A set of primer probes, kits and applications thereof for detecting PEDV, TGEV and PDCoV

Abstract

The present invention discloses a set of primer probe groups, kits and applications thereof for detecting PEDV, TGEV and PDCoV, and particularly relates to the field of molecular detection technology. The primer probe group for detecting at least one of PEDV, TGEV and PDCoV of the present invention comprises a first primer probe group, a second primer probe group and a third primer probe group; the first primer probe group comprises a specific primer pair and probe for PEDV; the second primer probe group comprises a specific primer pair and probe for TGEV; the third primer probe group comprises a specific primer pair and probe for PDCoV. This group of primer probe groups has good sensitivity, high specificity and good repeatability, and can simultaneously differentiate and diagnose PEDV, TGEV and PDCoV, and can provide certain technical support for the prevention and control of diseases related to swine diarrhea.

Description

Technical Field

[0001] The present invention relates to the field of molecular detection technology, and in particular to a primer probe set, a kit and applications thereof for detecting PEDV, TGEV and PDCoV. Background Art

[0002] Porcine epidemic diarrhea virus (PEDV), transmissible gastroenteritis virus (TGEV), and porcine deltacoronavirus (PDCoV) are three viral pathogens that can cause diarrhea in pigs. All three viruses belong to coronavirus diseases, which are characterized by rapid transmission and serious harm. The diarrhea caused by these three viruses has similar clinical symptoms, which are mainly manifested as vomiting, diarrhea, and decreased feed intake, affecting the normal growth and development of pigs. It is difficult to distinguish clinically, and mixed infections are often present, which makes the diagnosis of pathogens very difficult.

[0003] At present, the diagnostic methods of PEDV, TGEV and PDCoV mainly include pathogen cell separation, electron microscopy, common RT-PCR, enzyme-linked immunosorbent assay, loop-mediated isothermal amplification, gene chip, etc., but these methods have limitations. Therefore, it is urgent to establish a method that can detect PEDV, TGEV and PDCoV at the same time to provide certain technical support for the prevention and control of porcine diarrhea-related diseases. Summary of the invention

[0004] The present invention aims to solve at least one of the technical problems existing in the prior art. To this end, the present invention proposes a set of primer probe sets for detecting at least one of PEDV, TGEV and PDCoV, which has good sensitivity, high specificity and good repeatability, and can be effectively used to simultaneously detect PEDV, TGEV and PDCoV, providing certain technical support for the prevention and control of porcine diarrhea-related diseases.

[0005] The present invention also provides a kit for detecting at least one of PEDV, TGEV and PDCoV.

[0006] The present invention also proposes the use of the primer probe set in preparing a reagent for detecting one or more of PEDV, TGEV and PDCoV.

[0007] In a first aspect of the present invention, a primer-probe group for detecting at least one of PEDV, TGEV and PDCoV is provided, comprising a first primer-probe group, a second primer-probe group and a third primer-probe group; the first primer-probe group is a specific primer pair and probe for PEDV, the sequence of the specific primer pair PEDV-F / R is shown in SEQ ID NO.1 and SEQ ID NO.2, and the sequence of the probe PEDV-P is shown in SEQ ID NO.3; the second primer-probe group is a specific primer pair and probe for TGEV, the sequence of the specific primer pair TGEV-F / R is shown in SEQ ID NO.4 and SEQ ID NO.5, and the sequence of the probe TGEV-P is shown in SEQ ID NO.6; the third primer-probe group is a specific primer pair and probe for PDCoV, the sequence of the specific primer pair PDCoV-F / R is shown in SEQ ID NO.7 and SEQ ID NO.8, and the sequence of the probe PDCoV-P is shown in SEQ ID NO.9.

[0008] In some embodiments of the present invention, the 5' ends of the PEDV-P, the TGEV-P and the PDCoV-P are respectively connected to different fluorescent groups; and the 3' ends of the PEDV-P, the TGEV-P and the PDCoV-P are respectively connected to quenching groups.

[0009] In some embodiments of the present invention, the fluorescent group is selected from at least one of 6-FAM, CY3, CY5, CY5.5, HEX, JOE, ROX, and VIC; the quenching group is selected from at least one of BHQ1, BHQ2, BHQ3, and BHQX.

