A bispecific aptamer-triggered 3D-DNA nanomotor sensor and its application in lysozyme detection

Abstract

The application discloses a bispecific aptamer triggered 3D-DNA nanomotor sensor and application thereof in lysozyme detection, and belongs to the technical field of lysozyme detection. A novel DNA-walker-based biosensor is developed, the high synergy of DNA-walking and DNA-rolling improves the walking speed and persistence of the walking chain, and finally promotes the rapid accumulation of signals. The method can be applied to lysozyme detection, and can effectively improve the stability of the sensor without relying on the specific enzyme cutting action of traditional proteases, thereby avoiding the influence of environmental factor fluctuation on the performance of the sensor. The method can realize high-sensitivity detection of lysozyme, and the detection limit can reach 0.01 pg / mL.

Description

TECHNICAL FIELD

[0001] The application relates to a bispecific aptamer triggered 3D-DNA nanomotor sensor and application thereof in lysozyme detection, and belongs to the technical field of lysozyme detection. BACKGROUND

[0002] Lysozyme, also known as muramidase or N-acetylmuramidase, is a small protein composed of 129 amino acids, which is widely present in various organisms and plays an important role. Since the concentration of lysozyme in human body fluids, tissues and the like will increase and exceed the threshold under certain pathological conditions, it is widely used as a biomarker molecule for various diseases, such as leukemia, AIDS, tuberculosis, rheumatoid arthritis and Crohn's disease, and monitoring its concentration under pathological conditions is of great importance. In addition, lysozyme is also widely used as a food additive in the food industry, such as as a preservative in food storage, as a stabilizer and fermentation terminator in the wine industry, and the like. Unfortunately, even if its content in food is trace, lysozyme can still trigger adverse reactions of the immune system in sensitive individuals. Therefore, the analysis and determination of food allergen lysozyme in food is particularly important. Traditional lysozyme analysis methods mainly include chromatographic analysis methods and immunoassay methods (ELISA), but the sample pretreatment is complex, expensive instruments and equipment and specialized technical personnel are required, and the stability is poor. In recent years, new types of biosensors based on nanomaterials and aptamers have shown good application potential in the field of lysozyme analysis and detection, but low sensitivity and poor specificity are still the main problems faced. Therefore, it is urgent to develop a sensitive, specific, rapid and economical strategy to monitor the concentration of lysozyme.

[0003] DNA, due to its highly programmable, predictable, and easily modified structure, has been successfully used for bottom-up assembly of static nanostructures and dynamic nanodevices at the nanoscale. As a dynamic nanomolecular device, DNA walkers have shown great application potential in the field of biosensing due to their excellent mechanical properties and sustainable self-driving capabilities. Based on the type of walking track, currently constructed DNA walkers can be divided into one-dimensional (1D), two-dimensional (2D), and three-dimensional (3D) DNA walkers. Among them, 3D DNA walkers move on three-dimensional particles, have a larger surface area to volume ratio, significantly increase the concentration of DNA tracks at predetermined locations, and thus produce excellent signal amplification performance. However, most DNA walkers operate by moving the walking strand one by one along the track. During this process, the walking strand may derail from the track and pause its movement before reconnecting to a new track. This significantly slows down the reaction speed and reduces the sensitivity of 3D walkers in the field of biosensing. Currently, DNA walker-based biosensors are mostly used for analyzing nucleic acid targets and largely rely on the specific enzymatic cleavage of proteases to drive their operation, thus severely limiting their applicability and stability. Summary of the Invention

[0004] To address the aforementioned research background, this invention develops a novel DNA-walker-based biosensor and further provides a bispecific aptamer-triggered 3D-DNA nanomotor sensor and its application in lysozyme detection. The high synergy between DNA-walking and DNA-rolling enhances the walking speed and persistence of the walking chain, ultimately promoting rapid signal accumulation. The method of this invention enables rapid detection of lysozyme with high specificity and sensitivity, solving the problems of low reaction rate and poor signal accumulation capability in traditional DNA-walker-based sensors.

