Use of Glucosamine and Its Derivatives as Anti-SARS-CoV-2 Drugs

Abstract

The present invention provides the use of a class of glucosamine compounds represented by general formula I and pharmaceutically acceptable salts thereof in the preparation of drugs against SARS-CoV-2 virus and its mutant virus strains. The compounds represented by general formula I according to the present invention have good anti-SARS-CoV-2 virus effects and can be used in the preparation of anti-SARS-CoV-2 virus drugs.

Description

[0001] This invention is a divisional application of the application with application number 202011155916.6 and invention title "Use of Glucosamine and Its Derivatives as Anti - Novel Coronavirus Drugs", which was filed on October 26, 2020. Technical Field

[0002] This invention belongs to the field of medicine. Specifically, it relates to the use of a class of glucosamine compounds, their pharmaceutically acceptable salts, and pharmaceutical compositions containing such glucosamine compounds in the preparation of drugs against SARS - CoV - 2 virus (novel coronavirus) and its mutant virus strains. Background Art

[0003] Glucosamine, abbreviated as glucosamine, is an important precursor in protein or lipid glycosylation reactions. Its chemical structure is an amino monosaccharide formed by replacing the 2 - hydroxyl group of glucose with an amino group. The glucosamine derivative N - acetylglucosamine is the monomer of chitin. Industrially, glucosamine is usually prepared by hydrolyzing the exoskeletons of crustaceans. Glucosamine is often used as a dietary adjuvant for the treatment of osteoarthritis. The inventors of this invention found during experiments that glucosamine and its derivatives have obvious inhibitory effects on a variety of viruses and have good drug safety, so their development as antiviral drugs has broad prospects. For example, in the literature of F. Floc’h et al. (In vivo Antiviral Activity of D - Glucosamine, Archive of Virology 52, 169 - 173 (1976)), it has been reported that glucosamine can reduce the growth rate of tumors induced by Rous sarcoma virus in quails or chicks and increase the survival rate of mice inoculated with human influenza virus. However, the classification and subtypes of various coronaviruses such as those today did not exist nearly half a century ago.

[0004] Recently, with the spread of the novel coronavirus epidemic worldwide, people have realized the urgency of developing anti - novel coronavirus drugs. The International Committee on Taxonomy of Viruses announced that the novel coronavirus was named "SARS - CoV - 2". At the same time, pneumonia was named "COVID - 19".

[0005] The inventors of this application further studied the previously developed compound (Chinese Patent CN201910192721.X) and found that glucosamine and its derivatives also have obvious curative effects on the SARS - CoV - 2 virus.

[0006] The inventor further found through research that the glucosamine compound represented by Formula 1, with the chemical name of 2-amino-2-deoxy-D-glucopyranose, has an obvious inhibitory effect on the SARS-CoV-2 virus. It has good development prospects as a drug against the SARS-CoV-2 virus (novel coronavirus) and its mutant virus strains. Summary of the Invention

[0007] In one aspect of the present invention, there is provided the use of the glucosamine compound shown by General Formula I and its pharmaceutically acceptable salts in the preparation of drugs against the SARS-CoV-2 virus and its mutant virus strains:

[0008]

[0009] Wherein, the substituents R and R' are the same or different, and each independently selected from hydrogen, substituted or unsubstituted C1-C8 alkyl, substituted or unsubstituted C1-C8 alkylcarbonyl, substituted or unsubstituted C6-C15 arylcarbonyl, substituted or unsubstituted C6-C15 aryloxycarbonyl, and substituted or saturated or unsaturated 5- or 6-membered heterocyclic group aminocarbonyl containing 1 to 3 heteroatoms selected from N, O, and S;

[0010] Wherein, the "substituted" means that the substituent further contains 1 or 2 substituents selected from methyl, ethyl, propyl, methoxy, ethoxy, propoxy, methyl formate, ethyl formate, propyl formate, fluorine, and chlorine.

[0011] Preferably, the substituents R and R' are the same or different, and each independently selected from hydrogen, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C1-C6 alkylcarbonyl, substituted or unsubstituted C6-C10 arylcarbonyl, substituted or unsubstituted C6-C10 aryloxycarbonyl.

[0012] More preferably, the substituents R and R' are the same or different, and each independently selected from hydrogen, substituted or unsubstituted C1-C4 alkyl, substituted or unsubstituted C1-C4 alkylcarbonyl, substituted or unsubstituted C6-C8 arylcarbonyl, substituted or unsubstituted C6-C8 aryloxycarbonyl.

[0013] Further preferably, the substituents R and R’ are each independently selected from hydrogen, methyl, ethyl, propyl, isopropyl, n-butyl, isobutyl, tert-butyl, methylcarbonyl, ethylcarbonyl, propylcarbonyl, isopropylcarbonyl, n-butylcarbonyl, isobutylcarbonyl, tert-butylcarbonyl, phenylcarbonyl, methylphenylcarbonyl, ethylphenylcarbonyl, propylphenylcarbonyl, isopropylphenylcarbonyl, n-butylphenylcarbonyl, isobutylphenylcarbonyl, tert-butylphenylcarbonyl, naphthylcarbonyl, methylnaphthylcarbonyl, ethylnaphthylcarbonyl, propylnaphthylcarbonyl, isopropylnaphthylcarbonyl, n-butylnaphthylcarbonyl, isobutylnaphthylcarbonyl, tert-butylnaphthylcarbonyl.

[0014] Preferably, the glucosamine compound represented by the general formula I and its pharmaceutically acceptable salts are selected from one of the following compounds:

[0015]

[0016] Preferably, the pharmaceutically acceptable salt is a conventional non-toxic salt formed by the reaction of the compound of general formula I with an inorganic acid or an organic acid.

