Methods for extending protein half-life

Abstract

The present invention relates to a method for extending the half-life of a protein or (poly)peptide by replacing one or more amino acid residues of the protein. Further, the present invention relates to a protein with an extended half-life prepared by the above method.

Description

[0001] This application is a divisional application with application date of October 30, 2016, application number 201680071485.0, and invention name “Method for extending protein half-life”. Technical Field

[0002] The present invention relates to a method for extending the half-life of a protein or (poly)peptide by replacing one or more lysine residues associated with ubiquitination of the protein, and to a protein with an extended half-life. Background Art

[0003] Proteins or (poly)peptides in eukaryotic cells are degraded through two different pathways: the lysosomal system and the ubiquitin-proteasome system. The lysosomal system, which degrades 10-20% of cellular proteins, has no substrate specificity and no precise timing controllability. In other words, the lysosomal system is a process that especially degrades most extracellular proteins or membrane proteins, such as surface proteins that are taken up by cells through endocytosis and then degraded by lysosomes. As for the selective degradation of proteins in eukaryotic cells, the ubiquitin-proteasome pathway (UPP) should be involved, in which the target protein first binds to ubiquitin-binding enzymes to form polyubiquitin chains, and then is recognized and degraded by proteasomes. About 80-90% of eukaryotic cell proteins are degraded by UPP, so UPP is considered to regulate the degradation of most proteins in eukaryotic cells and is responsible for protein turnover and homeostasis in the body. Ubiquitin is a small protein composed of 76 highly conserved amino acids, and it exists in all eukaryotic cells. Among all the amino acid residues of ubiquitin, residues 6, 11, 27, 29, 33, 48 and 63 are lysine (Lys, K), and residues 48 and 63 are known to play a key role in the formation of polyubiquitin chains. Three enzymes, usually called E1, E2, and E3, act sequentially to promote ubiquitination, and ubiquitin-tagged proteins are degraded by the 26S proteasome in the ATP-dependent protein degradation complex.

[0004] As mentioned above, the ubiquitin proteasome pathway (UPP) consists of two separate and continuous processes. One process is a protein tagging process in which a certain number of ubiquitin molecules are attached to substrate proteins, and the other is a process in which the tagged proteins are degraded by the 26S proteasome complex. The binding between ubiquitin and substrate proteins is carried out by forming an isopeptide bond between the glycine residue at the C-terminus of ubiquitin and the lysine residue of the substrate, and then a series of enzymes (ubiquitin activating enzyme E1, ubiquitin conjugating enzyme E2, ubiquitin ligase E3) form a sulfhydryl bond between ubiquitin and substrate proteins. It is known that E1 (ubiquitin activating enzyme) activates ubiquitin through an ATP-dependent reaction mechanism. The activated ubiquitin is transferred to the cysteine ​​residue in the ubiquitin binding domain of E2 (ubiquitin conjugating enzyme), and then E2 transports the activated ubiquitin to the E3 ligase or directly to the substrate protein. E3 also catalyzes the formation of an isopeptide bond between the lysine residue of the substrate protein and the glycine residue of ubiquitin. Another ubiquitin can be attached to the C-terminal lysine residue of the ubiquitin attached to the substrate protein, and the repeated attachment of the additional ubiquitin moiety is linked to each other through a certain number of ubiquitin molecules to produce a polyubiquitin chain. After the polyubiquitin chain is generated, the substrate protein is selectively recognized and degraded by the 26S proteasome.

[0005] At the same time, there are many proteins with therapeutic effects in the body. These proteins or (poly)peptides or biologically active polypeptides with therapeutic effects in the body include, but are not limited to, for example, growth hormone releasing hormone (GHRH), growth hormone releasing peptide, interferon (interferon-α or interferon-β), interferon receptor, colony stimulating factor (CSF), glucagon-like peptide, interleukin, interleukin receptor, enzyme, interleukin binding protein, cytokine binding protein, G protein coupled receptor, human growth hormone (hGH), macrophage activating factor, macrophage peptide, B cell factor, T cell factor, protein A, allergy inhibitor, cell necrosis glycoprotein, G protein coupled receptor, immunotoxin, lymphotoxin, tumor necrosis factor, tumor suppressor factor, transfer growth factor, alpha-1 antitrypsin, albumin, alpha-lactalbumin, apolipoprotein E, erythropoietin, highly glycosylated erythropoietin, angiogenin, hemoglobin, thrombin, thrombin receptor activating peptide, thrombomodulin, factor VII, factor VII a, factor VIII, factor IX factors, plasminogen activator factor, urokinase, streptokinase, hirudin, protein C, C-reactive protein, renin inhibitor, collagenase inhibitor, superoxide dismutase, leptin, platelet-derived growth factor, epidermal growth factor, epidermal growth factor, angiostatin, angiotensin, bone growth factor, bone stimulating protein, calcitonin, insulin, atrial natriuretic peptide, chondroitin, fibrin-binding peptide, elcatonin, connective tissue activating factor, tissue factor channel inhibitor, follicle-stimulating hormone, luteinizing hormone, luteinizing hormone-releasing hormone, nerve growth factor, parathyroid hormone, relaxin, secretin, somatomedin, insulin-like growth factor, adrenocortical hormone, glucagon, intestinal cholecystokinin, pancreatic polypeptide, gastrin-releasing peptide, corticotropin-releasing factor, thyroid stimulating hormone, autotoxin, lactoferrin, myostatin, receptors, receptor antagonists, cell surface antigens, virus-derived vaccine antigens, monoclonal antibodies, polyclonal antibodies and antibody fragments.

[0006] Growth hormone (GH), a polypeptide hormone, is synthesized and secreted in the anterior lobe of the pituitary gland, and it is not only related to the growth of bones and cartilage, but also to the metabolism of the decomposition of fat and the stimulation of protein synthesis. Therefore, growth hormone can be used to treat dwarfism caused by various physical conditions (including, for example, congenital heart disease, chronic lung disease, chronic kidney disease or chronic wasting disease; abnormal hormone secretion caused by growth hormone deficiency, hypothyroidism or diabetes; and congenital genetic diseases such as Turner syndrome). Further, it is known that growth hormone regulates the transcription of STAT protein (signal transducer and transcription activator) (Oncogene, 19, 2585-2597, 2000).

[0007] Protein therapeutics related to homeostasis have various side effects, such as increasing the risk of cancer induction. For example, it is known that the incretin degrading enzyme (DPP-4) (dipeptidyl peptidase-4) inhibitor family therapeutic agents will increase the possibility of thyroid cancer induction, and it is known that insulin glargine will increase the risk of breast cancer. Further, the continuous or excessive administration of growth hormone to patients suffering from diseases with disordered secretion of growth hormone will be involved in diabetes, microvascular disease and premature death of patients. In this regard, there are extensive studies to reduce the disadvantages and side effects of therapeutic proteins. Extending the half-life of proteins is considered to be a method for reducing the disadvantages and side effects of therapeutic proteins. For this reason, a large number of methods have been disclosed. In this regard, the inventors have studied and developed a new method for extending the half-life of proteins in vivo and / or in vitro, and completed the present invention by replacing one or more lysine residues associated with ubiquitination in therapeutic proteins or (poly) peptides to prevent the degradation of proteins or (poly) peptides by the ubiquitin-proteasome system.

[0008] The teachings of all patents, publications, and references cited herein are incorporated by reference in their entirety into this application. Summary of the invention

[0009] Technical issues

[0010] The object of the present invention is to increase the half-life of proteins or (poly)peptides.