[0005] This invention provides a bispecific aptamer-triggered 3D-DNA nanomotor sensor. The sensor utilizes the highly specific response of a bispecific aptamer to lysozyme to trigger the operation of a 3D-DNA nanomotor, ultimately achieving specific quantitative detection of lysozyme. The 3D-DNA nanomotor sensor comprises three stages: bispecific aptamer recognition, DNA walking, and DNA rolling. The bispecific aptamer contains two aptamers capable of binding to different epitopes of lysozyme. When lysozyme is present in the system, the binding of the aptamer to lysozyme leads to the release of the Y-type walking chain (Y-WS), thereby triggering the DNA walking step. The Y-WS contains the core catalytic region of the E6-DNAzyme. 2+With the assistance of Y-WS, the AuNPs@Th will walk and cut Th to form AuNPs@toehold, and thus trigger the subsequent DNA rolling step. In the case of containing a burning chain (F) in the system, the AuNPs@toehold will roll on the AuNPs@Tt in the principle of similar "gear" operation, and finally release the fluorescently labeled signal chain (T-F). Due to the multi-toe interaction between AuNPs@toehold and AuNPs@Tt, the reaction rate caused by the derailment of a single walking chain is reduced. The AuNPs@toehold is an intermediate product formed by the Y-type walking chain (Y-WS) cutting the rA site in the Th under the drive of the E6-DNAzyme; the DNA rolling step is that the AuNPs@toehold steps on the surface of the AuNPs@Tt through multi-toe interaction in the context of entropy-driven cyclic reaction, and constantly releases the signal chain T-F in the Tt under the support of the external power of the burning chain (F).

[0006] The application provides a lysozyme detection system, which is composed of a bispecific aptamer, nano gold particles AuNPs@Th, nano particles AuNPs@Tt and a F chain; the bispecific aptamer is Y-shaped, and is composed of a Y-a chain, a Y-b chain and two lysozyme aptamers.

[0007] In an embodiment, the AuNPs@Th is a track hairpin Th connected by nano gold particles through an Au-S bond, the hairpin loop size of the Th is 32 nt, which is beneficial to the output of the final signal in the walking step, and the sequence is shown as SEQ ID NO. 1 (5'-3'):

[0008] SH-[T] 31 -CGACCTGTCTATATCAAGCTTTrAGGACAGATTTTTTTTTCAGGTCG.

[0009] In an embodiment, the nano gold particles AuNPs@Tt are a track triplex made of probes T, T-C and T-F connected by an Au-S bond; the sequences of the probes T, T-C and T-F are shown as SEQ ID NO. 2-4, respectively.

[0010] The nano gold particles AuNPs@Tt are a track triplex (Tt) for rolling, which is obtained by mixing T, T-C and T-F in a buffer, and keeping at 95 DEG C for 10 min, and then cooling the solution to 37 DEG C for 3 h.

[0011] In an embodiment,

[0012] Nucleotide sequence of the thiol-labeled probe T (5'-3'):

[0013] SH-[T] 20 -CTTCGCATCGCTGAGGGAAAAGCTTGATATAGACAGGTCGAA;

[0014] Nucleotide sequence of the probe T-C (5'-3'): CTGTCTATATCAAGCTTTTCCC;

[0015] Nucleotide sequence of the probe T-F (5'-3'): FAM-TCAGCGATGCGAAGACTCGTTCCTTA.

[0016] In an embodiment, the sequences of the Y-a chain and the Y-b chain are shown in SEQ ID NO. 5, respectively; the sequences of the two lysozyme aptamers are shown in SEQ ID NO. 7 and SEQ ID NO. 8, respectively.

