A molecular marker tightly linked to QTL related to black carp growth and its application

Abstract

The present invention discloses a molecular marker closely linked to a QTL associated with growth of black carp and its application, which comprises molecular markers snp8107 and snp9562, wherein snp8107 has a target sequence with a length of 437 bp and a nucleotide sequence as shown in SEQ ID NO:1, and there is an A / G SNP site at the 163rd nucleotide; snp9562 has a target sequence with a length of 274 bp and a nucleotide sequence as shown in SEQ ID NO:2, and there is a G / A SNP site at the 172nd nucleotide. The molecular marker closely linked to the QTL associated with growth of black carp is screened and identified in the present invention, which can be used to screen black carp individuals with advantageous genotypes, has the advantages of simplicity, high efficiency, accuracy and high specificity, and can be used in marker-assisted breeding of black carp to greatly save breeding costs and improve breeding efficiency.

Description

Technical Field

[0001] The invention belongs to the field of aquatic animal genetic breeding, and in particular relates to a molecular marker closely linked to a QTL associated with black carp growth and an application thereof. Background Art

[0002] Black carp (Mylopharyngodon piceus), also known as black carp, is one of the four major carps in my country and an important freshwater farmed fish in my country. It is naturally distributed in large and medium-sized river systems in East Asia, from the Heilongjiang River in the north to the Pearl River in the south. It is also an important freshwater farmed fish in my country. According to the China Fisheries Yearbook, my country's black carp production reached 694,500 tons in 2020, an increase of 2.20% compared with 2019. Due to the lack of attention to germplasm resource management and the continuous deterioration of the breeding environment in the process of black carp production, the germplasm resources of black carp have begun to gradually decrease, resulting in slow growth, decreased resistance to stress and many other phenomena, which are not conducive to the sustainable development of black carp farming. The traditional breeding method is to achieve the purpose of breeding through the screening of phenotypic traits, which has the disadvantages of time-consuming, labor-intensive, and unstable traits. Therefore, it is necessary to fully explore the genetic factors of black carp itself and use genetic methods to achieve efficient and stable breeding of good varieties of black carp.

[0003] The growth traits of black carp are complex quantitative traits that are easily affected by the environment. Generally speaking, good growth traits can shorten the breeding time and reap higher benefits. In the prior art, individuals with excellent growth traits are selected as parents based on family or individual phenotypes and pedigree information to improve growth performance, but this method has problems such as long breeding cycle and low efficiency. Molecular marker-assisted breeding has the advantages of fast speed, accuracy, reliability, strong specificity, and is not affected by the growth and development stage and environment. It can accelerate the breeding process of black carp germplasm resources. The premise of this technology is to obtain molecular markers that are closely linked to the target trait genes, and to find dominant genotype and phenotype individuals by comparing the differences in different genotype and phenotype traits to achieve the purpose of breeding.

[0004] QTL positioning is an important step in isolating molecular markers that are closely linked to target traits. Single nucleotide polymorphism (SNP) is a DNA sequence polymorphism caused by the conversion, transversion, insertion or deletion of a single nucleotide at the genome level. The technology is to find the SNP site by comparing it with known sequence information, and then use the discovered variable site to design specific primers to perform PCR amplification on genomic DNA to obtain a specific polymorphic product based on the SNP site. Finally, the polymorphism of the product is analyzed by gel electrophoresis. It has the advantages of high density, genetic stability, representativeness and easy automation of analysis. At present, there is no relevant report on the development and application of molecular markers closely linked to QTL related to black carp growth. Summary of the invention

[0005] In view of the problems in the prior art that the traditional breeding method of black carp is time-consuming and usually labor-intensive, in which families or individuals with excellent traits (such as growth traits and disease resistance) are selected as excellent parents for self-pollination or hybridization to establish families or groups, and the selection of quality traits determined by multiple genes (such as growth, disease resistance and salt tolerance) is relatively slow or unstable, the main purpose of the present invention is to provide a molecular marker tightly linked to QTL related to black carp growth.

[0006] Another object of the present invention is to provide the application of the molecular markers tightly linked to the above-mentioned black carp growth-related QTLs in black carp marker-assisted breeding.

[0007] To achieve the above object, the present invention adopts the following technical solution:

[0008] The invention provides a molecular marker tightly linked to a QTL associated with black carp growth, comprising molecular markers snp8107 and snp9562, wherein: the molecular marker snp8107 has a target sequence with a length of 437 bp and a nucleotide sequence as shown in SEQ ID NO:1, and an A / G SNP site exists at the 163rd nucleotide; the molecular marker snp9562 has a target sequence with a length of 274 bp and a nucleotide sequence as shown in SEQ ID NO:2, and a G / A SNP site exists at the 172nd nucleotide.

