A qRBSDV6R resistance gene and its application

Abstract

Disclosure of the Invention qRBSDV6 R Resistance genes, qRBSDV6 R The resistance gene sequence is as shown in SEQ ID NO.1 or SEQ ID NO.2 or a sequence having 80-90% or more homology with the sequence shown in SEQ ID NO.1 or SEQ ID NO.2. qRBSDV6 R Methods for obtaining resistance genes and their applications. qRBSDV6 S To verify the function of transgenic plants, qRBSDV6 S and overexpression in disease-resistant varieties qRBSDV6 S ,show qRBSDV6 S and qRBSDV6 R Controlled resistance to RBSDV and SRBSDV, demonstrating qRBSDV6 R As a resistance gene, experimental studies have found qRBSDV6 R Resistance genes can regulate rice to acquire resistance to rice black-streaked dwarf virus and southern rice black-streaked dwarf virus.

Description

Technical Field

[0001] The present invention belongs to the field of plant molecular biology and plant genetic engineering, and specifically relates to a qRBSDV6 R Resistance genes and their applications. Background Art

[0002] Rice (Oryza sativa L.) is one of the most important food crops in the world and also one of the most important cultivated crops in my country. However, it suffers from serious diseases and pests every year, causing huge losses to agricultural production.

[0003] Rice black-streaked dwarf virus (RBSDV) and southern rice black-streaked dwarf virus (SRBSDV) are both Fiji viruses (Reoviridae), transmitted by the small brown planthopper (SBPH) and white planthopper (WPH), respectively, which can seriously hinder the development of rice and significantly reduce its fruiting rate. In severe cases, the two viruses can even cause rice fields to fail to produce grains, which has become a long-standing problem in rice production.

[0004] Inhibiting virus transmission through pesticides is currently the main control strategy, but it is harmful to the environment and costly. The development of virus-resistant varieties is the most economical and environmentally friendly strategy to control viral diseases. However, so far, only a few varieties, such as Tetep, Teqing, koshihakari, etc., have shown moderate resistance to RBSDV, but this is mainly determined through field identification, which cannot distinguish between virus resistance and vector resistance. There are only a small number of moderately resistant materials, but the stability and type of their resistance (antiviral or anti-vector) need further confirmation. Due to the lack of high and stable resistance germplasm resources, there has been little breakthrough in resistance breeding against RBSDV.

[0005] Resistance to RBSDV and SRBSDV is a complex trait controlled by multiple genes. Genetic analysis of rice disease resistance genes has been rare, and these genes have not been cloned and identified. He et al. found that the brassinosteroid pathway mediates plant sensitivity to RBSDV infection, while the jasmonic acid pathway plays an active role in rice, which is mediated by OsGSK2, a conserved GSK3-like kinase that plays a key inhibitory role in BR signaling. DCL4, DCL2, and other proteins produce endogenous siRNAs that are dependent on RDR1 and show resistance to RBSDV. Advances in the study of the mechanism of virus-host interaction will help to elucidate the mechanism of rice resistance to RBSDV, and efficient and accurate molecular breeding can only be carried out after fully understanding its molecular genetic basis. However, compared with other important rice diseases such as rice blast and bacterial blight, this information is extremely scarce. Due to the insufficient understanding of the functional genes and molecular mechanisms of RBSDV resistance, it is currently impossible to propose an effective molecular regulation strategy.

[0006] It can be seen that screening and identifying highly resistant resources from a wide range of rice germplasm resources and discovering and accurately identifying disease-resistant genes are the key to achieving breakthrough progress in rice breeding and basic research. Summary of the invention

[0007] Purpose of the invention: The technical problem to be solved by the present invention is to provide a qRBSDV6 R Resistance genes.

[0008] The technical problem that the present invention also solves is to provide the qRBSDV6 R Methods for obtaining resistance genes.

[0009] The technical problem to be solved by the present invention is to provide an expression cassette, a recombinant vector or a cell containing the qRBSDV6 R Resistance genes.

[0010] The technical problem that the present invention also solves is to provide the qRBSDV6 R Application of the resistance gene, the protein or fragment, the expression box, the recombinant vector or the cell in regulating or breeding rice resistant to rice black-streaked dwarf disease and / or southern rice black-streaked dwarf disease.

[0011] Technical solution: In order to solve the above technical problems, the present invention provides a qRBSDV6 R Resistance gene, the qRBSDV6 R The resistance gene sequence is shown in SEQ ID NO.1 or SEQ ID NO.2 or a sequence having 80-90% or more homology with the sequence shown in SEQ ID NO.1 or SEQ ID NO.2.

[0012] The present invention also includes the qRBSDV6 R Method for obtaining resistance gene, the qRBSDV6 R A method for obtaining a resistance gene, the method comprising the following steps:

[0013] 1) Obtain W44-resistant plants through resistance experiment screening;

[0014] 2) Genome-wide association analysis and transcriptome analysis showed that qRBSDV6 R It is a candidate resistance gene, and its allele is qRBSDV6 S Disease susceptibility candidate genes;

[0015] 3) The susceptibility gene qRBSDV6 S Transgenic function verification was performed to obtain qRBSDV6 S and qRBSDV6 R This pair of alleles controls resistance to RBSDV and / or SRBSDV, wherein the qRBSDV6 R is a resistance gene;

[0016] 4) qRBSDV6 in W44 was analyzed by resequencing R The genomic structure of the region and design primers;

[0017] 5) qRBSDV6 R The candidate gene was amplified and expressed in Escherichia coli to screen positive clones, which were then further sequenced to obtain the qRBSDV6 R Resistance genes.

[0018] Wherein, the primer in step 3) is qRBSDV6 R -R(gDNA)-F: ATGGCTTAATGCTACCTGACCTCTG and qRBSDV6 R -R(gDNA)-R:TCAGCAGGCGGCATGGCG; or the primer is

[0019] QRBSDV6 R -R(CDS)-F ATGGCAATGGCTTGTGCAGTAGT and

[0020] QRBSDV6 R -R(CDS)-R TCAGCAGGCGGCATGGCG.

[0021] The present invention also includes the qRBSDV6 R Protein or fragment of a resistance gene.

[0022] Wherein, the amino acid sequence of the protein or fragment is shown as SEQ ID NO.3.

[0023] The present invention also includes an expression cassette, a recombinant vector or a cell containing the qRBSDV6 R Resistance genes.

[0024] The present invention also includes the qRBSDV6 R Application of the resistance gene, the protein or fragment, the expression box, the recombinant vector or the cell in regulating or breeding rice resistant to rice black-streaked dwarf disease and / or southern rice black-streaked dwarf disease.

[0025] The present invention also includes a method for obtaining a rice plant resistant to rice black-streaked dwarf disease and / or southern rice black-streaked dwarf disease, comprising the following steps:

[0026] 1) making plants contain said gene; or

[0027] 2) allowing the plant to express the protein or fragment.

[0028] Among them, it includes CRISPR gene editing, TALEN, ZFN site-directed mutagenesis, transgenic, hybridization, backcrossing or asexual reproduction steps.

[0029] Wherein, the method for identifying a plant, wherein the plant is a plant comprising the gene, a plant expressing the protein, or a plant obtained by the method, comprises the following steps:

[0030] 1) identifying whether the plant contains the gene; or,

[0031] 2) Identifying whether the plant expresses the protein.

[0032] The present invention also includes a method for controlling rice black-streaked dwarf disease and / or southern rice black-streaked dwarf disease, comprising: the rice contains the gene or the protein, the expression cassette, the recombinant vector or the cell.

[0033] Beneficial effects: Compared with the prior art, the present invention has the following advantages: the present invention can effectively inhibit the disease-prone gene qRBSDV6 S To verify the function of transgenic plants, we knocked out qRBSDV6 in susceptible varieties. S The resistance level to RBSDV and SRBSDV was significantly improved, and qRBSDV6 was overexpressed in the resistant varieties. S , the resistance level to RBSDV and SRBSDV decreased significantly, indicating that qRBSDV6 S and qRBSDV6 RThis pair of alleles controls resistance to RBSDV and SRBSDV, further demonstrating that qRBSDV6 R It is a resistance gene, and experimental studies have found that qRBSDV6 R Resistance genes can regulate rice to acquire resistance to rice black-streaked dwarf virus and southern rice black-streaked dwarf virus. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 , 4 Bar graph showing the field identification incidence of RBSDBV in each rice subtype (including Indica, Japonica, Aromatic, Aus).

[0035] Figure 2 , rice variety W44 showed stable and high resistance to RBSDV. Figure 2 a is the phenotype and incidence of naturally infected Zhonghuaidao No. 5 (H5), Tetep and W44 (scale bar = 100 cm). Figure 2 b is a schematic diagram of symptoms of susceptible varieties H5 and NPB, moderately resistant variety Tetep, and resistant variety W44 taken 30 days after inoculation with RBSDV (scale bar = 4 cm). Figure 2 c is the incidence rate of H5, NPB, Tetep and W44 on the 30th day after field and artificial inoculation. Figure 2 d is the transcription of RBSDV-CP after inoculation in different varieties under the conditions of 0, 8, and 19 days using qRT-PCR method. Figure 2 e The protein accumulation level of RBSDV-CP at 0, 8, and 19 days was detected by western blot.

[0036] Figure 3 , Analysis of insect resistance of rice varieties. The larvae of Laodelphax striatellus were grown on seedlings of NPB, W44, W43, W484 and IR50 (10 larvae per seedling). The survival rate of the larvae in each group was recorded after 5 days; Figure 3 a shows the survival rate of Laodelphax striatellus on NPB or other test lines. Figure 3 b is the number of gray leaf hoppers remaining in different test strains on the second day after inoculation.

[0037] Figure 4 , GWAS and haplotype analysis for RBSDV resistance. Figure 4 a is a Manhattan plot of the GWAS analysis results of RBSDV incidence. Field identification results: GWAS results using the entire set of phenotypes in field trials. Field identification: GWAS results use typical indica and Aus subtype phenotypes in field identification; Artificial inoculation: GWAS results use typical indica and Aus subtype phenotypes in artificial inoculation identification. Figure 4b is the LD heat map showing the region around the strong peak of qRBSDV6 in the GWAS results from the typical indica and Aus subtype phenotypes identified using artificial inoculation. Figure 4 c is the haplotype analysis of qRBSDV-6, and four haplotypes, Hap1, Hap2, Hap3 and Hap4, were identified in the Indica and Aus subpopulations.