[0017] Further preferably, the non-toxic salt is prepared by reacting the compound of general formula I with an inorganic acid or an organic acid. The inorganic acids include hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, sulfamic acid and phosphoric acid, and the organic acids include citric acid, tartaric acid, lactic acid, pyruvic acid, acetic acid, benzenesulfonic acid, p-toluenesulfonic acid, methanesulfonic acid, naphthalenesulfonic acid, ethanesulfonic acid, naphthalenedisulfonic acid, maleic acid, malic acid, malonic acid, fumaric acid, succinic acid, propionic acid, oxalic acid, trifluoroacetic acid, stearic acid, pamoic acid, hydroxymaleic acid, phenylacetic acid, benzoic acid, salicylic acid, glutamic acid, ascorbic acid, p-aminobenzenesulfonic acid, 2-acetoxybenzoic acid and isethionic acid; or the sodium salt, potassium salt, calcium salt, aluminum salt or ammonium salt formed by reacting the compound of general formula I with propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, aspartic acid or glutamic acid to form an ester and then reacting with an inorganic base; or the methylamine salt, ethylamine salt or ethanolamine salt formed by reacting the compound of general formula I with an organic base; or the corresponding inorganic acid salts formed by reacting the compound of general formula I with lysine, arginine, ornithine to form an ester and then reacting with hydrochloric acid, hydrobromic acid, hydrofluoric acid, sulfuric acid, nitric acid, phosphoric acid or the corresponding organic acid salts formed by reacting with formic acid, acetic acid, picric acid, methanesulfonic acid and ethanesulfonic acid.

[0018] On the other hand, the present invention provides an anti-SARS-CoV-2 virus pharmaceutical composition, which contains the compound represented by the general formula I, its pharmaceutically acceptable salts as active ingredients, and pharmaceutically acceptable carriers or excipients.

[0019] On the other hand, the present invention provides the use of the pharmaceutical composition in the preparation of a drug against SARS-CoV-2 virus and its mutant virus strains.

[0020] Preferably, the pharmaceutical composition includes, but is not limited to, capsules, tablets, injections, suppositories, infusions, liniments, and emulsions.

[0021] Preferably, the use of the glucosamine compound represented by the general formula I according to the present invention, its pharmaceutically acceptable salt, or a pharmaceutical composition containing the compound represented by the general formula I and its pharmaceutically acceptable salt as an active ingredient in the preparation of a drug against the SARS-CoV-2 virus and its mutant virus strains, wherein the drug is used for treating or preventing atypical pneumonia caused by the SARS-CoV-2 virus and its mutant virus strains in mammals.

[0022] Preferably, the mammals include bovines, equines, ovines, porcines, canines, felines, rodents, and primates, such as humans, cats, dogs, or pigs.

[0023] Beneficial effects

[0024] The compound represented by the general formula I according to the present invention has a good anti-SARS-CoV-2 virus effect and can be used for preparing an anti-SARS-CoV-2 virus drug. Description of the drawings

[0025] Figure 1 It is a flow chart of the mouse infection experiment according to Example 1.

[0026] Figure 2 It is a comparative analysis diagram of the scanned sections of the bronchi and lung tissues of the mice in the administration group and the control group according to Example 1.

[0027] Figure 3 It is a comparison diagram of the viral RNA loads in the bronchi and lung tissues of the mice in the administration group and the control group according to Example 1.

[0028] Figure 4 It is a flow chart of the mouse infection experiment according to Example 2.

[0029] Figure 5 It is a comparison diagram of the viral RNA loads in the bronchi and lung tissues of the mice in the administration group and the control group according to Example 2.

[0030] Figure 6 It is a flow chart of the mouse infection experiment according to Example 3.

[0031] Figure 7 It is a comparison diagram of the viral RNA loads in the bronchi and lung tissues of the mice in the administration group and the control group according to Example 3.

[0032] Figure 8 It is a flow chart of the mouse infection experiment according to Example 4.

[0033] Figure 9 Control chart of viral RNA load in bronchial and lung tissues of mice in the administration group and the control group according to Example 4.

[0034] Figure 10 Flow chart of the mouse infection experiment according to Example 5.

[0035] Figure 11 Control chart of viral RNA load in bronchial and lung tissues of mice in the administration group and the control group according to Example 5.

[0036] Figure 12 Flow chart of the mouse infection experiment according to Example 6.

[0037] Figure 13 Control chart of viral RNA load in bronchial and lung tissues of mice in the administration group and the control group according to Example 6.

[0038] The fluorescence quantitative real-time PCR (qRT-PCR) method was used to evaluate the differences in SARS-CoV-2 viral loads in bronchial and lung tissues of mice in the control group and the administration group in Test Examples 1-6. Detailed implementation mode

[0039] Hereinafter, the present invention will be described in detail. Before the description, it should be understood that the terms used in this specification and the appended claims should not be construed as limited to the general meaning and dictionary meaning, but should be interpreted according to the meaning and concept corresponding to the technical aspects of the present invention on the basis of the principle that allows the inventor to appropriately define the terms for the best interpretation. Therefore, the description presented here is only a preferred example for illustrative purposes and is not intended to limit the scope of the present invention. Thus, it should be understood that other equivalent ways or improved ways can be obtained without departing from the spirit and scope of the present invention.

[0040] The novel coronavirus 2019 (2019-nCoV) is a new strain of coronavirus that has never been found in humans before. On February 11, 2020, the International Committee on Taxonomy of Viruses (ICTV) announced that the official classification name of the novel coronavirus 2019 (2019-nCoV) is severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). On the same day, the World Health Organization (WHO) announced that the official name of the disease caused by this virus is COVID-19. The symptoms of SARS-CoV-2 infection are mainly pneumonia, which can be divided into simple infection, mild pneumonia, severe pneumonia, acute respiratory distress syndrome, sepsis, septic shock, etc. according to the severity of the condition. Patients with simple infection may have non-specific symptoms, such as fever, cough, sore throat, nasal congestion, fatigue, headache, muscle pain or discomfort, and the elderly and immunosuppressed may have atypical symptoms. Patients with mild pneumonia mainly have cough and shortness of breath. Severe pneumonia can be seen in adults, adolescents or children, and the main symptoms are increased respiratory rate, severe respiratory failure or dyspnea, central cyanosis, lethargy, confusion or convulsions, gasping, etc. The lung imaging of acute respiratory distress syndrome is bilateral ground-glass opacity, but it cannot be completely explained by effusion, lobar exudation, atelectasis or pulmonary mass, and the main symptom is pulmonary edema. Sepsis patients often have life-threatening organ dysfunction, and septic shock is the most critically ill patient with a high possibility of death. At present, for novel coronavirus infection, clinical treatment is mainly supportive, and there are no specific antiviral drugs available.

