DNA hydroxymethylation markers and kits for predicting the risk of ischemic stroke

Abstract

The present invention relates to a DNA hydroxymethylation marker and a kit for predicting the risk of ischemic stroke. The DNA hydroxymethylation marker includes a DNA hydroxymethylation site Chr1:11908348 in the promoter region of the NPPA gene, and the degree of hydroxymethylation indicates the degree of risk of ischemic stroke. The NPPA gene DNA hydroxymethylation marker provided by the present invention can be used to predict the risk of ischemic stroke, and can also be used as an intervention target for preventing and controlling ischemic stroke, which not only helps to explain the molecular mechanism of atrial natriuretic peptide acting on ischemic stroke, but also provides important epidemiological evidence for NPPA gene hydroxymethylation as a drug target for preventing and controlling ischemic stroke.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to a DNA hydroxymethylation marker and a kit for predicting the risk of ischemic stroke. Background Art

[0002] Although my country has made some achievements in the prevention and treatment of cardiovascular and cerebrovascular diseases in recent years, the incidence, prevalence, recurrence and mortality of stroke remain high. Therefore, it is urgent to effectively prevent and control the main type of stroke (ischemic stroke) and to find and discover more potential risk factors and intervention targets for ischemic stroke.

[0003] The natriuretic peptide axis is an important cardiac endocrine regulatory system for the body to respond to external environmental stimuli. It plays an important role in maintaining the body's water-sodium balance, blood pressure stability, and energy metabolism balance. The natriuretic peptide axis is mainly composed of atrial natriuretic peptide (ANP), brain natriuretic peptide (BNP), C-type natriuretic peptide (CNP), and their receptors. When blood volume increases, myocardial cells will secrete and release a large amount of biologically inactive atrial natriuretic peptide precursor (pro-ANP) and brain natriuretic peptide precursor (pro-BNP). Pro-ANP and pro-NNP are further activated into active ANP and BNP, and bind to their receptors to activate the natriuretic peptide axis, thereby promoting water-sodium metabolism, reducing blood volume, dilating blood vessels, and promoting energy metabolism, thereby maintaining cardiovascular homeostasis. As one of the important components of the natriuretic peptide axis, ANP may play an important role in the occurrence and development of ischemic stroke. A large amount of epidemiological evidence has supported this hypothesis. For example, the genetic polymorphism of NPPA, the coding gene of ANP, is significantly associated with the susceptibility of the population to hypertension, stroke, myocardial infarction and coronary heart disease; synthetic ANP (recombinant caperitide, valsartan) has been used to treat acute heart failure, but it can cause adverse outcomes such as hypotension and vascular edema. It can be seen that synthetic ANP may have great hidden dangers as a drug. A better understanding of the mechanism of action of ANP in ischemic stroke will help develop drugs for ANP and promote the clinical transformation of related research results of ANP. However, there have been no reports on the relationship between NPPA gene DNA hydroxymethylation and ischemic stroke, nor has there been a report on a suitable hydroxymethylation marker that can be used as an intervention target for ischemic stroke. Summary of the invention

[0004] To solve the above technical problems, the present invention provides a DNA hydroxymethylation marker associated with ischemic stroke through the study of the correlation between NPPA gene DNA hydroxymethylation and ischemic stroke. The degree of hydroxymethylation indicates the risk of ischemic stroke, which helps to explain the molecular mechanism of atrial natriuretic peptide on ischemic stroke. For every 2-fold increase in the hydroxymethylation level, the risk of ischemic stroke increases by 39%, and the detection sensitivity is high.

[0005] The first object of the present invention is to provide a DNA hydroxymethylation marker for predicting the risk of ischemic stroke. The DNA hydroxymethylation marker includes the DNA hydroxymethylation site Chr1:11908348 in the promoter region of the NPPA gene, and the degree of hydroxymethylation thereof indicates the risk degree of ischemic stroke.

[0006] Furthermore, a hydroxymethylation level of the DNA hydroxymethylation site Chr1:11908348 higher than 2.5% indicates a higher risk of ischemic stroke.

[0007] Furthermore, for every 2-fold increase in the hydroxymethylation level of the DNA hydroxymethylation site Chr1:11908348, the risk of ischemic stroke increased by 39%.

[0008] Furthermore, the upstream primer for amplifying the above DNA hydroxymethylation marker is shown as SEQ ID NO.1, and the downstream primer is shown as SEQ ID NO.2.