[0010] In some embodiments of the present invention, 6-FAM is connected to the 5' end of PEDV-P and BHQ1 is connected to the 3' end; ROX is connected to the 5' end of TGEV-P and BHQ2 is connected to the 3' end; VIC is connected to the 5' end of PDCoV-P and BHQ2 is connected to the 3' end.

[0011] The second aspect of the present invention provides a kit for detecting at least one of PEDV, TGEV and PDCoV, comprising the primer probe set described in the first invention of the present invention.

[0012] In some embodiments of the present invention, in the primer probe set, the molar ratio of the working concentrations of PEDV-F, PEDV-R and PEDV-P is 5:4-6:1-3; the molar ratio of the working concentrations of TGEV-F, TGEV-R and TGEV-P is 6:5-7:4-6; the molar ratio of the working concentrations of PDCov-F, PDCov-R and PDCov-P is 1:0.5-1.5:0.5-1.5; the molar ratio of the working concentrations of PEDV-P, TGEV-P and PDCov-P is 4:4-6:1-3.

[0013] In some embodiments of the present invention, in the primer probe set, the molar ratio of PEDV-F, PEDV-R and PEDV-P is 5:5:2; the molar ratio of TGEV-F, TGEV-R and TGEV-P is 6:6:5; the molar ratio of PDCoV-F, PDCoV-R and PDCoV-P is 1:1:1; the molar ratio of PEDV-P, TGEV-P and PDCoV-P is 4:5:2.

[0014] In some embodiments of the present invention, the working concentration of PEDV-P is 80 nM-120 nM.

[0015] In some embodiments of the present invention, the working concentration of PEDV-P is 90 nM-110 nM.

[0016] In some embodiments of the present invention, the working concentrations of PEDV-F and PEDV-R are 250 nM, and the working concentration of PEDV-P is 100 nM; the working concentrations of TGEV-F and TGEV-R are 150 nM, and the working concentration of TGEV-P is 125 nM; the working concentrations of PDCoV-F and PDCoV-R are 50 nM, and the working concentration of PDCoV-P is 50 nM.

[0017] In some embodiments of the present invention, the kit further comprises a positive standard and a negative standard.

[0018] In some embodiments of the present invention, the kit further comprises a PCR amplification reagent.

[0019] In some embodiments of the present invention, the PCR amplification reagent includes at least one of dNTP, MgCl2, reverse transcriptase, RNase inhibitor and DNA polymerase.

[0020] In some embodiments of the present invention, the PCR amplification reagent is One Step RT-qPCR Mix.

[0021] In some embodiments of the present invention, the positive standard is at least one of a1-a4:

[0022] a1: at least one of PEDV, TGEV and PDCoV;

[0023] a2: a recombinant plasmid carrying at least one of the ORF3 gene of PEDV, the N gene of TGEV, and the ORF1ab gene of PDCoV;

[0024] a3: a recombinant plasmid carrying at least one of the sequences shown in SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO.12;

[0025] a4: bacteria or virus-like particles containing the recombinant plasmid described in a2 or a3.

[0026] In some embodiments of the present invention, the positive standard is a recombinant plasmid carrying the sequences shown in SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO.12.

[0027] In some embodiments of the present invention, the positive standard is a vector pUC57.

[0028] In some embodiments of the present invention, the negative standard includes but is not limited to nucleic acid-free water and nucleic acid-free physiological saline.

[0029] In some embodiments of the present invention, the method for using the kit is as follows:

[0030] (1) extracting nucleic acid from a sample;

[0031] (2) Using the above kit to perform PCR detection on the nucleic acid, and analyzing the results after the reaction is completed.

[0032] In some embodiments of the present invention, the PCR is fluorescent quantitative PCR.

[0033] In some embodiments of the present invention, the sample comprises at least one of intestinal tissue, intestinal contents and feces of a pig.

[0034] In some embodiments of the present invention, in step (2), the reaction procedure of the fluorescent quantitative PCR reaction is: 52°C for 5 min; 95°C for 10 s; 95°C for 5 s, 50°C-56°C for 30 s, and 35-45 cycles.

[0035] In some embodiments of the present invention, in step (2), the reaction procedure of the fluorescent quantitative PCR reaction is: 52°C for 5 min; 95°C for 10 s; 95°C for 5 s, 53°C for 30 s, and 40 cycles.