[0041] The inventors of the present invention have found that the glucosamine compound represented by the general formula I according to the present invention, its pharmaceutically acceptable salt or solvate can effectively inhibit the occurrence of SARS-CoV-2 virus-related diseases.

[0042] In addition, based on the use of the compound represented by the formula I in the preparation of drugs against SARS-CoV-2 virus and its mutant virus strains, the present invention has developed a new pharmaceutical composition, which contains the compound represented by the general formula I, its pharmaceutically acceptable salt or solvate as the active ingredient, and a pharmaceutically acceptable carrier or excipient.

[0043] The "pharmaceutically acceptable salts" are conventional non-toxic salts formed by the reaction of the compounds of Formula I with inorganic acids or organic acids. For example, the conventional non-toxic salts can be prepared by reacting the compounds of Formula I with inorganic acids or organic acids. The inorganic acids include hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, sulfamic acid, phosphoric acid, etc., and the organic acids include citric acid, tartaric acid, lactic acid, pyruvic acid, acetic acid, benzenesulfonic acid, p-toluenesulfonic acid, methanesulfonic acid, naphthalenesulfonic acid, ethanesulfonic acid, naphthalenedisulfonic acid, maleic acid, malic acid, malonic acid, fumaric acid, succinic acid, propionic acid, oxalic acid, trifluoroacetic acid, stearic acid, pamoic acid, hydroxymaleic acid, phenylacetic acid, benzoic acid, salicylic acid, glutamic acid, ascorbic acid, p-aminobenzenesulfonic acid, 2-acetoxybenzoic acid, isethionic acid, etc.; or the sodium salts, potassium salts, calcium salts, aluminum salts or ammonium salts formed by reacting the esters of the compounds of Formula I with propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, aspartic acid or glutamic acid with inorganic bases; or the methylamine salts, ethylamine salts or ethanolamine salts formed by reacting the compounds of Formula I with organic bases; or the corresponding inorganic acid salts formed by reacting the esters of the compounds of Formula I with lysine, arginine, ornithine with hydrochloric acid, hydrobromic acid, hydrofluoric acid, sulfuric acid, nitric acid, phosphoric acid or the corresponding organic acid salts formed with formic acid, acetic acid, picric acid, methanesulfonic acid and ethanesulfonic acid.

[0044] The term "pharmaceutically acceptable carrier or excipient" refers to any preparation or carrier medium that can deliver an effective amount of the active substance of the present invention, does not interfere with the biological activity of the active substance and is non-toxic and has no side effects on the host or patient. Representative carriers include water, oils, vegetables and minerals, paste bases, lotion bases, ointment bases, etc. These bases include suspending agents, thickening agents, transdermal promoters, etc. Their preparations are well known to those skilled in the art of the cosmetics field or the topical drug field. For other information about carriers, reference can be made to Remington: The Science and Practice of Pharmacy, 21st Ed., Lippincott, Williams & Wilkins (2005), the content of which is incorporated herein by reference.

[0045] For a drug or a pharmacological active agent, the term "effective amount" or "therapeutically effective amount" refers to a sufficient amount of the drug or agent that is non-toxic but can achieve the desired effect. For the oral dosage forms in the present invention, the "effective amount" of an active substance in the composition refers to the amount required to achieve the desired effect when used in combination with another active substance in the composition. The determination of the effective amount varies from person to person, depending on the age and general condition of the recipient, and also depends on the specific active substance. The appropriate effective amount in a particular case can be determined by those skilled in the art according to routine tests.

[0046] The pharmaceutical composition of the present invention can be in various dosage forms, including but not limited to, capsules, tablets, injections, suppositories, infusions, liniments, emulsions, solid preparations, injections, topical preparations, sprays, liquid preparations or compound preparations, etc.

[0047] The various dosage forms of the pharmaceutical composition of the present invention can be prepared according to the conventional preparation methods in the pharmaceutical field. The unit dose of its formulation contains 0.05 - 200 mg of the compound of general formula (I). Preferably, the unit dose of the formulation contains 0.1 mg - 100 mg of the compound of general formula (I).

[0048] The compounds and pharmaceutical compositions of the present invention can be clinically used in mammals, including humans and animals, and can be administered through oral, nasal, dermal, pulmonary, or gastrointestinal routes, etc. The most preferred is oral administration. The optimal daily dose is preferably 0.01 - 200 mg / kg body weight, taken once, or 0.01 - 100 mg / kg body weight taken in divided doses. Regardless of the administration method, the optimal dose for an individual should be determined according to the specific treatment. Usually, it starts with a small dose and gradually increases the dose until the most suitable dose is found.

[0049] The following examples are only listed as examples of the embodiments of the present invention and do not constitute any limitation to the present invention. Those skilled in the art can understand that modifications within the scope of not deviating from the essence and concept of the present invention fall within the protection scope of the present invention. Unless otherwise specified, the reagents and instruments used in the following examples are commercially available products.