[0009] Further, detecting the hydroxymethylation level of the above DNA hydroxymethylation marker comprises the following steps:

[0010] (1) extracting DNA samples and treating the DNA samples with T4 β-glucosyltransferase and APOBEC3A enzyme;

[0011] (2) amplifying the DNA sample treated in step (1) using a suitable primer pair (such as SEQ ID NO.1 and SEQ ID NO.2 above) to obtain an amplified product;

[0012] (3) transcribing and digesting the amplified product of step (2) to obtain transcription and digestion products;

[0013] (4) Detecting the transcription and enzyme digestion products of step (3) to obtain the degree of hydroxymethylation at the Chr1:11908348 site in the sequence.

[0014] Furthermore, the DNA sample is a blood sample.

[0015] The second object of the present invention is to provide the use of the above-mentioned DNA hydroxymethylation marker in the preparation of a kit for predicting the risk of ischemic stroke.

[0016] Furthermore, the kit also includes primers for amplifying the DNA hydroxymethylation site Chr1:11908348 in the promoter region of the NPPA gene.

[0017] Furthermore, the upstream primer is shown as SEQ ID NO.1, and the downstream primer is shown as SEQ ID NO.2.

[0018] The third object of the present invention is to provide a primer for amplifying the above DNA hydroxymethylation marker in the preparation of a kit for predicting the risk of ischemic stroke, wherein the upstream primer is shown in SEQ ID NO.1, and the downstream primer is shown in SEQ ID NO.2. Specifically,

[0019] F:TTTTGTTTGAGGTTAGAGGTTTGTTTA

[0020] R: AAAAATCCTTAATTATCTCACCRCC, where R represents the base A / G.

[0021] The fourth object of the present invention is to provide a kit for predicting the risk of ischemic stroke, the kit comprising: primers for amplifying the DNA hydroxymethylation site Chr1:11908348 in the promoter region of the NPPA gene.

[0022] Furthermore, the kit also includes a reagent for detecting the hydroxymethylation level of the DNA hydroxymethylation site Chr1:11908348 in the promoter region of the NPPA gene.

[0023] The fifth object of the present invention is to provide the use of the above-mentioned DNA hydroxymethylation marker in the preparation of ischemic stroke therapeutic drugs, which are designed with the DNA hydroxymethylation site Chr1:11908348 in the promoter region of the NPPA gene as the target to inhibit the hydroxymethylation level of the target.

[0024] By means of the above scheme, the present invention has at least the following advantages:

[0025] The NPPA gene DNA hydroxymethylation marker provided by the present invention can be used to predict the risk of ischemic stroke, and can also be used as an intervention target for preventing and controlling ischemic stroke. The detection sensitivity of the hydroxymethylation marker is significantly better than that of existing ischemic stroke detection markers, and it has good accuracy and specificity.

[0026] The above description is only an overview of the technical solution of the present invention. In order to more clearly understand the technical means of the present invention and implement it according to the contents of the specification, the following is a description of the preferred embodiments of the present invention in conjunction with detailed drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to make the contents of the present invention more clearly understood, the present invention is further described in detail below based on specific embodiments of the present invention in conjunction with the accompanying drawings.

[0028] Figure 1 is a schematic diagram of the DNA hydroxymethylation marker of the present invention;

[0029] Figure 2 Schematic diagram of the 9 CpG sites in the promoter region of the NPPA gene detected, wherein site 2 is the hydroxymethylation marker of the present invention;

[0030] Figure 3 To investigate the relationship between the DNA hydroxymethylation level of NPPA gene and the risk of ischemic stroke;

[0031] Figure 4 The ROC curve of NPPA gene Chr1:11908348 DNA hydroxymethylation for the prediction of ischemic stroke;

[0032] Figure 5 This is a schematic diagram comparing the two models for predicting ischemic stroke before and after adding traditional risk factors to the NPPA gene Chr1:11908348 DNA hydroxymethylation. DETAILED DESCRIPTION

[0033] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0034] Example 1

[0035] First, 1,000 cases were randomly selected from people with ischemic stroke and with DNA biospecimens available. Then, 1,000 controls were selected from the healthy community population with normal DNA biospecimens based on age and gender frequency matching with the cases. Finally, a total of 853 cases and 918 controls met the criteria for inclusion in the study. Whole blood DNA samples were extracted from each research subject, and the target region sequencing technology was used to detect the hydroxymethylation level of each CpG site in the promoter region of the NPPA gene. That is, the promoter region of the human NPPA gene (gene number: ENSG00000175206) was queried using the ENSEMBL database. This region is Chromosome 1:11908117-11908380 (GRCh37.P13, -540bp to -277bp from TSS). The nucleic acid sequence of this region was intercepted on NCBI, and the nucleic acid sequence was imported into the EMBOSS Cpgplot software to predict the CpG island. Then, the Epidesigner program was used to design primers for the CpG island and CpG dense region sequences, and appropriate primers were selected for DNA hydroxymethylation detection (primer sequence information is shown in Table 1). After selection, the hydroxymethylation levels of 9 CpG sites were obtained. The 9 CpG sites were as follows: Figure 2 As shown, they are Chr1:11908353 (CpG1), Chr1:11908348 (CpG2), Chr1:11908299 (CpG3), Chr1:11908200 (CpG4), Chr1:11908182 (CpG5), Chr1:11908178 (CpG6), Chr1:11908168 (CpG7), Chr1:11908165 (CpG8), and Chr1:11908142 (CpG9).