[0017] The present application provides a method for detecting lysozyme, which is to detect the content of lysozyme by using the lysozyme detection kit, and the specific method is as follows:

[0018] (1) Mix 5-10 μL of 1-5 μM of the bispecific aptamer with the same volume of the sample to be tested, and incubate at 35-40 °C for 1-3 h; preferably, mix 10 μL of 1 μM of the bispecific aptamer with the same volume of the sample to be tested;

[0019] (2) Add the solution after incubation in step (1) to a mixed solution containing AuNPs@Th, AuNPs@Tt, 300 nM F chain, and incubate at 35-40 °C for 0.5-1 h;

[0020] (3) Detect the fluorescence intensity of the solution after incubation in step (2) by using an enzyme marker, and analyze the detection results.

[0021] In an embodiment, the sample to be tested contains a solid or a liquid. If the sample to be tested is a solid, it is first prepared into a solution and filtered through a 0.2-0.3 μm filter membrane to obtain the filtrate, preferably a 0.22 μm filter membrane is used.

[0022] In an embodiment, the solution after incubation in step (1) is added to a mixed solution containing 300 pM AuNPs@Th, 1.5 nM AuNPs@Tt, 20 mM MgCl2, 500 mM NaCl, 0.05% (v / v) Tween-20, 300 nM F chain, and incubated at 35-40 °C for 0.5-1 h; the volume of the mixed solution is 120-150 μL.

[0023] Preferably, the solution after incubation in step (1) is added into a mixed solution containing 200-400 pM AuNPs@Th, 1-1.5 nM AuNPs@Tt, 10-20 mM MgCl2, 400-600 mM NaCl, 0.01%-0.05% (v / v) Tween-20, 100-500 nM F strand; the volume of the mixed solution is 120-150 μL.

[0024] In an embodiment, the step (1) is incubated at 37℃ for 2 h.

[0025] In an embodiment, the step (2) is incubated at 37℃ for 1 h.

[0026] In an embodiment, the concentration of the F strand is 300 nM.

[0027] In an embodiment, the parameters of the microplate reader are excitation wavelength of 480 nm and emission wavelength of 510-700 nm.

[0028] In an embodiment, the quantitative relationship between the fluorescence intensity signal and the concentration of lysozyme is: ΔF = 6496.9 lgC + 9723.3; Lys

[0029] The ΔF is the fluorescence intensity; the C Lys is the concentration of lysozyme.

[0030] The present application provides a kit containing the lysozyme detection system.

[0031] In an embodiment, the kit further contains 10-20 mM MgCl2, 400-600 mM NaCl, 0.01%-0.05% (v / v) Tween-20.

[0032] The present application has the following beneficial effects:

[0033] (1) The present application first provides a 3D-DNA nanomotor sensor triggered by a dual-specific aptamer, which ingeniously designs a Y-shaped dual-specific aptamer recognition element, thereby improving the structural stability of the aptamer, and the dual-specific aptamer simultaneously recognizes and binds to the epitope to trigger subsequent amplification, thereby greatly improving the specificity of the recognition element.

[0034] ​(2) Compared with the traditional DNA-walker-based nanomotor sensor, the DNA walking strategy and the DNA rolling strategy are highly synergized in the application, the multi-toe walking strategy in the rolling strategy greatly improves the reaction rate and signal accumulation ability, and the sensitivity of the sensor is effectively improved. High-sensitivity detection of lysozyme can be realized, and the detection limit can reach 0.01 pg / mL.

[0035] (3) The intrinsic driving force of the 3D-DNA nanomotor sensor in the application is DNAzyme and entropy-driven cyclic reaction, which does not depend on the specific enzyme cutting action of the traditional proteinase, and effectively improves the stability of the sensor. The influence of environmental factors on the performance of the sensor is avoided. BRIEF DESCRIPTION OF DRAWINGS

[0036] Figure 1 The principle diagram of the 3D-DNA nanomotor sensor triggered by the bispecific aptamer for detecting lysozyme in the application;

[0037] Figure 2 The transmission electron microscope image and the dynamic light scattering particle size diagram of the 15nm gold nanoparticles;