[0050] Experimental Example 1

[0051]

[0052] Commercially available cas: 90 - 77 - 7

[0053] Experimental Example 2

[0054]

[0055] Commercially available cas: 10036 - 64 - 3

[0056] Experimental Example 3

[0057]

[0058] The synthesis of the compound refers to Journal of Biotechnology, 115(2), 157 - 166; 2005

[0059] 11H NMR (400 MHz, D2O): 0.95 (3H, m), 2.16 (2H, m), 3.29 (1H, dd,), 3.62 (1H, dd), 3.58 (1H, dd), 3.61–3.67 (2H, m), 3.72 (1H, dd), 4.99 (1H, d, J = 3.5 Hz, H-1). ESI-MS: 236.5 [M+H] +

[0060] Experimental Example 4

[0061]

[0062] The synthesis of the compound refers to Journal of Biotechnology, 115(2), 157-166; 2005

[0063] 1 1H NMR (400 MHz, D2O): 0.95 (3H, m), 1.32 (2H, m), 2.16 (2H, m), 3.29 (1H, dd,), 3.62 (1H, dd), 3.58 (1H, dd), 3.61–3.67 (2H, m), 3.72 (1H, dd), 4.99 (1H, d, J = 3.5 Hz, H-1). ESI-MS: 250.1 [M+H] +

[0064] Experimental Example 5

[0065]

[0066] Prepared according to the reference Huaxue Yanjiu Yu Yingyong, 20(3), 290-294; 2008; Yield: 96.0%.

[0067] 1 1H NMR (DMSO-d6, 400 MHz) δ: 7.95~7.54 (m, 5H, Ar), 7.45~7.42 (m, 1H, J 1,2 = 7.6 Hz, H-1, β-), 6.52 (d, J NH,2 = 4.8 Hz, 1H, NH), 5.04~4.57 (m, 4H, 4OH), 3.81~3.72 (m, 1H, H-4), 3.73~3.71 (m, 1H, H-3), 3.66~3.63 (m, 2H, H-6 and H-6'), 3.51~3.42 (m, 1H, H-5), 3.20~3.16 (m, 1H, H-2). ESI-MS: 284 [M+1] +

[0068] Experimental Example 6

[0069]

[0070] Reference: Prepared from Huaxue Yanjiu Yu Yingyong, 20(3), 290 - 294; 2008; Yield: 96.0%.

[0071] 1 HNMR (DMSO - d6, 400 MHz) δ: 7.92~7.54 (m, 4H, Ar), 7.45~7.42 (m, 1H, J 1,2 =7.6 Hz, H - 1, β - ), 6.52 (d, J NH,2 =4.8 Hz, 1H, NH), 5.04~4.57 (m, 4H, 4OH), 3.81~3.72 (m, 1H, H - 4), 3.73~3.71 (m, 1H, H - 3), 3.66~3.63 (m, 2H, H - 6 and H - 6'), 3.51~3.42 (m, 1H, H - 5), 3.20~3.16 (m, 1H, H - 2), 2.35 (s, 3H). ESI - MS: 298[M + 1] +

[0072] Example 1: Evaluation of the anti - SARS - CoV - 2 virus activity of Compound 1 at the animal level.

[0073] 1. Mouse infection experiment:

[0074] Select 6 - 8 - week - old BALB / c mice with the same sex and weight. Divide the mice into two groups on average (control group and drug - administered group). The mice in the control group are fed with ordinary breeding mouse food, and the mice in the drug - administered group are fed with mouse food containing Compound 1 (content: 2.5% (weight percentage)). After three days of feeding, both groups of mice are infected with the SARS - CoV - 2 mouse - adapted strain virus by nasal drip. During the virus infection period, the mice in the drug - administered group continue to be fed with mouse food containing the glucosamine of Compound I. Three days after the virus infection, the mice are euthanized, and the bronchial and lung tissues of the mice are obtained by dissection. The experimental flow chart is as Figure 1 shown. Divide the obtained tissues into two parts. One part is immediately placed in 4% paraformaldehyde solution for fixation and standby, and the other part is immediately ground to extract RNA for virus nucleic acid load detection.

[0075] 2. Pathological staining steps:

[0076] ① Fixation: Place the lung tissue in 4% paraformaldehyde solution at room temperature for fixation overnight to denature and coagulate the proteins of the tissue and cells;

[0077] ② Trimming: Trim the fixed tissue into an appropriate size, place it in an embedding cassette, and rinse it with running water for 30 minutes (to remove the fixative in the tissue);

[0078] ③ Wax infiltration and embedding: Place the tissue in melted paraffin. After the paraffin has completely infiltrated the tissue block, perform embedding. The embedding instrument used (brand: Thermo, model: HISTO STAR) cools and solidifies into a block;

[0079] ④ Sectioning, spreading, and baking: Fix the embedded wax block on a microtome (brand: Thermo, model: HM 340E), cut into thin sections, generally 5 - 8 microns thick. Attach the cut thin sections to glass slides and dry them in an incubator at 65°C for more than 2 hours;

[0080] ⑤ HE staining: Use an automatic staining machine (brand: Thermo, model: GEMINI AS) to perform HE staining on the sections. First, remove the paraffin in the sections with xylene, then through alcohol from high concentration to low concentration, and then into distilled water. Stain the sections with hematoxylin (brand: Beijing Dinuoao Biotech Co., Ltd., product number: R20580), then rinse with running water, differentiate with 1% hydrochloric acid - ethanol, and stain with eosin (brand: Zhongshan Jinqiao Biotech Co., Ltd., product number: ZLI - 9613);

[0081] ⑥ Dehydration and clearing: Dehydrate the stained sections with absolute alcohol, and then clear the sections with xylene;

[0082] ⑦ Drop neutral balsam on the cleared sections, cover with a coverslip for sealing. After the balsam is slightly dry, label the sections for future use;

[0083] ⑧ Section scanning: Scan the sections with a digital pathology slide scanner (brand: NANOZooner, model: 2.0HJ), and analyze the results using NDP.view2 U12388 - 01 digital pathology slide viewing software. The results are as Figure 2 shown. 3. Nucleic acid detection steps:

[0084] ① Tissue disruption: Cut the bronchial and lung tissues to be detected into small pieces, add a certain amount of Trizol (brand: ambion, product number: 1559625), use a tissue disruptor (brand: SCIENTZ, model: SCIENTZ - 48) to lyse the tissue, centrifuge the disrupted tissue (12000 rpm, centrifuge at 4°C for 15 minutes), and take the supernatant for future use;

[0085] ② RNA extraction: Add chloroform to the supernatant, shake well and let stand for 5 minutes, centrifuge at 12,000 rpm at 4°C for 15 minutes, and aspirate the supernatant; add an equal volume of isopropanol to the supernatant and mix well, let stand at 4°C for 10 minutes, centrifuge at 12,000 rpm at 4°C for 10 minutes, discard the supernatant, wash the precipitate with 75% ethanol 1 - 2 times, dry the supernatant, and the precipitate is RNA; dissolve the RNA with pure water at 65°C and store at -80°C for later use;

[0086] ③ Reverse transcription: Take 500 ng of RNA and perform reverse transcription using a reverse transcription kit (brand: Takara, catalog number: RR036A), incubate at 37°C for 15 - 20 minutes, and incubate at 85°C for 15 seconds;

[0087] ④ Fluorescent quantitative real-time PCR: Perform fluorescent quantitative real-time PCR detection on the reverse-transcribed cDNA samples. The fluorescent quantitative PCR equipment (brand: Applied Biosystems, model: Step One Plus), and the primers and probes used are as follows:

[0088] CoV-F3: TCCTGGTGATTCTTCTTCAGGT;

[0089] CoV-R3: TCTGAGAGAGGGTCAAGTGC;

[0090] CoV-probe: AGCTGCAGCACCAGCTGTCCA;

[0091] The detection results of the SARS-CoV-2 nucleic acid RNA copy number are as Figure 3 shown.

[0092] 4. Experimental results

[0093] From Figure 1 the HE staining results, it can be seen that after SARS-CoV-2 virus infection, the mice developed a certain degree of interstitial pneumonia. From the results, it can be seen that the degree of inflammatory cell infiltration in the lung tissues of the infected mice in the drug administration group was reduced compared with that of the control group mice. At the same time, it can be seen that the alveolar septum of the control group mice was significantly thickened, and the degree of vascular damage was also significantly aggravated compared with that of the drug administration group mice. The experimental results prove that the administration of compound 1 glucosamine can significantly reduce the lung inflammation caused by SARS-CoV-2 infection and has a certain protective effect on SARS-CoV-2-infected mice.

[0094] From Figure 2The nucleic acid test results showed that the RNA copy numbers of SARS-CoV-2 virus in the bronchial and lung tissues of the mice in the administration group were significantly lower than those in the control group. There were 7 mice in the control group and 8 mice in the administration group. Three days after infection, the average RNA copy numbers of SARS-CoV-2 virus in the bronchial and lung tissues of the control group mice were 1.6×10 9 and 2.4×10 10 respectively, while the average RNA copy numbers of SARS-CoV-2 virus in the bronchial and lung tissues of the infected mice in the administration group were 1.2×10 8 and 1×10 9 respectively. There were significant differences between the two groups. The above results proved that compound 1 had good therapeutic effects on mice infected with SARS-CoV-2 virus and could be used as a treatment means against SARS-CoV-2 virus.

[0095] Example 2: Evaluation of the anti-SARS-CoV-2 virus activity of compound 2 at the animal level.

[0096] 1. Mouse infection experiment:

[0097] 6-8-week-old BALB / c mice with the same sex and weight were selected and evenly divided into two groups (control group and administration group). The mice in the administration group were gavaged with a solution containing compound 2 (the administration dose was 350 mg / kg body weight), and the mice in the control group were gavaged with the same volume of PBS. Three days after gavage, both groups of mice were infected with SARS-CoV-2 mouse-adapted strain virus by nasal drip, and the mice in the administration group continued to be administered during the virus infection period. Three days after virus infection, the mice were euthanized, and the bronchial and lung tissues of the mice were obtained by dissection. The experimental flow chart is as shown in Figure 4 . The obtained tissues were immediately ground, and RNA was extracted for virus nucleic acid load detection.

[0098] 2. Nucleic acid detection steps:

[0099] ① Tissue fragmentation: The bronchial and lung tissues to be detected were cut into pieces, a certain amount of Trizol (brand: ambion, product number: 1559625) was added, and a tissue disruptor (brand: SCIENTZ, model: SCIENTZ-48) was used to lyse the tissues. The disrupted tissues were centrifuged (12,000 rpm, centrifuged at 4°C for 15 minutes), and the supernatant was taken for use;

[0100] ② RNA extraction: Add chloroform to the supernatant, shake well and let stand for 5 minutes, centrifuge at 12,000 rpm at 4°C for 15 minutes, and aspirate the supernatant; add an equal volume of isopropanol to the supernatant, mix well, let stand at 4°C for 10 minutes, centrifuge at 12,000 rpm at 4°C for 10 minutes, discard the supernatant, wash the precipitate with 75% ethanol 1-2 times, aspirate the supernatant dry, and the precipitate is RNA; dissolve the RNA with pure water at 65°C and store at -80°C for later use;

[0101] ③ Reverse transcription: Take 500 ng of RNA and perform reverse transcription using a reverse transcription kit (brand: Takara, catalog number: RR036A), incubate at 37°C for 15-20 minutes, and incubate at 85°C for 15 seconds;

[0102] ④ Fluorescent quantitative real-time PCR: Perform fluorescent quantitative real-time PCR detection on the reverse-transcribed cDNA samples. The fluorescent quantitative PCR equipment (brand: Applied Biosystems, model: Step One Plus), the primers and probes used are as shown in Example 1, and the SARS-CoV-2 nucleic acid RNA copy number detection results are as Figure 5 shown.