[0011] Furthermore, another object of the present invention is to provide a therapeutic protein with a prolonged half-life.

[0012] Furthermore, another object of the present invention is to provide a pharmaceutical composition comprising a protein with a prolonged half-life as a pharmaceutically active ingredient.

[0013] Solutions to the problem

[0014] To achieve the object, the present invention provides a method for extending the half-life of a protein in vivo and / or in vitro by replacing one or more lysine residues of the amino acids of the protein.

[0015] In the present invention, lysine residues can be replaced by conservative amino acids. The term "conservative amino acid replacement" refers to the replacement of an amino acid with another amino acid that is different from the amino acid but has similar chemical properties, such as charge and hydrophobicity. Generally speaking, the functional characteristics of a protein will not be essentially changed by amino acid replacement with corresponding conservative amino acids. For example, amino acids can be classified according to the similar chemical properties of the side chains, as follows: ① aliphatic side chains: glycine, alanine, valine, leucine, and isoleucine; ② aliphatic-hydroxy side chains: serine, threonine; ③ amide side chains: asparagine and glutamine; ④ aromatic side chains: phenylalanine, tyrosine, tryptophan; ⑤ basic side chains: lysine, arginine and histidine; ⑥ acidic side chains: aspartic acid and glutamic acid; and ⑦ sulfur-containing side chains: cysteine ​​and methionine.

[0016] In the present invention, lysine residues can be replaced by arginine and histidine having a basic side chain. Preferably, lysine residues are replaced by arginine.

[0017] Beneficial effects of the present invention

[0018] According to the present invention, variant proteins in which one or more lysine residues are replaced by arginine have a significantly prolonged half-life and are therefore able to be maintained for a long period of time. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 is the structure of the growth hormone expression vector;

[0020] Figure 2 This is the result of PCR cloning product of growth hormone gene;

[0021] Figure 3 for the expression of growth hormone plasmid gene in HEK-293T cells;

[0022] Figure 4 To explain the proteolytic pathway of growth hormone through ubiquitination experiments;

[0023] Figure 5 is the ubiquitination level of substituted growth hormones with arginine replacing lysine residues compared to wild type;

[0024] Figure 6 The half-life of growth hormone was altered after treatment with the protein synthesis inhibitor cyclododecatriene (CHX).

[0025] Figure 7 This is the result of JAK-STAT signal transduction-like effects.

[0026] Hereinafter, the present invention will be described in more detail with reference to the embodiments. It should be understood that these embodiments cannot be considered as limiting the present invention in any way. DETAILED DESCRIPTION

[0027] In another embodiment of the present invention, the protein is growth hormone. In the amino acid sequence of growth hormone (SEQ No.10), at least one lysine corresponding to positions 64, 67, 96, 141, 166, 171, 184, 194 and 198 at the N-terminus is replaced with arginine. Therefore, a growth hormone with an increased half-life in vivo and / or in vitro is provided. Further, a pharmaceutical composition comprising a replaced growth hormone for the prevention and / or treatment of dwarfism, Kabuki syndrome, and Kearns-Sell syndrome is provided (J Endocrinol Invest., 39 (6), 667-677, 2016; J Pediatr Endocrinol Metab., 2016, [Epub ahead of print]; Horm Res Paediatr. 2016, [Epub ahead of print]).

[0028] In another embodiment of the present invention, the protein is G-CSF. In the amino acid sequence of G-CSF (SEQ No. 31), at least one lysine corresponding to positions 11, 46, 53, 64 and 73 at the N-terminus is replaced with arginine. Therefore, a G-CSF with a prolonged in vivo and / or in vitro half-life is provided. Further, a pharmaceutical composition comprising a substituted G-CSF for preventing and / or treating neutropenia is provided (EMBO Mol Med. 2016, [Epub ahead of print]).

[0029] In the present invention, the lysine residue in the protein amino acid sequence is replaced with arginine (R) by a site-directed mutagenesis method. According to this method, primers are designed using a DNA sequence to induce site-directed mutagenesis, and then PCR is performed under specific conditions to generate a mutant plasmid DNA.

[0030] In the present invention, the ubiquitination degree is measured by transfecting the target protein into the cell line and using immunoprecipitation reaction. If the ubiquitination level is increased in the transfected cell line after treatment with MG132, it means that the target protein is degraded through the ubiquitin-proteasome pathway.

[0031] The pharmaceutical composition of the present invention can be administered into the body in a variety of ways, including oral, transdermal, subcutaneous, intravenous or intramuscular administration, and a more preferred embodiment is prepared in the form of injection. Further, the pharmaceutical composition of the present invention can also be made by methods well known to those skilled in the art to provide rapid, maintained or delayed release of the active substance after administration. The form of the preparation can be tablets, pills, powders, sachets, elixirs, suspensions, emulsions, solutions, syrups, aerosols, soft and hard capsules, sterile injections, sterile compressed powders, etc. Examples of suitable carriers, excipients and diluents are lactose, glucose, sucrose, mannitol, xylitol, erythritol, maltitol, starch, gum arabic, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylparaben, propylparaben, talc, magnesium stearate and mineral oil. Furthermore, the medicament may additionally include fillers, anti-adherent agents, lubricants, wetting agents, fragrances, emulsifiers, preservatives, and the like.

[0032] Examples of suitable carriers, excipients, and diluents are lactose, glucose, sucrose, mannitol, xylitol, erythritol, maltitol, starch, gum arabic, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylparaben, propylparaben, talc, magnesium stearate, and mineral oil. Further, medicaments may additionally include fillers, antiadherents, lubricants, wetting agents, fragrances, emulsifiers, preservatives, and the like.

[0033] As used herein, the singular forms "a", "an", "the" are intended to include the plural forms as well, unless otherwise clearly indicated herein. In addition, the terms "including", "includes", "having", "has", "with", "for example" or their variants used in the specification and / or claims do not have a limiting effect and are intended to be inclusive in a manner similar to the term "comprising". In the present invention, a "biologically active polypeptide or protein" is a (poly)peptide or protein that exhibits a useful biological activity when administered to a mammal, including a human.

[0034] Invention

[0035] The following examples provide illustrative embodiments. Based on the content disclosed in the present invention and the general level of those skilled in the art, those skilled in the art will appreciate that the following examples are intended only as examples, and that many changes, modifications and variations can be made without departing from the scope of the subject matter claimed in the present invention.

[0036] Example 1 Analysis of growth hormone ubiquitination and half-life extension, and analysis of signal transduction in cells

[0037] 1. GH expression vector cloning and protein expression

[0038] (1) GH expression vector cloning

[0039] The GH DNA amplified by PCR was treated with EcoRI and then ligated to the pCS4-flag (4.3 kb, Oncotarget., 7 (12), 14441-14457, 2016) vector previously digested with the same enzyme ( Figure 1 , growth hormone amino acid sequence: SEQ No. 10). Therefore, after restriction endonuclease digestion of the cloning vector, the presence of the DNA insert was confirmed by agarose gel electrophoresis ( Figure 2 ). The PCR conditions are as follows: Step 1: 94°C for 3 minutes (1 cycle); Step 2: 94°C for 30 seconds; 60°C for 30 seconds; 72°C for 30 seconds (25 cycles); Step 3: 72°C for 10 minutes (1 cycle), and then stored at 4°C. Figure 1 The nucleotide sequence underlined in black indicates the primer set used for PCR and determination of cloning sites ( Figure 2 To analyze protein expression, anti-myc antibody (9E10, sc-40) was used with Figure 1 Western blotting was performed to detect the binding of myc on the pcDNA3-myc vector of the PCR product. The results of the Western blotting showed that β-opsonin was well expressed. Actin was used as a standard to ensure that the amount of protein loaded was appropriate ( Figure 3 ).