[0038] Figure 3 The dynamic light scattering particle size diagram of the DNA functionalized gold nanoparticles AuNPs@Th(A) and AuNPs@Tt(A) and the ultraviolet-visible light absorption spectrum (C) of the DNA functionalized gold nanoparticles;

[0039] Figure 4 The polyacrylamide gel electrophoresis characterization diagram of the Y-shaped bispecific aptamer construction;

[0040] Figure 5 The polyacrylamide gel electrophoresis characterization diagram of the 3D-DNA nanomotor sensor running feasible verification;

[0041] Figure 6 The fluorescence spectrum diagram of the 3D-DNA nanomotor sensor running feasible verification;

[0042] Figure 7 The fluorescence spectrum diagram of the 3D-DNA nanomotor sensor in response to different lysozyme concentrations and the fitted linear correlation coefficient;

[0043] Figure 8 The specificity analysis and stability characterization diagram of the 3D-DNA nanomotor sensor;

[0044] Figure 9 The optimization diagram of the length of the hairpin loop in the middle of Th hairpin loop and the length of the Th terminal interval;

[0045] Figure 10Optimized plot for detecting the concentration of F-strand during the process of lysozyme;

[0046] Figure 11 Principle schematic diagram for two different modes;

[0047] Figure 12 Fluorescence intensity-time curve for different modes. DETAILED DESCRIPTION

[0048] Example 1: Preparation of gold nanoparticles with a diameter of 15 nm

[0049] First, 1 mL of 1% chloroauric acid aqueous solution was added to a three-necked round-bottom flask containing 98 mL of ultrapure water, stirred vigorously and heated to boiling in an oil bath. Then 1 mL of 5% trisodium citrate aqueous solution was quickly added, and after 30 min of reaction, the solution color gradually changed from light yellow to deep wine red. Finally, the round-bottom flask was transferred to room temperature, and the prepared AuNPs solution was cooled to room temperature under stirring, and stored at 4°C in the dark for standby.

[0050] The morphology and size of gold nanoparticles were determined by transmission electron microscopy (TEM) and dynamic light scattering, as shown in FIGS. 1A and 1B. The prepared gold nanoparticles were uniform in size and the average particle size was 15 nm. Figure 2

[0051] Example 2: Preparation of two DNA-functionalized gold nanoparticles

[0052] 3D-DNA nanomotor sensor mainly contains two kinds of DNA functionalized gold nanoparticles.

[0053] (1) Preparation of DNA functionalized gold nanoparticles (AuNPs@Th) used in the walking process: Before functionalization, 100 μL of 4 μM track hairpin (Th) was mixed with 10 μL of 20 mM TCEP at 25°C for 2 h to cleave the disulfide bond to obtain Th solution. Then, the Th solution was heated at 95°C for 10 min and then slowly cooled on ice to obtain a stable hairpin structure. Next, 500 μL of AuNPs prepared in Example 1 (1.79 nM) was added and shaken, and then PBS buffer (10x) was added dropwise to the above solution until the concentration of 0.05 M NaCl was reached. Then, the concentration of NaCl was increased to 0.5 M using 2 M NaCl with 0.1 M NaCl increments, with an interval of 8 hours, while maintaining the concentration of Tween-20 at 0.05% during the "aging" process. Finally, the excess Th was removed by centrifugation at 11000 rpm for 20 min to obtain AuNPs@Th. AuNPs@Th was resuspended in Tris-HCl buffer (10 mM, pH 8.3) and stored at 4°C for further use.

[0054] ​Th nucleotide sequence (5'-3'):

[0055] SH-[T] 31 -CGACCTG TCTATATCAAGCTTTrAGGACAGATTTTTTTTT CAGGTCG (SEQ ID NO. 1, the underlined part is the hairpin loop structure).