[0038] Figure 5 , Schematic diagram of the structural variation of the qRBSDV-6 region in the de novo assembled W44 genome.

[0039] Figure 6 , Screening of candidate genes for qRBSDV6. Figure 6 a) Based on the RNAseq results of W44 (resistant) and W122 (sensitive) at different stages after artificial inoculation, the expression profiles of annotated genes in the qRBSDV6 region were analyzed. There was a significant difference in the expression of LOC_Os06g02780 between W44 and W122. Figure 6 b) There are significant differences in the amino acid sequence alignment between W44 and Nipponbare LOC_Os06g02780. The same sequence is marked with "*", while the different sequences are marked with "." or ":". ( Figure 6 c) Real-time RT-PCR detection of LOC_Os06g02780 expression between W44 and W122. 18s-rRNA gene was used as internal reference. Error bars are standard deviations of three biological replicates for different treatments. Statistical significance was calculated using t-test. Similar results were obtained in three independent experiments. Different capital letters, P value < 0.01.

[0040] Figure 7 , verification of pEXT06f:OsAP47 overexpression transgenic rice; Figure 7 a is a schematic diagram of the overexpression of OsAP47 in W44, 35Sp: 35S-driven promoter, NOT T : NOT terminator; Figure 7 b is the detection of OsAP47 gene transcription levels in overexpression lines 35S:OsAP(#1), 35S:OsAP(#2), 35S:OsAP(#3), 35S:OsAP(#4), 35S:OsAP(#5) and 35S:OsAP(#6); Figure 7 c is the detection of OsAP47 protein expression level in overexpression lines 35S:OsAP(#1) and 35S:OsAP(#2) (Western Blot electrophoresis).

[0041] Figure 8 , verification of the Crispr-OsAP47 gene-edited strain; among them, Figure 8a is a schematic diagram of the principle of mutant gene obtained by OsAP47 gene editing related to sgRNA1; Figure 8 b is the forward and reverse sequencing results of the mutation site of the OsAP47 gene in the Crispr-OsAP(2-3) homozygous strain; Figure 8 c is the alignment of the amino acid sequence of OsAP47 in the Crispr-OsAP(2-3) strain and the amino acid sequence of OsAP47 in NPB; Figure 8 d is a schematic diagram of the principle of mutant gene obtained by OsAP47 gene editing related to sgRNA2; Figure 8 e is the forward and reverse sequencing results of the mutation site of the OsAP47 gene in the Crispr-OsAP(4-4) homozygous strain; Figure 8 f is the amino acid sequence alignment of OsAP47 in the Crispr-OsAP(4-4) strain and OsAP47 in NPB.

[0042] Fig. 9 , OsAP47 gene can enhance the susceptibility of rice to rice black-streaked dwarf virus; among them, Fig. 9 a is the morbidity statistics of W44, OsAP47 overexpression lines 35S:OsAP (#1) and 35S:OsAP (#2) after inoculation with rice black-streaked dwarf virus 30 days later; Fig. 9 b is the disease phenotypes of the W44 overexpression line 35S:OsAP (#1) and the OsAP47 overexpression line 35S:OsAP (#2) recorded 30 days after inoculation with rice black-streaked dwarf virus; Fig. 9 c is the 30-day incidence statistics of NPB, Crispr-OsAP47 gene-edited strains Crispr-OsAP(2-3) and Crispr-OsAP(4-4) inoculated with rice black-streaked dwarf virus; Fig. 9 d is the disease phenotypes of NPB, Crispr-OsAP gene-edited lines Crispr-OsAP (2-3) and Crispr-OsAP (4-4) after inoculation with rice black-streaked dwarf virus for 30 days. Mock represents the control of non-virulent Laodelphax striatum, and RBSDV represents the treatment of Laodelphax striatum carrying rice black-streaked dwarf virus.

[0043] Fig.10 , OsAP47 gene enhances the susceptibility of rice to southern rice black-streaked dwarf virus; Fig.10 a is the morbidity statistics of W44, OsAP47 overexpression lines 35S:OsAP (#1) and 35S:OsAP (#2) after inoculation with southern rice black-streaked dwarf virus 30 days later; Fig.10 b is the disease phenotypes recorded 30 days after W44, OsAP47 overexpressing lines 35S:OsAP (#1) and 35S:OsAP (#2) were inoculated with southern rice black-streaked dwarf virus; Fig.10c is the morbidity statistics of NPB, Crispr-OsAP47 gene-edited lines Crispr-OsAP(2-3) and Crispr-OsAP(4-4) inoculated with southern rice black-streaked dwarf virus 30 days later; Fig.10 d is the disease phenotype recorded 30 days after the NPB, Crispr-OsAP47 gene-edited lines Crispr-OsAP(2-3) and Crispr-OsAP(4-4) were inoculated with southern rice black-streaked dwarf virus. Mock represents the control of non-virulent white-backed planthoppers, and SRBSDV represents the treatment of white-backed planthoppers carrying southern rice black-streaked dwarf virus.

[0044] Fig.11 、NPB / W44 F 2 The incidence of some strains and parents in the first generation, among which R14 and R20 were detected by cloning and sequencing to contain qRBSDV R , R12 and R13 were detected to contain the disease susceptibility gene OsAP47.

[0045] Fig.12 ,qRBSDV R The encoded protein enhances rice resistance to SRBSDV. After the Crispr-OsAP(2-3) gene-edited rice was inoculated with SRBSDV, the purified qRBSDV R Protein and GFP protein control were diluted with buffer and then pumped into the intercellular space of rice tissue. Fig.12 a is purified qRBSDV R and SDS-PAGE Coomassie blue staining images of GFP protein, the boxes mark the purified protein bands; Fig.12 b is the transcription level of SRBSDV-S10 gene detected by qRT-PCR experiment 5 days after vacuuming, "*" indicates that there is a significant difference in t-test analysis, P < 0.05; Fig.12 c is the accumulation of SRBSDV-P6 protein detected by Western blot experiment 5 days after vacuuming. DETAILED DESCRIPTION

[0046] The following examples are provided for better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples can be purchased from conventional biochemical reagent stores unless otherwise specified.

[0047] Example 1

[0048] 1. Plant materials and their growth conditions, storage and cultivation of test viruses

[0049] 1) 509 rice materials, including indica, japonica, Aus and aromatic rice, were selected from rice RPD2 populations from 72 countries or regions for RBSDV resistance identification. The results of resistance identification were as follows: Figure 1 .

[0050] 2) Transgenic lines were transformed by Agrobacterium tumefaciens-mediated transformation and hygromycin selection. Transgenic lines were transformed by Agrobacterium tumefaciens-mediated transformation and hygromycin selection. All rice lines were grown in a greenhouse at 25h, 70% relative humidity, and 12 / 12h day and night light. Agrobacterium penetration test was performed on tobacco under 25h, 12 / 12h day and night light conditions.

[0051] 3) The rice used for the test were NPB (Nipponbare) and W44 (VANDANA), W44 can be purchased from the International Rice Research Institute (IRRI), and is the background plant for the rice genetic transformation of the present invention. Among them, NPB is a susceptible variety of rice black-streaked dwarf virus and southern rice black-streaked dwarf virus, and W44 is a disease-resistant variety of rice black-streaked dwarf virus and southern rice black-streaked dwarf virus.

[0052] 4) Escherichia coli (E. coli) strain TOP10 and Agrobacterium tumefaciens (Agrobacterium tumefaciens) strain EHA105 were purchased from Beijing Quanshijin Biotechnology Co., Ltd.

[0053] 5) Rice black-streaked dwarf virus was collected from Kaifeng, Henan, Jianhu, Jiangsu, Nanjing, Jiangsu and other areas in 2018. Suspected rice black-streaked dwarf virus plants with 4-5 leaves were collected and transplanted to the experimental field of this laboratory to preserve the virus source after testing and confirmation for feeding virus testing.

[0054] 2. Virus source and virus inoculation

[0055] (1) Wheat plants with typical symptoms of wheat dark green dwarf disease were collected from a wheat field in Jiangsu Province and tested by RT-PCR using RBSDV-specific primers. RBSDV-positive plants were artificially inoculated for identification.

[0056] (2) The adult population of SBPH was kept in the laboratory and reared on RBSDV-positive rice plants for 7 days. The SBPH was then transferred to healthy rice varieties. The seedling stage of Wuyujing No. 3 lasted for 8 days to allow RBSDV to circulate in SBPH. The virus-carrying rate of SBPH population was determined by dot-ELISA.

[0057] (3) White-backed planthoppers were obtained from laboratory-maintained adult populations and were reared on SRBSDV-positive rice plants for 7 days. The white-backed planthoppers were then transferred to healthy rice varieties for 8 days to allow SRBSDV to circulate in the white-backed planthoppers. The virus-carrying rate of the white-backed planthopper population was determined using a dot-ELISA assay.

[0058] 3. Evaluation of resistance to rice black streaked dwarf virus (RBSDVD)

[0059] In 2015 and 2016, in the RBSDVD epidemic area of ​​Kaifeng City, Henan Province, plots of wheat green dwarf disease (also caused by RBSDV) were selected as rice seedling fields in the surrounding wheat fields. Two weeks before wheat harvest, 509 rice varieties were sown. One month after sowing, the seedlings were transplanted to the rice fields in Jurong, Jiangsu. No pesticides or antiviral drugs were applied to the seedlings and Honda before the symptoms appeared, and the cultivation was the same as normal field management. One month after transplanting, the incidence of RBSDVD was recorded. Compared with healthy plants, the diseased plants showed extremely significant dwarfing, with stiff, dark green leaves, and waxy white protrusions on the back of the leaves, leaf sheaths, and stems. Three replicates were performed for each variety or line. The average value of the number of replicates was used as the phenotypic value. The incidence rate (number of RBSDV-infected plants / total number of plants × 100%) was used as an indicator to evaluate its resistance to RBSDV. The incidence rate survey was conducted during the first symptom period of RBSDV, and the second survey was conducted 7 days after the onset of the disease.

[0060] In the artificial inoculation test, 197 indica rice materials were identified for resistance to RBSDV. Seeds of 35 varieties were sown in a 500 ml beaker in the growth room of Jiangsu Academy of Agricultural Sciences at a humidity of 35% to 45% and a temperature of 25 to 30°C. At about 1.5 leaf stage, 30 healthy seedlings were inoculated with 3 gray leafhoppers carrying RBSDV per rice seedling for 72 hours. Gray leafhoppers were manually removed after 72 hours. The seedlings were transplanted to the cement pool of Jiangsu Academy of Agricultural Sciences. No pesticides and antiviral drugs were sprayed during the rice growth period, and other cultivation management was carried out according to conventional field management. The survey and data processing methods were the same as those in the field identification test.