[0040] (2) Substitution of Lysine (K) residues

[0041] The lysine residues were replaced with arginine (R) using site-directed mutagenesis. The following primer set was used for PCR to generate the substituted plasmid DNA.

[0042] (GH K67R) FP 5'-CCAAAGGAACAGAGGTATTCATTC-3' (SEQ No. 11), RP 5'-CAGGAATGAATACCTCTGTTCCTT-3' (SEQ No. 12);

[0043] (GH K141R) FP 5'-GACTCCCTAAGGGACCTAGAG-3' (SEQ No. 13), RP 5'-CTCTAGGTCCTTAGGAGGTC-3' (SEQ No. 14); and

[0044] (GH K166R)FP 5'-CAGATCTCAGGCAGACCTAC-3'(SEQ No.15),RP 5'-GTAGGTCTGCCTGAAGATCTG-3'(SEQ No.16)

[0045] By using pcDNA3-myc-β-growth hormone as a template, three plasmid DNAs in which one or more lysines were replaced with arginines (K→R) were generated (Table 1).

[0046] Table 1

[0047] Lysine (K) residues Growth hormone constructed by replacing lysine with arginine 67 pCS4-flag-GH(K67R) 141 pCS4-flag-GH(K141R) 166 pCS4-flag-GH(K166R)

[0048] 2. In vivo Ubiquitination Analysis

[0049] HEK293T cells were transfected with plasmids encoding pCS4-flag-GH WT and pMT123-HA-ubiquitin. For analysis of ubiquitination levels, 2 μg of pCS4-flag-GH WT and 1 μg of pMT123-HA-ubiquitin were co-transfected into cells. 24 hours after transfection, cells were treated with MG132 (proteasome inhibitor, 5 μg / ml) for 6 hours, after which immunoprecipitation analysis was performed ( Figure 4 ). Thus, HEK293T cells were transfected with plasmids encoding pCS4-flag-GH WT, pCS4-flag-GH variant (K67R), pCS4-flag-GH variant (K141R), pCS4-flag-GH variant (K166R) and pMT123-HA-ubiquitin, respectively. For the analysis of ubiquitination levels, 1 μg of pMT123-HA-ubiquitin was co-transfected with 2 μg of pCS4-flag-growth hormone WT, pCS4-flag-growth hormone variant (K67R), pCS4-flag-growthhormone variant (K141R) and pCS4-flag-growth hormone variant (K166R) into the cells, respectively. Next, 24 hours after transfection, immunoprecipitation reactions were performed ( Figure 5). The protein sample obtained by immunoprecipitation reaction was dissolved in a buffer containing (1% Triton X, 150mM NaCl, 50mM Tris-HCl, pH 8 and 1mM PMSF (phenylmethylsulfonyl)), and then mixed with anti-flag (Sigma-aldrich, F3165) primary antibody (Santa Cruz Biotechnology, sc-40), and then the mixture was incubated at 4°C overnight. The immunoprecipitate can be separated by reacting with A / G beads at 4°C for 2 hours. Then, the separated immunoprecipitate was washed twice with buffer.

[0050] After mixing with 2X SDS buffer and heating to 100°C for 7 minutes, the protein samples were separated by SDS gel electrophoresis. The separated proteins were transferred to a polyvinylidene fluoride (PVDF) membrane and then developed by the ECL system using an anti-mouse secondary antibody (peroxidase-labeled mouse IgG (H+L), KPL, 074-1806) diluted 1:1000 and a blocking solution containing anti-flag (Sigma-aldrich, F3165), anti-HA (sc-7392) and anti-β-actin antibodies (sc-47778). Therefore, when the anti-flag (Sigma-aldrich, F3165) antibody was used for immunoprecipitation experiments, polyubiquitin chains were formed by the binding of ubiquitin to pCS4-flag-growth hormone WT. Therefore, the bands that strongly indicated that ubiquitin was produced ( Figure 4 , lanes 2 and 3). Furthermore, when cells were treated with MG132 for six hours, the formation of polyubiquitin chains increased, and thus a more intense band representing ubiquitin was displayed ( Figure 4 , lane 3). Further, as for pCS4-flag-growth hormone variant (K67R), pCS4-flag-growth hormone variant (K141R) and pCS4-flag-growth hormone variant (K166R), the bands were not as intense as those of the wild type. These results indicate that a smaller amount of ubiquitin was detected because the variant plasmids could not bind to ubiquitin ( Figure 5 , lanes 3-5). These results indicate that β-opsonin first binds to ubiquitin and then forms polyubiquitin chains, which are then degraded by the ubiquitin-proteasome system through the formed polyubiquitin chains.

[0051] 3. Estimation of the half-life of growth hormone using the protease synthesis inhibitor cyclododecatriene (CHX)

[0052] HEK293T cells were transfected with 2 μg of pCS4-flag-GH WT, pCS4-flag-GH variant (K67R), pCS4-flag-GH variant (K141R) and pCS4-flag-GH variant (K166R). 48 hours after transfection, cells were treated with protease synthesis inhibitor cyclododecatriene (CHX) (Sigma-Aldrich, 100 μg / ml), and the half-life of each protein was measured 1 hour, 2 hours, 4 hours and 8 hours after the inhibitor treatment. As a result, the degradation of human growth hormone ( Figure 6 ). The half-life of human growth hormone is less than 2 hours, while the half-life of the pCS4-flag-growth hormone variant (K141R) is extended to 8 hours or more, such as Figure 6 shown.

[0053] 4. Signal transduction of growth hormone and substituted growth hormone in cells

[0054] Studies have reported that growth hormone controls the transcription of STAT (signal transducer and activator of transcription) proteins (Oncogene, 19, 2585-2597, 2000). In this experiment, we examined the signal transduction of growth hormone and substituted growth hormone in cells. First, HEK293T cells were transfected with 3 μg of pCS4-flag-growth hormone WT, pCS4-flag-growth hormone variant (K67R), pCS4-flag-growth hormone variant (K141R) and pCS4-flag-growth hormone variant (K166R), respectively. One day after transfection, the proteins were obtained by sonication lysis of the cells. PANC-1 cells (ATCC, CRL-1469) were washed seven times with PBS and then transfected with 3 μg of the above-obtained proteins. Western blotting was used to analyze the signal transduction in the cells. To this end, proteins isolated from PANC-1 cells transfected with pCS4-flag-growth hormone WT, pCS4-flag-growth hormone variant (K67R), pCS4-flag-growth hormone variant (K141R) and pCS4-flag-growth hormone variant (K166R) were transferred to polyvinylidene fluoride (PVDF) membranes. Next, proteins were visualized by ECL system using secondary antibodies diluted 1:1000 with anti-rabbit (horseradish peroxidase-labeled goat anti-rabbit IgG (H+L), SantaCruz Biotechnology, sc-2004) and anti-mouse (peroxidase-labeled mouse IgG (H+L), KPL, 074-1806) and blocking buffer containing anti-STAT3 (sc-21876), anti-phospho-STAT3 (Y705, Cell Signaling 9131S) and anti-β-actin antibodies (sc-47778). Thus, compared to pCS4-flag-growth hormone WT, the pCS4-flag-GH variant (K141R) showed the same or increased levels of phosphorylated-STAT3 signaling in PANC-1 cells, and compared to the control, the pCS4-flag-growth hormone variant (K67R) showed increased phosphorylated-STAT3 signaling ( Figure 7 ).