[0036] In some embodiments of the present invention, in step (2), the reaction system of the fluorescent quantitative PCR reaction is:

[0037]

[0038]

[0039] In some embodiments of the present invention, the nucleic acid extraction method includes but is not limited to a commercially available nucleic acid extraction kit, and the specific extraction steps refer to the instructions of the corresponding nucleic acid extraction kit.

[0040] In some embodiments of the present invention, the method of analyzing the results is as follows:

[0041] 1) When the Ct values ​​of the positive standards are all ≤35, and the Ct values ​​of the negative standards are >35 or there is no Ct value, make a judgment;

[0042] 2) The determination method is: when the Ct value of the fluorescent channel detected by the fluorescent group connected to PEDV-P is ≤35, the sample is judged to be infected with PEDV; when the Ct value of the fluorescent channel detected by the fluorescent group connected to TGEV-P is ≤35, the sample is judged to be infected with TGEV; when the Ct value of the fluorescent channel detected by the fluorescent group connected to PDCoV-P is ≤35, the sample is judged to be infected with PDCoV.

[0043] The third aspect of the present invention provides the use of the primer probe set of the first aspect of the present invention in the preparation of a reagent for detecting one or more of PEDV, TGEV and PDCoV.

[0044] The beneficial effects of the present invention are:

[0045] The present invention provides a set of primer probes for detecting PEDV, TGEV and PDCoV. The primer probes have good sensitivity, high specificity and good repeatability, and can simultaneously identify and diagnose PEDV, TGEV and PDCoV, and can provide certain technical support for the prevention and control of porcine diarrhea-related diseases. The method based on the primer probe set has a minimum detection amount of 1.99×10 2 copies / μL, and the minimum detection amount for TGEV was 1.99×10 2 copies / μL, and the minimum detection amount for PDCoV was 1.99×10 2 copies / μL.

[0046] The present invention also provides a kit for detecting PEDV, TGEV and PDCoV, which contains the above primer probe set, has good sensitivity, high specificity, good repeatability, and can simultaneously identify and diagnose PEDV, TGEV and PDCoV. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 The enzyme electrophoresis diagram of pUC57 / PEDV-TGEV-PDCoV provided by the present invention;

[0048] Figure 2 A standard curve established for PEDV by the detection method provided by the present invention;

[0049] Figure 3 A standard curve established for TGEV by the detection method provided by the present invention;

[0050] Figure 4 A standard curve established for PDCoV by the detection method provided by the present invention;

[0051] Figure 5 The sensitivity test results of the detection method provided by the present invention for PEDV (where 1 is the concentration of 1.99×10 8 copies / μL of the positive standard; 2 is the concentration of 1.99×10 7 copies / μL of the positive standard; 3 is the concentration of 1.99×10 6 copies / μL of the positive standard; 4 is the concentration of 1.99×10 5 copies / μL of the positive standard; 5 for a concentration of 1.99×10 4 copies / μL of the positive standard; 6 for a concentration of 1.99×10 3 copies / μL of the positive standard; 7 for a concentration of 1.99×10 2 copies / μL of positive standard);

[0052] Figure 6 The sensitivity test results of the detection method provided by the present invention for TGEV (where 1 is the concentration of 1.99×10 8 copies / μL of the positive standard; 2 is the concentration of 1.99×10 7 copies / μL of the positive standard; 3 is the concentration of 1.99×10 6 copies / μL of the positive standard; 4 is the concentration of 1.99×10 5 copies / μL of the positive standard; 5 for a concentration of 1.99×10 4 copies / μL of the positive standard; 6 for a concentration of 1.99×10 3 copies / μL of the positive standard; 7 for a concentration of 1.99×10 2 copies / μL of positive standard);

[0053] Figure 7 The sensitivity test results of the detection method provided by the present invention for PDCoV (where 1 is the concentration of 1.99×10 8 copies / μL of the positive standard; 2 is the concentration of 1.99×10 7 copies / μL of the positive standard; 3 is the concentration of 1.99×10 6 copies / μL of the positive standard; 4 is the concentration of 1.99×10 5 copies / μL of the positive standard; 5 for a concentration of 1.99×10 4 copies / μL of the positive standard; 6 for a concentration of 1.99×10 3 copies / μL of the positive standard; 7 for a concentration of 1.99×10 2 copies / μL of positive standard);

[0054] Figure 8 The specific detection result of the detection method provided by the present invention;

[0055] Fig. 9 This is the specific detection result of the detection method provided by the present invention. DETAILED DESCRIPTION

[0056] In order to make the technical scheme of the present invention more clearly understood by those skilled in the art, the following embodiments are listed for illustration. It should be pointed out that the following embodiments do not limit the protection scope of the present invention.