[0009] Preferably, the upstream primer sequence of the molecular marker snp8107 is shown as SEQ ID NO:3, and the downstream primer sequence is shown as SEQ ID NO:4; the upstream primer sequence of the molecular marker snp9562 is shown as SEQ ID NO:5, and the downstream primer sequence is shown as SEQ ID NO:6.

[0010] The present invention provides a method for screening molecular markers tightly linked to the above QTLs related to black carp growth, comprising the following steps:

[0011] (1) selecting normal-growing and deformed male and female black carps as healthy black carp parents, and constructing a black carp population by injecting hormones to accelerate maturation and artificial insemination;

[0012] (2) The phenotypic traits of the above-mentioned black carp population, including body weight, body length, body width and body height, were measured, and a 8-12 cm long cut was made from the tail of the black carp. 2 The fin tissues were placed in a centrifuge tube containing anhydrous ethanol and stored at -20°C;

[0013] (3) Two softwares, JionMap and MapQTL, were used for QTL localization. The former calculated the position information of each marker, and the latter calculated the QTL interval related to body weight. The molecular markers related to the body weight of black carp were obtained within the QTL interval with the highest effect.

[0014] Preferably, in step (1), the hormone used is a mixture of human chorionic gonadotropin analogue LRH-A and diometron osmotic pressure DOM.

[0015] Preferably, in step (2), the weight of the black carp group is measured using an electronic balance accurate to 0.1 g, and the body length, width and height are measured using a ruler accurate to 0.1 cm.

[0016] The present invention also provides the use of the molecular markers tightly linked to the QTLs related to black carp growth in assisting the detection of black carp body quality traits.

[0017] The present invention also provides the use of the molecular markers tightly linked to the QTLs related to black carp growth in black carp marker-assisted breeding.

[0018] The present invention also provides a method for screening black carp varieties based on the molecular markers closely linked to the QTLs related to black carp growth, comprising the following steps:

[0019] (a) Collect the fin tissue of the black carp to be tested, that is, cut 8-12cm from the tail of the black carp. 2 The fin tissues were placed in centrifuge tubes containing anhydrous ethanol and stored at -20°C, and genomic DNA was extracted;

[0020] (b) using the genomic DNA of the black carp to be tested as a template, and using the primer pairs shown in SEQ ID NOs: 3-6 to perform PCR amplification respectively to obtain PCR amplification products;

[0021] (c) After the PCR amplification product is sequenced by first-generation Sanger sequencing, the sequencing peak graph is observed by Senquencher software to perform SNP typing, and the genotype related to the body weight of black carp is obtained;

[0022] (d) combining the phenotypic shape data of black carp including body weight, body length, body width and body height with the above-mentioned genotypes related to the body weight of black carp for multiple comparisons to obtain the dominant genotype related to the body weight of black carp, thereby selecting black carp varieties.

[0023] Preferably, in step (a), the genomic DNA is extracted using the Tiangen marine biological tissue DNA extraction kit.

[0024] Preferably, in step (b), the reaction system for PCR amplification is a 25 μL reaction system, which includes 12.5 μL of 2×TaqPCR Master Mix, 8.5 μL of ddH2O, 2 μL of DNA template and 1 μL of upstream and downstream primers respectively; the PCR amplification process is: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 sec; annealing temperature is determined according to different primer pairs (55.5°C for snp8107 and 56.4°C for snp9562); extension at 72°C for 30 s; 30 cycles; extension at 72°C for 10 min; and storage at 4°C.

[0025] Preferably, in step (d), the dominant genotype associated with the body mass of Hanjiang black carp is a diplotype consisting of AA of snp8107 and GA of snp9562, and the dominant genotype associated with the body mass of Xiangjiang black carp is a diplotype consisting of AG of snp8107 and AA of snp9562.