[0055] Practicality

[0056] Since the variant proteins of the present invention have an extended half-life, the present invention can be used to develop protein or (poly)peptide therapeutic agents. Sequence Listing <110> UBI Protein <120> Methods for extending protein half-life <130> UBPRN16P01WO <150> KR 10-2015-0160728 <151> 2015-11-16 <160> 110 <170> KoPatentIn 3.0 <210> 1 <211> 198 <212> PRT <213> Artificial sequence <220> <223> Human β-opsonin <400> 1 Met Pro Val Pro Ala Leu Cys Leu Leu Trp Ala Leu Ala Met Val Thr 1 5 10 15 Arg Pro Ala Ser Ala Ala Pro Met Gly Gly Pro Glu Leu Ala Gln His 20 25 30 Glu Glu Leu Thr Leu Leu Phe His Gly Thr Leu Gln Leu Gly Gln Ala 35 40 45 Leu Asn Gly Val Tyr Arg Thr Thr Glu Gly Arg Leu Thr Lys Ala Arg 50 55 60 Asn Ser Leu Gly Leu Tyr Gly Arg Thr Ile Glu Leu Leu Gly Gln Glu 65 70 75 80 Val Ser Arg Gly Arg Asp Ala Ala Gln Glu Leu Arg Ala Ser Leu Leu 85 90 95 Glu Thr Gln Met Glu Glu Asp Ile Leu Gln Leu Gln Ala Glu Ala Thr 100 105 110 Ala Glu Val Leu Gly Glu Val Ala Gln Ala Gln Lys Val Leu Arg Asp 115 120 125 Ser Val Gln Arg Leu Glu Val Gln Leu Arg Ser Ala Trp Leu Gly Pro 130 135 140 Ala Tyr Arg Glu Phe Glu Val Leu Lys Ala His Ala Asp Lys Gln Ser 145 150 155 160 His Ile Leu Trp Ala Leu Thr Gly His Val Gln Arg Gln Arg Arg Glu 165 170 175 Met Val Ala Gln Gln His Arg Leu Arg Gln Ile Gln Glu Arg Leu His 180 185 190 Thr Ala Ala Leu Pro Ala 195 <210> 2 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Human β-opsonin <400> 2 agggacggct gacaagggcc aggaa 25 <210> 3 <211> 26 <212> DNA <213> Artificial sequence <220> <223> Human β-opsonin <400> 3 ccaggctgtt cctggccctt gtcagc 26 <210> 4 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Human β-opsonin <400> 4 ggcacagagg gtgctacggg acagc 25 <210> 5 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Human β-opsonin <400> 5 cgtagcaccc tctgtgcctg ggcca 25 <210> 6 <211> 26 <212> DNA <213> Artificial sequence <220> <223> Human β-opsonin <400> 6 gaatttgagg tcttaagggc tcacgc 26 <210> 7 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Human β-opsonin <400> 7 cttgtcagcg tgagccctta agacctc 27 <210> 8 <211> 26 <212> DNA <213> Artificial sequence <220> <223> Human β-opsonin <400> 8 gctcacgctg acaggcagag ccacat 26 <210> 9 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Human β-opsonin <400> 9 ccataggatg tggctctgcc tgtcagc 27 <210> 10 <211> 217 <212> PRT <213> Artificial sequence <220> <223> Human Growth Hormone <400> 10 Met Ala Thr Gly Ser Arg Thr Ser Leu Leu Leu Ala Phe Gly Leu Leu 1 5 10 15 Cys Leu Pro Trp Leu Gln Glu Gly Ser Ala Phe Pro Thr Ile Pro Leu 20 25 30 Ser Arg Leu Phe Asp Asn Ala Met Leu Arg Ala His Arg Leu His Gln 35 40 45 Leu Ala Phe Asp Thr Tyr Gln Glu Phe Glu Glu Ala Tyr Ile Pro Lys 50 55 60 Glu Gln Lys Tyr Ser Phe Leu Gln Asn Pro Gln Thr Ser Leu Cys Phe 65 70 75 80 Ser Glu Ser Ile Pro Thr Pro Ser Asn Arg Glu Glu Thr Gln Gln Lys 85 90 95 Ser Asn Leu Glu Leu Leu Arg Ile Ser Leu Leu Leu Ile Gln Ser Trp 100 105 110 Leu Glu Pro Val Gln Phe Leu Arg Ser Val Phe Ala Asn Ser Leu Val 115 120 125 Tyr Gly Ala Ser Asp Ser Asn Val Tyr Asp Leu Leu Lys Asp Leu Glu 130 135 140 Glu Gly Ile Gln Thr Leu Met Gly Arg Leu Glu Asp Gly Ser Pro Arg 145 150 155 160 Thr Gly Gln Ile Phe Lys Gln Thr Tyr Ser Lys Phe Asp Thr Asn Ser 165 170 175 His Asn Asp Asp Ala Leu Leu Lys Asn Tyr Gly Leu Leu Tyr Cys Phe 180 185 190 Arg Lys Asp Met Asp Lys Val Glu Thr Phe Leu Arg Ile Val Gln Cys 195 200 205 Arg Ser Val Glu Gly Ser Cys Gly Phe 210 215 <210> 11 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Human Growth Hormone <400> 11 ccaaaggaac agaggtattc attc 24 <210> 12 <211> 24 <212> DNA <213> Artificial sequence <220> <223> Human Growth Hormone <400> 12 caggaatgaa tacctctgtt cctt 24 <210> 13 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Human Growth Hormone <400> 13 gacctcctaa gggacctaga g 21 <210> 14 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Human Growth Hormone <400> 14 ctctaggtcc cttaggaggt c 21 <210> 15 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Human Growth Hormone <400> 15 cagatcttca ggcagaccta c 21 <210> 16 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Human Growth Hormone <400> 16 gtaggtctgc ctgaagatct g 21 <210> 17 <211> 110 <212> PRT <213> Artificial sequence <220> <223> Human insulin <400> 17 Met Ala Leu Trp Met Arg Leu Leu Pro Leu Leu Ala Leu Leu Ala Leu 1 5 10 15 Trp Gly Pro Asp Pro Ala Ala Ala Phe Val Asn Gln His Leu Cys Gly 20 25 30 Ser His Leu Val Glu Ala Leu Tyr Leu Val Cys Gly Glu Arg Gly Phe 35 40 45 Phe Tyr Thr Pro Lys Thr Arg Arg Glu Ala Glu Asp Leu Gln Val Gly 50 55 60 Gln Val Glu Leu Gly Gly Gly Pro Gly Ala Gly Ser Leu Gln Pro Leu 65 70 75 80 Ala Leu Glu Gly Ser Leu Gln Lys Arg Gly Ile Val Glu Gln Cys Cys 85 90 95 Thr Ser Ile Cys Ser Leu Tyr Gln Leu Glu Asn Tyr Cys Asn 100 105 110 <210> 18 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Human insulin <400> 18 ggcttcttct acacacccag gaccc 25 <210> 19 <211> 24 <212> DNA <213> Artificial sequence <220> <223> Human insulin <400> 19 ctcccggcgg gtcctgggtg tgta 24 <210> 20 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Human insulin <400> 20 tccctgcaga ggcgtggcat tgt 23 <210> twenty one <211> 27 <212> DNA <213> Artificial sequence <220> <223> Human insulin <400> twenty one ttgttccaca atgccacgcc tctgcag 27 <210> twenty two <211> 188 <212> PRT <213> Artificial sequence <220> <223> Human interferon alpha <400> twenty two Met Ala Leu Thr Phe Ala Leu Leu Val Ala Leu Leu Val Leu Ser Cys 1 5 10 15 Lys Ser Ser Cys Ser Val Gly Cys Asp Leu Pro Gln Thr His Ser Leu 20 25 30 Gly Ser Arg Arg Thr Leu Met Leu Leu Ala Gln Met Arg Arg Ile Ser 35 40 45 Leu Phe Ser Cys Leu Lys Asp Arg His Asp Phe Gly Phe Pro Gln Glu 50 55 60 Glu Phe Gly Asn Gln Phe Gln Lys Ala Glu Thr Ile Pro Val Leu His 65 70 75 80 Glu Met Ile Gln Gln Ile Phe Asn Leu Phe Ser Thr Lys Asp Ser Ser 85 90 95 Ala Ala Trp Asp Glu Thr Leu Leu Asp Lys Phe Tyr Thr Glu Leu Tyr 100 105 110 Gln Gln