTCCTTTACAGAAAAATGGTTGG) and pabABCcory vec F (SEQ ID NO: 16, GGAGGTTTAAACAAGCGGCCGCGATATC). Next, a plasmid containing the gene encoding the polypeptide HFM122 with 4-aminobenzoic acid hydroxylation activity (SEQ ID NO: 1) was prepared by artificial gene synthesis. Using this as a template, an insert DNA fragment was synthesized by PCR using primers pECsfD HFM122 F (SEQ ID NO: 17, AGGAGGTTTAAATTTATGCGCACTCAGGTGGCTAT) and pECsfD HFM122 R (SEQ ID NO: 18, CTTGTTTAAACCTCCTTATACGAGTGGCAGTCCTA). These PCR products were treated with DpnI (Takara Bio), and each DNA fragment was purified using NucleoSpin Geland PCR Clean-up (Takara Bio). The fragments were then ligated using the In-Fusion HD Cloning Kit (Takara Bio) to construct the plasmid pECsf_gapS_pabABC_HFM122. The resulting plasmid solution was used to transform the ECOS Competent E. coli DH5α strain (Nippon Gene). The cell solution was spread on LBKm agar medium (Bacto Trypton 1%, yeast extract 0.5%, NaCl 1%, kanamycin sulfate 50 μg / mL, agar 1.5%) and allowed to stand overnight at 37°C. For the resulting colonies, a PCR reaction was performed using Sapphire Amp (Takara Bio) and primers pabABC+pobA for CPCR F (SEQ ID NO: 19, GCTATCAAAACATTCGGCACATTGGTTTTCC) and pabABC+pobAfor CPCR R (SEQ ID NO: 20, GGAAGATGCGTGATCTGATCCTTCAACTC), and transformants in which the introduction of the target DNA fragment was confirmed were selected. The resulting transformant was inoculated into 2 mL of LBKm liquid medium (Bacto Trypton 1%, yeast extract 0.5%, NaCl 1%, kanamycin sulfate 50 μg / mL) and cultured overnight at 37° C. Plasmids were purified from this culture using NucleoSpin Plasmid EasyPure (Takara Bio).

[0221] (c) Preparation of plasmid pECsf_gapS_pabABC_tuD_HFM122

[0222] The plasmid pECsf_gapS_pabABC_HFM122 obtained above was used as a template, and primers pabClastR (SEQ ID NO: 21, TTACAGAAAAATGGTTGGGCGCAA) and HFM122F (SEQ ID NO: 22, ATGCGCACTCAGGTGGCTATCG) were used to synthesize a vector DNA fragment by PCR. Next, a DNA fragment (SEQ ID NO: 23, TACGTACCTGCAGGTAGCGTGTCAGTAGGCGCGTAGGGTAAGTGGGGTAGCGGCTTGTTAGATATCTTGAAATCGGCTTTCAACAGCATTGATTTCGATGTATTTAGCTGGCCGTTACCCTGCGAATGTCCACAGGGTAGC) was prepared using the promoter of the tuf gene (cg0587) possessed by the Corynebacterium glutamicum strain ATCC13032 (hereinafter referred to as the tu promoter). The insert DNA fragment was synthesized by PCR using primers pabC-Ptu F (SEQ ID NO: 24, ACCATTTTTCTGTAATGCGCTAGATCTGTGTGCTCAGTCTTCCAGGCTGCTTATCACAGTGAAAGCAAAACCAATTCGTGGCTGCGAAAGTCGTAGCCACCACGAAGTCCAAAGGAGGATCTAAATTATGAATAATATAAAAGGAGGAATTAATTAA) as a template and primers pabC-Ptu F (SEQ ID NO: 24, ACCATTTTTCTGTAATACGTACCTGCAGGTAGCGTG) and Ptu-HFM122R (SEQ ID NO: 25, CACCTGAGTGCGCATTTAATTAATTCCTCCTTTTA). These PCR products were treated with DpnI (Takara Bio), and each DNA fragment was purified using NucleoSpin Gel and PCR Clean-up (Takara Bio). The fragments were then ligated using the In-Fusion HD Cloning Kit (Takara Bio) to construct the plasmid pECsf_gapS_pabABC_tuD_HFM122.The obtained plasmid solution was used to transform the ECOSCompetent E.coli DH5α strain (Nippon Gene). After the cell solution was applied to LBKm agar medium, it was allowed to stand at 37°C overnight. For the obtained colonies, Sapphire Amp (Takara Bio) and primers Ptu seq 1 (sequence number 26, GCTTGTTAGATATCTTGAAATCGGCTTTC) and pabABC+pobA for CPCR R (sequence number 20, GGAAGATGCGTGATCTGATCCTTCAACTC) were used to perform PCR reactions, and transformants in which the target DNA fragment was introduced were selected. The obtained transformants were inoculated into 2 ml of LBKm liquid medium and cultured at 37°C overnight. The plasmid was purified from the culture solution using NucleoSpin Plasmid EasyPure (Takara Bio).

[0223] In the constructed plasmid, genes encoding 4-amino-4-deoxychorismate synthase and 4-amino-4-deoxychorismate lyase were linked under the control of the gap promoter, and the gene encoding wild-type HFM122 was linked under the control of the tu promoter.

[0224] (d) Preparation of other plasmids

[0225] Using the plasmid pECsf_gapS_pabABC_tuD_HFM122 obtained above as a template, a vector DNA fragment was synthesized by PCR using primers pGapABA_tu vec F (SEQ ID NO: 27, GGAGGTTTAAACAAGCGG) and pGapABA_tu vec R (SEQ ID NO: 28, AATTTAGATCCTCCTTTGGACTTCGTG). Next, plasmids containing genes encoding polypeptides having 4-aminobenzoic acid hydroxylation activity (SEQ ID NOs: 3, 5, 7, 9, and 11) were prepared by artificial gene synthesis. Using these plasmids as templates, insert DNA fragments were synthesized by PCR using the primers listed in the "Primers" column of Table A1. These PCR products were treated with DpnI (Takara Bio), and each DNA fragment was purified using NucleoSpin Gel and PCR Clean-up (Takara Bio). The plasmids listed in the "Plasmid" column of Table A1 were constructed by ligation using the In-Fusion HD Cloning Kit (Takara Bio). The resulting plasmids were used to transform the ECOS Competent E. coli DH5α strain (Nippon Gene). The cell suspension was spread on LBKm agar medium and incubated overnight at 37°C. PCR reactions were performed on the resulting colonies using Sapphire Amp (Takara Bio) and primers Ptu seq 1 (SEQ ID NO: 26, GCTTGTTAGATATCTTGAAATCGGCTTTC) and pabABC+pobA for CPCR R (SEQ ID NO: 20, GGAAGATGCGTGATCTGATCCTTCAACTC). Transformants in which the target DNA fragment had been introduced were selected. The obtained transformant was inoculated into 2 ml of LBKm liquid medium and cultured overnight at 37° C. The culture solution was used to purify the plasmid using NucleoSpin Plasmid EasyPure (Takara Bio).

[0226] In the constructed plasmid, genes encoding 4-amino-4-deoxychorismate synthase and 4-amino-4-deoxychorismate lyase were linked under the control of the gap promoter, and a gene encoding wild-type hydroxylase was linked under the control of the tu promoter.

[0227] [Table A1]

[0228]

[0229] (2) Preparation of a plasmid containing a gene encoding a mutant enzyme

[0230] As an example of the preparation of a plasmid containing a gene encoding a mutant enzyme, the preparation of a plasmid containing a gene encoding a mutant enzyme in which valine at position 47 of HFM77 is substituted with leucine is shown below.

[0231] Plasmid pECsf_gapS_pabABC_tu_HFM77_V47L was constructed by PCR using the plasmid pECsf_gapS_pabABC_tu_HFM77 as a template and complementary primers HFM77 V47L F (SEQ ID NO: 39, GCCGGGCTCCTGGAACAGTCTACGGTT) and HFM77 V47L R (SEQ ID NO: 40, TTCCAGGAGCCCGGCGCGGATGGTCTG). The PCR product was treated with DpnI (Takara Bio), and the treated solution was used to transform ECOS Competent E. coli DH5α strain (Nippon Gene). The cell suspension was spread on LBKm agar medium and incubated at 37°C overnight. The resulting colonies were selected as transformants. The transformants were inoculated into 2 mL of LBKm liquid medium and cultured at 37°C overnight. The plasmid was purified from the culture solution using NucleoSpin Plasmid EasyPure (Takara Bio).

[0232] Similarly, plasmids containing genes encoding the respective enzyme mutants were obtained by PCR using the plasmid shown in "Template" in Table A2 instead of plasmid pECsf_gapS_pabABC_tu_HFM77 and the primers shown in "Primers" in Table A2 instead of primers HFM77 V47LF and HFM77 V47LR.

[0233] [Table A2]

[0234]

[0235] (3) Introducing the plasmid into the host cell

[0236] Corynebacterium glutamicum DRHG145 strain (see Japanese Patent Application No. 2014-523757) was transformed using each of the plasmids obtained above by electroporation (Bio-rad). The resulting transformed cell suspension was spread on LBKm agar medium and allowed to stand at 30°C for 2 days. The resulting colonies were used as transformants.

[0237] (4) Cultivation of transformants

[0238] The transformant obtained above was inoculated in 1mL of CGYE medium (containing 50μg / mL of kanamycin sulfate) shown in Table A3, and cultured at 30°C overnight. 100μL of the obtained culture solution was inoculated in 10mL of CGXII medium (containing 50μg / mL of kanamycin sulfate) shown in Table A4, and cultured at 30°C for about 48 hours. The product after the bacterial cell was removed by centrifugation was used as the culture supernatant. The 4-amino-3-hydroxybenzoic acid concentration in the obtained culture supernatant was quantified according to the method of Reference Example 1, and the productivity improvement rate of 4-amino-3-hydroxybenzoic acid was calculated according to the following formula. Here, "WT" means "a transformant of a plasmid comprising a gene encoding a wild-type enzyme", and "MT" means "a transformant of a plasmid comprising a gene encoding a mutant enzyme made from a plasmid comprising a gene encoding the wild-type enzyme".

[0239] (Mathematical formula 1)

[0240] Productivity improvement rate = 4-amino-3-hydroxybenzoic acid productivity in MT / 4-amino-3-hydroxybenzoic acid productivity in WT

[0241] [Table A3]

[0242] CGYE medium composition (per 1L)

[0243] glucose 50g <![CDATA[(NH4)2SO4]]> 20g urea 5g <![CDATA[KH2PO4]]> 1g <![CDATA[K2HPO4]]> 1g <![CDATA[MgSO4·7H2O]]> 0.25g <![CDATA[CaCl2·2H2O]]> 10mg <![CDATA[FeSO4·7H2O]]> 10mg <![CDATA[MnSO4·5H2O]]> 10mg <![CDATA[ZnSO4·7H2O]]> 1mg <![CDATA[CuSO4·5H2O]]> 0.2mg <![CDATA[NiCl2·6H2O]]> 0.02mg Biotin (pH 7) 0.2mg yeast extract 1g

[0244] [Table A4]

[0245] CGXII medium composition (per 1 L)

[0246] glucose 50g <![CDATA[(NH4)2SO4]]> 20g urea 5g <![CDATA[KH2PO4]]> 1g <![CDATA[K2HPO4]]> 1g <![CDATA[MgSO4·7H2O]]> 0.25g <![CDATA[CaCl2·2H2O]]> 10mg <![CDATA[FeSO4·7H2O]]> 10mg <![CDATA[MnSO4·5H2O]]> 10mg <![CDATA[ZnSO4·7H2O]]> 1mg <![CDATA[CuSO4·5H2O]]> 0.2mg <![CDATA[NiCl2·6H2O]]> 0.02mg Biotin (pH 7) 0.2mg Tryptone 10g

[0247] (5) Results

[0248] As shown in Table A5, the strains into which the respective mutant enzymes were introduced had improved 4-amino-3-hydroxybenzoic acid production capabilities compared to the strains into which the wild-type enzymes were introduced.

[0249] [Table A5]

[0250]

[0251] Example B1 Production of 4-amino-3-hydroxybenzoic acid

[0252] In the following Examples, PCR was performed using PrimeSTAR Max Premix (Takara Bio).

[0253] (1) Preparation of a plasmid containing a gene encoding a wild-type enzyme

[0254] (a) Preparation of plasmid pECsf_gapS_pabABC

[0255] The genome extracted from Corynebacterium glutamicum ATCC13032 strain according to conventional methods was used as a template, and primers GN14_127 (sequence number 13, TATTAATTAAATGCGCGTTTTAATTATTGATAATTATGATTC) and GN14_133 (sequence number 14, TTGCGGCCGCTTGTTTAAACCTCCTTACAGAAAAATGGTTGGGCG) were used to amplify the DNA fragment containing the genes encoding 4-amino-4-deoxychorismate synthase and 4-amino-4-deoxychorismate lyase by PCR, and the fragment was inserted between the PacI site and the NotI site of the plasmid pECsf_gapS (see Japanese Patent Application No. 2015-25491), thereby obtaining the plasmid pECsf_gapS_pabABC.