[0056] (2) Preparation of DNA functionalized gold nanoparticles (AuNPs@Tt) used in rolling process: first, mix T, T-C and T-F strands in buffer and heat to 95℃ for 10 minutes. Then slowly cool the solution to 37℃ for 3 hours to construct the track triplex (Tt) for rolling. The subsequent functionalization process is the same as AuNPs@Th. The two DNA functionalized gold nanoparticles were characterized by UV-Vis spectrum as shown in Figure 3 C, the functionalized gold nanoparticles all showed the characteristic peak of nucleic acid at 260 nm, and DLS data showed that the particle size of the functionalized gold nanoparticles was larger than that of the gold nanoparticles before functionalization (as shown in Figure 3 A and 3B), the particle size of the functionalized gold nanoparticles was larger than that of the gold nanoparticles before functionalization, which fully proved the successful preparation of functionalized gold nanoparticles (AuNPs@Th) and functionalized gold nanoparticles (AuNPs@Tt).

[0057] ① Nucleotide sequence of probe T (5'-3', SEQ ID NO. 2):

[0058] SH-[T] 20 -CTTCGCATCGCTGAGGGAAAAGCTTGATATAGACAGGTCGAA,

[0059] ② Nucleotide sequence of probe T-C (5'-3', SEQ ID NO. 3):

[0060] CTGTCTATATCAAGCTTTTCCC,

[0061] ③ Nucleotide sequence of carboxyfluorescein-labeled probe T-F (5'-3', SEQ ID NO. 4):

[0062] FAM-TCAGCGATGCGAAGACTCGTTCCTTA.

[0063] Example 3: Construction of Y-shaped bispecific aptamer

[0064] First, equal volume of Y-a strand, Y-b strand and two aptamers (Ly-1 and Ly-2) with different binding sites for lysozyme were mixed. The mixture was heated to 95℃ for 5 minutes, and then slowly cooled to 37℃ for 1-3 hours to construct 2 μM Y-type bispecific aptamer. Verified by non-denaturing polyacrylamide gel electrophoresis (PAGE), as shown in lane 8, a new band with slower mobility appeared, indicating the successful construction of Y-type bispecific aptamer. Figure 4

[0065] Nucleotide sequence of Y-a (5'-3', SEQ ID NO. 5):

[0066] ACGACAGAGGTCAGATGCCTATGCGTGCTACCGTGAACGGCACCCATGTAAGCTTCGTCCTGTCTG;

[0067] Nucleotide sequence of Y-b (5'-3', SEQ ID NO. 6):

[0068] TGCCATCAAACCTCTGTCAGCGATCCGTTCACGGTAGCACGCATAGGCATCTGACCTCTGTCGT.

[0069] Nucleotide sequence of Ly-1 (5'-3', SEQ ID NO. 7):

[0070] GGGAATGGATCCACATCTACGAATTCATCAGGGCTAAAGAGTGCAGAGTTACTTAGTTCACTGCAGACTTGACGAAGCTT;

[0071] Nucleotide sequence of Ly-2 (5'-3', SEQ ID NO. 8):

[0072] AGCAGCACAGAGGTCAGATGGCAGCTAAGCAGGCGGCTCACAAAACCATTCGCATGCGGCCCTATGCGTGCTACCGTGAA.

[0073] Example 4: Running steps and feasibility characterization of 3D-DNA nanomotor sensor for detecting lysozyme

[0074] ​The experimental operation of a typical 3D-DNA nanomotor sensor is as follows: first, 10 μL of 1 μM Y-type bispecific aptamer is mixed with an equal volume of different concentrations of lysozyme in buffer to obtain a mixed solution containing lysozyme, and incubated at 37°C for 2 hours. Subsequently, the above mixed solution containing lysozyme is added to 130 μL of mixed solution containing 300 pM AuNPs@Th, 1.5 nM AuNPs@Tt, 20 mM MgCl2, 500 mM NaCl, 0.05% (v / v) Tween-20. The mixed solution is incubated at 37°C for 1 hour.