Leu Asn Asp Leu Glu Ala Cys Val Ile Gln Gly Val Gly Val 115 120 125 Thr Glu Thr Pro Leu Met Lys Glu Asp Ser Ile Leu Ala Val Arg Lys 130 135 140 Tyr Phe Gln Arg Ile Thr Leu Tyr Leu Lys Glu Lys Lys Tyr Ser Pro 145 150 155 160 Cys Ala Trp Glu Val Val Arg Ala Glu Ile Met Arg Ser Phe Ser Leu 165 170 175 Ser Thr Asn Leu Gln Glu Ser Leu Arg Ser Lys Glu 180 185 <210> 23 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Human interferon α <400> twenty three cttcagcaca agggactcat c 21 <210> twenty four <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Human interferon alpha <400> twenty four cagatgagtc ccttgtgctg a 21 <210> 25 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Human interferon alpha <400> 25 ctcctagaca gattctacac t 21 <210> 26 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Human interferon alpha <400> 26 agtgtagaat ctgtctagga g 21 <210> 27 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Human interferon alpha <400> 27 gctgtgagga gatacttcca a 21 <210> 28 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Human interferon alpha <400> 28 ttggaagtat ctcctcacag c 21 <210> 29 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Human interferon alpha <400> 29 ctctatctga gagagaagaa a 21 <210> 30 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Human interferon alpha <400> 30 tttcttctct ctcagataga g 21 <210> 31 <211> 207 <212> PRT <213> Artificial sequence <220> <223> Human G-CSF <400> 31 Met Ala Gly Pro Ala Thr Gln Ser Pro Met Lys Leu Met Ala Leu Gln 1 5 10 15 Leu Leu Leu Trp His Ser Ala Leu Trp Thr Val Gln Glu Ala Thr Pro 20 25 30 Leu Gly Pro Ala Ser Ser Leu Pro Gln Ser Phe Leu Leu Lys Cys Leu 35 40 45 Glu Gln Val Arg Lys Ile Gln Gly Asp Gly Ala Ala Leu Gln Glu Lys 50 55 60 Leu Val Ser Glu Cys Ala Thr Tyr Lys Leu Cys His Pro Glu Glu Leu 65 70 75 80 Val Leu Leu Gly His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser 85 90 95 Cys Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu His 100 105 110 Ser Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile 115 120 125 Ser Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp Val Ala 130 135 140 Asp Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala 145 150 155 160 Pro Ala Leu Gln Pro Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala 165 170 175 Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser 180 185 190 Phe Leu Glu Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro 195 200 205 <210> 32 <211> 24 <212> Ms <213> artificial sequence <220> <223> Human G-CSF <400> 32 agcttcctgc tcaggtgctt agag 24 <210> 33 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Human G-CSF <400> 33 ttgctctaag cacctgagca ggaa 24 <210> 34 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Human G-CSF <400> 34 tgtgccacct acaggctgtg ccac 24 <210> 35 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Human G-CSF <400> 35 ggggtggcac agcctgtagg tggc 24 <210> 36 <211> 187 <212> PRT <213> Artificial sequence <220> <223> Human interferon beta <400> 36 Met Thr Asn Lys Cys Leu Leu Gln Ile Ala Leu Leu Leu Cys Phe Ser 1 5 10 15 Thr Thr Ala Leu Ser Met Ser Tyr Asn Leu Leu Gly Phe Leu Gln Arg 20 25 30 Ser Ser Asn Phe Gln Cys Gln Lys Leu Leu Trp Gln Leu Asn Gly Arg 35 40 45 Leu Glu Tyr Cys Leu Lys Asp Arg Met Asn Phe Asp Ile Pro Glu Glu 50 55 60 Ile Lys Gln Leu Gln Gln Phe Gln Lys Glu Asp Ala Ala Leu Thr Ile 65 70 75 80 Tyr Glu Met Leu Gln Asn Ile Phe Ala Ile Phe Arg Gln Asp Ser Ser 85 90 95 Ser Thr Gly Trp Asn Glu Thr Ile Val Glu Asn Leu Leu Ala Asn Val 100 105 110 Tyr His Gln Ile Asn His Leu Lys Thr Val Leu Glu Glu Lys Leu Glu 115 120 125 Lys Glu Asp Phe Thr Arg Gly Lys Leu Met Ser Ser Leu His Leu Lys 130 135 140 Arg Tyr Tyr Gly Arg Ile Leu His Tyr Leu Lys Ala Lys Glu Tyr Ser 145 150 155 160 His Cys Ala Trp Thr Ile Val Arg Val Glu Ile Leu Arg Asn Phe Tyr 165 170 175 Phe Ile Asn Arg Leu Thr Gly Tyr Leu Arg Asn 180 185 <210> 37 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Human interferon beta <400> 37 cagtgtcaga ggctcctgtg g 21 <210> 38 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Human interferon beta <400> 38 ccacaggagc ctctgacact g 21 <210> 39 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Human interferon beta <400> 39 ctggaagaaa gactggagaa a 21 <210> 40 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Human interferon beta <400> 40 tttctccagt ctttcttcca g 21 <210> 41 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Human interferon beta <400> 41 cattacctga gggccaagga g 21 <210> 42 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Human interferon beta <400> 42 ctccttggcc ctcaggtaat g 21 <210> 43 <211> 193 <212> PRT <213> Artificial sequence <220> <223> Human erythropoietin <400> 43 Met Gly Val His Glu Cys Pro Ala Trp Leu Trp Leu Leu Leu Ser Leu 1 5 10 15 Leu Ser Leu Pro Leu Gly Leu Pro Val Leu Gly Ala Pro Pro Arg Leu 20 25 30 Ile Cys Asp Ser Arg Val Leu Glu Arg Tyr Leu Leu Glu Ala Lys Glu 35 40 45 Ala Glu Asn Ile Thr Thr Gly Cys Ala Glu His Cys Ser Leu Asn Glu 50 55 60 Asn Ile Thr Val Pro Asp Thr Lys Val Asn Phe Tyr Ala Trp Lys Arg 65 70 75 80 Met Glu Val Gly Gln Gln Ala Val Glu Val Trp Gln Gly Leu Ala Leu 85 90 95 Leu Ser Glu Ala Val Leu Arg Gly Gln Ala Leu Leu Val Asn Ser Ser 100 105 110 Gln Pro Trp Glu Pro Leu Gln Leu His Val Asp Lys Ala Val Ser Gly 115 120 125 Leu Arg Ser Leu Thr Thr Leu Leu Arg Ala Leu Gly Ala Gln Lys Glu 130 135 140 Ala Ile Ser Pro Pro Asp Ala Ala Ser Ala Ala Pro Leu Arg Thr Ile 145 150 155 160 Thr Ala Asp Thr Phe Arg Lys Leu Phe Arg Val Tyr Ser Asn Phe Leu 165 170 175 Arg Gly Lys Leu Lys Leu Tyr Thr Gly Glu Ala Cys Arg Thr Gly Asp 180 185 190 Arg <210> 44 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Human erythropoietin <400> 44 gcatgtggat agagccgtca gtgc 24 <210> 45 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Human erythropoietin <400> 45 gcactgacgg ctctatccac atgc 24 <210> 46 <211> 31 <212> DNA <213> Artificial sequence <220> <223> Human erythropoietin <400> 46 tgacactttc cgcagactct tccgagtcta c 31 <210> 47 <211> 31 <212> DNA <213> Artificial sequence <220> <223> Human erythropoietin <400> 47 gtagactcgg aagagtctgc ggaaagtgtc a 31 <210> 48 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Human erythropoietin <400> 48 ctccggggaa ggctgaagct g 21 <210> 49 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Human erythropoietin <400> 49 cagcttcagc cttccccgga g 21 <210> 50 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Human erythropoietin <400> 50 ggaaagctga ggctgtacac agg 23 <210> 51 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Human erythropoietin <400> 51 cctgtgtaca gcctcagctt tcc 23 <210> 52 <211> 396 <212> PRT <213> Artificial sequence <220> <223> Human bone morphogenetic protein-2 <400> 52 Met Val Ala Gly Thr Arg Cys Leu Leu Ala Leu Leu Leu Pro Gln Val 1 5 10 15 Leu Leu Gly Gly Ala Ala Gly Leu Val Pro Glu Leu Gly Arg Arg Lys 20 25 30 Phe Ala Ala Ala Ser Ser Gly Arg Pro Ser Ser Gln Pro Ser Asp Glu 35 40 45 Val Leu Ser Glu Phe Glu Leu Arg Leu Leu Ser Met Phe Gly Leu Lys 50 55 60 Gln Arg Pro Thr Pro Ser Arg Asp Ala Val Val Pro Pro Tyr Met Leu 65 70 75 80 Asp Leu Tyr Arg Arg His Ser Gly Gln Pro Gly Ser Pro Ala Pro Asp 85 90 95 His Arg Leu Glu Arg Ala Ala Ser Arg Ala Asn Thr Val Arg Ser Phe 100 105 110 His His Glu Glu Ser Leu Glu Glu Leu Pro Glu Thr Ser Gly Lys Thr 115 120 125 Thr Arg Arg Phe Phe Phe Asn Leu Ser Ser Ile Pro Thr Glu Glu Phe 130 135 140 Ile Thr Ser Ala Glu Leu Gln Val Phe Arg Glu Gln Met Gln Asp Ala 145 150 155 160 Leu Gly Asn Asn Ser Ser Phe His His Arg Ile Asn Ile Tyr Glu Ile 165 170 175 Ile Lys Pro Ala Thr Ala Asn Ser Lys Phe Pro Val Thr Arg Leu Leu 180 185 190 Asp Thr Arg Leu Val Asn Gln Asn Ala Ser Arg Trp Glu Ser Phe Asp 195 200 205 Val Thr Pro Ala Val Met Arg Trp Thr Ala Gln Gly His Ala Asn His 210 215 220 Gly Phe Val Val Glu Val Ala His Leu Glu Glu Lys Gln Gly Val Ser 225 230 235 240 Lys Arg His Val Arg Ile Ser Arg Ser Leu His Gln Asp Glu His Ser 245 250 255 Trp Ser Gln Ile Arg Pro Leu Leu Val Thr Phe Gly His Asp Gly Lys 260 265 270 Gly His Pro Leu His Lys Arg Glu Lys Arg Gln Ala Lys His Lys Gln 275 280 285 Arg Lys Arg Leu Lys Ser Ser Cys Lys Arg His Pro Leu Tyr Val Asp 290 295 300 Phe Ser Asp Val Gly Trp Asn Asp Trp Ile Val Ala Pro Pro Gly Tyr 305 310 315 320 His Ala Phe Tyr Cys His Gly Glu Cys Pro Phe Pro Leu Ala Asp His 325 330 335 Leu Asn Ser Thr Asn His Ala Ile Val Gln Thr Leu Val Asn Ser Val 340 345 350 Asn Ser Lys Ile Pro Lys Ala Cys Cys Val Pro Thr Glu Leu Ser Ala 355 360 365 Ile Ser Met Leu Tyr Leu Asp Glu Asn Glu Lys Val Val Leu Lys Asn 370 375 380 Tyr Gln Asp Met Val Val Glu Gly Cys Gly Cys Arg 385 390 395 <210> 53 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Human Bone Morphogenetic Protein-2 <400> 53 gaaacgcctt aggtccagct gtaagagac 29 <210> 54 <211> 29 <212> DNA <213> Artificial sequence <220> <223> Human bone morphogenetic protein-2 <400> 54 gtctcttaca gctggaccta aggcgtttc 29 <210> 55 <211> 30 <212> DNA <213> Artificial sequence <220> <223> Human bone morphogenetic protein-2 <400> 55 ttaagtccag ctgtaggaga caccctttgt 30 <210> 56 <211> 30 <212> DNA <213> Artificial sequence <220> <223> Human bone morphogenetic protein-2 <400> 56 acaaagggtg tctcctacag ctggacttaa 30 <210> 57 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Human bone morphogenetic protein-2 <400> 57 gttaactcta ggattcctaa ggc twenty three <210> 58 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Human bone morphogenetic protein-2 <400> 58 gccttaggaa tcctagagtt aac twenty three <210> 59 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Human bone morphogenetic protein-2 <400> 59 ggttgtatta aggaactatc aggac 25 <210> 60 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Human bone morphogenetic protein-2 <400> 60 gtcctgatag ttccttaata caacc 25 <210> 61 <211> 155 <212> PRT <213> Artificial sequence <220> <223> Human Fibroblast Growth Factor-1 <400> 61 Met Ala Glu Gly Glu Ile Thr Thr Phe Thr Ala Leu Thr Glu Lys Phe 1 5 10 15 Asn Leu Pro Pro Gly Asn Tyr Lys Lys Pro Lys Leu Leu Tyr Cys Ser 20 25 30 Asn Gly Gly His Phe Leu Arg Ile Leu Pro Asp Gly Thr Val Asp Gly 35 40 45 Thr Arg Asp Arg Ser Asp Gln His Ile Gln Leu Gln Leu Ser Ala Glu 50 55 60 Ser Val Gly Glu Val Tyr Ile Lys Ser Thr Glu Thr Gly Gln Tyr Leu 65 70 75 80 Ala Met Asp Thr Asp Gly Leu Leu Tyr Gly Ser Gln Thr Pro Asn Glu 85 90 95 Glu Cys Leu Phe Leu Glu Arg Leu Glu Glu Asn His Tyr Asn Thr Tyr 100 105 110 Ile Ser Lys Lys His Ala Glu Lys Asn Trp Phe Val Gly Leu Lys Lys 115 120 125 Asn Gly Ser Cys Lys Arg Gly Pro Arg Thr His Tyr Gly Gln Lys Ala 130 135 140 Ile Leu Phe Leu Pro Leu Pro Val Ser Ser Asp 145 150 155 <210> 62 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Human Fibroblast Growth Factor-1 <400> 62 aagaagccca gactcctcta c 21 <210> 63 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Human Fibroblast Growth Factor-1 <400> 63 gtagaggagt ctgggcttct t 21 <210> 64 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Human Fibroblast Growth Factor-1 <400> 64 catgcagaga ggaattggtt t 21 <210> 65 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Human Fibroblast Growth Factor-1 <400> 65 aaaccaattc ctctctgcat g 21 <210> 66 <211> 167 <212> PRT <213> Artificial sequence <220> <223> Human Leptin <400> 66 Met His Trp Gly Thr Leu Cys Gly Phe Leu Trp Leu Trp Pro Tyr Leu 1 5 10 15 Phe Tyr Val Gln Ala Val Pro Ile Gln Lys Val Gln Asp Asp Thr Lys 20 25 30 Thr Leu Ile Lys Thr Ile Val Thr Arg Ile Asn Asp Ile Ser His Thr 35 40 45 Gln Ser Val Ser Ser Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro 50 55 60 Gly Leu His Pro Ile Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala 65 70 75 80 Val Tyr Gln Gln Ile Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln 85 90 95 Ile Ser Asn Asp Leu Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala 100 105 110 Phe Ser Lys Ser Cys His Leu Pro Trp Ala Ser Gly Leu Glu Thr Leu 115 120 125 Asp Ser Leu Gly