[0256] (b) Preparation of plasmid pECsf_gapS_pabABC_HFM122

[0257] The vector DNA fragment was synthesized by PCR using the plasmid pECsf_gapS_pabABC obtained above as a template and primers pabABCcory vec R (SEQ ID NO: 15, AAATTTAAACCTCCTTTACAGAAAAATGGTTGG) and pabABCcory vec F (SEQ ID NO: 16, GGAGGTTTAAACAAGCGGCCGCGATATC). Next, a plasmid containing the gene encoding the polypeptide HFM122 with 4-aminobenzoic acid hydroxylation activity (SEQ ID NO: 1) was artificially synthesized. Using this as a template, an insert DNA fragment was synthesized by PCR using primers pECsfD HFM122 F (SEQ ID NO: 17, AGGAGGTTTAAATTTATGCGCACTCAGGTGGCTAT) and pECsfD HFM122 R (SEQ ID NO: 18, CTTGTTTAAACCTCCTTATACGAGTGGCAGTCCTA). These PCR products were treated with DpnI (Takara Bio), and each DNA fragment was purified using NucleoSpin Gel and PCR Clean-up (Takara Bio). The fragments were then ligated using the In-Fusion HD Cloning Kit (Takara Bio) to construct the plasmid pECsf_gapS_pabABC_HFM122. The resulting plasmid solution was used to transform the ECOS Competent E. coli DH5α strain (Nippon Gene). The cell solution was spread on LBKm agar medium (Bacto Trypton 1%, yeast extract 0.5%, NaCl 1%, kanamycin sulfate 50 μg / mL, agar 1.5%) and allowed to stand overnight at 37°C. For the resulting colonies, a PCR reaction was performed using Sapphire Amp (TakaraBio) and primers pabABC+pobA for CPCR F (SEQ ID NO: 19, GCTATCAAAACATTCGGCACATTGGTTTTCC) and pabABC+pobA for CPCR R (SEQ ID NO: 20, GGAAGATGCGTGATCTGATCCTTCAACTC), and transformants in which the introduction of the target DNA fragment was confirmed were selected. The resulting transformant was inoculated into 2 mL of LBKm liquid medium (BactoTrypton 1%, yeast extract 0.5%, NaCl 1%, kanamycin sulfate 50 μg / mL) and cultured overnight at 37° C. Plasmids were purified from this culture using NucleoSpin Plasmid EasyPure (Takara Bio).

[0258] (c) Preparation of plasmid pECsf_gapS_pabABC_tuD_HFM122

[0259] The plasmid pECsf_gapS_pabABC_HFM122 obtained above was used as a template, and primers pabClastR (SEQ ID NO: 21, TTACAGAAAAATGGTTGGGCGCAA) and HFM122F (SEQ ID NO: 22, ATGCGCACTCAGGTGGCTATCG) were used to synthesize a vector DNA fragment by PCR. Next, a DNA fragment (SEQ ID NO: 23, TACGTACCTGCAGGTAGCGTGTCAGTAGGCGCGTAGGGTAAGTGGGGTAGCGGCTTGTTAGATATCTTGAAATCGGCTTTCAACAGCATTGATTTCGATGTATTTAGCTGGCCGTTACCCTGCGAATGTCCACAGGGTAGCTGGTAGTTTGAAAATCAACGCCGTTGCCC) containing the promoter of the tuf gene (cg0587) possessed by Corynebacterium glutamicum strain ATCC13032 (hereinafter referred to as the tu promoter) was produced by artificial gene synthesis. The insert DNA fragment was synthesized by PCR using primers pabC-PtuF (SEQ ID NO: 24, ACCATTTTTTGTAATGCGCTAGATCTGTGTGCTCAGTCTTCCAGGCTGCTTATCACAGTGAAAGCAAAACCAATTCGTGGCTGCGAAAGTCGTAGCCACCACGAAGTCCAAAGGAGGATCTAAATTATGAATAATATAAAAGGAGGAATTAATTAA) as a template and primers pabC-PtuF (SEQ ID NO: 24, ACCATTTTTCTGTAATACGTACCTGCAGGTAGCGTG) and Ptu-HFM122R (SEQ ID NO: 25, CACCTGAGTGCGCATTTAATTAATTCCTCCTTTTA). These PCR products were treated with DpnI (Takara Bio), and each DNA fragment was purified using NucleoSpin Gel and PCR Clean-up (Takara Bio). The fragments were then ligated using the In-Fusion HD Cloning Kit (Takara Bio) to construct the plasmid pECsf_gapS_pabABC_tuD_HFM122.The obtained plasmid solution was used to transform the ECOS Competent E.coliDH5α strain (Nippon Gene). After the cell solution was applied to LBKm agar medium, it was allowed to stand at 37°C overnight. For the obtained colonies, Sapphire Amp (Takara Bio) and primers Ptu seq 1 (sequence number 26, GCTTGTTAGATATCTTGAAATCGGCTTTC) and pabABC+pobA for CPCR R (sequence number 20, GGAAGATGCGTGATCTGATCCTTCAACTC) were used to perform PCR reactions, and transformants in which the target DNA fragment had been introduced were selected. The obtained transformants were inoculated into 2 ml of LBKm liquid medium and cultured at 37°C overnight. The plasmid was purified from the culture solution using NucleoSpin Plasmid EasyPure (Takara Bio).

[0260] In the constructed plasmid, genes encoding 4-amino-4-deoxychorismate synthase and 4-amino-4-deoxychorismate lyase were linked under the control of the gap promoter, and the gene encoding wild-type HFM122 was linked under the control of the tu promoter.

[0261] (d) Preparation of other plasmids

[0262] Using the plasmid pECsf_gapS_pabABC_tuD_HFM122 obtained above as a template, a vector DNA fragment was synthesized by PCR using primers pGapABA_tu vec F (SEQ ID NO: 27, GGAGGTTTAAACAAGCGG) and pGapABA_tu vec R (SEQ ID NO: 28, AATTTAGATCCTCCTTTGGACTTCGTG). Next, plasmids containing genes encoding polypeptides having 4-aminobenzoic acid hydroxylation activity (SEQ ID NOs: 3, 5, and 7) were prepared by artificial gene synthesis. Using these plasmids as templates, insert DNA fragments were synthesized by PCR using the primers listed in the "Primers" column of Table B1. These PCR products were treated with DpnI (Takara Bio), and each DNA fragment was purified using NucleoSpin Gel and PCR Clean-up (Takara Bio). The plasmids listed in the "Plasmid" column of Table B1 were constructed by ligation using the In-Fusion HD Cloning Kit (Takara Bio). The resulting plasmid solution was used to transform ECOS-competent E. coli DH5α strain (Nippon Gene). The cell suspension was spread on LBKm agar medium and incubated overnight at 37°C. PCR reactions were performed on the resulting colonies using Sapphire Amp (Takara Bio) and primers Ptu seq 1 (SEQ ID NO: 26, GCTTGTTAGATATCTTGAAATCGGCTTTC) and pabABC+pobA for CPCR R (SEQ ID NO: 20, GGAAGATGCGTGATCTGATCCTTCAACTC). Transformants in which the target DNA fragment had been introduced were selected. The obtained transformant was inoculated into 2 ml of LBKm liquid medium and cultured overnight at 37° C. The plasmid was purified from the culture solution using NucleoSpin Plasmid EasyPure (Takara Bio).

[0263] In the constructed plasmid, genes encoding 4-amino-4-deoxychorismate synthase and 4-amino-4-deoxychorismate lyase were linked under the control of the gap promoter, and a gene encoding wild-type hydroxylase was linked under the control of the tu promoter.

[0264] [Table B1]

[0265]

[0266] (2) Preparation of a plasmid containing a gene encoding a mutant enzyme

[0267] As an example of the preparation of a plasmid containing a gene encoding a mutant enzyme, the preparation of a plasmid containing a gene encoding a mutant enzyme in which tyrosine at position 201 of HFM77 is substituted with phenylalanine is described below.

[0268] Plasmid pECsf_gapS_pabABC_tu_HFM77_Y201F was constructed by PCR using the plasmid pECsf_gapS_pabABC_tu_HFM77 as a template and complementary primers HFM77 Y201F F (SEQ ID NO: 51, CTCATCTTCGCACATCACGACCGCGGA) and HFM77 Y201F R (SEQ ID NO: 52, ATGTGCGAAGATGAGCTCTTCGGATGA). The PCR product was treated with DpnI (Takara Bio), and the resulting liquid was used to transform the ECOSCompetent E. coli DH5α strain (Nippon Gene). The cell suspension was spread on LBKm agar medium and incubated at 37°C overnight. The resulting colonies were selected as transformants. The transformants were inoculated into 2 mL of LBKm liquid medium and cultured at 37°C overnight. Plasmids were purified from the culture solution using NucleoSpin Plasmid EasyPure (Takara Bio).

[0269] Similarly, plasmids containing genes encoding the respective enzyme mutants were obtained by PCR using the plasmid shown in "Template" in Table B2 instead of plasmid pECsf_gapS_pabABC_tu_HFM77 and the primers shown in "Primers" in Table B2 instead of primers HFM77 Y201FF and HFM77 Y201FR.

[0270] [Table B2]

[0271]

[0272] (3) Introducing the plasmid into the host cell

[0273] Corynebacterium glutamicum DRHG145 strain (see Japanese Patent Application No. 2014-523757) was transformed using each of the plasmids obtained above by electroporation (Bio-rad). The resulting transformed cell suspension was spread on LBKm agar medium and allowed to stand at 30°C for 2 days. The resulting colonies were used as transformants.

[0274] (4) Cultivation of transformants

[0275] The transformant obtained above was inoculated in 1mL of CGYE culture medium (containing 50μg / mL of kanamycin sulfate) shown in Table B3, and cultured overnight at 30°C. 100μL of the culture solution obtained was inoculated in 10mL of CGXII culture medium (containing 50μg / mL of kanamycin sulfate) shown in Table B4, and after being cultured at 30°C for about 48 hours, the product after the bacterial cell was removed by centrifugation was used as the culture supernatant. The 4-amino-3-hydroxybenzoic acid concentration in the culture supernatant obtained was quantified according to the method of Reference Example 1, and the productivity improvement rate of 4-amino-3-hydroxybenzoic acid was calculated according to the following formula. Here, "WT" means "a transformant of a plasmid comprising a gene encoding a wild-type enzyme", and "MT" means "a transformant of a plasmid comprising a gene encoding a mutant enzyme made from a plasmid comprising a gene encoding the wild-type enzyme".

[0276] (Mathematical formula 1)

[0277] Productivity improvement rate = 4-amino-3-hydroxybenzoic acid productivity in MT / 4-amino-3-hydroxybenzoic acid productivity in WT

[0278] [Table B3]

[0279] CGYE medium composition (per 1L)

[0280] glucose 50g <![CDATA[(NH4)2SO4]]> 20g urea 5g <![CDATA[KH2PO4]]> 1g <![CDATA[K2HPO4]]> 1g <![CDATA[MgSO4·7H2O]]> 0.25g <![CDATA[CaCl2·2H2O]]> 10mg <![CDATA[FeSO4·7H2O]]> 10mg <![CDATA[MnSO4·5H2O]]> 10mg <![CDATA[ZnSO4·7H2O]]> 1mg <![CDATA[CuSO4·5H2O]]> 0.2mg <![CDATA[NiCl2·6H2O]]> 0.02mg Biotin (pH 7) 0.2mg yeast extract 1g

[0281] [Table B4]

[0282] CGXII medium composition (per 1 L)

[0283] glucose 50g <![CDATA[(NH4)2SO4]]> 20g urea 5g <![CDATA[KH2PO4]]> 1g <![CDATA[K2HPO4]]> 1g <![CDATA[MgSO4·7H2O]]> 0.25g <![CDATA[CaCl2·2H2O]]> 10mg <![CDATA[FeSO4·7H2O]]> 10mg <![CDATA[MnSO4·5H2O]]> 10mg <![CDATA[ZnSO4·7H2O]]> 1mg <![CDATA[CuSO4·5H2O]]> 0.2mg <![CDATA[NiCl2·6H2O]]> 0.02mg Biotin (pH 7) 0.2mg Tryptone 10g

[0284] (5) Results

[0285] As shown in Table B5, the strains into which the respective mutant enzymes were introduced had improved 4-amino-3-hydroxybenzoic acid production capabilities compared to the strains into which the wild-type enzymes were introduced.

[0286] [Table B5]

[0287] Hydroxylase Production capacity of 4-amino-3-hydroxybenzoic acid (g / L) Production capacity improvement rate HFM77 wt 0.073 1.00 HFM77 Y201F 0.114 1.56 HFM77 Y222F 0.100 1.37 HFM122 wt 0.134 1.00 HFM122 Y201F 0.224 1.67 HFM122 Y222F 0.256 1.90 HFM339 wt 0.016 1.00 HFM339 Y201F 0.061 3.80 HFM339 Y222F 0.139 8.74 HFM388 wt 0.033 1.00 HFM388 Y201F 0.079 2.38 HFM388 Y222F 0.230 6.95

[0288] Example C1 Production of 4-amino-3-hydroxybenzoic acid

[0289] In the following Examples, PCR was performed using PrimeSTAR Max Premix (Takara Bio).