[0057] The reagents, methods and equipment used in the following examples are all conventional reagents, methods and equipment in the art. The experimental methods in the following examples without specifying specific experimental conditions are usually carried out under conventional experimental conditions or according to the experimental conditions recommended by the manufacturer.

[0058] The One Step RT-qPCR Mix (Cat. No. RR600B) used in the following examples was provided by Takara Biotech (Dalian) Co., Ltd.

[0059] Example 1

[0060] This embodiment provides an RT-PCR detection method for detecting PEDV, TGEV and PDCoV.

[0061] 1. Design and synthesis of primers and probes

[0062] Primer pairs (PEDV-F / R) and probes (PEDV-P) targeting PEDV ORF3 gene, primer pairs (TGEV-F / R) and probes (TGEV-P) targeting TGEV N gene, and primer pairs (PDCoV-F / R) and probes (PDCoV-P) targeting PDCoV ORF3 gene were designed by referring to the highly conserved sequences of PEDV ORF3 gene (MK135459.1), TGEV N gene (AF302264.1), and PDCoV ORF1ab gene (MH025764.1) in GenBank. The specific information is shown in Table 1.

[0063] Table 1

[0064]

[0065] Among them, PEDV-P has 6-FAM connected to the 5' end and BHQ1 connected to the 3' end; TGEV-P has ROX connected to the 5' end and BHQ2 connected to the 3' end; PDCoV-P has VIC connected to the 5' end and BHQ2 connected to the 3' end;

[0066] The sequence of the target gene amplified from PEDV-F / R is shown in SEQ ID NO.10, and the nucleotide sequence of SEQ ID NO.10 is: 5'-CACAGTTGTCAAAGATGTCTCAAAGTCTGCTAACTTGTCTTTGGATGCTGTCCAAGAGTTGGAGCTCAATGTAGTTCCAATTAGACAAGC-3' (SEQ ID NO.10);

[0067] The sequence of the target gene amplified by TGEV-F / R is shown in SEQ ID NO.11, and the nucleotide sequence of SEQ ID NO.11 is: 5'-GAGCTAGAAGCAGTTCAGCCAATTTTGGTGACAGTGACCTCGTTGCCAATGGGAGCAGTGCCAAGCATTACCCACAATTGGCTGAATGTGTTCCATCTGTG-3' (SEQ ID NO.11);

[0068] The sequence of the target gene amplified by PDCoV-F / R is shown in SEQ ID NO.12, and the nucleotide sequence of SEQ ID NO.12 is: 5'-TGAGGTTTCTATGTTGACCAATTATGAGCTTTCCTCTGTGAATGCTCGTTTGGTTTACAATCATATTGTGTATGTTGG-3' (SEQ ID NO.12).

[0069] The above primers and probes were synthesized by Shanghai Bioengineering.

[0070] 2. Synthesis of Positive Standards

[0071] After the sequences shown in SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO.12 were connected in sequence, the above sequences were cloned into the pUC57 vector by Shanghai Sangon Biotechnology Co., Ltd. and sequenced to obtain the correctly identified recombinant vector pUC57 / PEDV-TGEV-PDCoV, and its enzyme electrophoresis diagram is shown in Figure 1 pUC57 / PEDV-TGEV-PDCoV was used as a positive standard.

[0072] 3. Carry out the reaction according to the following amplification reaction system (as shown in Table 2) and reaction procedure.

[0073] Table 2

[0074] Components volume Sample nucleic acid / positive standard / negative standard 2μL Primer probe mixture 2.35μL One Step RT-qRT-PCR Mix 10μL DEPC water Make up to 20 μL

[0075] Among them, in the primer-probe mixture, the molar ratio of PEDV-F, PEDV-R and PEDV-P is 5:5:2; the molar ratio of TGEV-F, TGEV-R and TGEV-P is 6:6:5; the molar ratio of PDCoV-F, PDCoV-R and PDCoV-P is 1:1:1; the molar ratio of PEDV-P, TGEV-P and PDCoV-P is 4:5:2, the working concentrations of PEDV-F and PEDV-R are 250nM, and the working concentration of PEDV-P is 100nM; the working concentrations of TGEV-F and TGEV-R are 150nM, and the working concentration of TGEV-P is 125nM; the working concentrations of PDCoV-F and PDCoV-R are 50nM, and the working concentration of PDCoV-P is 50nM. The positive standard is pUC57 / PEDV-TGEV-PDCoV. The negative standard is physiological saline without PEDV, TGEV and PDCoV nucleic acids.