[0036] Table 1 Primer sequences for detecting DNA hydroxymethylation in the promoter region of NPPA gene

[0037]

[0038] The specific detection method of DNA hydroxymethylation is:

[0039] First, the DNA samples were treated with T4β-glucosyltransferase and APOBEC3A enzymes in sequence using a DNA hydroxymethylation detection kit to label the hydroxymethylated cytosine in the sample DNA with glucose. The labeled hydroxymethylated cytosine will not be deaminated by the APOBEC3A enzyme, while the remaining cytosine and methylated cytosine are converted into thymine under the action of the APOBEC3A enzyme. Then, multiple PCR amplification was performed using the primers in Table 1 and the sample genome after enzyme conversion as a template. In order to distinguish different samples, primers with Index sequences were used to introduce specific label sequences compatible with the Illumina platform to the end of the library through PCR amplification. Finally, all sample Index PCR amplification products were mixed in equal amounts and sequenced on the Illumina HiSeq / Miseq platform in a 2×150bp / 2×250bp double-end sequencing mode to obtain FastQ data. The hydroxymethylation level of each CpG site was quantified as the number of reads with hydroxymethylation at the site (ie, the number of reads in which base C was detected) / the total number of reads at the site × 100%.

[0040] The results of the study are as follows:

[0041] 1. Clinical characteristics of the subjects

[0042] Table 2 shows the clinical characteristics of the study subjects, and it was found that compared with the healthy control group, patients with ischemic stroke had more traditional risk factors, such as a history of hypertension, diabetes, obesity, hyperglycemia, and hyperlipidemia (all P < 0.05).

[0043] Table 2 Clinical characteristics of the subjects

[0044]

[0045] 2. Hydroxymethylation sites that can independently predict the risk of ischemic stroke

[0046] By constructing a logistic regression model to analyze the relationship between the DNA hydroxymethylation level of the NPPA gene and ischemic stroke events, we found hydroxymethylation sites that can independently predict the risk of ischemic stroke. Figure 3 As shown in the data, after adjusting for traditional risk factors and correcting for multiple tests, only CpG2 was significantly associated with the risk of ischemic stroke (P < 0.05 and q < 0.05). For every 2-fold increase in the hydroxymethylation level of this site, the risk of ischemic stroke increased by 39%.

[0047] The predictive efficacy of DNA hydroxymethylation level at Chr1:11908348 of NPPA gene for ischemic stroke Figure 4-5 shown. Figure 4This is the ROC curve diagram of the hydroxymethylation level of this site and ischemic stroke. The AUC is 0.53>0.5, indicating that the hydroxymethylation of this site has a certain ability to predict ischemic stroke.

[0048] The net reclassification index NRI and the comprehensive discrimination index IDI were further calculated. The NRI value was 0.2297 (0.1226-0.3368), and the IDI value was 0.0066 (0.0018-0.0114). The calculation results and Figure 5 All of these indicate that the hydroxymethylation level of this site can increase the predictive efficacy of traditional risk factors for ischemic stroke and is statistically significant. At the same time, the likelihood ratio test was used to evaluate whether there was a statistical difference between the two constructed models, P = 0.0005 < 0.05, and the difference was statistically significant.

[0049] Example 2 Construction of a Hydroxymethylation Detection Kit

[0050] Based on the above research, it can be known that after the CpG2 site located in the promoter region is hydroxymethylated, it may promote NPPA gene expression and pro-ANP protein secretion, and then participate in the onset of ischemic stroke, and can be used as a predictive marker and potential drug target for the risk of ischemic stroke. Therefore, the present invention constructs a hydroxymethylation detection kit based on this CpG2 site.

[0051] The specific detection method is:

[0052] ① Whole blood DNA extraction and quality inspection

[0053] a. Detection of genomic DNA integrity by agarose gel electrophoresis: The electrophoresis bands were clearly visible, with no obvious degradation and no RNA contamination.

[0054] b.Nanodrop 2000 detection of genomic DNA quality: concentration ≥ 20 ng / μL, total amount ≥ 1 μg, OD260 / 280 = 1.7-2.0, OD260 / 230 ≥ 1.8.