[0290] (1) Preparation of a plasmid containing a gene encoding a wild-type enzyme

[0291] (a) Preparation of plasmid pECsf_gapS_pabABC

[0292] The genome extracted from Corynebacterium glutamicum ATCC13032 strain according to conventional methods was used as a template, and primers GN14_127 (sequence number 13, TATTAATTAAATGCGCGTTTTAATTATTGATAATTATGATTC) and GN14_133 (sequence number 14, TTGCGGCCGCTTGTTTAAACCTCCTTACAGAAAAATGGTTGGGCG) were used to amplify the DNA fragment containing the genes encoding 4-amino-4-deoxychorismate synthase and 4-amino-4-deoxychorismate lyase by PCR, and the fragment was inserted between the PacI site and the NotI site of the plasmid pECsf_gapS (see Japanese Patent Application No. 2015-25491), thereby obtaining the plasmid pECsf_gapS_pabABC.

[0293] (b) Preparation of plasmid pECsf_gapS_pabABC_HFM122

[0294] The vector DNA fragment was synthesized by PCR using the plasmid pECsf_gapS_pabABC obtained above as a template and primers pabABCcory vec R (SEQ ID NO: 15, AAATTTAAACCTCCTTTACAGAAAAATGGTTGG) and pabABCcory vec F (SEQ ID NO: 16, GGAGGTTTAAACAAGCGGCCGCGATATC). Next, a plasmid containing the gene encoding the polypeptide HFM122 with 4-aminobenzoic acid hydroxylation activity (SEQ ID NO: 1) was prepared by artificial gene synthesis. Using this as a template, an insert DNA fragment was synthesized by PCR using primers pECsfD HFM122 F (SEQ ID NO: 17, AGGAGGTTTAAATTTATGCGCACTCAGGTGGCTAT) and pECsfD HFM122 R (SEQ ID NO: 18, CTTGTTTAAACCTCCTTATACGAGTGGCAGTCCTA). These PCR products were treated with DpnI (Takara Bio), and each DNA fragment was purified using NucleoSpin Gel and PCR Clean-up (Takara Bio). The fragments were then ligated using the In-Fusion HD Cloning Kit (Takara Bio) to construct the plasmid pECsf_gapS_pabABC_HFM122. The resulting plasmid solution was used to transform the ECOS Competent E. coli DH5α strain (Nippon Gene). The cell solution was spread on LBKm agar medium (Bacto Trypton 1%, yeast extract 0.5%, NaCl 1%, kanamycin sulfate 50 μg / mL, agar 1.5%) and allowed to stand overnight at 37°C. For the resulting colonies, a PCR reaction was performed using Sapphire Amp (TakaraBio) and primers pabABC+pobA for CPCR F (SEQ ID NO: 19, GCTATCAAAACATTCGGCACATTGGTTTTCC) and pabABC+pobA for CPCR R (SEQ ID NO: 20, GGAAGATGCGTGATCTGATCCTTCAACTC), and transformants in which the introduction of the target DNA fragment was confirmed were selected. The resulting transformant was inoculated into 2 mL of LBKm liquid medium (BactoTrypton 1%, yeast extract 0.5%, NaCl 1%, kanamycin sulfate 50 μg / mL) and cultured overnight at 37° C. Plasmids were purified from the culture using NucleoSpin Plasmid EasyPure (Takara Bio).

[0295] (c) Preparation of plasmid pECsf_gapS_pabABC_tuD_HFM122

[0296] The plasmid pECsf_gapS_pabABC_HFM122 obtained above was used as a template and primers pabClastR (SEQ ID NO: 21, TTACAGAAAAATGGTTGGGCGCAA) and HFM122F (SEQ ID NO: 22, ATGCGCACTCAGGTGGCTATCG) were used to synthesize a vector DNA fragment by PCR. Next, a DNA fragment (SEQ ID NO: 23, TACGTACCTGCAGGTAGCGTGTCAGTAGGCGCGTAGGGTAAGTGGGGTAGCGGCTTGTTAGATATCTTGAAATCGGCTTTCAACAGCATTGATTTCGATGTATTTAGCTGGCCGTTACCCTGCGAATGTCCACAGGGTAGCTGGTAGTTTGAAAATCAACGCCGTTGCCCTTAGGATTCAGTAACTGGCACATTTTGTAATGCGCTAGATCTGTGTGCTCAGTCTTCCAGGCTGCTTATCACAGTGAAAGCAAAACCAATTCGTGGCTGCGAAAGTCGTAGCCACCACGAAGTCCAAAGGAGGATCTAAATTATGAATAATATAAAAGGAGGAATTAATTAA) containing the promoter of the tuf gene (cg0587) possessed by Corynebacterium glutamicum ATCC13032 strain (hereinafter referred to as tu promoter) was prepared by artificial gene synthesis and used as a template to generate the tuf fragment. Insert DNA fragments were synthesized by PCR using Ptu-F (SEQ ID NO: 24, ACCATTTTTCTGTAATACGTACCTGCAGGTAGCGTG) and Ptu-HFM122 R (SEQ ID NO: 25, CACCTGAGTGCGCATTTAATTAATTCCTCCTTTTA). These PCR products were treated with DpnI (Takara Bio), purified using NucleoSpin Gel and PCR Clean-up (Takara Bio), and ligated using the In-Fusion HD Cloning Kit (Takara Bio) to construct the plasmid pECsf_gapS_pabABC_tuD_HFM122.The obtained plasmid solution was used to transform the ECOS Competent E. coli DH5α strain (Nippon Gene). After the cell solution was applied to LBKm agar medium, it was allowed to stand at 37°C overnight. For the obtained colonies, Sapphire Amp (Takara Bio) and primers Ptu seq 1 (sequence number 26, GCTTGTTAGATATCTTGAAATCGGCTTTC) and pabABC+pobA for CPCR R (sequence number 20, GGAAGATGCGTGATCTGATCCTTCAACTC) were used to perform PCR reaction, and the transformant in which the target DNA fragment was introduced was selected. The obtained transformant was inoculated into 2 ml of LBKm liquid medium and cultured at 37°C overnight. The plasmid was purified from the culture solution using NucleoSpin Plasmid EasyPure (Takara Bio).

[0297] In the constructed plasmid, genes encoding 4-amino-4-deoxychorismate synthase and 4-amino-4-deoxychorismate lyase were linked under the control of the gap promoter, and the gene encoding wild-type HFM122 was linked under the control of the tu promoter.

[0298] (2) Preparation of a plasmid containing a gene encoding a mutant enzyme

[0299] As an example of the preparation of a plasmid containing a gene encoding a mutant enzyme, the preparation of a plasmid containing a gene encoding a mutant enzyme in which valine at position 47 of HFM122 is substituted with isoleucine is shown below.

[0300] Plasmid pECsf_gapS_pabABC_tuD_HFM122_V47I was constructed by PCR using the plasmid pECsf_gapS_pabABC_tuD_HFM122 as a template and complementary primers HFM122 V47I F (SEQ ID NO: 67, GCTGGTATTCTGGAACGTATCACGGTG) and HFM122 V47I R (SEQ ID NO: 68, TTCCAGAATACCAGCCCGAACTCGGCC). The PCR product was treated with DpnI (Takara Bio) and the resulting liquid was used to transform ECOS Competent E. coli DH5α strain (Nippon Gene). The cell suspension was spread on LBKm agar medium and incubated at 37°C overnight. The resulting colonies were selected as transformants. The transformants were inoculated into 2 mL of LBKm liquid medium and cultured at 37°C overnight. The plasmid was purified from the culture solution using NucleoSpin Plasmid EasyPure (Takara Bio).

[0301] Similarly, using the primers shown in "Primers" in Table C1 instead of primers HFM122 V47I F and HFM122 V47I R, plasmids containing genes encoding the respective enzyme mutants were obtained by PCR.

[0302] [Table C1]

[0303]

[0304] (3) Introducing the plasmid into the host cell

[0305] Corynebacterium glutamicum DRHG145 strain (see Japanese Patent Application No. 2014-523757) was transformed using each of the plasmids obtained above by electroporation (Bio-rad). The resulting transformed cell suspension was spread on LBKm agar medium and allowed to stand at 30°C for 2 days. The resulting colonies were used as transformants.

[0306] (4) Cultivation of transformants

[0307] The transformants obtained above were inoculated into 1 mL of CGYE medium (containing 50 μg / mL of kanamycin sulfate) shown in Table C2, respectively, and cultured at 30°C overnight. 100 μL of the obtained culture solution was inoculated into 10 mL of CGXII medium (containing 50 μg / mL of kanamycin sulfate) shown in Table C3, and after cultured at 30°C for 48 hours, the product after removing the bacterial cells by centrifugation was used as the culture supernatant. The 4-amino-3-hydroxybenzoic acid concentration in the obtained culture supernatant was quantified according to the method of Reference Example 1, and the productivity improvement rate of 4-amino-3-hydroxybenzoic acid was calculated according to the following formula. Here, "WT" means "a transformant having introduced a plasmid containing a gene encoding a wild-type enzyme", and "MT" means "a transformant having introduced a plasmid containing a gene encoding a mutant enzyme, made from a plasmid containing a gene encoding the wild-type enzyme".

[0308] (Mathematical formula 1)

[0309] Productivity improvement rate = 4-amino-3-hydroxybenzoic acid productivity in MT / 4-amino-3-hydroxybenzoic acid productivity in WT

[0310] [Table C2]

[0311] CGYE medium composition (per 1L)

[0312] glucose 50g <![CDATA[(NH4)2SO4]]> 20g urea 5g <![CDATA[KH2PO4]]> 1g <![CDATA[K2HPO4]]> 1g <![CDATA[MgSO4·7H2O]]> 0.25g <![CDATA[CaCl2·2H2O]]> 10mg <![CDATA[FeSO4·7H2O]]> 10mg <![CDATA[MnSO4·5H2O]]> 10mg <![CDATA[ZnSO4·7H2O]]> 1mg <![CDATA[CuSO4·5H2O]]> 0.2mg <![CDATA[NiCl2·6H2O]]> 0.02mg Biotin (pH 7) 0.2mg yeast extract 1g

[0313] [Table C3]

[0314] CGXII medium composition (per 1 L)

[0315] glucose 50g <![CDATA[(NH4)2SO4]]> 20g urea 5g <![CDATA[KH2PO4]]> 1g <![CDATA[K2HPO4]]> 1g <![CDATA[MgSO4·7H2O]]> 0.25g <![CDATA[CaCl2·2H2O]]> 10mg <![CDATA[FeSO4·7H2O]]> 10mg <![CDATA[MnSO4·5H2O]]> 10mg <![CDATA[ZnSO4·7H2O]]> 1mg <![CDATA[CuSO4·5H2O]]> 0.2mg <![CDATA[NiCl2·6H2O]]> 0.02mg Biotin (pH 7) 0.2mg Tryptone 10g

[0316] (5) Results

[0317] As shown in Table C4, the strains into which the mutant enzymes were introduced had improved 4-amino-3-hydroxybenzoic acid production capabilities compared to the strains into which the wild-type enzymes were introduced.

[0318] [Table C4]

[0319]

[0320] Reference Example 1 Quantification of 4-amino-3-hydroxybenzoic acid

[0321] Quantification of 4-amino-3-hydroxybenzoic acid was performed by HPLC. The reaction solution subjected to HPLC analysis was appropriately diluted with 0.1% phosphoric acid, and insoluble matter was removed using an AcroPrep 96-well filter plate (0.2 μm GHP membrane, Pall Corporation, Japan).

