A DNA methylation marker, primer and application thereof for assessing the risk of stroke

Abstract

The present invention relates to a DNA methylation marker, primer and application thereof for assessing the risk of stroke, wherein the DNA methylation marker comprises at least one of the DNA methylation sites Chr4:47840038, Chr4:47839941 and Chr4:47839933 in the promoter region of the CORIN gene, and a kit for assessing the risk of stroke is provided based on the DNA methylation marker. The CORIN gene DNA methylation marker provided by the present invention can be used to predict the risk of stroke, as a screening index for people at high risk of stroke, and can also be used as an intervention target for preventing and controlling stroke. The present invention not only helps to explain the molecular mechanism of Corin's involvement in the onset of stroke as a regulator of atrial natriuretic peptide, but also provides important epidemiological evidence for CORIN gene methylation as a drug target for preventing and controlling stroke.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to a DNA methylation marker, a primer and an application thereof for assessing the risk of stroke. Background Art

[0002] Stroke is a sudden disease of brain blood circulation disorder. It has become one of the leading diseases affecting human health worldwide. Therefore, how to effectively prevent and treat stroke is a major challenge facing my country's public health field. It is urgent to discover more potential risk factors and therapeutic targets and promote their clinical transformation.

[0003] The main members of the natriuretic peptide system (NPs) include atrial natriuretic peptide (ANP) and B-type natriuretic peptide (BNP), which play an important role in maintaining blood pressure through sodium excretion, diuresis and vasodilation. Existing studies have shown that increased levels of natriuretic peptides are associated with the risk of stroke. Corin is a type II transmembrane serine protease that is highly expressed in cardiomyocytes. It is the main physiological activator of ANP and can also activate BNP. Therefore, Corin, as an upstream regulator of NPs, may be involved in the pathogenesis of stroke. Basic research and epidemiological studies suggest the effects of Corin on cardiovascular disease. For example, overexpression of Corin protein in mice with dilated cardiomyopathy can improve cardiac function and delay the progression of heart failure. In contrast, CORIN gene knockout mice develop hypertension and myocardial hypertrophy. In humans, polymorphisms in the gene encoding Corin protein, CORIN, are associated with susceptibility to heart failure, myocardial hypertrophy and hypertension. Some small cross-sectional clinical studies have found that soluble Corin is associated with cardiovascular diseases, such as atrial fibrillation, heart failure, and myocardial infarction. Previous studies in our laboratory have found that lower serum Corin levels are significantly associated with the prevalence of stroke and poor stroke prognosis. The above studies suggest that Corin protein may be related to the pathogenesis of stroke, and Corin protein may become a therapeutic target or candidate drug for stroke prevention and treatment. However, no inhibitor of Corin protein has been found in human plasma, which reduces the safety of its clinical transformation. Therefore, it is necessary to better understand the molecular mechanism of the association between Corin and stroke. Epigenetic factors, as an interface between the genome and the dynamic environment, may affect the expression and function of genes, and thus have the potential to serve as the molecular mechanism we need. DNA methylation, as the most common and currently the most intensively studied epigenetic modification, has been considered to be involved in the pathological process of the disease by affecting the expression of related genes. For example, overall DNA methylation levels are associated with stroke, and methylation of the promoters of stroke-related genes, such as ABCG1, MMP2, ERα, thrombomodulin, and TP53, has been shown to be associated with stroke in some small sample case-control studies. However, there are no reports on the relationship between CORIN gene DNA methylation and stroke, nor have there been reports of a suitable methylation marker that can be used as an intervention target for the prevention and control of stroke. Summary of the invention

[0004] To solve the above technical problems, the present invention provides a DNA methylation marker related to stroke by studying the correlation between CORIN gene DNA methylation and stroke phenotype, which provides a basis for predicting the risk of stroke and screening of high-risk populations for stroke, and is also expected to serve as an intervention target for preventing and controlling stroke.

[0005] The first object of the present invention is to provide a DNA methylation marker for assessing the risk of stroke, wherein the DNA methylation marker comprises at least one of the DNA methylation sites Chr4:47840038, Chr4:47839941 and Chr4:47839933 in the promoter region of the CORIN gene.