[0103] 3. Experimental results:

[0104] From Figure 5 the nucleic acid detection results, it can be seen that the SARS-CoV-2 virus RNA copy numbers in the bronchus and lung tissues of the mice in the dosing group are significantly lower than those of the control group mice. The number of control group mice is 7, and the number of mice in the dosing group is 5. The average SARS-CoV-2 virus RNA copy numbers in the bronchus and lung tissues of the control group mice three days after infection are 1.6×10 9 and 2.4×10 10 , respectively, while the average SARS-CoV-2 virus RNA copy numbers in the bronchus and lung tissues of the infected mice in the dosing group are 1.94×10 8 and 1.07×10 9 , respectively. There are significant differences between the two groups. The above results prove that compound 2 has a good therapeutic effect on mice infected with the SARS-CoV-2 virus and can be used as a treatment method against the SARS-CoV-2 virus.

[0105] Example 3: Evaluation of the anti-SARS-CoV-2 virus activity of compound 3 at the animal level.

[0106] 1. Mouse infection experiment:

[0107] Six- to eight-week-old BALB / c mice of the same sex and weight were selected and evenly divided into two groups (control group and drug administration group). The mice in the drug administration group were gavaged with a solution containing Compound 3 (the drug administration dose was 350 mg / kg body weight), and the mice in the control group were gavaged with the same volume of PBS. Three days after gavage, both groups of mice were infected with the SARS-CoV-2 mouse-adapted strain virus by nasal drip, and the mice in the drug administration group continued to receive the drug during the virus infection period. Three days after virus infection, the mice were euthanized, and the bronchial and lung tissues of the mice were obtained by dissection. The experimental flow chart is as shown in Figure 6 shown. The obtained tissues were immediately ground, and RNA was extracted for virus nucleic acid load detection.

[0108] 2. Nucleic acid detection steps:

[0109] ① Tissue fragmentation: The bronchial and lung tissues to be detected were cut into small pieces, a certain amount of Trizol (brand: ambion, catalog number: 1559625) was added, and a tissue homogenizer (brand: SCIENTZ, model: SCIENTZ-48) was used to lyse the tissues. The fragmented tissues were centrifuged (12,000 rpm, 4 °C for 15 minutes), and the supernatant was taken for use.

[0110] ② RNA extraction: Chloroform was added to the supernatant, and after thorough shaking, it was allowed to stand for 5 minutes. Then it was centrifuged at 12,000 rpm, 4 °C for 15 minutes, and the supernatant was aspirated. An equal volume of isopropanol was added to the supernatant and mixed well, and it was allowed to stand at 4 °C for 10 minutes. Then it was centrifuged at 12,000 rpm, 4 °C for 10 minutes, and the supernatant was discarded. The precipitate was washed 1-2 times with 75% ethanol, and the supernatant was blotted dry. The precipitate was RNA. The RNA was dissolved in pure water at 65 °C and stored at -80 °C for use.

[0111] ③ Reverse transcription: 500 ng of RNA was taken and reverse transcribed using a reverse transcription kit (brand: Takara, catalog number: RR036A), incubated at 37 °C for 15-20 minutes, and incubated at 85 °C for 15 seconds.

[0112] ④ Fluorescent quantitative real-time PCR: The reverse-transcribed cDNA samples were subjected to fluorescent quantitative real-time PCR detection. The fluorescent quantitative PCR equipment (brand: Applied Biosystems, model: Step One Plus), and the primers and probes used were as shown in Example 1. The detection results of the SARS-COV-2 nucleic acid RNA copy number are as shown in Figure 7 shown.

[0113] 3. Experimental results:

[0114] From Figure 7The nucleic acid test results showed that the copy numbers of SARS-CoV-2 virus RNA in the bronchial and lung tissues of the mice in the drug administration group were significantly lower than those in the control group. There were 7 mice in the control group and 5 mice in the drug administration group. Three days after infection, the average copy numbers of SARS-CoV-2 virus RNA in the bronchial and lung tissues of the control group mice were 1.6×10 9 and 2.4×10 10 , while the average copy numbers of SARS-CoV-2 virus RNA in the bronchial and lung tissues of the infected mice in the drug administration group were 2.24×10 8 and 3.7×10 9 respectively. There were significant differences between the two groups. The above results proved that Compound 3 had good therapeutic effects on mice infected with SARS-CoV-2 virus and could be used as a treatment method against SARS-CoV-2 virus.

[0115] Example 4: Evaluation of the anti-SARS-CoV-2 virus activity of Compound 4 at the animal level.

[0116] 1. Mouse infection experiment:

[0117] 6-8-week-old BALB / c mice with the same sex and body weight were selected and evenly divided into two groups (control group and drug administration group). The mice in the drug administration group were gavaged with a solution containing Compound 4 (the administration dose was 500 mg / kg body weight), and the mice in the control group were gavaged with the same volume of PBS. Three days after gavage, both groups of mice were infected with SARS-CoV-2 mouse-adapted strain virus by nasal drip, and the mice in the drug administration group continued to be administered during the virus infection period. Three days after virus infection, the mice were euthanized, and the bronchial and lung tissues of the mice were dissected. The experimental flow chart was as shown in Figure 8 . The obtained tissues were immediately ground, and RNA was extracted for virus nucleic acid load detection.