[0075] Non-denaturing polyacrylamide gel electrophoresis (PAGE) is used to verify the formation of reaction products in the sensor process after the reaction. The specific process and results are as follows: the concentration of each DNA sample is set to 400 nM, 2 μL of the sample to be analyzed is mixed with 2 μL of 6x loading buffer. Next, the mixture is added dropwise to the loading well of a 12% polyacrylamide gel. Subsequently, electrophoresis analysis is carried out in 1x TBE buffer at a constant voltage of 4°C and 120V for 60 minutes. The gel is then stained with Gel Red for 5 minutes, and the gel image is captured by a gel imager, as shown in Figure 5 When lysozyme is introduced into the system, the Th is cut by the E6-DNAzyme embedded in the Y-type walking strand to form a toehold DNA (lane 8, band a), and finally the Tt band disappears (lane 10), generating a new T / F complex (band b). This indicates that the 3D-DNA nanomotor can function normally according to the expected design principle.

[0076] To further verify the feasibility of the proposed nanomotor biosensor, the running progress of the nanomotor biosensor under different conditions was studied by fluorescence spectroscopy. As shown in Figure 6 After introducing lysozyme into the system, a significantly enhanced fluorescence signal was obtained. This indicates that the binding of the aptamer to the target triggers the normal operation of the nanomotor biosensor, and finally releases many fluorophore-labeled chains into the solution.

[0077] Example 5: Performance characterization of 3D-DNA nanomotor sensor for detecting lysozyme

[0078] The 3D-DNA nanomotor sensor was used to detect different concentrations of lysozyme (concentrations of 0, 0.05 pg / mL, 0.5 pg / mL, 5 pg / mL, 50 pg / mL, 500 pg / mL, 5 ng / mL, 50 ng / mL, 500 ng / mL).

[0079] The 10 μL of 1 μM Y-type bispecific aptamer was mixed with an equal volume of different concentrations of lysozyme in buffer to obtain a mixed solution containing lysozyme, and incubated at 37°C for 2 hours. Subsequently, the mixed solution containing lysozyme was added to 130 μL of mixed solution containing 300 pM AuNPs@Th, 1.5 nM AuNPs@Tt, 20 mM MgCl2, 500 mM NaCl, 0.05% (v / v) Tween-20, 300 nM F chain. The mixed solution was incubated at 37°C for 1 hour. After incubation, the fluorescence intensity in the solution was determined by SynergyH1 multi-mode enzyme marker in a 96-well transparent bottom black polystyrene microplate. In order to determine the real-time fluorescence curve of the nanomotor biosensor, the above mixed solution was directly incubated at 37°C on the Synergy H1 multi-mode enzyme marker, and the real-time fluorescence value was read every 5 minutes until the end of the reaction.

[0080] The results are shown in Figure 7 Figure 7 As shown in A, the fluorescence signal response gradually increased as the target concentration increased from 0.05 pg / mL to 500 ng / mL, and showed a good linear relationship with the logarithm of the lysozyme concentration Figure 7 B). The regression equation was ΔF = 6496.9 lgC Lys +9723.3, and the correlation coefficient value R 2 was 0.995, where F was the fluorescence signal intensity and C was the lysozyme concentration. According to the 3 times signal-to-noise ratio principle (LOD = 3δ / κ, where δ is the standard deviation of the blank parallel determination, and κ is the slope of the calibration curve), the detection limit (LOD) was 0.01 pg / mL. The relative standard deviation of 5 ng / mL lysozyme was 3.8% in 11 repeated determinations.

[0081] Example 6: Specificity and stability characterization of 3D-DNA nanomotor sensor for detecting lysozyme

[0082] The specificity of the developed 3D-DNA nanomotor sensor was studied by analyzing the cross-reactivity of different interfering proteins in PBS buffer.

[0083] As shown in Figure 8 A, β-Lg, Cas, α-La, Ig-G, BSA, OVA showed no cross-reactivity with Lys, and the concentration of lysozyme was 5 ng / mL, and the concentration of the remaining interfering proteins was 25 ng / mL, even though the concentration of the interfering proteins in the detection system was 5 times the concentration of the interfering proteins in the detection system. These results confirm that the method proposed in the present application has high specificity for the determination of Lys in a variety of cases.