[0322] The HPLC apparatus used was a Chromaster (Hitachi High-Technologies Corporation). The analytical column used was an L-column ODS (4.6 mm ID × 150 mm, Chemical Evaluation Research Institute). Eluent A was a 0.1 M potassium dihydrogen phosphate solution in 0.1% phosphoric acid, and eluent B was 70% methanol. Gradient elution was performed at a flow rate of 1.0 mL / min and a column temperature of 40°C. 4-Amino-3-hydroxybenzoic acid was detected using a UV detector (detection wavelength 280 nm). A concentration calibration curve was prepared using a standard sample [4-amino-3-hydroxybenzoic acid (seller code A1194, Tokyo Chemical Industry Co., Ltd.)], and 4-amino-3-hydroxybenzoic acid was quantified based on the concentration calibration curve. Sequence Listing <110> Kao Co., Ltd. <120> Polypeptide with 4-aminobenzoic acid hydroxylation activity and use thereof <130> KS1681 <150> JP 2019-203523 <151> 2019-11-08 <150> JP 2019-233484 <151> 2019-12-24 <150> JP 2019-233485 <151> 2019-12-24 <160> 100 <170> PatentIn version 3.5 <210> 1 <211> 1176 <212> DNA <213> Caulobacter vibrioides <220> <221> CDS <222> (1)..(1173) <223> Codon-optimized oligonucleotides <400> 1 atg cgc act cag gtg gct atc gta gga gca ggc cca gct ggc ctg ttc 48 Met Arg Thr Gln Val Ala Ile Val Gly Ala Gly Pro Ala Gly Leu Phe 1 5 10 15 ttg ggc cat ctc ctc cgt caa gct ggt gtg gac gtc gtg att ctg gaa 96 Leu Gly His Leu Leu Arg Gln Ala Gly Val Asp Val Val Ile Leu Glu 20 25 30 cgc aaa gac cgt gct tat gtc gaa ggc cga gtt cgg gct ggt gtc ctg 144 Arg Lys Asp Arg Ala Tyr Val Glu Gly Arg Val Arg Ala Gly Val Leu 35 40 45 gaa cgt atc acg gtg gag ctg atg gag cgt ctt ggt gtg gat gag cga 192 Glu Arg Ile Thr Val Glu Leu Met Glu Arg Leu Gly Val Asp Glu Arg 50 55 60 atg cgc cga gag ggc ttg gtg cat gct ggc gct aat ctt gcg tct gat 240 Met Arg Arg Glu Gly Leu Val His Ala Gly Ala Asn Leu Ala Ser Asp 65 70 75 80 ggc gag atg ttc cgt atc gac atg gca gag ctc acg ggt ggt tcc acc 288 Gly Glu Met Phe Arg Ile Asp Met Ala Glu Leu Thr Gly Gly Ser Thr 85 90 95 gtc atg gtt tac ggc caa cag gag gtg atg aag gac ctg ttt gat gca 336 Val Met Val Tyr Gly Gln Gln Glu Val Met Lys Asp Leu Phe Asp Ala 100 105 110 gca gag cag cgc gat ctg cga att gtc ttt gac gcc gat gca gtg cgt 384 Ala Glu Gln Arg Asp Leu Arg Ile Val Phe Asp Ala Asp Ala Val Arg 115 120 125 ctg cac gat gtg gaa ggc gaa cgt cct cac atc acc tgg cgc aaa gac 432 Leu His Asp Val Glu Gly Glu Arg Pro His Ile Thr Trp Arg Lys Asp 130 135 140 ggg gca gaa cac cgc ctg gac tgc gat ttc att gcc ggc tgc gac ggc 480 Gly Ala Glu His Arg Leu Asp Cys Asp Phe Ile Ala Gly Cys Asp Gly 145 150 155 160 tac cac gga gtt tct cgt gcg acc att ccc gat aag gtt ctc aag acc 528 Tyr His Gly Val Ser Arg Ala Thr Ile Pro Asp Lys Val Leu Lys Thr 165 170 175 ttc gaa cgg gtg tat ccc ttt ggg tgg ttg gga atc ctg gct gaa gca 576 Phe Glu Arg Val Tyr Pro Phe Gly Trp Leu Gly Ile Leu Ala Glu Ala 180 185 190 cct ccg tgt gac cac gag ttg atc tac tcg aac cat gat cgc ggt ttt 624 Pro Pro Cys Asp His Glu Leu Ile Tyr Ser Asn His Asp Arg Gly Phe 195 200 205 gcc ctg gcg tcg atg cgc tca ccg aca cgc tcc cgc tat tac gtg cag 672 Ala Leu Ala Ser Met Arg Ser Pro Thr Arg Ser Arg Tyr Tyr Val Gln 210 215 220 tgc tca ctc gac gat cgc ctc gag gat tgg tcc gat gaa cgg ttc tgg 720 Cys Ser Leu Asp Asp Arg Leu Glu Asp Trp Ser Asp Glu Arg Phe Trp 225 230 235 240 gat gaa gtt tcg gtt cgc ctg gga ccg gaa gca gcc gct cgg atc gtt 768 Asp Glu Val Ser Val Arg Leu Gly Pro Glu Ala Ala Ala Arg Ile Val 245 250 255 cgc gca cct tcc tc gag aag aagc att gcc cca ctt cgc tcc ttc gtt 816 Arg Ala Pro Ser Phe Glu Lys Ser Ile Ala Pro Leu Arg Ser Phe Val 260 265 270 tcc gag cct atg cgg tat ggc cgc ctt ttc ctc gcg ggt gat gcg gct 864 Ser Glu Pro Met Arg Tyr Gly Arg Leu Phe Leu Ala Gly Asp Ala Ala 275 280 285 cat atc gtt cca ccc act gga gcg aaa ggg atg aac ttg gcc gta tca 912 His Ile Val Pro Pro Thr Gly Ala Lys Gly Met Asn Leu Ala Val Ser 290 295 300 gac gtc atc atg ctg tcc gaa gcc ctg gtc gaa cac tac cac gaa cgc 960 Asp Val Ile Met Leu Ser Glu Ala Leu Val Glu His Tyr His Glu Arg 305 310 315 320 tct tcc gct ggt atc gat ggt tac agc gca cgt gca ctt gcc cgc gtc 1008 Ser Ser Ala Gly Ile Asp Gly Tyr Ser Ala Arg Ala Leu Ala Arg Val 325 330 335 tgg aag gcg gag cgt ttc agc tgg tgg ttt acc tcc ctt act cac cgc 1056 Trp Lys Ala Glu Arg Phe Ser Trp Trp Phe Thr Ser Leu Thr His Arg 340 345 350 ttc cca gac cag gac ggc ttc gac cgc aag atg caa gtc gcc gaa ttg 1104 Phe Pro Asp Gln Asp Gly Phe Asp Arg Lys Met Gln Val Ala Glu Leu 355 360 365 gca tac atc aag ggt tct cgc gct gcc cag gtc acc ctg gcg gag aac 1152 Ala Tyr Ile Lys Gly Ser Arg Ala Ala Gln Val Thr Leu Ala Glu Asn 370 375 380 tac gta gga ctg cca ctc gta taa 1176 Tyr Val Gly Leu Pro Leu Val 385 390 <210> 2 <211> 391 <212> PRT <213> Caulobacter vibrioides <400> 2 Met Arg Thr Gln Val Ala Ile Val Gly Ala Gly Pro Ala Gly Leu Phe 1 5 10 15 Leu Gly His Leu Leu Arg Gln Ala Gly Val Asp Val Val Ile Leu Glu 20 25 30 Arg Lys Asp Arg Ala Tyr Val Glu Gly Arg Val Arg Ala Gly Val Leu 35 40 45 Glu Arg Ile Thr Val Glu Leu Met Glu Arg Leu Gly Val Asp Glu Arg 50 55 60 Met Arg Arg Glu Gly Leu Val His Ala Gly Ala Asn Leu Ala Ser Asp 65 70 75 80 Gly Glu Met Phe Arg Ile Asp Met Ala Glu Leu Thr Gly Gly Ser Thr 85 90 95 Val Met Val Tyr Gly Gln Gln Glu Val Met Lys Asp Leu Phe Asp Ala 100 105 110 Ala Glu Gln Arg Asp Leu Arg Ile Val Phe Asp Ala Asp Ala Val Arg 115 120 125 Leu His Asp Val Glu Gly Glu Arg Pro His Ile Thr Trp Arg Lys Asp 130 135 140 Gly Ala Glu His Arg Leu Asp Cys Asp Phe Ile Ala Gly Cys Asp Gly 145 150 155 160 Tyr His Gly Val Ser Arg Ala Thr Ile Pro Asp Lys Val Leu Lys Thr 165 170 175 Phe Glu Arg Val Tyr Pro Phe Gly Trp Leu Gly Ile Leu Ala Glu Ala 180 185 190 Pro Pro Cys Asp His Glu Leu Ile Tyr Ser Asn His Asp Arg Gly Phe 195 200 205 Ala Leu Ala Ser Met Arg Ser Pro Thr Arg Ser Arg Tyr Tyr Val Gln 210 215 220 Cys Ser Leu Asp Asp Arg Leu Glu Asp Trp Ser Asp Glu Arg Phe Trp 225 230 235 240 Asp Glu Val Ser Val Arg Leu Gly Pro Glu Ala Ala Ala Arg Ile Val 245 250 255 Arg Ala Pro Ser Phe Glu Lys Ser Ile Ala Pro Leu Arg Ser Phe Val 260 265 270 Ser Glu Pro Met Arg Tyr Gly Arg Leu Phe Leu Ala Gly Asp Ala Ala 275 280 285 His Ile Val Pro Pro Thr Gly Ala Lys Gly Met Asn Leu Ala Val Ser 290 295 300 Asp Val Ile Met Leu Ser Glu Ala Leu Val Glu His Tyr His Glu Arg 305 310 315 320 Ser Ser Ala Gly Ile Asp Gly Tyr Ser Ala Arg Ala Leu Ala Arg Val 325 330 335 Trp Lys Ala Glu Arg Phe Ser Trp Trp Phe Thr Ser Leu Thr His Arg 340 345 350 Phe Pro Asp Gln Asp Gly Phe Asp Arg Lys Met Gln Val Ala Glu Leu 355 360 365 Ala Tyr Ile Lys Gly Ser Arg Ala Ala Gln Val Thr Leu Ala Glu Asn 370 375 380 Tyr Val Gly Leu Pro Leu Val 385 390 <210> 3 <2​​​​ <220> <221> CDS <222> (1)..(1170) <223> Codon-optimized oligonucleotide <400> 3 atg cgc acc caa gtg gtc atc atc ggc tca gga ccg tct ggc ctt ctt 48 Met Arg Thr Gln Val Val Ile Ile Gly Ser Gly Pro Ser Gly Leu Leu 1 5 10 15 ctg gga cag ctt ctg acc gag gca ggg atc gca aac gtc atc ctc gat 96 Leu Gly Gln Leu Leu Thr Glu Ala Gly Ile Ala Asn Val Ile Leu Asp 20 25 30 cgc gct acc aag gcc cac att ctc ggg cga gtt cgc gct gga gtg ttg 144 Arg Ala Thr Lys Ala His Ile Leu Gly Arg Val Arg Ala Gly Val Leu 35 40 45 gaa cag ggc acc gtt cgc ctt atg gaa gag gct ggt tgt ggt gcg cga 192 Glu Gln Gly Thr Val Arg Leu Met Glu Glu Ala Gly Cys Gly Ala Arg 50 55 60 atg cac gca gaa gga ctg cca cac gac ggc ttt tcg ctg gca ttc gac 240 Met His Ala Glu Gly Leu Pro His Asp Gly Phe Ser Leu Ala Phe Asp 65 70 75 80 ggt cgg gat cac cgc att gac ctg ttc ggc ctg act ggt ggc cgt cgc 288 Gly Arg Asp His Arg Ile Asp Leu Phe Gly Leu Thr Gly Gly Arg Arg 85 90 95 gta atg atc tat ggt cag acg gag ctg aca cgg gac ctg atg gat cat 336 Val Met Ile Tyr Gly Gln Thr Glu Leu Thr Arg Asp Leu Met Asp His 100 105 110 cgc gag cgg gtt ggt gca ctc tcc atc tac gaa gcg gct aac gtc atg 384 Arg Glu Arg Val Gly Ala Leu Ser Ile Tyr Glu Ala Ala Asn Val Met 115 120 125 ccc cgc gat ttc gat gga cgg aca cct cac gtt gcg tat gag aag gac 432 Pro Arg Asp Phe Asp Gly Arg Thr Pro His Val Ala Tyr Glu Lys Asp 130 135 140 ggt att gcg caa cgc att gac tgc gac ttc atc gcc ggc tgt gac ggc 480 Gly Ile Ala Gln Arg Ile Asp Cys Asp Phe Ile Ala Gly Cys Asp Gly 145 150 155 160 ttc cat ggc gtg tcc cgt cgt tcc ctg cca gag aaa gcc atc cgg aat 528 Phe His Gly Val Ser Arg Arg Ser Leu Pro Glu Lys Ala Ile Arg Asn 165 170 175 ttc gag aag atc tac cca ttt gga tgg ctc ggc atc ctg gca gat gtc 576 Phe Glu Lys Ile Tyr Pro Phe Gly Trp Leu Gly Ile Leu Ala Asp Val 180 185 190 cca ccg gtc gat cat gaa ctc gtg tac gct aat cac cca cgc ggg ttt 624 Pro Pro Val Asp His Glu Leu Val Tyr Ala Asn His Pro Arg Gly Phe 195 200 205 gca ttg tgc tct atg cgt tcc cat acc cgt tct cgc tac tac atc cag 672 Ala Leu Cys Ser Met Arg Ser His Thr Arg Ser Arg Tyr Tyr Ile Gln 210 215 220 tgc cct ttg gag gaa aag atc gaa gat tgg gat gat cag cgc ttc tgg 720 Cys Pro Leu Glu Glu Lys Ile Glu Asp Trp Asp Asp Gln Arg Phe Trp 225 230 235 240 gat gaa ctc cgc cgt cgt ctg cct gcg cac cat gcg gag cgc gtg gta 768 Asp Glu Leu Arg Arg Arg Leu Pro Ala His His Ala Glu Arg Val Val 245 250 255 acc ggt ccg agc ttc gag aag tcc att gca ccc ttg cgt tcg ttc gtt 816 Thr Gly Pro Ser Phe Glu Lys Ser Ile Ala Pro Leu Arg Ser Phe Val 260 265 270 gcc gaa cca atg cgc ttc aac cgc ctg ttc ttg gcg ggc gat gct gcc 864 Ala Glu Pro Met Arg Phe Asn Arg Leu Phe Leu Ala Gly Asp Ala Ala 275 280 285 cac att gtc cca cct acc ggt gct aaa ggc ctt aac ctc gct gct tcc 912 His Ile Val Pro Pro Thr Gly Ala Lys Gly Leu Asn Leu Ala Ala Ser 290 295 300 gac gtc cac tac ctg ttt gag ggg ttg ctc gaa cac tac cag gat cga 960 Asp Val His Tyr Leu Phe Glu Gly Leu Leu Glu His Tyr Gln Asp Arg 305 310 315 320 agc aac gca ggc atc gac gcc tat tcc gct cgc gca ctg gct cgt gtg 1008 Ser Asn Ala Gly Ile Asp Ala Tyr Ser Ala Arg Ala Leu Ala Arg Val 325 330 335 tgg aaa gcc gtt cgc ttc agc tgg tgg atg acg act atg ctt cac cgt 1056 Trp Lys Ala Val Arg Phe Ser Trp Trp Met Thr Thr Met Leu His Arg 340 345 350 ttt ccc gaa acc tcc gac ttt gac cag cgc att caa gag gcc gaa ctg 1104 Phe Pro Glu Thr Ser Asp Phe Asp Gln Arg Ile Gln Glu Ala Glu Leu 355 360 365 gac tat ctc acc cac tca cga gct gcc gca act gca ctt gcg gaa aac 1152 Asp Tyr Leu Thr His Ser Arg Ala Ala Ala Thr Ala Leu Ala Glu Asn 370 375 380 tac gtg ggt ctg ccg ttc taa 1173 Tyr Val Gly Leu Pro Phe 385 390 <210> 4 <211> 390 <212> PRT <213> Sinorhizobium meliloti <400> 4 Met Arg Thr Gln Val Val Ile Ile Gly Ser Gly Pro Ser Gly Leu Leu 1 5 10 15 Leu Gly Gln Leu Leu Thr Glu Ala Gly Ile Ala Asn Val Ile Leu Asp 20 25 30 Arg Ala Thr Lys Ala His Ile Leu Gly Arg Val Arg Ala Gly Val Leu 35 40 45 Glu Gln Gly Thr Val Arg Leu Met Glu Glu Ala Gly Cys Gly Ala Arg 50 55 60 Met His Ala Glu Gly Leu Pro His Asp Gly Phe Ser Leu Ala Phe Asp 65 70 75 80 Gly Arg Asp His Arg Ile Asp Leu Phe Gly Leu Thr Gly Gly Arg Arg 85 90 95 Val Met Ile Tyr Gly Gln Thr Glu Leu Thr Arg Asp Leu Met Asp His 100 105 110 Arg Glu Arg Val Gly Ala Leu Ser Ile Tyr Glu Ala Ala Asn Val Met 115 120 125 Pro Arg Asp Phe Asp Gly Arg Thr Pro His Val Ala Tyr Glu Lys Asp 130 135 140 Gly Ile Ala Gln Arg Ile Asp Cys Asp Phe Ile Ala Gly Cys Asp Gly 145 150 155 160 Phe His Gly Val Ser Arg Arg Ser Leu Pro Glu Lys Ala Ile Arg Asn 165 170 175 Phe Glu Lys Ile Tyr Pro Phe Gly Trp Leu Gly Ile Leu Ala Asp Val 180 185 190 Pro Pro Val Asp His Glu Leu Val Tyr Ala Asn His Pro Arg Gly Phe 195 200 205 Ala Leu Cys Ser Met Arg Ser His Thr Arg Ser Arg Tyr Tyr Ile Gln 210 215 220 Cys Pro Leu Glu Glu Lys Ile Glu Asp Trp Asp Asp Gln Arg Phe Trp 225 230 235 240 Asp Glu Leu Arg Arg Arg Leu Pro Ala His His Ala Glu Arg Val Val 245 250 255 Thr Gly Pro Ser Phe Glu Lys Ser Ile Ala Pro Leu Arg Ser Phe Val 260 265 270 Ala Glu Pro Met Arg Phe Asn Arg Leu Phe Leu Ala Gly Asp Ala Ala 275 280 285 His Ile Val Pro Pro Thr Gly Ala Lys Gly Leu Asn Leu Ala Ala Ser 290 295 300 Asp Val His Tyr Leu Phe Glu Gly Leu Leu Glu His Tyr Gln Asp Arg 305 310 315 320 Ser Asn Ala Gly Ile Asp Ala Tyr Ser Ala Arg Ala Leu Ala Arg Val 325 330 335 Trp Lys Ala Val Arg Phe Ser Trp Trp Met Thr Thr Met Leu His Arg 340 345 350 Phe Pro Glu Thr Ser Asp Phe Asp Gln Arg Ile Gln Glu Ala Glu Leu 355 360 365 Asp Tyr Leu Thr His Ser Arg Ala Ala Ala Thr Ala Leu Ala Glu Asn 370 375 380 Tyr Val Gly Leu Pro Phe 385 390 <210> 5 <211> 1173 <212> DNA <213> Rhodopseudomonas palustris <220> <221> CDS <222> (1)..