[0061] The results of field induction showed that the incidence of the resistant variety W44 was 6.33% to 8.48%, the incidence of the susceptible control H5 was 83.94% to 87.84%, and the incidence of the medium-resistant control Tetep was 28.89% to 32.29% ( Figure 2 a, 2b). The results of artificial inoculation showed that the incidence of W44 was 8.33% to 11.89%, the incidence of H5 was 77.78% to 89.44%, and the incidence of Tetep was 33.33% to 41.44%. There was no significant difference between the results of field induction and artificial inoculation, which showed the accuracy of the artificial inoculation test and that W44 had a stable high resistance ( Figure 2c). To investigate the molecular mechanism of resistance in W44, we detected the expression of RBSDV-S6 gene transcription and translation during virus infection. At 8 and 19 days after inoculation, the mRNA level of RBSDV-S6 in W44 was significantly lower than that in NPB and Tetep ( Figure 2 d); The expression of viral protein levels was detected by virus P6-specific antibodies. It was found that NPB could detect viral P6 protein 8 days after inoculation, Tetep could detect the virus 19 days after inoculation, and W44 could not detect the virus at both 8 and 19 days ( Figure 2 e), indicating that W44 could inhibit the accumulation of rice black-streaked dwarf virus.

[0062] In order to further determine whether W44 is antiviral or insect-resistant, the insect resistance of W44 was evaluated (antibiotic and non-tropic). In the non-tropic test, the number of insects falling on W44 plants was significantly different from the insect-resistant control IR50, but not significantly different from the insect-susceptible control NPB, indicating that SBPH has no preference for W44 ( Figure 3 a); In the antibiosis experiment, there was no significant difference between the survival rates of SBPH and NPB in W44 plants ( Figure 3 b), indicating that W44 is not resistant. Therefore, the resistance of W44 mainly comes from the resistance to rice black-streaked dwarf virus, rather than the resistance to SBPH. In summary, W44 is a stable and highly virus-resistant variety that can inhibit the accumulation of viruses.

[0063] 4. Genome-wide association analysis

[0064] GWAS analysis was performed using GAPIT version 2. SNPs were selected from the 700K analysis of a previous study for GWAS analysis based on the criteria of less than 15% missing data and minor allele frequency (MAF) > 0.05 (McCouch et al., 2016a). GWAS used a mixed linear model with a kinship matrix, and PCA was performed in GAPIT. Manhattan plots were drawn using the CMR software package. The rice genome sequence version MSU V7.0 was used as the reference for analysis.

[0065] from Figure 4 As can be seen, GWAS and haplotype analysis of RBSDV resistance. (4a) Manhattan plot of GWAS results for RBSDV incidence. Field trial (whole group), GWAS results using the whole group phenotype in the field trial. Field trial (Indica+Aus); GWAS results using typical indica and Aus subtype phenotypes in the field trial; Artificial inoculation (Indica+Aus), GWAS results using typical indica and Aus subtype phenotypes in artificial inoculation. (4b) From the typical indica and Aus subtype phenotypes using artificial inoculation, the LD heat map shows the area around the strong peak of qRBSDV6 in the GWAS results.

[0066] Combined with 700kb SNP data, GWAS was used to locate markers for field-induced and artificial inoculation phenotypic data (P<10-4). Association analysis of field inoculation phenotypic data (whole panel) located 6 QTLs ( Figure 4 a); Phenotypic data of artificially inoculated indica rice (indica), 8 QTLs were located ( Figure 4 a); phenotypic data of field-grown japonica rice (japonica), only two QTLs were located ( Figure 4 a). Among these resistance loci, a QTL on chromosome 6 was located in the whole panel induced in the field and in the artificially inoculated indica rice, but not in the non-resistant japonica rice. By calculating the linkage disequilibrium of this locus and combining the GWAS results, we identified the 800kb to 1200kb region on chromosome 6 as the QTL locus ( Figure 4 b), and marked it as qRBSDV6. Through haplotype analysis and incidence statistics, it was found that qRBSDV6 in W44 showed Hap1 resistance haplotype ( Figure 4 c).

[0067] 5. Structural variation exists in the qRBSDV6 region of the W44 genome

[0068] To further analyze the candidate genes on qRBSDV6, we resequenced and assembled the genome of W44 and compared it with the known whole genome sequence of Nipponbare. We found that the qRBSDV6 locus in W44 had structural variation in the range of 930 kb to 1140 kb ( Figure 5 ), a total of 62 genes in this region.

[0069] 6. Transcriptome analysis

[0070] Transcriptome sequencing and gene expression profile analysis of virus-infected NPB and W44 revealed that 45 genes were transcribed in the region with structural variation, most of which encoded expressed proteins and transposon proteins, and only 10 genes encoded proteins with known functions. Among them, the aspartic protease OsAP was highly expressed in the susceptible variety NPB, but very low in the resistant variety W44.

[0071] (1) At the 1.5-leaf stage, 35 healthy seedlings of sensitive W122 and resistant W44 were inoculated with RBSDV-carrying gray leafhoppers for 48 h, with two inoculated per plant. Two gray leafhoppers without RBSDV were used as mock controls. Ten seedlings of W122 and W44 were collected at 0, 8, and 19 days, respectively, and different samples were ground in liquid nitrogen. Total RNA was extracted from the collected samples using Trizol reagent. TBTOOLS was used for cluster analysis of transcriptome data.

[0072] (2) Data analysis was performed using HISAT2-Stringtie-Deseq2. In short, HISAT2 mapped the reads of each sample to the MSU7.0 reference sequence, and then Stringtie performed the analysis. The raw counts of each sample output from Stringtie were input and normalized by DESeq2. DESeq2 was used to further analyze differentially expressed genes.

[0073] in, Figure 6 a is the expression profile of the annotated genes in the qRBSDV6 region analyzed based on RNAseq of W44 (resistant) and W122 (sensitive) at different stages after artificial inoculation. There was a significant difference in the expression of LOC_Os06g02780 between W44 and W122. Figure 6 b is the amino acid sequence alignment between W44 and Nipponbare LOC_Os06g02780, which shows significant differences. The same sequences are marked with "*", while the different sequences are marked with "." or ":". Figure 6 c Real-time RT-PCR detection of the expression of LOC_Os06g02780 between W44 and W122. 18s-rRNA gene was used as an internal reference.

[0074] 7. Susceptible allele qRBSDV6 of LOC_Os06g02780 S Cloning, expression and functional verification of the OsAP47 gene

[0075] 1) OsAP47 gene cloning

[0076] (1) Total RNA of NPB was extracted and cDNA was synthesized using Takara reverse transcription reagent. Using the cDNA of NPB as a template, the OsAP47 coding sequence was amplified by PCR using the forward primer pEXT06f-OsAP47-F and the reverse primer pEXT06f-OsAP47-R of the OsAP47 gene. The sequences of the forward and reverse primers are as follows:

[0077] pEXT06f-OsAP47-F:gacaagcttggtacctctagaATGGCAATGGCTTGTGCAG,

[0078] pEXT06f-OsAP47-R:gtctttgtagtccatactagtGCAGGCGGCATGGCGGAA.

[0079] (2) The PCR reaction system was as follows: 10× buffer 10.0 μL, 2.5 mM dNTPs 8.0 μL, Primer STAR Taq enzyme (Takara) 1.0 μL, template cDNA 4.0 μL, forward and reverse primers 5.0 μL each (primer concentration 10 μM), and water was added to 100 μL.

[0080] (3) The PCR amplification procedure was as follows: pre-denaturation at 98°C for 3 min; denaturation at 98°C for 30 s, annealing at 52°C for 30 s, extension at 72°C at 1 kb / 1 min, 34 cycles; and extension at 72°C for another 6 min.

[0081] (4) The PCR amplification products were separated by nucleic acid electrophoresis on 1% agarose gel, stained with nucleic acid dye, photographed under ultraviolet light, and the results were recorded. The OsAP47 gene PCR product was recovered by cutting the gel and using Axygen gel recovery kit to recover the electrophoresis bands.

[0082] 2) Construction, genetic transformation and verification of rice transgenic overexpression vector

[0083] (1) The recovered PCR product of the OsAP47 gene was connected to the pEXT06f vector (purchased from Changzhou Biotech Co., Ltd.) double-digested with XbaI / SpeI using a universal biological homologous recombinase to obtain a recombinant vector carrying the OsAP47 gene. The C-terminus of the vector pEXT06f contains a Flag tag ( Figure 7 a).

[0084] (2) The recombinant vector carrying the OsAP47 gene was transformed into the competent E. coli TOP10 cell, and then evenly spread on an LB plate (containing 50 μg / mL of kanamycin), cultured at 37°C for 12-16 hours, and a single colony was obtained.

[0085] (3) Using the primer pEXT06f-OsAP47-F and the vector downstream primer pEXT06f-Reverse, the single colony obtained in step (2) was verified by colony PCR. The PCR product was subjected to nucleic acid electrophoresis on an agarose gel, and positive clones were recorded by taking photos.

[0086] The sequence of the vector downstream primer pEXT06f-Reverse is as follows: caggaaacagctatgac.

[0087] (4) Pick a positive single colony that has been verified to be correct by colony growth, and then use the Axygen plasmid extraction kit to extract the plasmid, which is then sent to Anhui Chuzhou General Biotechnology Co., Ltd. for sequencing.

[0088] (5) The sequencing results showed that the sequence of the amplified OsAP47 gene was shown in SEQ ID NO.4, which was in line with expectations. The sequence of the OsAP47 protein encoded by the gene was shown in SEQ ID NO.5. The plasmid with the correct sequencing results was transformed into Agrobacterium EHA105 by electroporation, added to LB medium, cultured at 28°C for 2h, and then evenly spread on LB plates (containing 50μg / mL kanamycin and 50μg / mL rifampicin), cultured at 28°C for 48h, and single colonies were obtained.

[0089] (6) Colony PCR was performed on the single colony obtained in step (5) using primer pEXT06f-OsAP47-F and vector downstream primer pEXT06f-Reverse. Colony PCR confirmed that the correct clone was EHA105 Agrobacterium carrying the OsAP47 gene, and the glycerol bacteria were stored at -70°C.