[0006] Furthermore, the DNA methylation marker includes a combination of DNA methylation sites in the promoter region of the CORIN gene, and the combination of DNA methylation sites is any one of the following combinations (1)-(4):

[0007] (1) Chr4:47840038 and Chr4:47839941, (2) Chr4:47840038 and Chr4:47839933, (3) Chr4:47839941 and Chr4:47839933, (4) Chr4:47840038, Chr4:47839941 and Chr4:47839933.

[0008] Furthermore, the upstream primer for amplifying the DNA methylation marker is shown as SEQ ID NO.1, and the downstream primer is shown as SEQ ID NO.2.

[0009] The second object of the present invention is to provide the use of the above-mentioned DNA methylation marker in the preparation of a kit for assessing the risk of stroke.

[0010] Furthermore, the kit for assessing the risk of stroke includes a primer pair for amplifying at least one of the DNA methylation sites Chr4:47840038, Chr4:47839941 and Chr4:47839933 in the promoter region of the CORIN gene. Preferably, the primer pair includes amplifying the DNA methylation sites Chr4:47840038, Chr4:47839941 and Chr4:47839933 simultaneously.

[0011] Furthermore, in the primer pair, the upstream primer is shown in SEQ ID NO. 1, and the downstream primer is shown in SEQ ID NO. 2. The primer pair can simultaneously amplify Chr4:47840038, Chr4:47839941 and Chr4:47839933 sites, and then detect the methylation level of each site separately when used, so as to judge the risk of stroke.

[0012] Furthermore, the application comprises the following steps:

[0013] (5) extracting DNA samples and treating the DNA samples with sulfite;

[0014] (6) amplifying the sample treated with sulfite in step (1) using the primers to obtain an amplified product;

[0015] (7) transcribing and digesting the amplified product of step (2) to obtain transcription and digestion products;

[0016] (8) Detecting the transcription and enzyme digestion products of step (3) to obtain the methylation levels of Chr4:47840038, Chr4:47839941 and Chr4:47839933 in the sample sequence.

[0017] Furthermore, DNA samples are derived from blood, which is easy to sample.

[0018] The third object of the present invention is to provide a primer pair for amplifying the above DNA methylation marker in the preparation of a kit for assessing the risk of stroke, wherein the upstream primer is shown in SEQ ID NO.1, and the downstream primer is shown in SEQ ID NO.2. Specifically,

[0019] F:GGGTGGGATTTGTAGAGTAGATAA

[0020] R: ACTTTAAAAACCCRACTCTACRACAA, where R represents the base A / G.

[0021] The fourth object of the present invention is to provide a kit for assessing the risk of stroke, which comprises: primers for separately or simultaneously amplifying the DNA methylation sites Chr4:47840038, Chr4:47839941 and Chr4:47839933 in the promoter region of the CORIN gene, and a reagent for detecting the methylation level of at least one of the sites Chr4:47840038, Chr4:47839941 and Chr4:47839933.

[0022] Furthermore, the upstream primer is shown as SEQ ID NO.1, and the downstream primer is shown as SEQ ID NO.2.

[0023] The fifth object of the present invention is to provide the use of the above-mentioned DNA methylation marker in the preparation of a stroke therapeutic drug, which is designed for at least one of the DNA methylation sites Chr4:47840038, Chr4:47839941 and Chr4:47839933 in the promoter region of the CORIN gene. DNA methylation is changeable. The targeted drug designed based on the above-mentioned DNA methylation site can regulate the expression of the CORIN gene and the secretion of Corin, thereby achieving the purpose of treating stroke.

[0024] By means of the above scheme, the present invention has at least the following advantages:

[0025] The CORIN gene DNA methylation marker provided by the present invention can be used to predict the risk of stroke, provide a basis for the screening of people at high risk of stroke, and can also be used as an intervention target for the prevention and control of stroke. It not only helps to explain the molecular mechanism of Corin upregulation on stroke, but also will provide important epidemiological evidence for CORIN gene methylation as a drug target for the prevention and control of stroke.

[0026] The above description is only an overview of the technical solution of the present invention. In order to more clearly understand the technical means of the present invention and implement it according to the contents of the specification, the following is a description of the preferred embodiments of the present invention in conjunction with detailed drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to make the contents of the present invention more clearly understood, the present invention is further described in detail below based on specific embodiments of the present invention in conjunction with the accompanying drawings.