(1170) <223> Codon-optimized oligonucleotides <400> 5 atg cgc act cag gtg gca atc att ggt gcc ggt cca tcc ggt ctg ctt 48 Met Arg Thr Gln Val Ala Ile Ile Gly Ala Gly Pro Ser Gly Leu Leu 1 5 10 15 ctc gga cag ctc ctt cac aag tac ggg atc gac gcc gtc atc gtt gag 96 Leu Gly Gln Leu Leu His Lys Tyr Gly Ile Asp Ala Val Ile Val Glu 20 25 30 cgc aaa gat ccc gat tac gtg ctt tcc cgc atc cgt gca ggc gtt ctg 144 Arg Lys Asp Pro Asp Tyr Val Leu Ser Arg Ile Arg Ala Gly Val Leu 35 40 45 gag cag ggc atg gtt gac ctc ctg gac gaa gct ggc gta agc gct cgg 192 Glu Gln Gly Met Val Asp Leu Leu Asp Glu Ala Gly Val Ser Ala Arg 50 55 60 ttg cat cag gaa gcg ctt gtt cac ggt ggt ttc gaa atc gcg ttc gca 240 Leu His Gln Glu Ala Leu Val His Gly Gly Phe Glu Ile Ala Phe Ala 65 70 75 80 ggc caa cgg cat ccc att gat ctg cgt ggt gca acc gga ggc aag tct 288 Gly Gln Arg His Pro Ile Asp Leu Arg Gly Ala Thr Gly Gly Lys Ser 85 90 95 gtc acc gtc tat ggt cag acc gag gta acc cga gat ctc atg gag gct 336 Val Thr Val Tyr Gly Gln Thr Glu Val Thr Arg Asp Leu Met Glu Ala 100 105 110 cga tct gca gct ggc ctt acg acg atc tat gac gct gcg gat gtt tcg 384 Arg Ser Ala Ala Gly Leu Thr Thr Ile Tyr Asp Ala Ala Asp Val Ser 115 120 125 ctg cat gac ttt gaa ggc gca cac cct aag gtg cgt tac gtc aaa gac 432 Leu His Asp Phe Glu Gly Ala His Pro Lys Val Arg Tyr Val Lys Asp 130 135 140 ggc acc act cgc gag atc gtg tgc gat ttc att gcg gga tgt gac ggg 480 Gly Thr Thr Arg Glu Ile Val Cys Asp Phe Ile Ala Gly Cys Asp Gly 145 150 155 160 ttc cac gga att tcg cgc caa tct gtg cca gcg tct gcc gtt cag tcc 528 Phe His Gly Ile Ser Arg Gln Ser Val Pro Ala Ser Ala Val Gln Ser 165 170 175 ttc gaa cgc gtg tat ccg ttc ggc tgg tg gga ctt ctg tcc gat acc 576 Phe Glu Arg Val Tyr Pro Phe Gly Trp Leu Gly Leu Leu Ser Asp Thr 180 185 190 cct ccc gtc agc cca gaa ctg atc tac gtc aac cac gac cga ggc ttt 624 Pro Pro Val Ser Pro Glu Leu Ile Tyr Val Asn His Asp Arg Gly Phe 195 200 205 gct ctc tgc tcg atg cgc tcc atg cac cgt tca cgg tac tac gtc caa 672 Ala Leu Cys Ser Met Arg Ser Met His Arg Ser Arg Tyr Tyr Val Gln 210 215 220 tgc cct ttg acc gac gat gtc gct gat tgg tct gat gat cgc ttc tgg 720 Cys Pro Leu Thr Asp Asp Val Ala Asp Trp Ser Asp Asp Arg Phe Trp 225 230 235 240 gac gaa ctg aag tcc cgc ctc gac ccg gaa aca gcg ggg aaa ctc gtg 768 Asp Glu Leu Lys Ser Arg Leu Asp Pro Glu Thr Ala Gly Lys Leu Val 245 250 255 aca ggc ccg tca atc gag aag tca atc gca cca ctg cgt tcc ttt gtc 816 Thr Gly Pro Ser Ile Glu Lys Ser Ile Ala Pro Leu Arg Ser Phe Val 260 265 270 gct gaa cca atg cgc ttt ggt cgc ctt ttc ctg gcc ggt gat gcc gct 864 Ala Glu Pro Met Arg Phe Gly Arg Leu Phe Leu Ala Gly Asp Ala Ala 275 280 285 cac att gtt ccg cct acc gga gca aag ggc ttg aat ctg gcg gct tca 912 His Ile Val Pro Pro Thr Gly Ala Lys Gly Leu Asn Leu Ala Ala Ser 290 295 300 gac gtg tac tac ctg agc cgt gca atg cgg gag tac tat gcc gag aag 960 Asp Val Tyr Tyr Leu Ser Arg Ala Met Arg Glu Tyr Tyr Ala Glu Lys 305 310 315 320 tcc gaa gcc gcc atc gac gct tac tcg gca tcc gcc ttg cgc cgt gtt 1008 Ser Glu Single Gly Ile Asp Single Tyr Sing Ser Single Leu Single Arg Arg Val 325 330 335 tgg aag gcg gaa cgt ttc tcc tgg tgg atg act tct cag ctg cac cgc 1056 Trp Lys Ala Glu Arg Phe Ser Trp Trp Met Thr Ser Gln Leu His Arg 340 345 350 ttt cca gat tcc gac gca ttc agc caa cgc atc cag act gct gag ctc 1104 Phe Pro Asp Ser Asp With Phe Served With Gln Arg and Gln Thr With Glu Leu 355 360 365 gat tat ctg gtg aac tcc aaa gca gcc att acc tcc ttg gcc gag aac 1152 Asp Tyr Leu Val Asn Is Lys Ala Ala Ile Thr Ser Leu Ala Glu Asn 370 375 380 tac gta ggc ctg cca tac taa 1173 Tyr Val Gly Leu Pro Tyr 385,390 <210> 6 <211> 390 <212> PRT <213> Rhodopseudomonas palustris <400> 6 Met Arg Thr Gln Val Ala Ile Ile Gly Ala Gly Pro Ser Gly Leu Leu 1 5 10 15 Leu Gly Gln Leu Leu His Lys Tyr Gly Ile Asp Ala Val Ile Val Glu 20 25 30 Arg Lys Asp Pro Asp Tyr Val Leu Ser Arg Ile Arg Ala Gly Val Leu 35 40 45 Glu Gln Gly Met Val Asp Leu Leu Asp Glu Ala Gly Val Ser Ala Arg 50 55 60 Leu His Gln Glu Ala Leu Val His Gly Gly Phe Glu Ile Ala Phe Ala 65 70 75 80 Gly Gln Arg His Pro Ile Asp Leu Arg Gly Ala Thr Gly Gly Lys Ser 85 90 95 Val Thr Val Tyr Gly Gln Thr Glu Val Thr Arg Asp Leu Met Glu Ala 100 105 110 Arg Ser Ala Ala Gly Leu Thr Thr Ile Tyr Asp Ala Ala Asp Val Ser 115 120 125 Leu His Asp Phe Glu Gly Ala His Pro Lys Val Arg Tyr Val Lys Asp 130 135 140 Gly Thr Thr Arg Glu Ile Val Cys Asp Phe Ile Ala Gly Cys Asp Gly 145 150 155 160 Phe His Gly Ile Ser Arg Gln Ser Val Pro Ala Ser Ala Val Gln Ser 165 170 175 Phe Glu Arg Val Tyr Pro Phe Gly Trp Leu Gly Leu Leu Ser Asp Thr 180 185 190 Pro Pro Val Ser Pro Glu Leu Ile Tyr Val Asn His Asp Arg Gly Phe 195 200 205 Ala Leu Cys Ser Met Arg Ser Met His Arg Ser Arg Tyr Tyr Val Gln 210 215 220 Cys Pro Leu Thr Asp Asp Val Ala Asp Trp Ser Asp Asp Arg Phe Trp 225 230 235 240 Asp Glu Leu Lys Ser Arg Leu Asp Pro Glu Thr Ala Gly Lys Leu Val 245 250 255 Thr Gly Pro Ser Ile Glu Lys Ser Ile Ala Pro Leu Arg Ser Phe Val 260 265 270 Ala Glu Pro Met Arg Phe Gly Arg Leu Phe Leu Ala Gly Asp Ala Ala 275 280 285 His Ile Val Pro Pro Thr Gly Ala Lys Gly Leu Asn Leu Ala Ala Ser 290 295 300 Asp Val Tyr Tyr Leu Ser Arg Ala Met Arg Glu Tyr Tyr Ala Glu Lys 305 310 315 320 Ser Glu Ala Gly Ile Asp Ala Tyr Ser Ala Ser Ala Leu Arg Arg Val 325 330 335 Trp Lys Ala Glu Arg Phe Ser Trp Trp Met Thr Ser Gln Leu His Arg 340 345 350 Phe Pro Asp Ser Asp Ala Phe Ser Gln Arg Ile Gln Thr Ala Glu Leu 355 360 365 Asp Tyr Leu Val Asn Ser Lys Ala Ala Ile Thr Ser Leu Ala Glu Asn 370 375 380 Tyr Val Gly Leu Pro Tyr 385 390 <210> 7 <211> 1179 <212> DNA <213> Bradyrhizobium diazoefficiens <220> <221> CDS <222> (1)..(1176) <223> Codon-optimized oligonucleotides <400> 7 atg cgt act cag gtg gga atc gtg gga gcc gga cca gcc ggt ctg ctc 48 Met Arg Thr Gln Val Gly Ile Val Gly Ala Gly Pro Ala Gly Leu Leu 1 5 10 15 ctc tcg cac atg ctg tat ctg tcc ggc att gag tcg atc atc atc gag 96 Leu Ser His Met Leu Tyr Leu Ser Gly Ile Glu Ser Ile Ile Ile Glu 20 25 30 tca cgt tcg cag gcg gaa atc gag cag acc atc cgc gcc ggg gta ctg 144 Ser Arg Ser Gln Ala Glu Ile Glu Gln Thr Ile Arg Ala Gly Val Leu 35 40 45 gaa cag tct acg gtt gac ctg atg acc gag att ggg gct ggc gat cgc 192 Glu Gln Ser Thr Val Asp Leu Met Thr Glu Ile Gly Ala Gly Asp Arg 50 55 60 atg aag cgg gaa ggc ttt gtc cat ggt ggc ttt gag ctc cgc ttt gca 240 Met Lys Arg Glu Gly Phe Val His Gly Gly Phe Glu Leu Arg Phe Ala 65 70 75 80 ggg cat ggg cac cgg atc gat ctg cag aac ctt gct aat ggc cgc acg 288 Gly His Gly His Arg Ile Asp Leu Gln Asn Leu Ala Asn Gly Arg Thr 85 90 95 atc aca gtc tat cca cag cac gaa gtc ctc aag gac ctg att gcc ttg 336 Ile Thr Val Tyr Pro Gln His Glu Val Leu Lys Asp Leu Ile Ala Leu 100 105 110 cgc ttg cgt act ggt ggt caa atc cac ttt gag gct aaa gct acc tcc 384 Arg Leu Arg Thr Gly Gly Gln Ile His Phe Glu Ala Lys Ala Thr Ser 115 120 125 att gac ggt ctg acc agc gat cag cca gtt gtg cgc ttc att acc aag 432 Ile Asp Gly Leu Thr Ser Asp Gln Pro Val Val Arg Phe Ile Thr Lys 130 135 140 caa ggt gaa acc cgt gaa ttg tcc tgc gac ttt gtg gct ggc tgt gac 480 Gln Gly Glu Thr Arg Glu Leu Ser Cys Asp Phe Val Ala Gly Cys Asp 145 150 155 160 ggt ggc tat gga gcc tca cga gct gcg att ccg gag gat ctg gtt cgc 528 Gly Gly Tyr Gly Ala Ser Arg Ala Ala Ile Pro Glu Asp Leu Val Arg 165 170 175 cgc gat tac ttc cga gtg tac ccg ttc ggt tgg ttc ggc atc ctg gca 576 Arg Asp Tyr Phe Arg Val Tyr Pro Phe Gly Trp Phe Gly Ile Leu Ala 180 185 190 aaa gcc cca ccc tca tcc gaa gag ctc atc tac gca cat cac gac cgc 624 Lys Ala Pro Pro Ser Ser Ser Glu Glu Leu Ile Tyr Ala His His Asp Arg 195 200 205 gga ttc gcg ctc atc agc aca cgc tct ccg aat atc cag cgc atg tac 672 Gly Phe Ala Leu Is Pro Asn With Gln Arg Met Tyr 210 215 220 ttc cag tgc gca cct acc gat tcc gtt gac aac tgg agc gat gat cgc 720 Phe Gln Cys Ala Pro Thr Asp Ser Val Asp Asn Trp Ser Asp Asp Arg 225 230 235 240 att tgg aac gag ttg cag act cgg gtt ggt ggc gat ggc ttc gag ctc 768 Ile Trp Asn Glu Leu Gln Thr Arg Val Gly Gly Asp Gly Phe Glu Leu 245 250 255 aag act ggc cct atc ttc cag aag ggt atc att cct ctt cgc tcc ttc 816 Lys Thr Gly Pro Ile Phe Gln Lys Gly Ile Pro Leu Arg Ser Phe 260 265 270 gtt tgc gaa ccc atg caa cac gga cgg ctt ttc ctt gca ggc gat gct 864 Val Cys Glu Pro Met Gln His Gly Arg Leu Phe Leu Ala Gly Asp Ala 275 280 285 gca cac tct gtc cct ccc aca ggt gca aaa ggc ctc aac ctg gca gct 912 Ala His Ser Val Pro Pro Thr Gly Ala Lys Gly Leu Asn Leu Ala Ala 290 295 300 gca gac gtg tac gtc ctt gcc cgt gca ctt gcg agc tac tac gct aag 960 Ala Asp Val Tyr Val Leu Ala Arg Ala Leu Ala Ser Tyr Tyr Ala Lys 305 310 315 320 cga tcc acc acc ctg ttg gac gcg tat tcc tct acc gca ttg cgt cgc 1008 Arg Ser Thr Thr Leu Leu Asp Ala Tyr Ser Ser Thr Ala Leu Arg Arg 325 330 335 gtg tgg cgt gcc caa cac ttc tcc tgg tgg atg acc tct atg ctg cat 1056 Val Trp Arg Ala Gln His Phe Ser Trp Trp Met Thr Ser Met Leu His 340 345 350 tgg ttt cac gaa gga acc gaa ttc gac ctg aag cgt caa ctg gcg gag 1104 Trp Phe His Glu Gly Thr Glu Phe Asp Leu Lys Arg Gln Leu Ala Glu 355 360 365 ctc gaa ttg gtc acg tcc tcc aaa gcg gct gca acc act ctg gcc gaa 1152 Leu Glu Leu Val Thr Ser Ser Lys Ala Ala Ala Thr Thr Leu Ala Glu 370 375 380 aac tac gta ggc atg cca ctt gct taa 1179 Asn Tyr Val Gly Met Pro Leu Ala 385 390 <210> 8 <211> 392 <212> PRT <213> Bradyrhizobium diazoefficiens <400> 8 Met Arg Thr Gln Val Gly Ile Val Gly Ala Gly Pro Ala Gly Leu Leu 1 5 10 15 Leu Ser His Met Leu Tyr Leu Ser Gly Ile Glu Ser Ile Ile Ile Glu 20 25 30 Ser Arg Ser Gln Ala Glu Ile Glu Gln Thr Ile Arg Ala Gly Val Leu 35 40 45 Glu Gln Ser Thr Val Asp Leu Met Thr Glu Ile Gly Ala Gly Asp Arg 50 55 60 Met Lys Arg Glu Gly Phe Val His Gly Gly Phe Glu Leu Arg Phe Ala 65 70 75 80 Gly His Gly His Arg Ile Asp Leu Gln Asn Leu Ala Asn Gly Arg Thr 85 90 95 Ile Thr Val Tyr Pro Gln His Glu Val Leu Lys Asp Leu Ile Ala Leu 100 105 110 Arg Leu Arg Thr Gly Gly Gln Ile His Phe Glu Ala Lys Ala Thr Ser 115 120 125 Ile Asp Gly Leu Thr Ser Asp Gln Pro Val Val Arg Phe Ile Thr Lys 130 135 140 Gln Gly Glu Thr Arg Glu Leu Ser Cys Asp Phe Val Ala Gly Cys Asp 145 150 155 160 Gly Gly Tyr Gly Ala Ser Arg Ala Ala Ile Pro Glu Asp Leu Val Arg 165 170 175 Arg Asp Tyr Phe Arg Val Tyr Pro Phe Gly Trp Phe Gly Ile Leu Ala 180 185 190 Lys Ala Pro Pro Ser Ser Glu Glu Leu Ile Tyr Ala His His Asp Arg 195 200 205 Gly Phe Ala Leu Ile Ser Thr Arg Ser Pro Asn Ile Gln Arg Met Tyr 210 215 220 Phe Gln Cys Ala Pro Thr Asp Ser Val Asp Asn Trp Ser Asp Asp Arg 225 230 235 240 Ile Trp Asn Glu Leu Gln Thr Arg Val Gly Gly Asp Gly Phe Glu Leu 245 250 255 Lys Thr Gly Pro Ile Phe Gln Lys Gly Ile Ile Pro Leu Arg Ser Phe 260 265 270 Val Cys Glu Pro Met Gln His Gly Arg Leu Phe Leu Ala Gly Asp Ala 275 280 285 Ala His Ser Val Pro Pro Thr Gly Ala Lys Gly Leu Asn Leu Ala Ala Ala 290 295 300 Ala Asp Val Tyr Val Leu Ala Arg Ala Leu Ala Ser Tyr Tyr Ala Lys 305 310 315 320 Arg Ser Thr Thr Leu Leu Asp Ala Tyr Ser Ser Thr Ala Leu Arg Arg 325 330 335 Val Trp Arg Ala Gln His Phe Ser Trp Trp Met Thr Ser Met Leu His 340 345 350 Trp Phe His Glu Gly Thr Glu Phe Asp Leu Lys Arg Gln Leu Ala Glu 355 360 365 Leu Glu Leu Val Thr Ser Ser Lys Ala Ala Ala Thr Thr Leu Ala Glu 370 375 380 Asn Tyr Val Gly Met Pro Leu Ala 385 390 <210> 9 <211> 1179 <212> DNA <213> Heavy metal-tolerant copper-greedy bacteria (Cupriavidus metallidurans) <220> <221> CDS <222> (1)..