[0090] (7) EHA105 Agrobacterium carrying the OsAP47 gene was transformed into W44 to obtain multiple independent genetic transformation strains overexpressing the OsAP47 gene, which were numbered as overexpression strains 35S:OsAP (#1), 35S:OsAP (#2), 35S:OsAP (#3), 35S:OsAP (#4), 35S:OsAP (#5) and 35S:OsAP (#6).

[0091] (8) Detection of transcription level in rice lines overexpressing OsAP47 gene: Using cDNA of each transformed line as template, OsAP gene was amplified with OsAP47 gene specific primers pEXT06f-OsAP47-F and pEXT06f-OsAP47-R for PCR verification. Untransformed Agrobacterium W44 was also set as negative control. The results are shown in Figure 7 b, It can be seen that the OsAP47 gene can be transcribed and expressed in W44.

[0092] (9) Detection of protein levels in rice lines overexpressing the OsAP47 gene: Rice leaves overexpressing the OsAP47 gene were collected to detect the expression level of the OsAP47 protein. The collected rice leaves were ground with liquid nitrogen and then added to the protein extract. After mixing, the mixture was placed in an ice bath for 10 minutes. The mixture was then centrifuged at 13,000 g, 80uL of the supernatant was collected, 20uL of 5x protein loading buffer was added, and the mixture was mixed and placed in a boiling water bath for 8 minutes. 10uL of the sample was taken for electrophoresis separation on an SDS-PAGE gel and electrophoresed at 120V for 1.5 hours. After the electrophoresis, the protein sample was transferred to a PVDF membrane and sealed by incubation with 1*TBST containing 5% milk. A 1:5000 diluted Flag-conjugated HRP antibody (purchased from Sigma, product number F1804-50UG) was added and the membrane was washed three times with TBST for 5 minutes after incubation for 2 hours. The membrane was scanned and photographed. Figure 7 As shown in c, western blot showed that the OsAP47-Flag fusion protein (55 kDa) was successfully expressed in W44.

[0093] 3) Construction, genetic transformation and verification of OsAP47 gene editing vector

[0094] (1) Using the monocotyledonous plant CRISPR / Cas9 vector system designed by the research group of Academician Liu Yaoguang of South China Agricultural University (published in Molecular Plant 8, 1274-1284 in 2015), two pairs of target linker primers OsAP-U6a-gRNA-F1 and OsAP-U6a-gRNA-R1, OsAP-U6b-gRNA-F2 and OsAP-U6b-gRNA-R2 were designed.

[0095] The target linker primer pair U6a includes: OsAP-U6a-gRNA-F1 and OsAP-U6a-gRNA-R1.

[0096] The sequence of OsAP-U6a-gRNA-F1 is as follows: CCGCCCGTACGGTCGGCTCAAC;

[0097] The sequence of OsAP-U6a-gRNA-R1 is as follows: AAACGTTGAGCCGACCGTACGGG.

[0098] The target linker primer pair U6b includes: OsAP-U6b-gRNA-F2 and OsAP-U6b-gRNA-R2.

[0099] The sequence of OsAP-U6b-gRNA-F2 is as follows: TTGCGCCGACTACATACAGTGG;

[0100] The sequence of OsAP-U6b-gRNA-R2 is as follows: AACCCACTGTATGTAGTCGGCG.

[0101] (2) Preparation of target linker U6a: OsAP-U6a-gRNA-F1 and OsAP-U6a-gRNA-R1 were separately washed with ddH 2 Dissolve in 100 μM stock solution and add 1 μl of each into the same container with ddHO. 2 O to make up the volume to 100 μl, then treat at 90°C for 30 s, move to room temperature to cool and complete annealing to obtain the target linker U6a.

[0102] Preparation of target linker U6b: OsAP-U6b-gRNA-F2 and OsAP-U6b-gRNA-R2 were separately washed with ddH 2 O to make a 100 μM stock solution, take 1 μl of each and add it to the same container, and wash with ddHO. 2 O to make the volume to 100 μl, then treat at 90°C for 30 seconds, move to room temperature to cool and complete annealing to obtain the target linker U6b.

[0103] (3) U6a-related gRNA vector digestion and expression cassette ligation: Add ATP to a final concentration of 1.0 mM in 1 μl of 10x Bsa I endonuclease buffer, then add 20 ng / μl of pYLgRNA-OsU6a / 6b plasmid (published in Molecular Plant 8, 1274-1284 in 2015), 1 μl, 0.5 μl target linker U6a, 5U BsaI and 35U T4 DNA ligase. Place the reaction system in a PCR instrument and react according to the following program: 37°C 5 min, 20°C 5 min, 5 cycles. After the reaction is completed, the ligation product 1 is obtained.

[0104] U6b-related gRNA vector digestion and expression cassette ligation: The reaction system and conditions are the same as those of U6a-related gRNA vector digestion and expression cassette ligation, the only difference being that the target linker U6b is used instead of the target linker U6a. After the reaction is completed, the ligation product 2 is obtained.

[0105] (4) Amplification of gDNA expression cassette

[0106] Amplify U6a-related gDNA expression cassette U6a-gRNA:

[0107] Take 1 μl of the ligation product 1 obtained in step (3) as a template, add 0.2 μM of the expression cassette primer UF, 0.2 μM of the adapter reverse primer OsAP-U6a-gRNA-R1 and an appropriate amount of high-fidelity PCR enzyme (Takara), and perform the first round of PCR reaction according to the following procedure to obtain product 1: 98°C for 10 s, 60°C for 15 s, 68°C for 20 s, and 25-28 cycles.

[0108] Take 1 μl of the ligation product 1 obtained in step (3) as a template, add 0.2 μM adapter forward primer OsAP-U6a-gRNA-F1, 0.2 μM expression cassette primer gRNA-R and an appropriate amount of high-fidelity PCR enzyme (Takara), and perform the first round of PCR reaction according to the following procedure to obtain product 2: 98°C for 10 s, 60°C for 15 s, 68°C for 20 s, and 25-28 cycles.

[0109] The first round PCR reaction products 1 and 2 of the ligation product 1 were respectively treated with ddH 2 O was diluted 10 times, and then 1 μl of each was mixed as a template, and position-specific primers Uctcg-B1' and gRcggt-BL (final concentration 0.15 μM) were added. A high-fidelity enzyme was used for 20-25 cycles, and the program for each cycle was as follows: 98°C for 10s, 58°C for 15s, and 68°C for 20s. After the reaction, 2-3 μl of PCR product was electrophoresed to check whether the length was consistent, U6a-gRNA = 599bp. U6a-gRNA was purified using Axygen purification kit.

[0110] Expression cassette primer UF: CTCCGTTTTACCTGTGGAATCG.

[0111] Expression cassette primer gRNA-R: CGGAGGAAAATTCCATCCAC.

[0112] Position-specific primer Uctcg-B1′: TTCAGAGgtctcTctcgACTAGTGGAATCGGCAGCAAAGG.

[0113] Position-specific primer gRcggt-BL: AGCGTGggtctcGaccgACGCGTCCATCCACTCCAAGCTC.

[0114] Amplify U6b-related gDNA expression cassette U6b-gRNA: The reaction system and conditions are the same as those for amplifying U6a-related gDNA expression cassettes, except that OsAP-U6b-gRNA-R2 replaces OsAP-U6a-gRNA-R1, and OsAP-U6b-gRNA-F2 replaces OsAP-U6a-gRNA-F1. After the reaction is completed, take 2-3μl of PCR product for electrophoresis to check whether the length is consistent, U6b-gRNA = 485bp, and use Axygen purification Kit to purify U6b-gRNA.

[0115] (5) Cutting and ligating: Take about 50ng U6a-gRNA, add about 70ng pYLCRISPR / Cas9-MH plasmid (published in Molecular Plant 8, 1274-1284 in 2015), 1x Bsa I-endonuclease buffer, 10U BsaI, the reaction system is 15μl, and digest at 37℃ for 10min. Then, add ATP to a final concentration of 0.8mM, add 35U T4 DNA ligase, and perform enzyme digestion and ligation reaction in a PCR instrument. The specific procedure is as follows: 37℃ for 2min; 10℃ for 3min, 20℃ for 5min, 15 cycles; finally 37℃ for 2min. Finally, the recombinant plasmid 1 is obtained.

[0116] The same method as above was used, only U6a-gRNA was replaced with U6b-gRNA to obtain recombinant plasmid 2.

[0117] (6) Recombinant plasmids 1 and 2 were respectively transformed into E. coli competent cells TOP10, evenly spread on LB plates (containing 50 μg / mL of kanamycin), cultured at 37°C for 12-16 h, and single colonies were collected.

[0118] (7) Using vector primers SP-F and SP-R, PCR was performed on the single colonies obtained in step (6) for verification. The PCR products were subjected to nucleic acid electrophoresis on agarose gel. The presence of a 2000 bp band was considered positive. Positive clones were recorded by taking photos.

[0119] Vector primer SP-F: GCGCGGTGTCATCTATGTTACTAGATCG.

[0120] Vector primer SP-R: CCCGACATAGATGCAATAACTTC.

[0121] (8) Single positive colonies carrying recombinant plasmids 1 and 2 were taken for shake culture and plasmids were extracted according to the instructions of the plasmid extraction kit (Axygen) and sent to Anhui Chuzhou General Biotechnology Co., Ltd. for sequencing.

[0122] (9) The correctly sequenced recombinant plasmids 1 and 2 were transformed into Agrobacterium EHA105 by electroporation, added to the antibiotic-free LB medium, incubated at 28°C for 2 h, and then evenly spread on LB plates (containing 50 μg / mL kanamycin and 50 μg / mL rifampicin) and incubated at 28°C for 48 h. Single colonies were collected from each.

[0123] (10) Using vector primers SP-F and SP-R, PCR verification was performed on each single colony obtained in step (9), and the correct clone was picked out. EHA105 Agrobacterium carrying the candidate gene target site was transformed into NPB to obtain multiple independent genetic transformation strains.

[0124] (11) Targeting effect detection of genetically transformed strains: The genomic DNA of each genetically transformed strain was used as a template, and the target detection primers Crispr-OsAP-F and Crispr-OsAP-R were used to amplify the target sequence. Then, the target PCR products of the T0 or T1 generation plants were directly sequenced. The sequencing results of two strains showed a single peak of mutation, indicating that the strain was a homozygous mutation. One of the strains was a homozygous mutation with a base (T) inserted between the 203rd and 204th bases of the CDS of the OsAP47 gene ( Figure 8 a, 8b), therefore, this strain was named Crispr-OsAP (2-3). Another strain was a homozygous mutation with deletion of bases (AG) at positions 311 and 312 of the CDS of the OsAP47 gene ( Figure 8 d, 8e), therefore, the strain was named Crispr-OsAP (4-4). The amino acid sequences of the mutants were compared, and the results showed that the above-mentioned 1 base insertion or 2 base deletion caused the OsAP47 protein translation to terminate prematurely ( Figure 8 c, 8f).