[0026] Compared with the prior art, the beneficial effect of the present invention is that the molecular markers snp8107 and snp9562 closely linked to the QTL related to black carp growth are screened and identified in the present invention, based on which black carp individuals with advantageous genotypes can be screened, which has the advantages of simplicity, high efficiency, accuracy and high specificity, and can be used for marker-assisted breeding of black carp to select black carp varieties with good traits, which can greatly save breeding costs and improve breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 It is the sequencing peak diagram of different genotypes after sequencing typing of molecular markers snp8107 and snp9562 in the embodiment. DETAILED DESCRIPTION

[0028] In order to make the purpose, technical solution and advantages of the embodiment of the present invention clearer, the technical solution of the embodiment of the present invention will be clearly and completely described below in conjunction with the accompanying drawings of the embodiment of the present invention. Obviously, the described embodiment is a part of the embodiment of the present invention, not all of the embodiments. Based on the described embodiment of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0029] Example 1

[0030] This example screens molecular markers and primers closely linked to QTLs related to black carp growth, and the specific steps are as follows:

[0031] (1) Preparation of parents: The black carp used was from the wild population of Hanjiang River. Male and female individuals with excellent growth traits were selected as parents. After hatching, they were first cultured in a flowing water tank (1.5m 3) for cultivation, with zooplankton as the starter bait, and gradually lured to eat compound feed. When the juveniles are about 15 days old, they are moved to an outdoor cement pool (3m×2m×1m) for standardized juvenile cultivation, and then switched to artificial compound feed. Feed is fed three times in the morning, noon and evening, and the eating situation is observed. The aerator is turned on according to weather conditions.

[0032] (2) Growth data measurement: When the offspring were raised for 10 months after hatching, the weight, length, width and height of 384 offspring were measured. An electronic balance was used to measure body mass traits (accurate to 0.1 g), and a standard ruler was used to measure morphological traits (accurate to 0.1 cm).

[0033] (3) Screening of major SNPs: 128 individuals with extreme body weight were selected from 384 individuals for subsequent body weight SNP development. First, the total DNA of black carp was extracted using a kit (Tiangen Marine Biological Tissue DNA Extraction Kit), and the DNA was sent to Novogene Biotech for simplified genome sequencing. The raw data obtained by sequencing was aligned with the genome using the software BWA (v0.7.17), and then the software Stacks (v2.54) was used for SNP development and genotyping. VCFtools (v0.1.15) was used with missing data <20% and sequencing depth >5× as filtering criteria to filter out SNPs that did not meet the criteria, and only SNPs with MAF (minor allele frequency) >10% were retained. The software JoinMap4.0 was used to construct a genetic linkage map. The markers finally retained were first recoded into the JoinMap format under the "CP" population type. The marker types were divided into two modes: 1:1 (lm×ll or nn×np) and 1:2:1 (hk×hk). Using the χ2 test, SNPs that showed significant segregation distortion and p<0.01 in the χ2 goodness of fit test were excluded, and the remaining markers were assigned to linkage groups (LGs), and the CP algorithm was used to construct a map under the condition of a logarithmic odds ratio (LOD) threshold of 10.0. The regression mapping algorithm and Kosambi function were used to determine the marker order along a single linkage group and the genetic distance between markers. The recombination rate parameter was set to 0.40. The multi-QTL model mapping (MQM) method of the software MapQTL6 was used to determine the LOD value with 1000 permutation tests (t-tests) for each trait, with a confidence interval of 95%. QTLs with LOD values ​​exceeding the whole chromosome LOD threshold were considered to be related to growth traits. The genetic linkage map was constructed using genotype data for QTL positioning, and finally a major effect QTL related to weight was obtained, located at the 5.446-7.492 cM position of linkage group 17. This QTL interval contains five SNP molecular markers, among which snp8107 and snp9562 are the two markers with higher LOD and PVE values, with LOD values ​​of 3.83 and 3.21, and PVE values ​​of 12.9% and 10.9%, respectively.

[0034] (4) Primer design for fragments containing molecular markers: Use the IDs of snp8107 and snp9562 to find detailed information about SNPs, including their genetic distance, LOD value, and PVE value in the genome, for subsequent sequence extraction. First, use the software BWA (v0.7.17) to construct a black carp reference genome index, and then use bedtools to extract the flanking sequence containing the SNP. Using the obtained sequence, primers were designed in the software Primer Premier5, requiring that the amplified fragment contain the SNP site.

[0035] Example 2

[0036] In this example, black carp varieties are screened based on molecular markers closely linked to QTLs related to black carp growth, and the steps are as follows:

[0037] (1) A black carp population was constructed using black carp from the Hanjiang River system. Male and female individuals with excellent growth traits were selected as parents for artificial insemination. The fertilized eggs were cultured in hatching buckets until water splashed and then placed in ponds for cultivation. When the black carp was 10 months old after hatching, 288 black carps were randomly selected for measurement of body weight and length traits, and PIT electronic tags were implanted. Subsequently, a small piece of tail fin tissue was cut off and placed in a 96-well plate filled with anhydrous ethanol and stored in a -20℃ refrigerator for future use.