(1176) <223> Codon-optimized oligonucleotides <400> 9 atg cgc act cag gtt ggt atc att gga gct ggt cca gca ggc ttg ctc 48 Met Arg Thr Gln Val Gly Ile Ile Gly Ala Gly Pro Ala Gly Leu Leu 1 5 10 15 ctt tcc cat ctc ctg cac ctc aag ggt atc gat tct gtc gtc atc gaa 96 Leu Ser His Leu Leu His Leu Lys Gly Ile Asp Ser Val Val Ile Glu 20 25 30 tct cgg aca cgc gaa gag atc gag tcc acg att cgg gcg ggt gta ctg 144 Ser Arg Thr Arg Glu Glu Ile Glu Ser Thr Ile Arg Ala Gly Val Leu 35 40 45 gaa cag ggc acc atg gac ctc ttg cag gat gtt ggc ctt ggg aat cgc 192 Glu Gln Gly Thr Met Asp Leu Leu Gln Asp Val Gly Leu Gly Asn Arg 50 55 60 atg gtc gcc gag ggc gca ctt cac caa ggc ttc gaa ttg acc ttt gag 240 Met Val Ala Glu Gly Ala Leu His Gln Gly Phe Glu Leu Thr Phe Glu 65 70 75 80 ggc gaa cgg cat cgt atc gat ctc acc gac ctg acg ggc cat gcg atc 288 Gly Glu Arg His Arg Ile Asp Leu Thr Asp Leu Thr Gly His Ala Ile 85 90 95 acc gta tac gca cag cac gaa gtg atc aag gat ctt gtg gca gca cga 336 Thr Val Tyr Ala Gln His Glu Val Ile Lys Asp Leu Val Ala Ala Arg 100 105 110 gtg gca gct ggt ggg aaa ctg gtt ttc ggc gtt tcg aac act tct ctc 384 Val Ala Ala Gly Gly Lys Leu Val Phe Gly Val Ser Asn Thr Ser Leu 115 120 125 cac gat gtg gaa tcc acc aaa ccg tcg att cgc tac gag aag gac gac 432 His Asp Val Glu Ser Thr Lys Pro Ser Ile Arg Tyr Glu Lys Asp Asp 130 135 140 gac acg tgc gaa att cac tgc gac ttc gtc atc ggg tgt gat ggc tca 480 Asp Thr Cys Glu Ile His Cys Asp Phe Val Ile Gly Cys Asp Gly Ser 145 150 155 160 caa gga cca tca cgc tct gca att ccc gaa gca gtc cgc aaa gac cat 528 Gln Gly Pro Ser Arg Ser Ala Ile Pro Glu Ala Val Arg Lys Asp His 165 170 175 cag cgc ttg tac ccc ttt ggc tgg ttt ggc att ctg gtc gaa gct ccg 576 Gln Arg Leu Tyr Pro Phe Gly Trp Phe Gly Ile Leu Val Glu Ala Pro 180 185 190 cct tca tcc gac gag ctg atc tac gca cga cat gac cgc gga ttt gcc 624 Pro Ser Ser Asp Glu Leu Ile Tyr Ala Arg His Asp Arg Gly Phe Ala 195 200 205 ctg atc tcg act cgt agc cct acc gtc caa cgt atg tac ttc cag tgc 672 Leu Ile Ser Thr Arg Ser Pro Thr Val Gln Arg Met Tyr Phe Gln Cys 210 215 220 gat cca cgg gat agc gtt gag aac tgg tcc gac gat cgc atc tgg tcc 720 Asp Pro Arg Asp Ser Val Glu Asn Trp Ser Asp Asp Arg Ile Trp Ser 225 230 235 240 gag ctc cac gca cga ttg gat caa gcc gat ggt tgg cgt gta act gag 768 Glu Leu His Ala Arg Leu Asp Gln Ala Asp Gly Trp Arg Val Thr Glu 245 250 255 ggc cgc att ttc cag aag aac atc gtt ggt atg cgc tcc ttc gtg agc 816 Gly Arg Ile Phe Gln Lys Asn Ile Val Gly Met Arg Ser Phe Val Ser 260 265 270 aat gtg atg cag cac ggt cgc ctg ttt ctg gct ggg gat tct gcc cac 864 Asn Val Met Gln His Gly Arg Leu Phe Leu Ala Gly Asp Ser Ala His 275 280 285 atc gtt ccg cct act ggc gcg aaa gga atg aac ctc gcc gtg aac gat 912 Ile Val Pro Pro Thr Gly Ala Lys Gly Met Asn Leu Ala Val Asn Asp 290 295 300 gtc aag atc ctg gct gaa ggt ctg gac tcc ttc tac aag aac ggt acc 960 Val Lys Ile Leu Ala Glu Gly Leu Asp Ser Phe Tyr Lys Asn Gly Thr 305 310 315 320 gag gac aag ctg aat gcg tat acc gcc acc gcc ctg cag cgt atc tgg 1008 Glu Asp Lys Leu Asn Ala Tyr Thr Ala Thr Ala Leu Gln Arg Ile Trp 325 330 335 cgt gcg gag cac ttc tcc tgg tgg atg acc tcc atg ttg cac cgc ttc 1056 Arg Ala Glu His Phe Ser Trp Trp Met Thr Ser Met Leu His Arg Phe 340 345 350 gct gat gcg acc cca ttc gac cag caa ctt cag gtg tcc gaa ctg cgc 1104 Ala Asp Ala Thr Pro Phe Asp Gln Gln Leu Gln Val Ser Glu Leu Arg 355 360 365 tat gtc acc tcg tcc cgt gct ggc gct aca gct ctt gcc gag aac tat 1152 Tyr Val Thr Ser Ser Arg Ala Gly Ala Thr Ala Leu Ala Glu Asn Tyr 370 375 380 gtg gga atg gtt gga ctg agc cac taa 1179 Val Gly Met Val Gly Leu Ser His 385 390 <210> 10 <211> 392 <212> PRT <213> Cupriavidus metallidurans <400> 10 Met Arg Thr Gln Val Gly Ile Ile Gly Ala Gly Pro Ala Gly Leu Leu 1 5 10 15 Leu Ser His Leu Leu His Leu Lys Gly Ile Asp Ser Val Val Ile Glu 20 25 30 Ser Arg Thr Arg Glu Glu Ile Glu Ser Thr Ile Arg Ala Gly Val Leu 35 40 45 Glu Gln Gly Thr Met Asp Leu Leu Gln Asp Val Gly Leu Gly Asn Arg 50 55 60 Met Val Ala Glu Gly Ala Leu His Gln Gly Phe Glu Leu Thr Phe Glu 65 70 75 80 Gly Glu Arg His Arg Ile Asp Leu Thr Asp Leu Thr Gly His Ala Ile 85 90 95 Thr Val Tyr Ala Gln His Glu Val Ile Lys Asp Leu Val Ala Ala Arg 100 105 110 Val Ala Ala Gly Gly Lys Leu Val Phe Gly Val Ser Asn Thr Ser Leu 115 120 125 His Asp Val Glu Ser Thr Lys Pro Ser Ile Arg Tyr Glu Lys Asp Asp 130 135 140 Asp Thr Cys Glu Ile His Cys Asp Phe Val Ile Gly Cys Asp Gly Ser 145 150 155 160 Gln Gly Pro Ser Arg Ser Ala Ile Pro Glu Ala Val Arg Lys Asp His 165 170 175 Gln Arg Leu Tyr Pro Phe Gly Trp Phe Gly Ile Leu Val Glu Ala Pro 180 185 190 Pro Ser Ser Asp Glu Leu Ile Tyr Ala Arg His Asp Arg Gly Phe Ala 195 200 205 Leu Ile Ser Thr Arg Ser Pro Thr Val Gln Arg Met Tyr Phe Gln Cys 210 215 220 Asp Pro Arg Asp Ser Val Glu Asn Trp Ser Asp Asp Arg Ile Trp Ser 225 230 235 240 Glu Leu His Ala Arg Leu Asp Gln Ala Asp Gly Trp Arg Val Thr Glu 245 250 255 Gly Arg Ile Phe Gln Lys Asn Ile Val Gly Met Arg Ser Phe Val Ser 260 265 270 Asn Val Met Gln His Gly Arg Leu Phe Leu Ala Gly Asp Ser Ala His 275 280 285 Ile Val Pro Pro Thr Gly Ala Lys Gly Met Asn Leu Ala Val Asn Asp 290 295 300 Val Lys Ile Leu Ala Glu Gly Leu Asp Ser Phe Tyr Lys Asn Gly Thr 305 310 315 320 Glu Asp Lys Leu Asn Ala Tyr Thr Ala Thr Ala Leu Gln Arg Ile Trp 325 330 335 Arg Ala Glu His Phe Ser Trp Trp Met Thr Ser Met Leu His Arg Phe 340 345 350 Ala Asp Ala Thr Pro Phe Asp Gln Gln Leu Gln Val Ser Glu Leu Arg 355 360 365 Tyr Val Thr Ser Ser Arg Ala Gly Ala Thr Ala Leu Ala Glu Asn Tyr 370 375 380 Val Gly Met Val Gly Leu Ser His 385 390 <210> 11 <211> 1176 <212> DNA <213> Rhodococcus sp. <220> <221> CDS <222> (1)..(1173) <223> Codon-optimized oligonucleotides <400> 11 atg cgt acc caa gtg gcc atc att gga gcg ggt cca gct ggg ctg ctg 48 Met Arg Thr Gln Val Ala Ile Ile Gly Ala Gly Pro Ala Gly Leu Leu 1 5 10 15 ctc agc cac ctc ctg gat gaa cag gga atc gac tca atc ctg atc gaa 96 Leu Ser His Leu Leu Asp Glu Gln Gly Ile Asp Ser Ile Leu Ile Glu 20 25 30 tct cgc act cag gaa tac gtt ctg tca cgc atc cgt gcc ggt gtc ctg 144 Ser Arg Thr Gln Glu Tyr Val Leu Ser Arg Ile Arg Ala Gly Val Leu 35 40 45 gag cac tcc acg gtg caa ctt ctg gat gag cat ggg ttg ggt gag cgc 192 Glu His Ser Thr Val Gln Leu Leu Asp Glu His Gly Leu Gly Glu Arg 50 55 60 ctg cat cgc gaa ggt gat gaa cat cgc ggc atc tac ttg cag tgg ccc 240 Leu His Arg Glu Gly Asp Glu His Arg Gly Ile Tyr Leu Gln Trp Pro 65 70 75 80 gaa gaa cga cac cac atc gac ttc cgg gac ctg gtc gat cgt tcc gtc 288 Glu Glu Arg His His Ile Asp Phe Arg Asp Leu Val Asp Arg Ser Val 85 90 95 tgg gtg tat ggt cag acc gag gtg aca aag gat ctg gtc gtc gca cgc 336 Trp Val Tyr Gly Gln Thr Glu Val Thr Lys Asp Leu Val Val Ala Arg 100 105 110 gag aaa gcg ggt caa cag atc tac tac gat gtg tcc gac acc gcg ctt 384 Glu Lys Ala Gly Gln Gln Ile Tyr Tyr Asp Val Ser Asp Thr Ala Leu 115 120 125 cac gac gta gaa tcc gac gca ccc tac gtt acc ttc act gac gca tcg 432 His Asp Val Glu Ser Asp Ala Pro Tyr Val Thr Phe Thr Asp Ala Ser 130 135 140 ggc aat gcg gtt cgc att gat gca acc gtt gtt gcg ggc tgt gat ggc 480 Gly Asn Ala Val Arg Ile Asp Ala Thr Val Val Ala Gly Cys Asp Gly 145 150 155 160 tct ttc ggt cca tca cgg gct gca atg cct gac tcg gtt cgt aac acc 528 Ser Phe Gly Pro Ser Arg Ala Ala Met Pro Asp Ser Val Arg Asn Thr 165 170 175 tgg gag cgt gtg tac cca tat tcc tgg ttg ggc gtg ctt gca gat gtg 576 Trp Glu Arg Val Tyr Pro Tyr Ser Trp Leu Gly Val Leu Ala Asp Val 180 185 190 gct cct tct acc gac gag ctg atc tat gcc tgg cat cag gac ggt ttt 624 Ala Pro Ser Thr Asp Glu Leu Ile Tyr Ala Trp His Gln Asp Gly Phe 195 200 205 gca atg cac tcc atg cga tcc tcg acc gtt tct cgc ctg tac ctc cag 672 Ala Met His Ser Met Arg Ser Ser Thr Val Ser Arg Leu Tyr Leu Gln 210 215 220 gtt cct aac ggg act gac att gac acc tgg tcc gac gac cgc atc tgg 720 Val Pro Asn Gly Thr Asp Ile Asp Thr Trp Ser Asp Asp Arg Ile Trp 225 230 235 240 gat gct ctg gcc ctc cgt ctt gga cac gga caa gat ggc tgg acc ctg 768 Asp Ala Leu Ala Leu Arg Leu Gly His Gly Gln Asp Gly Trp Thr Leu 245 250 255 aat ccc ggc ccg att acc gag aag tcg gtg ttg cca atg cgc tct tac 816 Asn Pro Gly Pro Ile Thr Glu Lys Ser Val Leu Pro Met Arg Ser Tyr 260 265 270 gtc cag act cca atg cgc cat ggc aac ctt tat ctg gct ggt gat gca 864 Val Gln Thr Pro Met Arg His Gly Asn Leu Tyr Leu Ala Gly Asp Ala 275 280 285 gct cac atc gtc ccg cct act ggc gct aag ggt ctg aac ctg gct gta 912 Ala His Ile Val Pro Pro Thr Gly Ala Lys Gly Leu Asn Leu Ala Val 290 295 300 gca gat gtc gca ctc ctc gca cca gcc ttg gcg caa aag ctc aaa ggc 960 Ala Asp Val Ala Leu Leu Ala Pro Ala Leu Ala Gln Lys Leu Lys Gly 305 310 315 320 aac gac tcc cgt gcc gcg gat agc tac agc gat gat gcc ttg cga cgg 1008 Asn Asp Ser Arg Ala Ala Asp Ser Tyr Ser Asp Asp Ala Leu Arg Arg 325 330 335 gta tgg cgc tgc acc cac ttc agc tgg tgg atg acg acg atg ctt cac 1056 Val Trp Arg Cys Thr His Phe Ser Trp Trp Met Thr Thr Met Leu His 340 345 350 aca gga gat gac ccg ttt gat gcc cag ctc cag ctt tcc cag ctc aag 1104 Thr Gly Asp Asp Pro Phe Asp Ala Gln Leu Gln Leu Ser Gln Leu Lys 355 360 365 tgg gtc gca tcc tcc gaa gcc gga gct atg ggc ttg gct gag aac tac 1152 Trp Val Ala Ser Ser Glu Ala Gly Ala Met Gly Leu Ala Glu Asn Tyr 370 375 380 gct ggc ctt ccg att ggc ttc taa 1176 Ala Gly Leu Pro Ile Gly Phe 385 390 <210> 12 <211> 391 <212> PRT <213> Rhodococcus sp. <400> 12 Met Arg Thr Gln Val Ala Ile Ile Gly Ala Gly Pro Ala Gly Leu Leu 1 5 10 15 Leu Ser His Leu Leu Asp Glu Gln Gly Ile Asp Ser Ile Leu Ile Glu 20 25 30 Ser Arg Thr Gln Glu Tyr Val Leu Ser Arg Ile Arg Ala Gly Val Leu 35 40 45 Glu His Ser Thr Val Gln Leu Leu Asp Glu His Gly Leu Gly Glu Arg 50 55 60 Leu His Arg Glu Gly Asp Glu