[0125] Crispr-OsAP-F:ACTCTTTACTAGACTTTGCCGTC.

[0126] Crispr-OsAP-R:CTTCTTTTTGCATATGTGTGGGTT.

[0127] 4) Evaluation of resistance to rice black-streaked dwarf disease in homozygous lines of OsAP47 overexpression and CRISPR / Cas9 editing

[0128] (1) Non-virus-carrying Laodelphax striatum was fed on a rice black-streaked dwarf virus source for 7 days to obtain the virus, and then transferred to a beaker with Wuyujing 3 seedlings for breeding and spent a circulation period of about 7 days.

[0129] (2) Fifty small hoppers were randomly selected from the small hoppers that had completed the cycle, and the virus infection rate of the small hoppers was detected by DOT-ELISA method, and the inoculated insect number was calculated (inoculated insect number = effective inoculated insect number / virus infection rate).

[0130] (3) At an intensity of 2 effective insect inoculation heads / seedling, the offspring of W44, NPB, OsAP47 overexpression lines 35S:OsAP(#1) and 35S:OsAP(#2), and Crispr-OsAP gene-edited lines Crispr-OsAP(2-3) and Crispr-OsAP(4-4) were artificially inoculated to investigate the resistance level of each transgenic plant. In addition, a control group of plants inoculated with non-toxic gray planthoppers was set up.

[0131] (4) Two days after inoculation, the Laodelphax striatellus was removed manually and transplanted to the experimental field to show symptoms. After 30 days, the incidence of each plant was counted and the disease phenotype was recorded by taking photos ( Fig. 9 ). The experimental results showed that the Crispr-OsAP(2-3) and Crispr-OsAP(4-4) lines with OsAP47 knocked out in NPB had an incidence rate lower than 40%, while the incidence rate of NPB was close to 80%. Therefore, the OsAP47 knockout lines were significantly more resistant to rice black-streaked dwarf virus than NPB; the 35S:OsAP(#1) and 35S:OsAP(#2) lines overexpressing the OsAP47 gene in W44 had an incidence rate close to 30%, while the incidence rate of W44 was close to 5%. Therefore, the lines overexpressing the OsAP47 gene were significantly more sensitive to rice black-streaked dwarf virus than the disease-resistant rice variety W44. The above results indicate that OsAP47 is a disease-susceptible gene that negatively regulates rice resistance to rice black-streaked dwarf virus.

[0132] 5) Evaluation of resistance to southern rice black-streaked dwarf disease in homozygous lines of OsAP47 overexpression and CRISPR / Cas9 editing

[0133] (1) feeding non-virus white-backed planthoppers on a southern rice black-streaked dwarf virus source for 3 days to obtain the virus, and then transferring them to a beaker with Wuyujing 3 seedlings for breeding, and spending a cycle period of about 7-10 days;

[0134] (2) Randomly select 50 white-backed planthoppers that have completed the cycle, detect the virus-carrying rate of white-backed planthoppers by DOT-ELISA method, and calculate the inoculated insect quantity (inoculated insect quantity = effective inoculated insect quantity / virus-carrying rate);

[0135] (3) At an intensity of 2 effective inoculations per seedling, W44, NPB, OsAP47 overexpression lines 35S:OsAP (#1) and 35S:OsAP (#2), and Crispr-OsAP47 gene-edited lines Crispr-OsAP (2-3) and Crispr-OsAP (4-4) were artificially inoculated to investigate the resistance level of each transgenic plant.

[0136] (4) Two days after inoculation, white-backed planthoppers were removed manually and transplanted to the experimental field to show symptoms. After 30 days, the incidence rate was counted and the disease phenotype was recorded by taking photos ( Fig.10 ). The experimental results showed that the Crispr-OsAP(2-3) and Crispr-OsAP(4-4) lines with OsAP47 knocked out in NPB had an incidence rate lower than 15%, while that of NPB was close to 40%. Therefore, the plants with OsAP47 knocked out were significantly more resistant to southern rice black-streaked dwarf virus than NPB; the 35S:OsAP(#1) and 35S:OsAP(#2) lines overexpressing OsAP47 in W44 had an incidence rate of nearly 30%, while that of W44 was less than 5%. Therefore, the lines overexpressing OsAP47 were significantly more sensitive to southern rice black-streaked dwarf virus than the disease-resistant rice variety W44. The above results indicate that OsAP47 is a disease-susceptible gene that negatively regulates rice resistance to southern rice black-streaked dwarf virus.

[0137] From the above experiments, it can be seen that the allele qRBSDV6 of LOC_Os06g02780 of the present invention S That is, the OsAP47 gene is a susceptible gene, which further proves that the qRBSDV6 R The gene is a disease resistance gene.

[0138] 8.qRBSDV6 R Acquisition of candidate genes

[0139] 1)qRBSDV6 R Amplification of candidate genes

[0140] After identifying LOC_Os06g02780 as a possible candidate gene, the gene in W44 was very different from the published rice genome sequence and could not be cloned using conventional methods. Therefore, we analyzed the genomic structure of the qRBSDV6 region in W44 by resequencing. However, the sequencing reads did not match the 930Kb to 1140Kb segment of chromosome 6 (including qRBSDV-6) of the known sequence Nipponbare ( Figure 5). The resequencing results based on the Nipponbare sequence showed that there were structural variations in the qRBSDV-6 region. The W44 genome was then reassembled by combining 200X Pacbio and 100X Illumina sequencing data and further annotated using Maker2.0 ( Figure 5 A large structural variation was detected in the qRBSDV-6 region, in which a large sequence was replaced by a new sequence ( Figure 5 In this interval, a highly divergent allele, LOC_Os06g02780 (Genebank accession number: LOC4339940), was annotated in the W44 region ( Figure 5 ). Based on this, we redesigned primers for qRBSDV6 R The candidate gene LOC_Os06g02780 was amplified successfully. The details are as follows:

[0141] Leaves of healthy W44 plants were collected to extract genomic DNA (gDNA) of W44. qRBSDV6 in W44 was amplified by PCR using gDNA as a template. R of the genome sequence.

[0142] The primer sequences were designed based on the sequencing results:

[0143] QRBSDV6 R -R(gDNA)-F:ATGGCTTAATGCTACCTGACCTCTG, qRBSDV6 R -R(gDNA)-R:TCAGCAGGCGGCATGGCG; the gene sequence of the amplified product is shown in SEQ ID NO.1.

[0144] Leaves of healthy W44 plants were collected, total RNA was extracted and reverse transcribed to obtain W44 cDNA. Using W44 cDNA as a template, qRBSDV6 was amplified by PCR using the following primers: R CDS coding sequence:

[0145] QRBSDV6 R -R(CDS)-F ATGGCAATGGCTTGTGCAGTAGT and

[0146] QRBSDV6 R -R(CDS)-R TCAGCAGGCGGCATGGCG;

[0147] The amplified qRBSDV6 R The CDS sequence is shown in SEQ ID NO.2, and its amino acid sequence is shown in SEQ ID NO.3.

[0148] The reaction systems for amplifying SEQ ID NO.1 and SEQ ID NO.2 are the same except for the template and primers. The template used for amplifying SEQ ID NO.1 is W44 gDNA, and the primers are qRBSDV6 R -R(gDNA)-F and qRBSDV6 R -R(gDNA)-R; the template used to amplify SEQ ID NO.2 was W44 cDNA, and the primer was qRBSDV6 R -R(CDS)-F and qRBSDV6 R -R(CDS)-R, PCR reaction system is as follows (if recovery is required, the system is expanded to 50 μL for PCR):

[0149]

[0150] The PCR reaction procedure is as follows:

[0151]

[0152] Note: Annealing temperature and extension time can be changed as needed.

[0153] 2) Rubber recycling

[0154] Cut out the agarose gel containing the target band under the UV light of the gel imaging system, put it into a 2.0 mL centrifuge tube, and purify and recover it according to the following steps:

[0155] (1) Add 3 gel volumes of Buffer DE-A to the centrifuge tube containing gel and incubate in a 75°C water bath until the gel is completely melted.

[0156] (2) Add half the volume of Buffer DE-B to Buffer DE-A and mix well.

[0157] (3) Transfer the mixture in (2) to a DNA preparation tube, centrifuge at 12,000 rpm for 1 min, and discard the filtrate.

[0158] (4) Place the preparation tube back into the centrifuge tube, add 500 μL Buffer W1, centrifuge at 12,000 rpm for 30 s, and discard the filtrate.

[0159] (5) Place the preparation tube back into the centrifuge tube, add 700 μL Buffer W2 (anhydrous ethanol has been added in advance), centrifuge at 12,000 rpm for 30 s, discard the filtrate, and repeat this step.

[0160] (6) Place the preparation tube back into the centrifuge tube and centrifuge at 12,000 rpm for 1 min.

[0161] (7) Place the preparation tube in a new 1.5 mL centrifuge tube, add 25-30 μL ddH2O to the central membrane of the preparation tube, let stand at room temperature for 1 min, and centrifuge at 12,000 rpm for 1 min to elute the DNA.

[0162] Note: If the target band of the amplified gene is clear and single, Clean up can be performed directly after PCR instead of gel recovery. For detailed steps, please refer to the instructions in the kit.

[0163] 3) Ligation of pMD18-T vector

[0164]

[0165] Ligate for 3 h or overnight at 16°C.

[0166] 4) Transformation of E. coli

[0167] (1) Take the trans10 competent cells out of the -80°C freezer and place them on ice for about 5 minutes to thaw;

[0168] (2) Add the ligation product (10 μL) to the competent cells (50 μL), pipette gently to mix well, and let stand on ice for 30 min;

[0169] (3) Heat shock in a 42°C water bath for 90 seconds, then immediately remove from heat and place on ice for 2 minutes;

[0170] (4) Add 500 μL of antibiotic-free LB to the tube and incubate at 37°C in a shaker for 1 h to allow the bacteria to resume growth;

[0171] (5) 4000 rpm, 2 min, keep 100 μL of supernatant and precipitate, mix well, apply to corresponding antibiotic LB plate, and culture at 37°C.