[0038] (2) The left and right 300 bp sequences of the molecular markers were extracted from the genome for primer construction, where S is forward and A is reverse, specifically: snp8107 primer sequence: S: 5'TGGTCTGCTGTGTTCTCCTC 3' (SEQ ID NO: 3); A: 5'CGGTGTGGATGAACAGACTC3' (SEQ ID NO: 4); snp9562 primer sequence: S: 5'CTATCAGCACACTCACCACATT 3' (SEQ ID NO: 5); A: 5'CAGACCACAATGCTCTTCCA3' (SEQ ID NO: 6).

[0039] (3) PCR amplification was performed using the primer pairs of molecular markers snp8107 and snp9562, respectively. The system was 25 μL, and the components included 12.5 μL 2×Taq Master Mix, 8.5 μL ddH2O, 2 μL DNA, and 1 μL each of upstream and downstream primers; the procedure was: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 sec; annealing temperature was determined according to different primer pairs (55.5°C for snp8107 and 56.4°C for snp9562); extension at 72°C for 30 s; 30 cycles; extension at 72°C for 10 min; storage at 4°C, and after obtaining the PCR amplification products, 1% agarose gel electrophoresis was performed, and UV light or gel imager was used to detect obvious bands, wherein the snp8107 amplification product had a 437 bp band and the snp9562 amplification product had a 274 bp band.

[0040] (4) Direct sequencing: The PCR products were submitted to Sangon Biotech (Shanghai) Co., Ltd. for first-generation sequencing. The sequences were as follows:

[0041] snp8107: TGGTCTGCTGTGTTCTCCTCAATAGCAGTACAGGCGTTTCATTGGACCAGTAATAATTACAATGTGCCGTGTCCAAATGAACACATGATTATAAGCTGCCATTTTTCTCACAGTGGAATCTGGTGTGCGACAGCGAGTGGAGAGTCCCGTTCGCAACCTCAACGTTATACATGGGCTACTTGTTGGGCTCTCTTGTTTCTGGTCAACTTTCTGAC AGGTACTGCTTTTGTCCACATATCATAATTAATGCAAACAGTCGGTTTTGATGGAGAGTATCTGGCCGAAGCTATATGACACCACCTGTGTGCTTTACAGATCTAGTAAGCTAGTGAAGCAATAGTTTTTGTTTACTGGTCTACTTCCACTCTCATAACTGAAGATGTTCTCGTTGCTCTCTCCTAACCTGAAGAGTCTGTTCATCCACACCG(SEQ ID NO:1);

[0042] snp9562: CTATCAGCACACTCACCACATTCGCTGTTTTATTCTGAAATACAAAAATGGATGCGATAGCTTTTTAATAATGCACATGTTCATTACTGTCATTTTTATTCGAGTGAACTTCTCCAAACAGACTTTTGGCTCCGCTGACCTGGATTCATTCAGGTGAGCGCAGGAGACAGGGAACGCAAACTAATCCGAAGAAGTCATGTGTGAACCGCATCTTTACAACAAACGTGTGCATTTGTGTGTGTGATGATCCATGTTTGGAAGAGCATTGTGGTCTG (SEQ ID NO: 2). After obtaining the sequencing data, the sequencing peak graph was observed using the software Sequencher (v5.4.6) ( Figure 1 ) and determine its genotype based on the peak shape in the peak graph.

[0043] (5) Using the measured genotype data (since there is a very significant correlation between the three phenotypic traits, that is, improving one of the traits can also improve other traits, this embodiment is mainly used to improve body weight and is supported by the body length trait), combined with the phenotypic data, the gene frequency and average body weight of different genotypes are statistically calculated, and the results are expressed as mean ± standard deviation. The dominant genotype of the group is determined by the average value, and the results are shown in Tables 1-4. First, the allele and gene frequencies of the single SNP sites are statistically analyzed (Table 2). It can be seen that the A gene frequency of snp8107 and the G gene frequency of snp9562 are relatively high. Then, the growth phenotype data of different haplotypes are statistically analyzed (removing haplotypes or diplotypes with only one individual). From Table 3, it can be seen that the average weight and body length of the haplotype AG of snp8107 and the haplotype GA of snp9562 are significantly higher than the average of the overall sample. Since the three SNPs are located in the same linkage group, there may be a linkage effect, so the accuracy can be improved by combining different haplotypes into diplotypes for statistical analysis. From Table 4, it can be seen that the average weight of the diplotype composed of AA of snp8107 and GA of snp9562 is significantly higher than the total average weight of 288 black carp (Table 4). Therefore, it can be considered that this diplotype is the dominant genotype of the Hanjiang population.