[0028] Figure 1 The target sequences and primers for targeted bisulfite sequencing, as well as the 9 predicted CpG sites;

[0029] Figure 2 The results of DNA methylation level detection of 9 CpG sites in stroke patients and healthy controls;

[0030] Figure 3 is the receiver operating characteristic curve corresponding to the CpG3 site;

[0031] Figure 4 is the receiver operating characteristic curve corresponding to the CpG8 site;

[0032] Figure 5 is the receiver operating characteristic curve corresponding to the CpG9 site;

[0033] Figure 6 This is the receiver operating characteristic curve corresponding to the CpG3+CpG8 model;

[0034] Figure 7 This is the receiver operating characteristic curve corresponding to the CpG3+CpG9 model;

[0035] Figure 8 This is the receiver operating characteristic curve corresponding to the CpG8+CpG9 model;

[0036] Fig. 9 This is the receiver operating characteristic curve corresponding to the CpG3+CpG8+CpG9 model. DETAILED DESCRIPTION

[0037] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0038] Example 1

[0039] A total of 1771 subjects were included in this experiment, including 853 stroke patients and 918 healthy controls. Whole blood DNA samples were extracted from each subject, and the methylation levels of each CpG site in the promoter region of the CORIN gene were detected using the target region sequencing technology, that is, the promoter region of the human CORIN gene (gene number: ENSG00000145244) was queried using the ENSEMBL database, which was Chr4:47840136-47839906 (GRCh37.p13, from TSS: -13bp to 217bp), and the nucleic acid sequence of this region was intercepted on NCBI, and the nucleic acid sequence was imported into the EMBOSS Cpgplot software to predict the CpG island, and then the Epidesigner program was used to design primers for the CpG island and CpG dense region sequences, and appropriate primers were selected for DNA methylation detection (primer sequence information is shown in Table 1). After selection, CORIN methylation obtained the methylation levels of 9 CpG sites, such as Figure 1 shown.

[0040] Table 1 Primer sequences for DNA methylation detection in the promoter region of CORIN gene

[0041]

[0042] The specific detection method of DNA methylation is:

[0043] First, the DNA samples were treated with bisulfite using the EZ-96 DNA methylation kit (Zymo Research, Inc., CA, United States) to convert all cytosine C in the sample DNA that was not methylated into uracil U. Then, multiple PCR amplification was performed using the primers in Table 1 and the sample genome after bisulfite treatment as a template. To distinguish different samples, primers with Index sequences were used to introduce specific tag sequences compatible with the Illumina platform to the ends of the library through PCR amplification. Finally, all sample Index PCR amplification products were mixed in equal amounts and high-throughput sequenced on the Illumina Hiseq / Miseq platform in a 2×150bp / 2×250bp double-end sequencing mode to obtain FastQ data. The methylation level of each CpG site was quantified as the number of reads methylated at the site (i.e., the number of reads detecting base C) / the total number of reads at the site × 100%.

[0044] The results of the study are as follows:

[0045] 1. Clinical characteristics of the subjects

[0046] This example includes 853 ischemic stroke patients (average age 62 years, 53% male) and 918 age- and sex-matched healthy controls (average age 61 years, 55% male). It was found that ischemic stroke patients in the study had more metabolic risk factors such as hypertension, diabetes, lipids, and obesity compared with healthy controls (all P < 0.05).

[0047] Table 2 Clinical characteristics of the subjects

[0048]

[0049]

[0050] 2. Relationship between CORIN gene promoter region methylation and ischemic stroke

[0051] The DNA methylation levels of the above 9 CpG sites were detected, and it was found that the DNA methylation levels of the 9 CpG sites detected in stroke patients were lower than those in healthy controls (see Figure 2 , ns: P>0.05; *: P < 0.05; **: P < 0.01; ***: P < 0.001).

[0052] After adjusting for age, sex, education level, smoking, drinking, body mass index, low-density lipoprotein cholesterol, high-density lipoprotein cholesterol, diabetes and hypertension (see Table 3), all nine methylation sites were significantly associated with ischemic stroke (P<0.05), and these associations remained after multiple corrections (q<0.05).