[0076] The reaction program was: 52°C for 5 min; 95°C for 10 s; 95°C for 5 s, 53°C for 30 s, for 40 cycles, and the fluorescence signal was collected at the end of each cycle of annealing.

[0077] The corresponding Ct value is read by the software of the fluorescence quantitative PCR instrument. The specific conditions and criteria are shown in Table 3 (Note: Ct value>35 is judged as suspicious. If the test is repeated, the amplification curve has a clear peak and is judged as positive, otherwise it is negative. "+" indicates that the repeated test is positive, and "-" indicates that the repeated test is negative).

[0078] Table 3

[0079]

[0080]

[0081] 4. Establishment of standard curve

[0082] The positive standard (pUC57 / PEDV-TGEV-PDCoV) was diluted 10-fold to obtain a concentration of 1.99×10 0 copies / μL~1.99×10 8 The positive standard solution was 0.05477 copies / μL. The positive standard solution was used as the test object to construct a standard curve. The specific test steps were as above. Each concentration was repeated 3 times, and the average value was taken to make a standard curve.

[0083] Correlation coefficient R of the standard curves corresponding to the three primer sets PEDV-F / R / P, TGEV-F / R / P and PDCoV-F / R / P 2 The values ​​of 1.99×10 and 1.99×10 were all greater than 0.99, and the amplification efficiency was in the range of 90% to 105%. There was a good linear relationship between the number of starting templates and the CT value. 2 copies / μL~1.99×10 8 The PCR amplification curves of the concentrations of copies / μL are all valid. 2 is 0.9905, the amplification efficiency is 99%, the standard equation is y = -3.36x + 42.86, and the detection limit is 1.99 × 10 2 copies / μL; for TGEV-F / R / P, 1.99×10 2 copies / μL~1.99×10 8 The PCR amplification curves of the concentrations of copies / μL are all valid. 2 is 0.99424, the amplification efficiency is 90%, the standard equation is y = -3.58x + 41.9, and the detection limit is 1.99 × 10 2 copies / μL; for PDCoV-F / R / P, 1.99×10 2 copies / μL~1.99×10 8 The PCR amplification curves of the concentrations of copies / μL are all valid. 2 is 0.99083, the amplification efficiency is 91%, the standard equation is y = -3.57x + 41.6, and the detection limit is 1.99 × 10 2 copies / μL. Where x refers to the logarithm of the standard concentration and y refers to the ct value. Figure 2-4 shown.

[0084] Example 2

[0085] This embodiment provides a nucleic acid combined diagnostic kit for detecting PEDV, TGEV and PDCoV in the same reaction.

[0086] The kit includes a primer-probe mixture, a One Step RT-qPCR Mix, a positive standard and a negative standard. The method of using the kit is the same as the RT-qPCR detection method for detecting PEDV, TGEV and PDCoV provided in Example 1.

[0087] The primer-probe mixture includes PEDV-F / R / P, TGEV-F / R / P and PDCoV-F / R / P, the molar ratio of PEDV-F, PEDV-R and PEDV-P is 5:5:2; the molar ratio of TGEV-F, TGEV-R and TGEV-P is 6:6:5; the molar ratio of PDCoV-F, PDCoV-R and PDCoV-P is 1:1:1; the molar ratio of PEDV-P, TGEV-P and PDCoV-P is 4:5:2. The positive standard is pUC57 / PEDV-TGEV-PDCoV. The negative standard is physiological saline without PEDV, TGEV and PDCoV nucleic acids.

[0088] Example 3

[0089] 1. Sensitivity test

[0090] The positive standard (pUC57 / PEDV-TGEV-PDCoV) was diluted 10-fold to obtain a concentration of 1.99×10 0 copies / μL~1.99×10 8 The positive standard solution was used as the detection object to detect the sensitivity of the method provided in the above Example 1.