[0044] Table 1: Phenotypic data and correlations of 288 individuals in the Hanjiang black carp population

[0045] Comparison Items Weight / g Body length / cm weight Pearson correlation 1 0.963** Mean ± SD 88.01±27.09 16.92±1.65

[0046] Note: **The correlation is significant at the 0.01 level (two-tailed).

[0047] Table 2: Genotypes and genotype frequencies of two SNP loci in the Hanjiang black carp population

[0048]

[0049] Note: In snp8107, AA is AA, AB is AG, and BB is GG; in snp9562, AA is GG, AB is GA, and BB is AA.

[0050] Table 3: Association analysis between different haplotypes of two SNP loci and growth traits in Hanjiang black carp population

[0051]

[0052]

[0053] Table 4: Association analysis between diplotypes composed of snp8107 and snp9562 loci and body weight and length traits of Hanjiang black carp population

[0054]

[0055] Example 3

[0056] This example verifies the application of molecular markers snp8107 and snp9562 in the Xiangjiang population, as follows:

[0057] 30 adult black carps from Xiangjiang River were selected as test materials. The measurement of growth traits, sequence information, PCR amplification, and SNP typing were the same as in Example 2. No statistical analysis was performed on the undetected single / double type and the genotype samples with a quantity of 1. The correlation analysis of body weight and body length, the frequency statistics of different genotypes, and the association analysis of different haplotypes and diplotypes with growth traits were performed on the 30 black carps from Xiangjiang River. The results are shown in Tables 5-8. As can be seen from Table 7, in the 30 adult black carps randomly selected, the haplotype AG of snp8107 and the haplotype AA of snp9562 are significantly higher than the average weight of other haplotypes (Table 6). In addition, after forming the diplotype, the diplotype composed of AG of snp8107 and AA of snp9562 is significantly higher than the average weight of other diplotypes (Table 8). Correlation analysis shows that body weight and body length have a very significant correlation (Table 5). This proves that the molecular markers snp8107 and snp9562 tightly linked to the black carp growth-related QTL in the present invention are also applicable to black carp in other water systems. However, due to the influence of genetic and environmental factors, there are differences in the dominant genotypes of populations in different water systems.

[0058] Table 5: Phenotypic data of 30 individuals in the Xiangjiang black carp population and the correlation between body weight and length

[0059] Comparison Items Weight / g Body length / cm weight Pearson correlation 1 0.873** Mean ± SD 500.483±183.293 30.677±3.455

[0060] Note: **The correlation is significant at the 0.01 level (two-tailed).

[0061] Table 6: Genotypes and genotype frequencies of two SNP loci in the Xiangjiang black carp population

[0062]

[0063]

[0064] Note: In snp8107, AA is AA, AB is AG, and BB is GG; in snp9562, AA is GG, AB is GA, and BB is AA.

[0065] Table 7: Association analysis between different haplotypes of two SNP loci and growth traits in Xiangjiang black carp population

[0066]

[0067] Table 8: Association analysis between diplotypes composed of snp8107 and snp9562 loci and body weight and length traits of Xiangjiang black carp population

[0068]