[0172] 5) Screening of positive clones

[0173] Pick a single clone on the plate and perform colony PCR to select the positive clone.

[0174] The PCR reaction system is as follows:

[0175]

[0176] The PCR reaction procedure is detailed in step 1.

[0177] 6) Send for sequencing

[0178] The selected RThe positive colonies of genome and CDS sequences were added to 500 μL of LB culture medium with corresponding antibiotics, placed in a 37°C shaker for 8 hours, and then 200 μL of the culture medium was sent for testing. The sequencing result is shown in SEQ ID NO.1 (qRBSDV6 R Genome) and SEQ ID NO.2 (qRBSDV6 R CDS).

[0179] 9. F 2 qRBSDV6 in genetic populations R Functional verification

[0180] The F1 hybrid was obtained by crossing the resistant parent W44 with the susceptible parent Nipponbare. 1 , then F 1 The F containing 108 plants was obtained by self-pollination. 2 The groups were named R1 to R108. 2 Collect leaves from individual plants, and collect F 2:3 Seed, sequencing analysis F 2 The genotype of qRBSDV6 of individual plants (see method 9) was determined, and F 2:3 The results showed that the resistance of F 2 The sequencing results of R14 and R20 in the individual strains were qRBSDV6 R (W44) sequence, the average incidence after inoculation with RBS DV was 22.49% and 11.43% respectively; F 2 The sequencing results of R12 and R13 in the individual strains were qRBSDV6 s (Nipponbare) sequences, the average incidence rates after inoculation with RBSDV were 44.17% and 58.95%, respectively. The resistance level of the former was significantly higher than that of the latter two ( Fig.11 ), indicating the presence of qRBSDV6 R Type genes can improve the resistance level of offspring materials. s (Nipponbare type) The primers are OsAP-S(gDNA)-F: ATGGCAATGGCTTGTGCAGC and OsAP-S(gDNA)-F: TCAGCAGGCGGCATGGCG; the amplified sequence is shown in SEQ ID NO.4.

[0181] Example 2qRBSDV R Evaluation of the effect of the encoded protein on the infection of southern rice black-streaked dwarf virus

[0182] 1)qRBSDV R Construction of prokaryotic expression vector of protein and green fluorescent protein GFP

[0183] (1) Using qRBSDV6 R CDS sequence (SEQ ID NO.2) was used as template, qRBSDV R (DN24)-28a-F (the primer was obtained from qRBSDV6 R Amplification starts from the 25th amino acid position and does not include the signal peptide sequence of the first 24 amino acids of the protein), qRBSDV R -28a-R are upstream and downstream primers, and PCR reaction amplifies qRBSDV6 R The coding sequence of the protein except the signal peptide; using the plant GFP expression vector as a template and GFP-28a-F and GFP-28a-R as upstream and downstream primers, PCR reaction amplifies the GFP coding sequence. The primer sequence is:

[0184] QUR R (DN24)-28a-F:

[0185] AGCAAATGGGTCGCGGATCCCTCACTGAGCAGCATGCAGC;

[0186] QUR R -28a-R:

[0187] GCGGCCGCAAGCTTGTCGACGCAGGCGGCATGGCGGAA GFP-28a-F:

[0188] AGCAAATGGGTCGCGGATCCATGGTGAGCAAGGGCGAG GFP-28a-R:

[0189] GCGGCCGCAAGCTTGTCGACCTTGTACAGCTCGTCCATGC

[0190] (2) PCR reaction system: 12.5 μL of 2×KOD One Mix (TOYOBO), 0.5 μL of template DNA, 0.75 μL of upstream and downstream primers (primer concentration 10 μM), and water was added to 25 μL. The DNA templates were qRBSDV cloned in 8 of Example 1. R CDS sequence (SEQ ID NO: 2), and pGD-2x35S-GFP plant expression vector plasmid.

[0191] (3) The PCR amplification program was as follows: pre-denaturation at 98°C for 30 s; denaturation at 98°C for 10 s, annealing at 55°C for 5 s, extension at 68°C for 1 kb / 10 s, 34 cycles; and extension at 68°C for another 2 min.

[0192] (4) The PCR amplification products were separated by nucleic acid electrophoresis on 1% agarose gel, and photographed under ultraviolet light after staining with nucleic acid dye, the results were recorded, and the gel was cut to recover the PCR products. The electrophoresis bands were recovered using the Axygen gel recovery kit.

[0193] (5) The prokaryotic expression vector pET28a was digested with restriction endonucleases BamHI and SalI, and the recovered PCR products were ligated to the digested vector using homologous recombinase (General Bio) to obtain pET28a-qRBSDV R and pET28a-GFP recombinant expression vector.

[0194] (6) The recombinant vector was transformed into E. coli competent cells TOP10, and then evenly spread on LB plates (containing 50 μg / mL of kanamycin), cultured at 37°C for 12-16 h, and a single colony was obtained.

[0195] (7) Perform colony PCR verification on the obtained single colony using the primers in step (1), perform nucleic acid electrophoresis on the PCR product on agarose gel, take photos and record the positive clones, and inoculate the positive clones into 5 mL LB medium (containing 50 μg / mL kanamycin), culture at 37°C, 230 rpm and shaking for 12-16 h, then store the glycerol culture at -70°C and extract the plasmid.

[0196] 2)qRBSDV R Prokaryotic expression and purification of green fluorescent protein GFP

[0197] (1) The plasmid with the correct sequencing result was transformed into the E. coli expression strain BL21 (DE3), evenly spread on LB plates (containing 50 μg / mL kanamycin), and cultured at 37°C for 12-16 h.

[0198] (2) Pick a single colony of BL21(DE3) on the LB plate and inoculate it into 5 mL of LB liquid medium (containing 50 μg / mL kanamycin). Incubate at 37°C with shaking at 230 rpm for 12-16 h and store the glycerol culture at -70°C.

[0199] (3) Inoculate the stored glycerol bacteria into 5 mL of LB liquid medium (containing 50 μg / mL kanamycin) and culture at 37°C with shaking at 230 rpm for 12-16 h. Then transfer the culture into 250 mL of LB liquid medium (containing 50 μg / mL kanamycin) at a ratio of 1:50 and culture at 37°C with shaking at 230 rpm. Measure the absorbance of the bacterial solution until the OD 600 When the pH was 0.6, 125 μL of 0.5 M IPTG was added and cultured at 16°C and 90 rpm for 12 h to induce protein expression.

[0200] (4) The cells were collected by centrifugation and then PBS buffer (137 mM NaCl, 2.7 mM KCl, 10 mM Na 2 HPO 4 , 1.8 mM KH 2 PO 4 ) After re-suspending, the cells were ultrasonically disrupted to release proteins, and centrifuged at 4°C, 5000g for 10 min. The supernatant was added with 0.5 mL of nickel gel (Biyuntian Biotechnology) and incubated at 4°C for 2 h. The incubation solution was then added to the gravity purification column, the nickel gel was washed with PBS, and 2 mL of PBS solution containing 300 mM imidazole was added to elute the protein. SDS-PAGE electrophoresis and Coomassie Brilliant Blue staining were used to detect the protein purification effect ( Fig.12 a).

[0201] (5) The purified protein was added to a dialysis bag (Biyuntian Biotechnology), and the dialysis bag was immersed in 1 L of PBS buffer and dialyzed at 4°C for 12 h. The protein sample in the dialysis bag was then aspirated.

[0202] 3)qRBSDV R Detection of the effect of proteins on SRBSDV infection

[0203] (1) Non-virus white-backed planthoppers were fed on a southern rice black-streaked dwarf virus source for 3 days to obtain the virus, and then transferred to a beaker with Wuyujing 3 seedlings for breeding and spent a circulation period of about 7-10 days.

[0204] (2) Fifty white-backed planthoppers were randomly selected from the completed white-backed planthoppers, and the virus infection rate of the white-backed planthoppers was detected by DOT-ELISA method, and the inoculated insect number was calculated (inoculated insect number = effective inoculated insect number / virus infection rate).

[0205] (3) Artificial inoculation was performed on the offspring of the Crispr-OsAP47 gene-edited strain Crispr-OsAP(2-3) obtained in step 3) of 7 of Example 1 at an effective inoculation intensity of 2 heads / seedling. The purpose of selecting OsAP47 knockout rice for inoculation was to exclude the possibility that the susceptible gene OsAP47 was involved in the qRBSDV infection. R Interference with protein function analysis.

[0206] (4) Two days after inoculation, white-backed plant hoppers were removed manually, individual rice seedlings were separated, and the soil on the roots was cleaned. The GFP protein purified in Section 2) and qRBSDV R The protein was diluted with 150 mL of protein dilution buffer (10 mM Tris-HCl, 10 mM MgCl 2, 0.005% SILWET L-77, pH 5.5), and the final protein concentration in the buffer was 2 μg / mL. The rice seedlings inoculated with SRBSDV were completely immersed in the buffer, and the GFP protein and qRBSDV were respectively pumped into the buffer using a vacuum pump. R The protein buffer is pumped into the intercellular spaces of the rice tissue.

[0207] (5) The rice seedlings into which the buffer solution was pumped were cultured in Kimura B rice nutrient solution. After 5 days, samples were taken to extract rice total RNA and total protein. The transcription level of SRBSDV-S10 and the accumulation of P6 protein were detected by qRT-PCR and Western blot, respectively. Fig.12 b, c) The results showed that compared with the GFP control, the R The S10 transcription and P6 protein accumulation of SRBSDV in Crispr-OsAP(2-3) rice in protein buffer were significantly reduced.