[0091] The specific detection steps are the same as those in the above-mentioned embodiment 1.

[0092] The sensitivity is measured by the copy number. The minimum detection amount of PEDV by the above method is 1.99×10 2 copies / μL, such as Figure 4 As shown; the minimum detection amount of TGEV is 1.99×10 2 copies / μL, such as Figure 5 As shown; the minimum detection amount of PDCoV is 1.99×10 2 copies / μL, such as Figure 5-7 shown.

[0093] 2. Specificity detection

[0094] The nucleic acids of circovirus, O-type foot-and-mouth disease virus, A-type foot-and-mouth disease virus, pseudorabies virus, porcine reproductive and respiratory syndrome virus, African swine fever virus, porcine parvovirus, classical swine fever virus, PEDV, TGEV and PDCoV preserved in the laboratory and confirmed by sequencing were extracted, and the positive standard (pUC57 / PEDV-TGEV-PDCoV) was used as a positive control, and the negative standard (DEPC water) was used as a negative control. The extracted nucleic acids, positive standards and negative standards were used as detection objects to detect the specificity of the method provided in Example 1.

[0095] The specific method for extracting the viral nucleic acid is: using the Tianlong Technology Virus DNA / RNA Extraction Kit, and following the instructions. The remaining specific detection steps are the same as those in Example 1 above.

[0096] like Figure 8 and 9 As shown, except for the positive standard, PEDV, TGEV and PDCoV, the other viruses did not show effective amplification curves. The method provided in the above Example 1 has good specificity.

[0097] 3. Repeatability test

[0098] (1) Intragroup repeatability experiment

[0099] The positive standard (pUC57 / PEDV-TGEV-PDCoV) was diluted to obtain a concentration of 1.99×10 3 , 1.99×10 5 , 1.99×10 7 The positive standard solution was 1000 copies / μL, and DEPC water was used as the negative control. The positive standard solution and the negative control were used as the test objects to test the repeatability of the method provided in the above Example 1. Each concentration was repeated 3 times.

[0100] The specific detection steps are the same as those in the above-mentioned embodiment 1.

[0101] The results showed that the intra-group repeatability of the three gradients was very good, and the intra-group coefficient of variation was no more than 2.5%. 3 When the concentration was 1.99×10 5 When the concentration was 1.99×10 8When the intra-group coefficients of variation of PEDV, TGEV and PDCoV were 2.50%, 1.35% and 2.31%, respectively, as shown in Table 4.

[0102] Table 4

[0103]

[0104] (2) Intergroup repeatability experiment

[0105] The positive standard (pUC57 / PEDV-TGEV-PDCoV) was diluted to obtain a concentration of 1.99×10 3 , 1.99×10 5 , 1.99×10 7 The positive standard solution was 0.300 copies / μL, and DEPC water was used as a negative control. The positive standard solution and negative control were used as test objects to test the repeatability of the method provided in Example 1. The experiment was repeated at two other time points.

[0106] The specific detection steps are the same as those in Example 1. The intergroup reproducibility of the three gradients is very good, and the intergroup variation coefficient is less than 3.0%. 3 When the concentration was 1.99×10 5 When the concentration was 1.99×10 7 When the concentration of 100 copies / μL was 4.3447 W / m, the inter-group coefficients of variation for PEDV, TGEV, and PDCoV were 0.95%, 1.20%, and 2.94%, respectively, as shown in Table 5.

[0107]

[0108]

[0109] Therefore, the method provided in the above embodiment 1 has good repeatability.