[0055] ②T4β-glucosyltransferase and APOBEC3A enzyme treatment

[0056] The DNA samples that have passed the quality inspection are treated with T4β-glucosyltransferase and APOBEC3A enzyme using a DNA hydroxymethylation detection kit to label the hydroxymethylated cytosine in the sample DNA with glucose. The labeled hydroxymethylated cytosine will not be deaminated by the APOBEC3A enzyme, while the remaining cytosine and methylated cytosine are converted into thymine under the action of the APOBEC3A enzyme.

[0057] ③Multiplex PCR amplification

[0058] Then, the designed primers (F: TTTTGTTTGAGGTTAGAGGTTTGTTTA; R: AAAAATCCTTAATTATCTCACCRCC) were used to amplify the DNA of the enzyme-transformed sample to obtain an amplification product with a T7 RNA polymerase promoter sequence.

[0059] ④CpG fragment cutting

[0060] The amplified DNA product is then transcribed into RNA fragments using T7 RNA polymerase, and the resulting RNA fragments are cut into small fragments containing CpG using RNaseA.

[0061] ⑤ Flight mass spectrometry

[0062] Finally, in each small RNA fragment, the final products of cytosine and methylated cytosine are CpA, and the final product of hydroxymethylated cytosine is CpG. The molecular weight of this final product is detected using the Agena Mass Array flight mass spectrometry system.

[0063] ⑥ Calculation of hydroxymethylation level and prediction of ischemic stroke risk

[0064] The hydroxymethylation level of this CpG site is quantified as product mass CpG / (CpG+CpA)×100%. A hydroxymethylation level >2.5% indicates a higher risk of ischemic stroke (see Figure 4 ), close attention should be paid and preventive treatment measures should be taken. The diagnosis of stroke by CpG2 site methylation model is shown in Table 3.

[0065] Table 3 CpG2 site methylation model for the diagnosis of stroke

[0066]

[0067] Based on the above research, it can be known that after the Chr1:11908348CpG site located in the promoter region is hydroxymethylated, it may promote NPPA gene expression and pro-ANP protein secretion, and then participate in the occurrence of ischemic stroke. It can serve as a predictive marker for the risk of ischemic stroke and a potential drug target.

[0068] Obviously, the above embodiments are merely examples for clear explanation and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived from these are still within the protection scope of the invention. Sequence Listing <110> Soochow University <120> DNA hydroxymethylation markers and kits for predicting the risk of ischemic stroke <160> 2 <170> SIPOSequenceListing 1.0 <210> 1 <211> 27 <212> DNA <213> (Artificial sequence) <400> 1 ttttgtttga ggttagaggt ttgttta 27 <210> 2 <211> 25 <212> DNA <213> (Artificial sequence) <400> 2 aaaaatcctt aattatctcaccrcc 25

Claims

1. Use of a reagent for detecting the level of DNA hydroxymethylation markers in the preparation of a kit for predicting the risk of ischemic stroke, characterized in that: The DNA hydroxymethylation marker is NPPA The DNA hydroxymethylation site Chr1 in the gene promoter region: 11908348, the kit is used to detect the hydroxymethylation level of the site, and the kit is used in combination with a traditional risk factor model for predicting the risk of ischemic stroke to improve the efficacy of predicting the risk of ischemic stroke, the traditional risk factor model includes age, gender, education level, smoking, drinking, body mass index, low-density lipoprotein cholesterol, high-density lipoprotein cholesterol and whether there is a history of hypertension; Detecting the hydroxymethylation level of the DNA hydroxymethylation marker comprises the following steps: (1) extracting a DNA sample, and treating the DNA sample with T4 β-glucosyltransferase and APOBEC3A enzyme; (2) amplifying the DNA sample treated in step (1) to obtain an amplified product; (3) performing transcription and enzyme digestion on the amplified product of step (2) to obtain transcription and enzyme digestion products; (4) Detect the transcription and enzyme digestion products of step (3) to obtain the degree of hydroxymethylation at the Chr1: 11908348 site in the sequence.

2. The use according to claim 1, characterized in that: For every 2-fold increase in the hydroxymethylation level of the DNA hydroxymethylation site Chr1: 11908348, the risk of ischemic stroke increases by 39%.

3. The use according to claim 1, characterized in that: The kit includes amplification NPPA Primers for the DNA hydroxymethylation site Chr1: 11908348 in the gene promoter region.

4. The use according to claim 3, characterized in that: The upstream primer is shown as SEQ ID NO.1, and the downstream primer is shown as SEQ ID NO.2.

Images