Gly Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val 130 135 140 Val Ala Leu Ser Arg Leu Gln Gly Ser Leu Gln Asp Met Leu Trp Gln 145 150 155 160 Leu Asp Leu Ser Pro Gly Cys 165 <210> 67 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Human Leptin <400> 67 cccatccaaa aggtccaaga t 21 <210> 68 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Human Leptin <400> 68 atcttggacc ttttggatgg g 21 <210> 69 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Human Leptin <400> 69 gatgacacca agaccctcat c 21 <210> 70 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Human Leptin <400> 70 gatgagggtc ttggtgtcat c 21 <210> 71 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Human Leptin <400> 71 accctcatca ggacaattgt c 21 <210> 72 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Human Leptin <400> 72 gacaattgtc ctgatgaggg t 21 <210> 73 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Human Leptin <400> 73 accttatcca ggatggacca g 21 <210> 74 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Human Leptin <400> 74 ctggtccatc ctggataagg t 21 <210> 75 <211> 209 <212> PRT <213> Artificial sequence <220> <223> Human vascular endothelial growth factor A <400> 75 Met Asn Phe Leu Leu Ser Trp Val His Trp Ser Leu Ala Leu Leu Leu 1 5 10 15 Tyr Leu His His Ala Lys Trp Ser Gln Ala Ala Pro Met Ala Glu Gly 20 25 30 Gly Gly Gln Asn His His Glu Val Val Lys Phe Met Asp Val Tyr Gln 35 40 45 Arg Ser Tyr Cys His Pro Ile Glu Thr Leu Val Asp Ile Phe Gln Glu 50 55 60 Tyr Pro Asp Glu Ile Glu Tyr Ile Phe Lys Pro Ser Cys Val Pro Leu 65 70 75 80 Met Arg Cys Gly Gly Cys Cys Asn Asp Glu Gly Leu Glu Cys Val Pro 85 90 95 Thr Glu Glu Ser Asn Ile Thr Met Gln Ile Met Arg Ile Lys Pro His 100 105 110 Gln Gly Gln His Ile Gly Glu Met Ser Phe Leu Gln His Asn Lys Cys 115 120 125 Glu Cys Arg Pro Lys Lys Asp Arg Ala Arg Gln Glu Lys Lys Ser Val 130 135 140 Arg Gly Lys Gly Lys Gly Gln Lys Arg Lys Arg Lys Lys Ser Arg Pro 145 150 155 160 Cys Gly Pro Cys Ser Glu Arg Arg Lys His Leu Phe Val Gln Asp Pro 165 170 175 Gln Thr Cys Lys Cys Ser Cys Lys Asn Thr Asp Ser Arg Cys Lys Ala 180 185 190 Arg Gln Leu Glu Leu Asn Glu Arg Thr Cys Arg Cys Asp Lys Pro Arg 195 200 205 Arg <210> 76 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Human vascular endothelial growth factor A <400> 76 tacagcacaa cagatgtgaa tgcagacc 28 <210> 77 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Human vascular endothelial growth factor A <400> 77 ggtctgcatt cacatctgtt gtgctgta 28 <210> 78 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Human vascular endothelial growth factor A <400> 78 atccgcagac gtgtagatgt tcctgca 27 <210> 79 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Human vascular endothelial growth factor A <400> 79 tgcaggaaca tctacacgtc tgcggat 27 <210> 80 <211> 117 <212> PRT <213> Artificial sequence <220> <223> Human prepro-GHRL <400> 80 Met Pro Ser Pro Gly Thr Val Cys Ser Leu Leu Leu Leu Gly Met Leu 1 5 10 15 Trp Leu Asp Leu Ala Met Ala Gly Ser Ser Phe Leu Ser Pro Glu His 20 25 30 Gln Arg Val Gln Gln Arg Lys Glu Ser Lys Lys Pro Pro Ala Lys Leu 35 40 45 Gln Pro Arg Ala Leu Ala Gly Trp Leu Arg Pro Glu Asp Gly Gly Gln 50 55 60 Ala Glu Gly Ala Glu Asp Glu Met Glu Val Arg Phe Asn Ala Pro Phe 65 70 75 80 Asp Val Gly Ile Lys Leu Ser Gly Val Gln Tyr Gln Gln His Ser Gln 85 90 95 Ala Leu Gly Lys Phe Leu Gln Asp Ile Leu Trp Glu Glu Ala Lys Glu 100 105 110 Ala Pro Ala Asp Lys 115 <210> 81 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Human prepro-GHRL <400> 81 gccctgggga ggtttcttca g 21 <210> 82 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Human prepro-GHRL <400> 82 ctgaagaaac ctccccaggg c 21 <210> 83 <211> 28 <212> PRT <213> Artificial sequence <220> <223> Human appetite-stimulating hormone (ghrelin) <400> 83 Gly Ser Ser Phe Leu Ser Pro Glu His Gln Arg Val Gln Gln Arg Lys 1 5 10 15 Glu Ser Lys Lys Pro Pro Ala Lys Leu Gln Pro Arg 20 25 <210> 84 <211> 31 <212> DNA <213> Artificial sequence <220> <223> Human appetite-stimulating hormone (ghrelin) <400> 84 agtccagcag agaagggagt cgaagaagcc a 31 <210> 85 <211> 31 <212> DNA <213> Artificial sequence <220> <223> Human appetite-stimulating hormone (ghrelin) <400> 85 tggcttcttc gactcccttc tctgctggac t 31 <210> 86 <211> 31 <212> DNA <213> Artificial sequence <220> <223> Human appetite-stimulating hormone (ghrelin) <400> 86 agaaaggagt cgaggaagcc accagccaag c 31 <210> 87 <211> 31 <212> DNA <213> Artificial sequence <220> <223> Human appetite-stimulating hormone (ghrelin) <400> 87 gcttggctgg tggcttcctc gactcctttc t 31 <210> 88 <211> 31 <212> DNA <213> Artificial sequence <220> <223> Human appetite-stimulating hormone (ghrelin) <400> 88 agaaaggagt cgaagaggcc accagccaag c 31 <210> 89 <211> 31 <212> DNA <213> Artificial sequence <220> <223> Human appetite-stimulating hormone (ghrelin) <400> 89 gcttggctgg tggcctcttc gactcctttc t 31 <210> 90 <211> 30 <212> DNA <213> Artificial sequence <220> <223> Human appetite-stimulating hormone (ghrelin) <400> 90 aagaagccac cagccaggct gcagccccga 30 <210> 91 <211> 30 <212> DNA <213> Artificial sequence <220> <223> Human appetite-stimulating hormone (ghrelin) <400> 91 tcggggctgc agcctggctg gtggcttctt 30 <210> 92 <211> 31 <212> PRT <213> Artificial sequence <220> <223> Human glucagon-like peptide-1 (GLP-1) <400> 92 His Ala Glu Gly Thr Phe Thr Ser Asp Val Ser Ser Tyr Leu Glu Gly 1 5 10 15 Gln Ala Ala Lys Glu Phe Ile Ala Trp Leu Val Lys Gly Arg Gly 20 25 30 <210> 93 <211> 18 <212> DNA <213> Artificial sequence <220> <223> Human glucagon-like peptide-1 (GLP-1) <400> 93 aagctgccag ggaattca 18 <210> 94 <211> 18 <212> DNA <213> Artificial sequence <220> <223> Human glucagon-like peptide-1 (GLP-1) <400> 94 tgaattccct ggcagctt 18 <210> 95 <211> 17 <212> DNA <213> Artificial sequence <220> <223> Human glucagon-like peptide-1 (GLP-1) <400> 95 ttggctggtg agaggcc 17 <210> 96 <211> 17 <212> DNA <213> Artificial sequence <220> <223> Human glucagon-like peptide-1 (GLP-1) <400> 