[0110] The embodiments of the present invention are described in detail above in conjunction with the accompanying drawings, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict. Sequence Listing <110> Animal Health Institute, Guangdong Academy of Agricultural Sciences <120> A set of primer probes, kits and applications thereof for detecting PEDV, TGEV and PDCoV <160> 12 <170> SIPOSequenceListing 1.0 <210> 1 <211> 19 <212> DNA <213> Artificial Sequence <400> 1 cacagttgtc aaagatgtc 19 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <400> 2 gcttgtctaa ttggaacta 19 <210> 3 <211> 26 <212> DNA <213> Artificial Sequence <400> 3 ctgctaactt gtctttggat gctgtc 26 <210> 4 <211> 18 <212> DNA <213> Artificial Sequence <400> 4 gagctagaag cagttcag 18 <210> 5 <211> 18 <212> DNA <213> Artificial Sequence <400> 5 cacagatgga acacattc 18 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <400> 6 tgacagtgac ctcgttgcca 20 <210> 7 <211> 18 <212> DNA <213> Artificial Sequence <400> 7 tgaggtttct atgttgac 18 <210> 8 <211> twenty one <212> DNA <213> Artificial Sequence <400> 8 ccaacataca caatatgatt g 21 <210> 9 <211> twenty four <212> DNA <213> Artificial Sequence <400> 9 aaaccaaacg agcattcaca gagg 24 <210> 10 <211> 90 <212> DNA <213> Artificial Sequence <400> 10 cacagttgtc aaagatgtct caaagtctgc taacttgtct ttggatgctg tccaagagtt 60 ggagctcaat gtagttccaa ttagacaagc 90 <210> 11 <211> 101 <212> DNA <213> Artificial Sequence <400> 11 gagctagaag cagttcagcc aattttggtg acagtgacct cgttgccaat gggagcagtg 60 ccaagcatta cccacaattg gctgaatgtg ttccatctgt g 101 <210> 12 <211> 78 <212> DNA <213> Artificial Sequence <400> 12 tgaggtttct atgttgacca attatgagct ttcctctgtg aatgctcgtt tggtttacaa 60 tcatattgtg tatgttgg 78

Claims

1. A primer probe set for detecting porcine epidemic diarrhea virus (PEDV), porcine transmissible gastroenteritis virus (TGEV) and porcine deltacoronavirus (PDCoV), characterized in that: It consists of a first primer probe set, a second primer probe set and a third primer probe set; The first primer-probe set is a specific primer pair and probe for PEDV, the sequences of the specific primer pair PEDV-F / R are shown in SEQ ID NO.1 and SEQ ID NO.2, and the sequence of the probe PEDV-P is shown in SEQ ID NO.3; The second primer-probe set is a specific primer pair and probe for TGEV, the sequences of the specific primer pair TGEV-F / R are shown in SEQ ID NO.4 and SEQ ID NO.5, and the sequence of the probe TGEV-P is shown in SEQ ID NO.6; The third primer probe set is a specific primer pair and probe for PDCoV, the sequences of the specific primer pair PDCoV-F / R are shown in SEQ ID NO.7 and SEQ ID NO.8, and the sequence of the probe PDCoV-P is shown in SEQ ID NO.

9.

2. The primer probe set according to claim 1, characterized in that: The 5' ends of the PEDV-P, the TGEV-P, and the PDCoV-P are respectively connected with different fluorescent groups; The 3' ends of the PEDV-P, the TGEV-P and the PDCoV-P are respectively connected with quenching groups.

3. A kit for detecting PEDV, TGEV and PDCoV, characterized in that: Comprising the primer probe set according to claim 1 or 2.

4. The kit according to claim 3, characterized in that In the primer probe set, the molar ratio of the working concentrations of PEDV-F, PEDV-R and PEDV-P is 5: 4-6: 1-3; the molar ratio of the working concentrations of TGEV-F, TGEV-R and TGEV-P is 6: 5-7: 4-6; the molar ratio of the working concentrations of PDCoV-F, PDCoV-R and PDCoV-P is 1: 0.5-1.5: 0.5-1.5; the molar ratio of the working concentrations of PEDV-P, TGEV-P and PDCoV-P is 4: 4-6: 1-3.

5. The kit according to claim 4, characterized in that The working concentration of PEDV-P was 100 nM.

6. The kit according to claim 3 or 4, characterized in that The kit also includes a positive standard and a negative standard.

7. The kit according to claim 6, characterized in that The method of using the kit is as follows: (1) Extracting nucleic acid from samples; (2) Using the kit described in claim 6 to perform PCR detection on the nucleic acid, and analyzing the results after the reaction is completed.

8. The kit according to claim 7, characterized in that In (2), the PCR reaction procedure is: 52°C for 5 min; 95°C for 10 s; 95°C for 5 s, 50°C-56°C for 30 s, for 35-45 cycles.

9. The kit according to claim 7, characterized in that The sample includes at least one of intestinal tissue, intestinal contents and feces of a pig.

10. Use of the primer probe set according to claim 1 or 2 in preparing a reagent for detecting PEDV, TGEV and PDCoV.

Images