[0084] Example 7: Actual sample with standard addition recovery

[0085] ​In order to evaluate the practical application performance of the 3D-DNA nanomotor sensor in a complex environment, the method proposed in the application is used to analyze the spiked actual samples (milk, juice and infant amino acid formula powder) containing different concentrations of lysozyme.

[0086] Milk sample pretreatment: first, 2 g of milk is defatted, then filtered through a 0.22 μm filter membrane, and diluted with ultrapure water to 5 mL for further use.

[0087] Juice sample pretreatment: 2 g of juice is directly filtered through a 0.22 μm filter membrane, and diluted with ultrapure water to 5 mL for standby use.

[0088] Solid sample pretreatment: 2 g of infant amino acid formula powder is first dissolved in 5 mL of ultrapure water, and then treated in the same way as the milk sample.

[0089] The results are shown in Table 1, the spiked recovery rate of lysozyme is in the range of 98.0% to 103.5%, and the relative standard deviation (RSD) is 1.4% to 4.5%. This result shows that the 3D-DNA nanomotor sensor constructed in the application can effectively resist the interference of complex matrix in the actual sample, and has good practical analysis potential.

[0090] Table 1. Spiked recovery performance of 3D-DNA nanomotor sensor in actual samples

[0091]

[0092] ND a : not detected.

[0093] Comparative Example 1

[0094] According to the preparation method of DNA functionalized gold nanoparticles (AuNPs@Th) in Example 2, the difference is that the length of the hairpin loop in the middle of Th is replaced by 22 nt and 42 nt, different AuNPs@Th are prepared, and they are applied to lysozyme detection according to the method of Example 5, and the results are shown in Figure 9 A, the results show that when the size of the hairpin loop is 22 nt and 42 nt, the fluorescence intensity is not as strong as that when it is 32 nt.

[0095] Comparative Example 2

[0096] According to the preparation method of DNA functionalized gold nanoparticles (AuNPs@Th) in Example 2, the difference is that the length of the interval at the end of Th is replaced by 11 nt, 21 nt and 41 nt, different AuNPs@Th are prepared, and they are applied to lysozyme detection according to the method of Example 5, and the results are shown in Figure 9As shown in Figure B, the fluorescence intensity is lower when the end-space length is 11nt, 21nt, and 41nt than when the end-space length is 31nt.

[0097] Comparative Example 3

[0098] For a detailed implementation method, please refer to Example 5, except that the concentration of the F chain is replaced with 100 nM, 200 nM, 400 nM, or 500 nM. Figure 10 As shown, when the concentration of F chain in the system is 100 nM, 200 nM, 400 nM, and 500 nM, the signal-to-noise ratio of the DNA nanomotor sensor is not as high as that under the condition of 300 nM.

[0099] Comparative Example 4

[0100] The operation steps are the same as in Example 4, except that the rolling step reaction element is not added. Figure 11 Slow (traditional walker mode alone) was used to determine the fluorescence growth kinetics curve in this mode, and the results are as follows: Figure 12 As shown, the traditional standalone walker mode signal generation speed is slower and the signal accumulation capability is weaker than that of the DNA-rolling highly synergistic DNA nanomotor sensor of this invention.