[0053] In order to test whether the methylation levels of the nine sites can improve the predictive ability of traditional risk factors for ischemic stroke, the receiver operating characteristic curve (ROC) was drawn and the area under the curve (AUC) was compared. It was found that all nine sites can improve the predictive ability of traditional risk factors for ischemic stroke, such as Figures 3 to 5 The results showed that the methylation levels of three sites improved the predictive ability of traditional risk factors for ischemic stroke: Chr4:47840038 (0.8578 vs 0.8515, P = 0.0076); Chr4:47839941 (0.8598 vs 0.8515, P = 0.0019); Chr4:47839933 (0.8568 vs 0.8515, P = 0.0144). Figures 6 to 9 The ROC curves of multiple methylation site combination models were displayed, and it was found that the site combination model can also improve the predictive ability of traditional risk factors for ischemic stroke.

[0054] At the same time, the calculation results of the net reclassification improvement (NRI) and the integrated discrimination index (IDI) also showed that the methylation levels of the three CpG sites could improve the predictive ability of traditional risk factors for ischemic stroke (Table 4).

[0055] Table 3 Relationship between CORIN gene promoter region methylation level and ischemic stroke

[0056]

[0057]

[0058] Table 4 Net reclassification index and comprehensive discrimination improvement index of each CpG site

[0059]

[0060] Example 2

[0061] Based on the above research results, we found that methylation in the promoter region of the CORIN gene may be a predictor of the risk of stroke. To verify this conclusion, we conducted a prospective cohort study. The inventors included 2498 subjects who did not have a stroke at baseline in 2010, followed up on stroke events every 2 years, and ended the follow-up in 2020. The method for detecting the methylation level of the promoter region of the CORIN gene is as described in Example 1.

[0062] 1. Clinical characteristics of the subjects

[0063] A total of 2498 subjects (mean age 53 years, 39% male) who did not have stroke at baseline were included, of whom 88 developed stroke during the follow-up period. Compared with subjects who did not develop stroke during the follow-up period, subjects who developed stroke had more metabolic risk factors, such as hypertension, diabetes, and lipids (see Table 5).

[0064] Table 5 Clinical characteristics of the subjects

[0065]

[0066] 2. Relationship between CORIN gene promoter region methylation and stroke

[0067] During the 10-year follow-up of the Suzhou cohort, 88 people developed stroke, 71 died of non-stroke causes, and 214 were lost to follow-up (follow-up rate 91.43%). After adjusting for the above traditional risk factors, we found that the methylation levels of 3 of the 9 CpG sites were associated with a low risk of stroke, namely CpG3 (located at Chr4:47840038, HR=0.74, P=0.015), CpG8 (located at Chr4:47839941, HR=0.80, P=0.047), and CpG9 (Chr4:47839933, HR=0.82, P=0.050) (see Table 6).

[0068] In order to test whether the methylation levels of Chr4:47840038, Chr4:47839941, and Chr4:47839933 can improve the predictive ability of traditional risk factors for stroke, NRI and IDI were calculated. The results showed that the methylation levels of Chr4:47840038 and Chr4:47839933 can improve the predictive ability of traditional risk factors for ischemic stroke (Table 7).

[0069] Table 6 Relationship between methylation level of CORIN gene promoter region and stroke incidence

[0070]

[0071] Table 7 Net reclassification index and comprehensive discrimination improvement index for each CpG site

[0072]

[0073] Example 3 Construction of a methylation detection kit

[0074] Based on the above research, we can know that: Figure 1 As shown, after methylation of CpG3, CpG8, and CpG9 sites in the promoter region, CORIN gene expression and Corin protein secretion may be inhibited, thereby participating in the onset of stroke, and can be used as a predictive marker and potential drug target for the risk of stroke. Therefore, the present invention constructs a methylation detection kit based on CpG3, CpG8, and CpG9 sites.

[0075] The specific detection method is:

[0076] ① Whole blood DNA extraction and quality inspection

[0077] a. Agarose gel electrophoresis to detect genomic DNA integrity: The electrophoresis bands are clearly visible, with no obvious degradation and no RNA contamination.

[0078] b.Nanodrop 2000 detection of genomic DNA quality: concentration ≥ 20 ng / μL, total amount ≥ 1 μg, OD260 / 280 = 1.7-2.0, OD260 / 230 ≥ 1.8.

[0079] ②Sulfite treatment

[0080] The DNA samples that passed the quality inspection were treated with sulfite using the EZ-96 DNA methylation kit (Zymo Research, Orange, CA) to convert all unmethylated cytosine C in the sample DNA into uracil U.