[0208] The above experiments further illustrate that qRBSDV6 of the present invention R The gene is a disease-resistant gene, and the protein it encodes improves rice's resistance to SRBSDV. Sequence Listing <110> Jiangsu Academy of Agricultural Sciences <120> A qRBSDV6R resistance gene and its application <160> 5 <170> SIPOSequenceListing 1.0 <210> 1 <211> 2389 <212> DNA <213> qRBSDV6R resistance gene (Oryza sativa L.) <400> 1 atggcttaat gctacctgac ctctgggccc acagtattgc cgaacccgac atctaatatt 60 gtgcatgccc taagctacca cgactccacg agcacggcgc cgtccctcta taaatagtca 120 gtcgatcagg gagctcactt gagcataaac taattgagca gtagctgcta ccaatggctt 180 gtgcagtagt actaccgccg ctgctactgt ttttgttgt gctctctggc tctaccgctc 240 tcactgagca gcatgcagct ggtgttgatg acatcaacta cagtgtggtg ctaactagta 300 gctggctgaa tccaaaggcc gtctgctccc ggctgagtac gtatactctc tccctctct 360 aatattaa ttaagatgta ttagttatcg tataggctaa atatactcta ctccctttgt 420 tttcaaatat aagcatttct agcatttaaa attatacac aaggtaatat atatgaaaca 480 tttaaagagg atcagctgtt tccccggctc attaaatatt taacttttac ctaattttat 540 cccatcaacc accctgacag tcgcaactac ccctcgtcttt tttttttatt ttcaacctca 600 tgatctgtgc tataaagaa tctagaaata catgcataca atattacatt tgagaaattg 660 cgcgcatttc taatttcttt cttttacgta cgcatgaatg cagtgggccc acaccccaat 720 gtaaccagct ggttgccgtt gagccgaacg tacggcccgt gctggtcgtc ggcgaacagt 780 ggcagcagca atacggcgcc gccgccgtct gcggccgaca tactccggtc cgaccaacag 840 cgcggtgacc acatacaatg gacgctctc ctctcctct cctctcgc ctcgcctac 900 gaggaccaaa gaagacgctc aaacgtcacc ggcagtcaat caacggcttt tcctaccaa 960 gcttctctt tcaactttgg caaaacgag acacgtaa atactccaa ctagccgtca 1020 caaaaaaa taaactatac tacattagta atgaaactat atatttgtat ttctaaat 1080 taagtctaa cgaatttaa gaagtatagg atacggaaa agcaccgata gtcatgagtg 1140 catgacttca tccatcagga ttcaatcct agtgcccacg atatgctta gagcatgtat 1200 taaaggacac attcgtgaga agaaggtgtg gtgttatgtg tgtgtgtg tgtgtgcgta 1260 tacgtctgcc atgtaatcta aaaaagtat agaatacgt acgtacattt atcaatg 1320 tatatat actgccttta atttggtca ggggatgatg atcgagccgg ccgcaatcgg 1380 cggcggcgta agamggaggc agctcccgg agtggtccag acgttggtgc tggacacggc 1440 cagcgacgtg gcgtggttgc agtgcgcgcc atgcccagtg ccgccatgcc acccgcaaac 1500 ggacgtactc tacgatccca ccaagtcgtc ggagtccgcg gccttctcct gcaactcccc 1560 gacctgcgcc cagctcggcc cgtacgccaa tggctgcatc aaaccagt gccagtaccg 1620 cgtccagtac cccgacggca cgtccacggc gggcaactac gtctccgacc tgctcacgct 1680 caccgccacc gcctcggtct ccgccttcaa gttcgggtgc agccacgccg tgcagggtcg 1740 cttcagcagc agcaccgccg ggatcatggc cctaggcggc ggcccggagt ctctggtgtc 1800 gcagacggcg acaacctacg gccgcgtctt ctcccactgc ttcccgccgc ccacccgcgt 1860 gggcttcttc atcctcggcg tgccaagggt ggcagcatgg agatacgtgc tgactcccat 1920 gctcaacatc cccgccctcc cgccgacctt ttacatggta cgcctccagg ccatcaccgt 1980 tgccggccag cagctcgccg tgccccccac cgtcttctcc gccggcgcag tgctcgacac 2040 acgcaccgcc atcacgaggc tgccgccaac ggcgtaccag gcgctgcgcc aggcgttcag 2100 ggaccggatg acgatgtacc gtccggtcgc gcccaagggc atgctcgaca cctgctacga 2160 cctgaccggc gtggagagct tcgcgctgcc gaggatcacc ctcgtgttcg atgggaacgc 2220 cgccgtcgag ctcgacccgt cgggcatcct ctacgaggac tgcctcgcct tcgccgccag 2280 cgccaacgac caagtccccg ggatcatcgg caacgtgcag atgcagacga tcgaggtgct 2340 ctacaacatc cccgccggcc tcgtcggatt ccgccatgcc gcctgctga 2389 <210> 2 <211> 1500 <212> DNA <213> qRBSDV6R resistance gene (Oryza sativa L.) <400> 2 atggcaatgg cttgtgcagt agtactaccg ccgctgctac tgttttttgt tgtgctctct 60 ggctctaccg ctctcactga gcagcatgca gctggtgttg atgacatcaa ctacagtgtg 120 gtgctaacta gtagctggct gaatccaaag gccgtctgct cccggctgat gggcccacac 180 cccaatgtaa ccagctggtt gccgttgagc cgaacgtacg gcccgtgctg gtcgtcggcg 240 aacagtggca gcagcaatac ggcgccgccg ccgtctgcgg ccgacatact ccggtccgac 300 caacagcgcg gtgaccacat acaatggacg ctctccctct ccctctccct ctccgcctcc 360 gcctacgagg accaaagaag acgctcaaac gtcaccggca gtcaatcaac ggcttttcct 420 aaccaagctt cttctttcaa ctttggcaaa aacgagacaa cggggatgat gatcgagccg 480 gccgcaatcg gcggcggcgt agacaggagg cagcttcccg gagtggtcca gacgttggtg 540 ctggacacgg ccagcgacgt ggcgtggttg cagtgcgcgc catgcccagt gccgccatgc 600 cacccgcaaa cggacgtact ctacgatccc accaagtcgt cggagtccgc ggccttctcc 660 tgcaactccc cgacctgcgc ccagctcggc ccgtacgcca atggctgcat caacaaccag 720 tgccagtacc gcgtccagta ccccgacggc acgtccacgg cgggcaacta cgtctccgac 780 ctgctcacgc tcaccgccac cgcctcggtc tccgccttca agttcgggtg cagccacgcc 840 gtgcagggtc gcttcagcag cagcaccgcc gggatcatgg ccctaggcgg cggcccggag 900 tctctggtgt cgcagacggc gacaacctac ggccgcgtct tctcccactg cttcccgccg 960 cccacccgcg tgggcttctt catcctcggc gtgccaaggg tggcagcatg gagatacgtg 1020 ctgactccca tgctcaacat ccccgccctc ccgccgacct tttacatggt acgcctccag 1080 gccatcaccg ttgccggcca gcagctcgcc gtgcccccca ccgtcttctc cgccggcgca 1140 gtgctcgaca cacgcaccgc catcacgagg ctgccgccaa cggcgtacca ggcgctgcgc 1200 caggcgttca gggaccggat gacgatgtac cgtccggtcg cgcccaaggg catgctcgac 1260 acctgctacg acctgaccgg cgtggagagc ttcgcgctgc cgaggatcac cctcgtgttc 1320 gatgggaacg ccgccgtcga gctcgacccg tcgggcatcc tctacgagga ctgcctcgcc 1380 ttcgccgcca gcgccaacga ccaagtcccc gggatcatcg gcaacgtgca gatgcagacg 1440 atcgaggtgc tctacaacat ccccgccggc ctcgtcggat tccgccatgc cgcctgctga 1500 <210> 3 <211> 499 <212> PRT <213> qRBSDV6R resistance gene (Oryza sativa L.) <400> 3 Met Ala Met Ala Cys Ala Val Val Leu Pro Pro Leu Leu Leu Phe Phe 1 5 10 15 Val Val Leu Ser Gly Ser Thr Ala Leu Thr Glu Gln His Ala Ala Gly 20 25 30 Val Asp Asp Ile Asn Tyr Ser Val Val Leu Thr Ser Ser Trp Leu Asn 35 40 45 Pro Lys Ala Val Cys Ser Arg Leu Met Gly Pro His Pro Asn Val Thr 50 55 60 Ser Trp Leu Pro Leu Ser Arg Thr Tyr Gly Pro Cys Trp Ser Ser Ala 65 70 75 80 Asn Ser Gly Ser Ser Asn Thr Ala Pro Pro Pro Ser Ala Ala Asp Ile 85 90 95 Leu Arg Ser Asp Gln Gln Arg Gly Asp His Ile Gln Trp Thr Leu Ser 100 105 110 Leu Ser Leu Ser Leu Ser Ala Ser Ala Tyr Glu Asp Gln Arg Arg Arg 115 120 125 Ser Asn Val Thr Gly Ser Gln Ser Thr Ala Phe Pro Asn Gln Ala Ser 130 135 140 Ser Phe Asn Phe Gly Lys Asn Glu Thr Thr Gly Met Met Ile Glu Pro 145 150 155 160 Ala Ala Ile Gly Gly Gly Val Asp Arg Arg Gln Leu Pro Gly Val Val 165 170 175 Gln Thr Leu Val Leu Asp Thr Ala Ser Asp Val Ala Trp Leu Gln Cys 180 185 190 Ala Pro Cys Pro Val Pro Pro Cys His Pro Gln Thr Asp Val Leu Tyr 195 200 205 Asp Pro Thr Lys Ser Ser Glu Ser Ala Ala Phe Ser Cys Asn Ser Pro 210 215 220 Thr Cys Ala Gln Leu Gly Pro Tyr Ala Asn Gly Cys Ile Asn Asn Gln 225 230 235 240 Cys Gln Tyr Arg Val Gln Tyr Pro Asp Gly Thr Ser Thr Ala Gly Asn 245 250 255 Tyr Val Ser Asp Leu Leu Thr Leu Thr Ala Thr Ala Ser Val Ser Ala 260 265 270 Phe Lys Phe Gly Cys Ser His Ala Val Gln Gly Arg Phe Ser Ser Ser 275 280 285 Thr Ala Gly Ile Met Ala Leu Gly Gly Gly Pro Glu Ser Leu Val Ser 290 295 300 Gln Thr Ala Thr Thr Tyr Gly Arg Val Phe Ser His Cys Phe Pro Pro 305 310 315 320 Pro Thr Arg Val Gly Phe Phe Ile Leu Gly Val Pro Arg Val Ala Ala 325 330 335 Trp Arg Tyr Val Leu Thr Pro Met Leu Asn Ile Pro Ala Leu Pro Pro 340 345 350 Thr Phe Tyr Met Val Arg Leu Gln Ala