His Arg Gly Ile Tyr Leu Gln Trp Pro 65 70 75 80 Glu Glu Arg His His Ile Asp Phe Arg Asp Leu Val Asp Arg Ser Val 85 9� 95 Trp Val Tyr Gly Gln Thr Glu Val Thr Lys Asp Leu Val Val Ala Arg 100 105 110 Glu Lys Ala Gly Gln Gln Ile Tyr Tyr Asp Val Ser Asp Thr Ala Leu 115 120 125 His Asp Val Glu Ser Asp Ala Pro Tyr Val Thr Phe Thr Asp Ala Ser 130 135 140 Gly Asn Ala Val Arg Ile Asp Ala Thr Val Val Ala Gly Cys Asp Gly 145 150 155 160 Ser Phe Gly Pro Ser Arg Ala Ala Met Pro Asp Ser Val Arg Asn Thr 165 170 175 Trp Glu Arg Val Tyr Pro Tyr Ser Trp Leu Gly Val Leu Ala Asp Val 180 185 190 Ala Pro Ser Thr Asp Glu Leu Ile Tyr Ala Trp His Gln Asp Gly Phe 195 200 205 Ala Met His Ser Met Arg Ser Ser Thr Val Ser Arg Leu Tyr Leu Gln 210 215 220 Val Pro Asn Gly Thr Asp Ile Asp Thr Trp Ser Asp Asp Arg Ile Trp 225 230 235 240 Asp Ala Leu Ala Leu Arg Leu Gly His Gly Gln Asp Gly Trp Thr Leu 245 250 255 Asn Pro Gly Pro Ile Thr Glu Lys Ser Val Leu Pro Met Arg Ser Tyr 260 265 270 Val Gln Thr Pro Met Arg His Gly Asn Leu Tyr Leu Ala Gly Asp Ala 275 280 285 Ala His Ile Val Pro Pro Thr Gly Ala Lys Gly Leu Asn Leu Ala Val 290 295 300 Ala Asp Val Ala Leu Leu Ala Pro Ala Leu Ala Gln Lys Leu Lys Gly 305 310 315 320 Asn Asp Ser Arg Ala Ala Asp Ser Tyr Ser Asp Asp Ala Leu Arg Arg 325 330 335 Val Trp Arg Cys Thr His Phe Ser Trp Trp Met Thr Thr Met Leu His 340 345 350 Thr Gly Asp Asp Pro Phe Asp Ala Gln Leu Gln Leu Ser Gln Leu Lys 355 360 365 Trp Val Ala Ser Ser Glu Ala Gly Ala Met Gly Leu Ala Glu Asn Tyr 370 375 380 Ala Gly Leu Pro Ile Gly Phe 385 390 <210> 13 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 13 tattaattaa atgcgcgttt taattattga taattatgat tc 42 <210> 14 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 14 ttgcggccgc ttgtttaaac ctccttacag aaaaatggtt gggcg 45 <210> 15 <211> 33 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 15 aaatttaaac ctcctttaca gaaaaatggt tgg 33 <210> 16 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 16 ggaggtttaa acaagcggcc gcgatatc 28 <210> 17 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 17 aggaggttta aatttatgcg cactcaggtg gctat 35 <210> 18 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 18 cttgtttaaa cctccttata cgagtggcag tccta 35 <210> 19 <211> 31 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 19 gctatcaaaa cattcggcac attggttttc c 31 <210> 20 <211> 29 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 20 ggaagatgcg tgatctgatc cttcaactc 29 <210> twenty one <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> twenty one ttacagaaaa atggttgggc gcaa 24 <210> twenty two <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> twenty two atgcgcactc aggtggctat cg 22 <210> twenty three <211> 342 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> twenty three tacgtacctg caggtagcgt gtcagtaggc gcgtagggta agtggggtag cggcttgtta 60 gatatcttga aatcggcttt caacagcatt gatttcgatg tatttagctg gccgttaccc 120 tgcgaatgtc cacagggtag ctggtagttt gaaaatcaac gccgttgccc ttaggattca 180 gtaactggca cattttgtaa tgcgctagat ctgtgtgctc agtcttccag gctgctttc 240 acagtgaaag caaaaccaat tcgtggctgc gaaagtcgta gccaccacga agtccaaagg 300 aggatctaaa ttatgaataa tataaaagga ggaattaatt aa 342 <210> twenty four <211> 36 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> twenty four accatttttc tgtaatacgt acctgcaggt agcgtg 36 <210> 25 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 25 cacctgagtg cgcatttaat taattcctcc tttta 35 <210> 26 <211> 29 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 26 gcttgttaga tatcttgaaa tcggctttc 29 <210> 27 <211> 18 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 27 ggaggtttaa acaagcgg 18 <210> 28 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 28 aatttagatc ctcctttgga cttcgtg 27 <210> 29 <211> 36 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 29 aggaggatct aaattatgcg tactcaggtg ggaatc 36 <210> 30 <211> 32 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 30 cttgtttaaa cctccttaag caagtggcat gc 32 <210> 31 <211> 36 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 31 aggaggatct aaattatgcg cactcaggtg gcaatc 36 <210> 32 <211> 34 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 32 cttgtttaaa cctccttagt atggcaggcc tacg 34 <210> 33 <211> 36 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 33 aggaggatct aaattatgcg cacccaagtg gtcatc 36 <210> 34 <211> 37 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 34 cttgtttaaa cctccttaga acggcagacc cacgtag 37 <210> 35 <211> 36 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 35 aggaggatct aaattatgcg cactcaggtt ggtatc 36 <210> 36 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 36 cttgtttaaa cctccttagt ggctcagtcc aaccattc 38 <210> 37 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 37 aggaggatct aaattatgcg tacccaagtg gccatcattg 40 <210> 38 <211> 36 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 38 cttgtttaaa cctccttaga agccaatcgg aaggcc 36 <210> 39 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 39 gccgggctcc tggaacagtc tacggtt 27 <210> 40 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 40 ttccaggagc ccggcgcgga tggtctg 27 <210> 41 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 41 gctggtctcc tggaacgtat cacggtg 27 <210> 42 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 42 ttccaggaga ccagcccgaa ctcggcc 27 <210> 43 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 43 gcaggcctcc tggagcaggg catggtt 27 <210> 44 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 44 ctccaggagg cctgcacgga tgcggga 27 <210> 45 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 45 gctggactct tggaacaggg caccgtt 27 <210> 46 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 46 ttccaagagt ccagcgcgaa ctcgccc 27 <210> 47 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 47 gcgggtctcc tggaacaggg caccatg 27 <210> 48 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 48 ttccaggaga cccgcccgaa tcgtgga 27 <210> 49 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 49 gccggtctcc tggagcactc cacggtg 27 <210> 50 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 50 ctccaggaga ccggcacgga tgcgtga 27 <210> 51 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 51 ctcatcttcg cacatcacga ccgcgga 27 <210> 52 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 52 atgtgcgaag atgagctctt cggatga 27 <210> 53 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 53 cgcatgttct tccagtgcgc acctacc 27 <210> 54 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 54 ctggaagaac atgcgctgga tattcgg 27 <210> 55 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 55 ttgatcttct cgaaccatga tcgcggt 27 <210> 56 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 56 gttcgagaag atcaactcgt ggtcaca 27 <210> 57 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 57 cgctatttcg tgcagtgctc actcgac 27 <210> 58 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 58 ctgcacgaaa tagcgggagc gtgtcgg 27 <210> 59 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 59 ctgatcttcg tcaaccacga ccgaggc 27 <210> 60 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 60 gttgacgaag atcagttctg ggctgac 27 <210> 61 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 61 cggtacttcg tccaatgccctttgacc 27 <210> 62 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 62 ttggacgaag taccgtgaac ggtgcat 27 <210> 63 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 63 ctcgtgttcg ctaatcaccc acgcggg 27 <210> 64 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 64 attagcgaac acgagttcat gatcgac 27 <210> 65 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 65 cgctacttca tccagtgccc tttggag 27 <210> 66 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 66 ctggatgaag tagcgagaac gggtatg 27 <210> 67 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 67 gctggtattc tggaacgtat cacggtg 27 <210> 68 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 68 ttccagaata ccagcccgaa ctcggcc 27 <210> 69 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 69 gctggttctc tggaacgtat cacggtg 27 <210> 70 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 70 ttccagagaa ccagcccgaa ctcggcc 27 <210> 71 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 71 gctggtacac tggaacgtat cacggtg 27 <210> 72 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 72 ttccagtgta ccagcccgaa ctcggcc 27 <210> 73 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 73 gctggttgtc tggaacgtat cacggtg 27 <210> 74 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 74 ttccagacaa ccagcccgaa ctcggcc 27 <210> 75 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 75 gctggtatgc tggaacgtat cacggtg 27 <210> 76 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 76 ttccagcata ccagcccgaa ctcggcc 27 <210> 77 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 77 gctggtcaac tggaacgtat cacggtg 27 <210> 78 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 78 ttccagttga ccagcccgaa ctcggcc 27 <210> 79 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 79 ttggtggcag ctggcgctaa tcttgcg 27 <210> 80 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 80 gccagctgcc accaagccct ctcggcg 27 <210> 81 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 81 ttggtgatgg ctggcgctaa tcttgcg 27 <210> 82 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 82 gccagccatc accaagccct ctcggcg 27 <210> 83 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 83 tttgccatgg cgtcgatgcg ctcaccg 27 <210> 84 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 84 cgacgccatg gcaaaaccgc gatcatg 27 <210> 85 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 85 ccacccgcag gagcgaaagg gatgaac 27 <210> 86 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 86 cgctcctgcg ggtggaacga tatgagc 27 <210> 87 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 87 ccacccggtg gagcgaaagggatgaac 27 <210> 88 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 88 cgctccaccg ggtggaacgatatgagc 27 <210> 89 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 89 ccaccctgtg gagcgaaagg gatgaac 27 <210> 90 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 90 cgctccacagggtggaacgatatgagc 27 <210> 91 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 91 cccaccctctg gagcgaaagg gatgaac 27 <210> 92 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 92 cgctccagagggtggaacgatatgagc 27 <210> 93 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 93 gagaacgttg taggactgcc actcgta 27 <210> 94 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 94 tcctacaacg ttctccgcca gggtgac 27 <210> 95 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 95 gagaacctcg taggactgcc actcgta 27 <210> 96 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 96 tcctacgagg ttctccgcca gggtgac 27 <210> 97 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 97 gagaacattg taggactgcc actcgta 27 <210> 98 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 98 tcctacaatg ttctccgcca gggtgac 27 <210> 99 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 99 gagaacatgg taggactgcc actcgta 27 <210> 100 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Synthetic oligonucleotides <400> 100 tcctaccatg ttctccgcca gggtgac 27