[0069] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention. Sequence Listing <110> Shanghai Ocean University <120> A molecular marker tightly linked to QTL related to black carp growth and its application <160> 6 <170> SIPO Sequence Listing 1.0 <210> 1 <211> 438 <212> DNA <213> Artificial sequence <400> 1 tggtctgctg tgttctcctc aatagcagta caggcgtttc attggaccag taataattac 60 aatgtgccgt gtccaaatga acacatgatt ataagctgcc atttttctca cacagtggaa 120 tctggtgtgc gacagcgagt ggagagtccc gttcgcaacc tcaacgttat acatgggcta 180 cttgttgggc tctcttgttt ctggtcaact ttctgacagg tactgctttt gtccacatat 240 cataattaat gcaaacagtc ggttttgatg gagagtatct ggccgaagct atatgacacc 300 acctgtgtgc tttacagatc tagtaagcta gtgaagcaat agtaaaacag tttttgttta 360 ctggtctact tccactctca taactgaaga tgttctcgtt gctctctcct aacctgaaga 420 gtctgttcat ccacaccg 438 <210> 2 <211> 275 <212> DNA <213> Artificial sequence <400> 2 ctatcagcac actcaccaca ttcgctgttt tattctgaaa tacaaaaatg gatgcgatag 60 ctttttaata atgcacatgt tcattactgt catttttatt cgagtgaact tctccaaaca 120 gacttttggc tccgctgacc tggattcatt caggtgagcg caggagacag ggaacgcaaa 180 ctaatccgaa gaagtcatgt gtgaaccgca tctttacaac aaacgtgtgc atttgtgtgt 240 gtgatgatcc atgtttggaa gagcattgtg gtctg 275 <210> 3 <211> 20 <212> DNA <213> Artificial sequence <400> 3 tggtctgctg tgttctcctc 20 <210> 4 <211> 20 <212> DNA <213> Artificial sequence <400> 4 cggtgtggat gaacagactc 20 <210> 5 <211> twenty two <212> DNA <213> Artificial sequence <400> 5 ctatcagcac actcaccaca tt 22 <210> 6 <211> 20 <212> DNA <213> Artificial sequence <400> 6 cagaccacaa tgctcttcca 20

Claims

1. A molecular marker closely linked to a QTL associated with black carp growth, comprising molecular markers snp8107 and snp9562, wherein: The molecular marker snp8107 has a target sequence of 437 bp in length and a nucleotide sequence as shown in SEQ ID NO: 1, and there is an A / G SNP site at the 163rd nucleotide; the molecular marker snp9562 has a target sequence of 274 bp in length and a nucleotide sequence as shown in SEQ ID NO: 2, and there is a G / A SNP site at the 172nd nucleotide.

2. The molecular marker tightly linked to the QTL related to black carp growth according to claim 1, characterized in that: The upstream primer sequence of the molecular marker snp8107 is shown in SEQ ID NO:3, and the downstream primer sequence is shown in SEQ ID NO:4; the upstream primer sequence of the molecular marker snp9562 is shown in SEQ ID NO:5, and the downstream primer sequence is shown in SEQ ID NO:

6.

3. Use of the molecular marker tightly linked to the QTL related to black carp growth as described in claim 1 or 2 in assisting the detection of black carp body mass traits.

4. Use of the molecular marker tightly linked to the QTL related to black carp growth as claimed in claim 1 or 2 in marker-assisted breeding of black carp.

5. A method for screening black carp species, characterized in that: The method is achieved by using the molecular markers tightly linked to the QTLs related to black carp growth as described in claim 1 or 2, and comprises the following steps: (a) Collect the fin tissue of the black carp to be tested, that is, cut 8-12cm from the tail of the black carp. 2 The fin tissues were placed in centrifuge tubes containing anhydrous ethanol and stored at -20°C, and genomic DNA was extracted; (b) using the genomic DNA of the black carp to be tested as a template, and using the primer pairs shown in SEQ ID NOs: 3-6 to perform PCR amplification respectively to obtain PCR amplification products; (c) After the PCR amplification product is sequenced by first-generation Sanger sequencing, the sequencing peak graph is observed by Senquencher software to perform SNP typing, and the genotype related to the body weight of black carp is obtained; (d) Combining the phenotypic shape data of black carp including body weight, body length, body width and body height with the above-mentioned genotypes related to the body weight of black carp, multiple comparisons are performed to obtain the dominant genotype related to the body weight of black carp and select black carp varieties.

6. The method for screening black carp species according to claim 5, characterized in that: In step (a), genomic DNA is extracted using the Tiangen Marine Biological Tissue DNA Extraction Kit; and / or In step (b), the reaction system for PCR amplification is a 25 μL reaction system, which includes 12.5 μL of 2×Taq PCR MasterMix, 8.5 μL of ddH2O, 2 μL of DNA template and 1 μL of upstream and downstream primers respectively; the PCR amplification process is: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 sec; annealing; extension at 72°C for 30 s; 30 cycles; extension at 72°C for 10 min; storage at 4°C; wherein the annealing temperature of np8107 is 55.5°C, and the annealing temperature of snp9562 is 56.4°C.

7. The method for screening black carp species according to claim 5, characterized in that: In step (d), the dominant genotype associated with the body mass of Hanjiang black carp is a diplotype consisting of AA of snp8107 and GA of snp9562, and the dominant genotype associated with the body mass of Xiangjiang black carp is a diplotype consisting of AG of snp8107 and AA of snp9562.

Images