[0081] ③Multiplex PCR amplification

[0082] Then, the designed primers (F: GGGTGGGATTTGTAGAGTAGATAA; R: ACTTTAAAAACCCRACTCTACRACAA) were used to amplify the DNA of the sulfite-treated specimen to obtain an amplification product with a T7 RNA polymerase promoter sequence.

[0083] ④CpG fragment cutting

[0084] The amplified DNA product is then transcribed into RNA fragments using T7 RNA polymerase, and the resulting RNA fragments are cut into small fragments containing CpG using RNaseA.

[0085] ⑤ Flight mass spectrometry

[0086] Finally, in each small RNA fragment, the final product of unmethylated CpG is CpA, and the final product of methylated CpG is CpG. The molecular weight of this final product is detected using the Agena Mass Array flight mass spectrometry system.

[0087] ⑥ Calculation of methylation levels and prediction of stroke risk

[0088] The methylation level of the CpG site was quantified as product mass CpG / (CpG+CpA)×100%, and the methylation level of each site was brought into the prediction model: Logit(p)=-9.421495+0.041777*age+-0.507642*sex+2.063699*education level+0.063120*smoking+0.036780*drinking+0.238716*body mass index+-0.327 The predicted value p is calculated from 117*LDL+0.327616*HDL+1.935708*diabetes+1.594185*hypertension+-0.028011*CpG3 methylation level+-0.071986*CpG8 methylation level+0.045531*CpG9 methylation level. When the predicted incidence rate p≥0.5131, it indicates that the risk of stroke is high, and close attention should be paid and preventive treatment measures should be taken.

[0089] Table 8 Comparison of various site methylation combination models for the diagnosis of stroke

[0090]

[0091] The detailed information of each model is as follows:

[0092] Table 9 Model details Traditional risk factor model

[0093]

[0094] Traditional risk factor model + CpG3

[0095]

[0096]

[0097] Traditional risk factor model + CpG8

[0098]

[0099] Traditional risk factor model + CpG9

[0100]

[0101]

[0102] Traditional risk factor model + CpG3 + CpG8

[0103]

[0104] Traditional risk factor model + CpG3 + CpG9

[0105]

[0106] Traditional risk factor model + CpG8 + CpG9

[0107]

[0108] Traditional risk factor model

[0109] +CpG3+CpG8+CpG9

[0110]

[0111] Obviously, the above embodiments are merely examples for clear explanation and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived from these are still within the protection scope of the invention. Sequence Listing <110> Soochow University <120> A DNA methylation marker, primer and application thereof for assessing the risk of stroke <160> 2 <170> SIPOSequenceListing 1.0 <210> 1 <211> twenty four <212> DNA <213> (Artificial sequence) <400> 1 gggtgggatt tgtagagtag ataa 24 <210> 2 <211> 26 <212> DNA <213> (Artificial sequence) <400> 2 actttaaaaacccractctacracaa 26

Claims

1. Use of a reagent for detecting the level of DNA methylation markers in the preparation of a kit for assessing the risk of stroke, characterized in that: The DNA methylation marker is CORIN The combination of DNA methylation sites in the gene promoter region: Chr4:47840038, Chr4:47839941 and Chr4:47839933. The kit is used to detect the methylation level of each site in the combination of DNA methylation sites.

2. The use according to claim 1, characterized in that: The kit for assessing the risk of stroke includes amplification CORIN Primer pairs for the DNA methylation sites Chr4:47840038, Chr4:47839941 and Chr4:47839933 in the gene promoter region.

3. The use according to claim 2, characterized in that: The upstream primers for amplifying DNA methylation sites Chr4:47840038, Chr4:47839941 and Chr4:47839933 are shown in SEQ ID NO.1, and the downstream primers are shown in SEQ ID NO.

2.

4. The use according to claim 3, characterized in that: The application comprises the following steps: (1) Extracting DNA samples and treating the DNA samples with sulfite; (2) amplifying the sample treated with sulfite in step (1) using the primer pair to obtain an amplified product; (3) performing transcription and enzyme digestion on the amplified product of step (2) to obtain transcription and enzyme digestion products; (4) Detect the transcription and enzyme digestion products of step (3) to obtain the methylation levels of Chr4:47840038, Chr4:47839941 and Chr4:47839933.

Images