[0118] 2. Nucleic acid detection steps:

[0119] ① Tissue fragmentation: The bronchial and lung tissues to be detected were cut into pieces, a certain amount of Trizol (brand: ambion, product number: 1559625) was added, and a tissue disruptor (brand: SCIENTZ, model: SCIENTZ-48) was used to lyse the tissues. The disrupted tissues were centrifuged (12,000 rpm, centrifuged at 4°C for 15 minutes), and the supernatant was taken for later use;

[0120] ② RNA extraction: Add chloroform to the supernatant, shake well and let stand for 5 minutes, centrifuge at 12,000 rpm at 4°C for 15 minutes, and aspirate the supernatant; add an equal volume of isopropanol to the supernatant and mix well, let stand at 4°C for 10 minutes, centrifuge at 12,000 rpm at 4°C for 10 minutes, discard the supernatant, wash the precipitate with 75% ethanol 1-2 times, blot dry the supernatant, and the precipitate is RNA; dissolve the RNA with pure water at 65°C and store at -80°C for later use;

[0121] ③ Reverse transcription: Take 500 ng of RNA and perform reverse transcription using a reverse transcription kit (brand: Takara, catalog number: RR036A), incubate at 37°C for 15-20 minutes, and incubate at 85°C for 15 seconds;

[0122] ④ Fluorescent quantitative real-time PCR: Perform fluorescent quantitative real-time PCR detection on the reverse-transcribed cDNA samples. The fluorescent quantitative PCR equipment (brand: Applied Biosystems, model: Step One Plus), the primers and probes used are as shown in Example 1, and the detection results of the SARS-CoV-2 nucleic acid RNA copy number are as Figure 9 shown.

[0123] 3. Experimental results:

[0124] From Figure 9 the nucleic acid detection results, it can be seen that the SARS-CoV-2 virus RNA copy numbers in the bronchus and lung tissues of the mice in the dosing group are significantly lower than those of the control group mice. The number of mice in both the control group and the dosing group is 4. The average SARS-CoV-2 virus RNA copy numbers in the bronchus and lung tissues of the control group mice three days after infection are 8.4×10 8 and 8.6×10 9 , respectively, while the average SARS-CoV-2 virus RNA copy numbers in the bronchus and lung tissues of the infected mice in the dosing group are 1.7×10 8 and 3.13×10 9 , respectively. The above results prove that compound 4 has a good therapeutic effect on mice infected with the SARS-CoV-2 virus and can be used as a therapeutic means against the SARS-CoV-2 virus.

[0125] Example 5: Evaluation of the anti-SARS-CoV-2 virus activity of compound 5 at the animal level.

[0126] 1. Mouse infection experiment:

[0127] Six- to eight-week-old BALB / c mice of the same sex and weight were selected and evenly divided into two groups (control group and drug administration group). The mice in the drug administration group were gavaged with a solution containing Compound 5 (the drug administration dose was 500 mg / kg body weight), and the mice in the control group were gavaged with the same volume of PBS. Three days after gavage, the two groups of mice were infected with the SARS-CoV-2 mouse-adapted strain virus by nasal drip, and the mice in the drug administration group continued to be administered during the virus infection period. Three days after virus infection, the mice were euthanized, and the bronchial and lung tissues of the mice were obtained by dissection. The experimental flow chart is as shown in Figure 10 as follows. The obtained tissues were immediately ground, and RNA was extracted for virus nucleic acid load detection.

[0128] 2. Nucleic acid detection steps:

[0129] ① Tissue fragmentation: The bronchial and lung tissues to be detected were cut into small pieces, a certain amount of Trizol (brand: ambion, product number: 1559625) was added, and a tissue disruptor (brand: SCIENTZ, model: SCIENTZ-48) was used to lyse the tissues. The disrupted tissues were centrifuged (12,000 rpm, 4 °C for 15 minutes), and the supernatant was taken for later use;

[0130] ② RNA extraction: Chloroform was added to the supernatant, shaken well and left to stand for 5 minutes, centrifuged at 12,000 rpm, 4 °C for 15 minutes, and the supernatant was aspirated; An equal volume of isopropanol was added to the supernatant and mixed well, left to stand at 4 °C for 10 minutes, centrifuged at 12,000 rpm, 4 °C for 10 minutes, the supernatant was discarded, the precipitate was washed 1-2 times with 75% ethanol, the supernatant was blotted dry, and the precipitate was RNA; The RNA was dissolved in pure water at 65 °C and stored at -80 °C for later use;

[0131] ③ Reverse transcription: 500 ng of RNA was taken and reverse transcribed using a reverse transcription kit (brand: Takara, product number: RR036A), incubated at 37 °C for 15-20 minutes, and incubated at 85 °C for 15 seconds;

[0132] ④ Fluorescent quantitative real-time PCR: The reverse-transcribed cDNA samples were subjected to fluorescent quantitative real-time PCR detection. The fluorescent quantitative PCR equipment (brand: Applied Biosystems, model: Step One Plus), and the primers and probes used were as shown in Example 1. The detection results of the SARS-COV-2 nucleic acid RNA copy number are as shown in Figure 11 as follows.

[0133] 3. Experimental results:

[0134] From Figure 11The nucleic acid test results showed that the copy numbers of SARS-CoV-2 virus RNA in the bronchial and lung tissues of the mice in the administration group were significantly lower than those in the control group. The number of mice in both the control group and the administration group was 4. Three days after infection, the average copy numbers of SARS-CoV-2 virus RNA in the bronchial and lung tissues of the control group mice were 8.4×10 8 and 8.6×10 9 , while the average copy numbers of SARS-CoV-2 virus RNA in the bronchial and lung tissues of the infected mice in the administration group were 3.4×10 8 and 4.44×10 9 . The above results proved that Compound 5 had good therapeutic effects on mice infected with SARS-CoV-2 virus and could be used as a treatment means against SARS-CoV-2 virus.

[0135] Example 6: Evaluation of the anti-SARS-CoV-2 virus activity of Compound 6 at the animal level.

[0136] 1. Mouse infection experiment:

[0137] BALB / c mice aged 6 - 8 weeks with the same sex and body weight were selected and evenly divided into two groups (control group and administration group). The mice in the administration group were gavaged with a solution containing Compound 6 (the administration dose was 500 mg / kg body weight), and the mice in the control group were gavaged with the same volume of PBS. Three days after gavage, both groups of mice were infected with SARS-CoV-2 mouse-adapted strain virus by nasal drip, and the mice in the administration group continued to be administered during the virus infection period. Three days after virus infection, the mice were euthanized, and the bronchial and lung tissues of the mice were dissected. The experimental flow chart was as shown in Figure 12 . The obtained tissues were immediately ground, and RNA was extracted for virus nucleic acid load detection.