[0101] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims. SEQUENCE LISTING <110> Jiangnan University <120> A bispecific aptamer-triggered 3D-DNA nanomotor sensor and its application in lysozyme detection use <130> BAA220480A <160> 8 <170> PatentIn version 3.3 <210> 1 <211> 77 <212> DNA <213> Artificial sequence <400> 1 tttttttttt tttttttttt tttttttttt cgacctgtct atatcaagct ttraggacag 60 attttttttt caggtcg 77 <210> 2 <211> 62 <212> DNA <213> Artificial sequence <400> 2 tttttttttt tttttttttt cttcgcatcg ctgagggaaa agcttgatat agacaggtcg 60 aa 62 <210> 3 <211> twenty two <212> DNA <213> Artificial sequence <400> 3 ctgtctatat caagcttttc cc 22 <210> 4 <211> 26 <212> DNA <213> Artificial sequence <400> 4 tcagcgatgc gaagactcgt tcctta 26 <210> 5 <211> 66 <212> DNA <213> Artificial sequence <400> 5 acgacagagg tcagatgcct atgcgtgcta ccgtgaacgg cacccatgta agcttcgtcc 60 tgtctg 66 <210> 6 <211> 64 <212> DNA <213> Artificial sequence <400> 6 tgccatcaaa cctctgtcag cgatccgttc acggtagcac gcataggcat ctgacctctg 60 tcgt 64 <210> 7 <211> 80 <212> DNA <213> Artificial Sequence <400> 7 gggaatggat ccacatctac gaattcatca gggctaaaga gtgcagagtt acttagttca 60 ctgcagactt gacgaagctt 80 <210> 8 <211> 80 <212> DNA <213> Artificial Sequence <400> 8 agcagcacag aggtcagatg gcagctaagc aggcggctca caaaaccatt cgcatgcggc 60 cctatgcgtg ctaccgtgaa 80

Claims

1. A lysozyme detection system characterized by, The lysozyme detection system is composed of a bispecific aptamer, nano gold particles AuNPs@Th, nano gold particles AuNPs@Tt and F chain; the bispecific aptamer is Y-shaped, composed of Y-a chain, Y-b chain and two lysozyme aptamers; the AuNPs@Th is an orbital hairpin Th connected by nano gold particles through Au-S bond, the sequence of Th is shown as SEQ ID NO. 1; the nano gold particles AuNPs@Tt is an orbital triplex made of probes T, T-C and T-F connected by Au-S bond; the sequences of probes T, T-C and T-F are shown as SEQ ID NO. 2-4 respectively; the sequences of Y-a chain and Y-b chain are shown as SEQ ID NO. 5 and SEQ ID NO. 6 respectively; the sequences of the two lysozyme aptamers are shown as SEQ ID NO. 7 and SEQ ID NO. 8 respectively; the F chain is a combustion chain.

2. A method of detecting lysozyme, characterized by, The lysozyme detection system of claim 1 is used to detect the content of lysozyme, and the specific method is as follows: (1) 5-10 μL of 1-5 μM bispecific aptamer is mixed with the sample to be tested in equal volume ratio, and incubated at 35-40 ℃ for 1-3 h; (2) the solution after incubation in step (1) is added to a mixed solution containing AuNPs@Th, AuNPs@Tt, 100-500 nM F chain, and incubated at 35-40 ℃ for 0.5-1 h; (3) the fluorescence intensity of the solution after incubation in step (2) is detected by an enzyme-labeled instrument, and the detection result is analyzed; The method is not for the purpose of diagnosing diseases.

3. The method of claim 2, wherein, The sample to be tested contains solids or liquids, if the sample to be tested is solid, it is first prepared into a solution and filtered through a 0.2-0.3 μm filter membrane to obtain the filtrate.

4. The method of claim 3, wherein, The solution after incubation in step (1) is added to a mixed solution containing 300 pM AuNPs@Th, 1.5 nM AuNPs@Tt, 20 mM MgCl2, 500 mM NaCl, 0.05% v / v Tween-20, 300 nM F chain, and incubated at 35-40 ℃ for 0.5-1 h; the volume of the mixed solution is 120-150 μL.

5. The method of claim 4, wherein, The step (1) is incubated at 37 ℃ for 2 h; the step (2) is incubated at 37 ℃ for 1 h.

6. The method according to any one of claims 2 to 5, characterized in that, The quantitative relationship between the fluorescence intensity signal and the lysozyme concentration is: ΔF = 6496.9 lgC Lys + 9723.3; The AF is the fluorescence intensity; the C Lys is the concentration of lysozyme.

7. A kit containing the lysozyme detection system of claim 1.

Images