96 ggcctctcac cagccaa 17 <210> 97 <211> 470 <212> PRT <213> Artificial sequence <220> <223> Human IgG heavy chain <400> 97 Met Asp Trp Thr Trp Arg Phe Leu Phe Val Val Ala Ala Ala Thr Gly 1 5 10 15 Val Gln Ser Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln 20 25 30 Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Asn Ile 35 40 45 Lys Asp Thr Tyr Ile His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 50 55 60 Glu Trp Val Ala Arg Ile Tyr Pro Thr Asn Gly Tyr Thr Arg Tyr Ala 65 70 75 80 Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Ala Asp Thr Ser Lys Asn 85 90 95 Thr Ala Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 100 105 110 Tyr Tyr Cys Ser Arg Trp Gly Gly Asp Gly Phe Tyr Ala Met Asp Tyr 115 120 125 Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly 130 135 140 Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly 145 150 155 160 Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val 165 170 175 Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe 180 185 190 Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val 195 200 205 Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val 210 215 220 Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys Lys Val Glu Pro Lys 225 230 235 240 Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu 245 250 255 Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr 260 265 270 Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val 275 280 285 Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val 290 295 300 Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser 305 310 315 320 Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu 325 330 335 Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala 340 345 350 Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro 355 360 365 Gln Val Tyr Thr Leu Pro Pro Ser Arg Glu Glu Met Thr Lys Asn Gln 370 375 380 Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala 385 390 395 400 Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr 405 410 415 Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu 420 425 430 Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser 435 440 445 Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser 450 455 460 Leu Ser Pro Gly Leu Glu 465 470 <210> 98 <211> 30 <212> DNA <213> Artificial sequence <220> <223> Human IgG heavy chain <400> 98 acaaaggtgg acaggaaggt ggagcccaag 30 <210> 99 <211> 30 <212> DNA <213> Artificial sequence <220> <223> Human IgG heavy chain <400> 99 cttgggctcc accttcctgtccacctttgt 30 <210> 100 <211> 34 <212> DNA <213> Artificial sequence <220> <223> Human IgG heavy chain <400> 100 gagtataagt gcagggtgtc caataaggcc ctgc 34 <210> 101 <211> 34 <212> DNA <213> Artificial sequence <220> <223> Human IgG heavy chain <400> 101 gcagggcctt attggacacc ctgcacttat actc 34 <210> 102 <211> 34 <212> DNA <213> Artificial sequence <220> <223> Human IgG heavy chain <400> 102 ctttctgtat agcaggctga ccgtggataa gtcc 34 <210> 103 <211> 34 <212> DNA <213> Artificial sequence <220> <223> Human IgG heavy chain <400> 103 ggacttatcc acggtcagcc tgctatacag aaag 34 <210> 104 <211> 238 <212> PRT <213> Artificial sequence <220> <223> Human IgG light chain <400> 104 Met Asp Met Arg Val Pro Ala Gln Leu Leu Gly Leu Leu Leu Leu Trp 1 5 10 15 Leu Ser Gly Ala Arg Cys Asp Ile Gln Met Thr Gln Ser Pro Ser Ser 20 25 30 Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser 35 40 45 Gln Asp Val Asn Thr Ala Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys 50 55 60 Ala Pro Lys Leu Leu Ile Tyr Ser Ala Ser Phe Leu Tyr Ser Gly Val 65 70 75 80 Pro Ser Arg Phe Ser Gly Ser Arg Ser Gly Thr Asp Phe Thr Leu Thr 85 90 95 Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln 100 105 110 His Tyr Thr Thr Pro Pro Thr Phe Gly Gln Gly Thr Lys Val Glu Ile 115 120 125 Lys Arg Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp 130 135 140 Glu Gln Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn 145 150 155 160 Phe Tyr Pro Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu 165 170 175 Gln Ser Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp 180 185 190 Ser Thr Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr 195 200 205 Glu Lys His Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser 210 215 220 Ser Pro Val Thr Lys Ser Phe Asn Arg Gly Glu Cys Leu Glu 225 230 235 <210> 105 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Human IgG light chain <400> 105 cctggcaagg ccccaaggct gctgatctac 30 <210> 106 <211> 30 <212> DNA <213> Artificial sequence <220> <223> Human IgG light chain <400> 106 gtagatcagc agccttgggg ccttgccagg 30 <210> 107 <211> 30 <212> DNA <213> Artificial sequence <220> <223> Human IgG light chain <400> 107 acaaaggtgg agatcaggag gaccgtggcc 30 <210> 108 <211> 30 <212> DNA <213> Artificial sequence <220> <223> Human IgG light chain <400> 108 ggccacggtc ctcctgatct ccacctttgt 30 <210> 109 <211> 30 <212> DNA <213> Artificial sequence <220> <223> Human IgG light chain <400> 109 gccaaggtgc agtggagggt ggataacgcc 30 <210> 110 <211> 30 <212> DNA <213> Artificial sequence <220> <223> Human IgG light chain <400> 110 ggcgttatcc accctccact gcaccttggc 30

Claims

1. A growth hormone (GH) with an extended half-life, wherein: The amino acid sequence of the growth hormone is shown in SEQ No. 10, and the lysine residue at position 141 corresponding to the N-terminus of the growth hormone is replaced by arginine.

2. A pharmaceutical composition for preventing and / or treating dwarfism, Kabuki syndrome and / or Kearns-Sell syndrome (KSS), wherein: The pharmaceutical composition comprises the growth hormone according to claim 1 and a pharmaceutically acceptable excipient.

3. An expression vector comprising: (a) a promoter; (b) a nucleotide sequence encoding the growth hormone of claim 1; and an optional linker, wherein the promoter and the nucleotide sequence are operably linked. A host cell comprising the expression vector according to claim 3.

Images