Ile Thr Val Ala Gly Gln Gln 355 360 365 Leu Ala Val Pro Pro Thr Val Phe Ser Ala Gly Ala Val Leu Asp Thr 370 375 380 Arg Thr Ala Ile Thr Arg Leu Pro Pro Thr Ala Tyr Gln Ala Leu Arg 385 390 395 400 Gln Ala Phe Arg Asp Arg Met Thr Met Tyr Arg Pro Val Ala Pro Lys 405 410 415 Gly Met Leu Asp Thr Cys Tyr Asp Leu Thr Gly Val Glu Ser Phe Ala 420 425 430 Leu Pro Arg Ile Thr Leu Val Phe Asp Gly Asn Ala Ala Val Glu Leu 435 440 445 Asp Pro Ser Gly Ile Leu Tyr Glu Asp Cys Leu Ala Phe Ala Ala Ser 450 455 460 Ala Asn Asp Gln Val Pro Gly Ile Ile Gly Asn Val Gln Met Gln Thr 465 470 475 480 Ile Glu Val Leu Tyr Asn Ile Pro Ala Gly Leu Val Gly Phe Arg His 485 490 495 Ala Ala Cys <210> 4 <211> 2706 <212> DNA <213> qRBSDV6S gene (Oryza sativa L.) <400> 4 atggcaatgg cttgtgcagc actagtgccg ttgctactgt tgcttcttgt tgtgctctct 60 ggctctacat ctctcgctga ccacagtgca ggtgtagatg aggtcaacta catcgtggtg 120 ctaaccagca gctggctca gccaaattcc gtctgctcca gcctgagtac cgtctttatt 180 tttctctc ttctcctac tctctccgta atttttcat atataagttt atccaaattt 240 atagaaaatt agcaatactt ctaacacaaaaaatatat tatcaaata tattcaatgt 300 tacatttaat tgaaaactaa tttgggaccg tagatgttgc tacgtcctttt tacaaattta 360 atcaaaaaaaaactttga ctagaaaaaa aaaaaacg actttatata tgaacagag 420 gtagtagtac ctaagattaa aacttgaacg ttttataa gtagttaagt cagagcaatt 480 atactatttc ctcctattat aaatataaat catttatctt ctcgactctt tactagactt 540 tgccgtcgtt gggcaacttt taactatata ttctccttg tttaccttgg taaataact 600 ctctaacaa tgaaacgaat tattttggca tttaata attatta attatatcata 660 ttaataata taattgttgt acgtgtgt tagtgcccc acaccccac gtgaccaact 720 gggtcccgtt gagccgaccg tacggccgt gcagctccctc gccggcgaag ggtaggggcgg 780 cgccgtccac cgtcgacggc atgctctgt cggaccagca ccgcgccgac tacatacagt 840 ggaggctctc cggctcggtc gccggcgtgc tgcagcggc cgacgacgtg cggtgtcaa 900 ctaactacga acagcagtcc atagaaggag atcttaacta tggcacgtac taccctgcac 960 ctgcaccaat gtcatcaaag gtaaaattat ttaacccaca catatgcaaa aagaagtaaa 1020 ataattatat aacaataata ataattaacc tattactagt aattaattag aaagctaagt 1080 ttatataatt aaaaaaggtt aataattacc cacaatatat aatattaata aaattggcta 1140 gaacttctta tgcattattg attgatctga tgaaaagaat aatagatcta gaacttatta 1200 cattattgac gtacatgctg cttatcaaat tcaaattcaa cttctacgta tagtaacgaa 1260 aaaaataaat ttaacctttt ttttttacaa ttttcctttt tcttcctgga agtatcttct 1320 tagggagga agagatttcc tgttgttgtt gtttagatta aatgagagat caagatgtag 1380 taaagaactg gattctgatg ttataattta ttttttcttt tatatattaa taaaatctta 1440 acggtggtgg ctttccctgc tgtggttctt aaaaaaactt cttttttaag atgtagaagt 1500 tcaatttgat cttacatatt atttgtgcag tgatatatta catgttaata catcttgtca 1560 aattactttt tcataaccat ttaagtgata tgcaaattaa caacgtgacc ggacatctcc 1620 tcgagggatc gaaatatatt aaaacgtact cacatgctag ctgtccgatc tcaggcgatg 1680 aatccggccg ccaccggcgg cggcggcggc gggccgggag tgacccagac gatggtgctg 1740 gacacggcga gcgacgtgac atgggtgcag tgctcgccgt gccccacgcc gccgtgctac 1800 ccgcaaaagg acgtcctcta cgaccccacc aagtcgtcgt cgtccggcgt cttctcctgc 1860 aactcgccga cgtgcaccca gctcggcccc tacgccaatg gctgcaccaa caataaccag 1920 tgccagtacc gcgtccggta ccccgacggc acgtcgacgg cgggcaccta catctccgac 1980 ctgctgacca tcacccccgc caccgcagtc aggagcttcc agttcggctg cagccacggc 2040 gtgcagggca gcttcagctt cggcagcagc gccgccggga tcatggcact cggcggcggg 2100 ccggagtcac tggtgtcgca gacggcggcg acctacggcc gcgtcttctc ccactgcttc 2160 ccgccgccga cgcgccgggg attcttcacc ctcggcgtgc cgagggtggc cgcctggagg 2220 tacgtgctga cgccgatgct caagaacccg gccatcccgc ccacgttcta catggtgcgc 2280 ctcgaggcca tcgccgtcgc cgggcagcgg atcgccgtgc cgcccaccgt gttcgccgcc 2340 ggcgccgcgc tcgactcccg caccgccatc accaggctgc cgccgacggc gtaccaggcg 2400 ctgaggcagg cgttcaggga ccggatggcg atgtaccagc cggcgccgcc caagggcccg 2460 ctcgacacct gctacgacat ggccggcgtc cgcagcttcg cgctgccgag gatcacgctt 2520 gtgttcgaca agaacgccgc cgtcgagctc gatccgtcgg gcgtcctctt ccagggctgc 2580 ctcgccttca ccgccggccc caacgaccag gtccccggga tcatcggcaa catccagctt 2640 cagacgctcg aggtgctcta caacatcccc gccgccctcg tcggattccg ccatgccgcc 2700 tgctga 2706 <210> 5 <211> 494 <212> PRT <213> qRBSDV6S gene (Oryza sativa L.) <400> 5 Met Ala Met Ala Cys Ala Ala Leu Val Pro Leu Leu Leu Leu Leu Leu 1 5 10 15 Val Val Leu Ser Gly Ser Thr Ser Leu Ala Asp His Ser Ala Gly Val 20 25 30 Asp Glu Val Asn Tyr Ile Val Val Leu Thr Ser Ser Trp Leu Lys Pro 35 40 45 Asn Ser Val Cys Ser Ser Leu Met Ser Pro His Pro Asn Val Thr Asn 50 55 60 Trp Val Pro Leu Ser Arg Pro Tyr Gly Pro Cys Ser Ser Ser Pro Ala 65 70 75 80 Lys Gly Arg Ala Ala Pro Ser Thr Val Asp Gly Met Leu Trp Ser Asp 85 90 95 Gln His Arg Ala Asp Tyr Ile Gln Trp Arg Leu Ser Gly Ser Val Ala 100 105 110 Gly Val Leu Gln Pro Ala Asp Asp Val Pro Val Ser Thr Asn Tyr Glu 115 120 125 Gln Gln Ser Ile Glu Gly Asp Leu Asn Tyr Gly Thr Tyr Tyr Pro Ala 130 135 140 Pro Ala Pro Met Ser Ser Lys Ala Met Asn Pro Ala Ala Thr Gly Gly 145 150 155 160 Gly Gly Gly Gly Pro Gly Val Thr Gln Thr Met Val Leu Asp Thr Ala 165 170 175 Ser Asp Val Thr Trp Val Gln Cys Ser Pro Cys Pro Thr Pro Pro Cys 180 185 190 Tyr Pro Gln Lys Asp Val Leu Tyr Asp Pro Thr Lys Ser Ser Ser Ser 195 200 205 Gly Val Phe Ser Cys Asn Ser Pro Thr Cys Thr Gln Leu Gly Pro Tyr 210 215 220 Ala Asn Gly Cys Thr Asn Asn Asn Gln Cys Gln Tyr Arg Val Arg Tyr 225 230 235 240 Pro Asp Gly Thr Ser Thr Ala Gly Thr Tyr Ile Ser Asp Leu Leu Thr 245 250 255 Ile Thr Pro Ala Thr Ala Val Arg Ser Phe Gln Phe Gly Cys Ser His 260 265 270 Gly Val Gln Gly Ser Phe Ser Phe Gly Ser Ser Ala Ala Gly Ile Met 275 280 285 Ala Leu Gly Gly Gly Pro Glu Ser Leu Val Ser Gln Thr Ala Ala Thr 290 295 300 Tyr Gly Arg Val Phe Ser His Cys Phe Pro Pro Pro Thr Arg Arg Gly 305 310 315 320 Phe Phe Thr Leu Gly Val Pro Arg Val Ala Ala Trp Arg Tyr Val Leu 325 330 335 Thr Pro Met Leu Lys Asn Pro Ala Ile Pro Pro Thr Phe Tyr Met Val 340 345 350 Arg Leu Glu Ala Ile Ala Val Ala Gly Gln Arg Ile Ala Val Pro Pro 355 360 365 Thr Val Phe Ala Ala Gly Ala Ala Leu Asp Ser Arg Thr Ala Ile Thr 370 375 380 Arg Leu Pro Pro Thr Ala Tyr Gln Ala Leu Arg Gln Ala Phe Arg Asp 385 390 395 400 Arg Met Ala Met Tyr Gln Pro Ala Pro Pro Lys Gly Pro Leu Asp Thr 405 410 415 Cys Tyr Asp Met Ala Gly Val Arg Ser Phe Ala Leu Pro Arg Ile Thr 420 425 430 Leu Val Phe Asp Lys Asn Ala Ala Val Glu Leu Asp Pro Ser Gly Val 435 440 445 Leu Phe Gln Gly Cys Leu Ala Phe Thr Ala Gly Pro Asn Asp Gln Val 450 455 460 Pro Gly Ile Ile Gly Asn Ile Gln Leu Gln Thr Leu Glu Val Leu Tyr 465 470 475 480 Asn Ile Pro Ala Ala Leu Val Gly Phe Arg His Ala Ala Cys 485 490

Claims

1. A QRBSDV6 R A resistance gene, characterized in that Said QRBSDV6 R The resistance gene sequence is shown in SEQ ID NO.

2.

2. The method according to claim 1 QRBSDV6 R The protein encoded by the resistance gene, the amino acid sequence of the protein is shown in SEQ ID NO.

3.

3. An expression cassette or a recombinant vector containing the QRBSDV6 R Resistance genes.

4. Use of the protein according to claim 2 in the prevention and treatment of southern rice black-streaked dwarf disease.

Images