[0138] 2. Nucleic acid detection steps:

[0139] ① Tissue fragmentation: The bronchial and lung tissues to be detected were cut into pieces, a certain amount of Trizol (brand: ambion, product number: 1559625) was added, and a tissue disruptor (brand: SCIENTZ, model: SCIENTZ-48) was used to lyse the tissues. The disrupted tissues were centrifuged (12,000 rpm, centrifuged at 4°C for 15 minutes), and the supernatant was taken for use;

[0140] ② RNA extraction: Add chloroform to the supernatant, shake well and let stand for 5 minutes, centrifuge at 12,000 rpm at 4 °C for 15 minutes, and aspirate the supernatant; add an equal volume of isopropanol to the supernatant, mix well, let stand at 4 °C for 10 minutes, centrifuge at 12,000 rpm at 4 °C for 10 minutes, discard the supernatant, wash the precipitate with 75% ethanol 1-2 times, blot dry the supernatant, and the precipitate is RNA; dissolve the RNA with pure water at 65 °C and store at -80 °C for later use;

[0141] ③ Reverse transcription: Take 500 ng of RNA and perform reverse transcription using a reverse transcription kit (brand: Takara, catalog number: RR036A), incubate at 37 °C for 15 - 20 minutes, and incubate at 85 °C for 15 seconds;

[0142] ④ Fluorescent quantitative real-time PCR: Perform fluorescent quantitative real-time PCR detection on the reverse-transcribed cDNA samples. The fluorescent quantitative PCR equipment (brand: Applied Biosystems, model: Step One Plus), the primers and probes used are as shown in Example 1, and the SARS-CoV-2 nucleic acid RNA copy number detection results are as Figure 13 shown.

[0143] 3. Experimental results:

[0144] From Figure 13 the nucleic acid detection results, it can be seen that the SARS-CoV-2 virus RNA copy numbers in the bronchus and lung tissues of the mice in the administration group are significantly lower than those of the control group mice. The number of mice in both the control group and the administration group is 4. Three days after infection, the average SARS-CoV-2 virus RNA copy numbers in the bronchus and lung tissues of the control group mice are 8.4×10 8 and 8.6×10 9 , respectively, while the average SARS-CoV-2 virus RNA copy numbers in the bronchus and lung tissues of the infected mice in the administration group are 4.01×10 8 and 5.24×10 9 , respectively. The above results prove that compound 6 has a good therapeutic effect on mice infected with the SARS-CoV-2 virus and can be used as a treatment method against the SARS-CoV-2 virus. Sequence Listing <110> Nanhu Laboratory Academy of Military Medical Sciences, Academy of Military Sciences of the Chinese People's Liberation Army <120> Use of Glucosamine and Its Derivatives as Anti-Novel Coronavirus Drugs <160> 3 <170> SIPOSequenceListing 1.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <400> 1 tcctggtgat tcttcttcag gt 22 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <400> 2 tctgagagag ggtcaagtgc 20 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <400> 3 agctgcagca ccagctgtcc a 21

Claims

1. Use of pharmaceutically acceptable salts of glucosamine compounds represented by Compounds 1, 3, 4, 5, and 6 in the preparation of a drug against SARS-CoV-2 virus: 。 2. The use according to claim 1, wherein the pharmaceutically acceptable salt is a conventional non-toxic salt formed by the reaction of Compounds 1, 3, 4, 5, and 6 with an inorganic acid or an organic acid.

3. The use according to claim 2, wherein the non-toxic salt is prepared by the reaction of Compounds 1, 3, 4, 5, and 6 with an inorganic acid or an organic acid. The inorganic acids include hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, sulfamic acid, and phosphoric acid, and the organic acids include citric acid, tartaric acid, lactic acid, pyruvic acid, acetic acid, benzenesulfonic acid, p-toluenesulfonic acid, methanesulfonic acid, naphthalenesulfonic acid, ethanesulfonic acid, naphthalenedisulfonic acid, maleic acid, malic acid, malonic acid, fumaric acid, succinic acid, propionic acid, oxalic acid, trifluoroacetic acid, stearic acid, pamoic acid, hydroxymaleic acid, phenylacetic acid, benzoic acid, salicylic acid, glutamic acid, ascorbic acid, sulfanilic acid, 2-acetoxybenzoic acid, and isethionic acid; or sodium, potassium, calcium, aluminum, or ammonium salts formed by the reaction of Compounds 1, 3, 4, 5, and 6 with propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, aspartic acid, or glutamic acid to form esters and then with inorganic bases; or methylamine salts, ethylamine salts, or ethanolamine salts formed by the reaction of Compounds 1, 3, 4, 5, and 6 with organic bases; or corresponding inorganic acid salts formed by the reaction of Compounds 1, 3, 4, 5, and 6 with lysine, arginine, or ornithine to form esters and then with hydrochloric acid, hydrobromic acid, hydrofluoric acid, sulfuric acid, nitric acid, or phosphoric acid, or corresponding organic acid salts formed by the reaction with formic acid, acetic acid, picric acid, methanesulfonic acid, and ethanesulfonic acid.

4. Use of an anti-SARS-CoV-2 virus pharmaceutical composition in the preparation of a drug against SARS-CoV-2 virus. The pharmaceutical composition contains, as an active ingredient, the compound 1, 3, 4, 5, 6 and its pharmaceutically acceptable salts according to any one of claims 1-3, and a pharmaceutically acceptable carrier or excipient. The pharmaceutical composition is a liquid preparation and is administered through the pulmonary route. The unit dose of the formulation contains 0.1-100 mg of the compound 1, 3, 4, 5, 6.

Images