Claims

1. A method for producing a mutant polypeptide having 4-aminobenzoic acid hydroxylation activity, characterized in that: In a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8, 10 or 12 and having 4-aminobenzoic acid hydroxylation activity, the valine residue at position 47 of the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8, 10 or 12 is substituted with leucine.

2. A method for improving the hydroxylation activity of 4-aminobenzoic acid, characterized in that: In a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8, 10 or 12 and having 4-aminobenzoic acid hydroxylation activity, the valine residue at position 47 of the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8, 10 or 12 is substituted with leucine.

3. A polypeptide having 4-aminobenzoic acid hydroxylation activity obtained by the method for producing a mutant polypeptide having 4-aminobenzoic acid hydroxylation activity according to claim 1, or by the method for enhancing 4-aminobenzoic acid hydroxylation activity according to claim 2. A polynucleotide encoding the polypeptide of claim 3.

5. A vector or DNA segment comprising the polynucleotide of claim 4. A transformed cell comprising the vector or DNA fragment according to claim 5.

7. The transformed cell according to claim 6, wherein The transformed cell is Escherichia coli or Corynebacterium.

8. The transformed cell according to claim 6 or 7, wherein The transformed cell is a microorganism capable of supplying 4-aminobenzoic acid, 4-Aminobenzoic acid derivatives are represented by the following general formula (2): In formula (2), R 1 represents a hydrogen atom, a hydroxyl group, a methoxy group, an amino group, a fluorine atom, a chlorine atom, a bromine atom, an iodine atom, a carboxyl group, a methyl group, an ethyl group, and R 2 represents a hydrogen atom, a hydroxyl group, a methoxy group, an amino group, a fluorine atom, a chlorine atom, a bromine atom, an iodine atom, a carboxyl group, a methyl group, or an ethyl group.

9. A method for producing 4-amino-3-hydroxybenzoic acids, comprising the step of culturing the transformed cell according to any one of claims 6 to 8, or the step of culturing the transformed cell according to claim 8, in the presence of 4-aminobenzoic acids. 4-Amino-3-hydroxybenzoic acid derivatives are 4-amino-3-hydroxybenzoic acid derivatives represented by the following general formula (1), and 4-aminobenzoic acid derivatives are 4-aminobenzoic acid derivatives represented by the following general formula (2). In formula (1), R 1 represents a hydrogen atom, a hydroxyl group, a methoxy group, an amino group, a fluorine atom, a chlorine atom, a bromine atom, an iodine atom, a carboxyl group, a methyl group, an ethyl group, and R 2 represents a hydrogen atom, a hydroxyl group, a methoxy group, an amino group, a fluorine atom, a chlorine atom, a bromine atom, an iodine atom, a carboxyl group, a methyl group, or an ethyl group, and X 1 and X 2 is a hydrogen atom or a hydroxyl group, at least one of which represents a hydroxyl group, In formula (2), R 1 represents a hydrogen atom, a hydroxyl group, a methoxy group, an amino group, a fluorine atom, a chlorine atom, a bromine atom, an iodine atom, a carboxyl group, a methyl group, an ethyl group, and R 2 represents a hydrogen atom, a hydroxyl group, a methoxy group, an amino group, a fluorine atom, a chlorine atom, a bromine atom, an iodine atom, a carboxyl group, a methyl group, or an ethyl group.

10. The method according to claim 9, comprising the step of recovering 4-amino-3-hydroxybenzoic acid compounds from the culture medium.

Images