A rapid labeling method for intestinal cell migration in fish

Abstract

The present invention discloses a method for in vivo labeling of fish. After injecting a solution of 5-bromo-2'-deoxyuridine into the abdominal cavity of the fish according to the required injection dose, a fluorescent probe FITC-Keratin is then injected into the abdominal cavity of the fish. Subsequently, the intestinal support of the live fish is made into frozen sections, which are then subjected to antigen repair, circle sealing, addition of primary antibody, addition of secondary antibody, spontaneous fluorescence quenching, DAPI nuclear counterstaining, and then microscopic examination and photographing to collect images. The present invention is safe, efficient and accurate, and creatively combines the BrdU in vivo labeling method with the fluorescent probe technology and applies it to the research on the proliferation and migration of fish intestinal epithelial cells, providing a technical approach for studying the promoting effect of exogenous substances on the proliferation and migration of fish intestinal epithelial cells, and having very important significance for the efficient and healthy aquaculture of fish.

Description

Technical Field

[0001] The present invention relates to a method for in vivo labeling, in particular to a rapid labeling method for intestinal cell migration in fish. Background Art

[0002] Aquaculture is one of the fastest-growing industries in the food production industry, providing a large amount of high-quality animal protein for humans. However, due to the intensive farming environment, farmed fish often suffer from various pathogenic infections, causing significant economic losses. Most infections occur in the mucosa (especially the intestinal mucosa). Due to contact with a large number of bacteria, viruses, biological toxins, and chemical toxins in the intestinal lumen, the intestinal mucosal tissue becomes the most threatened part of fish. In addition, studies have shown that after high plant protein replaces fish meal, it is easy to cause liver and intestinal damage in fish, triggering a series of immune-mediated diseases. These factors all limit the sustainable development of aquaculture.

[0003] Existing research scholars have adopted the method of preventing and treating fish intestinal inflammation with Chinese herbal medicines and achieved good results. For example, some Chinese herbal medicines such as curcumin and berberine can improve the intestinal health of fish, but their pharmacological effects need to be further studied and the mechanism of action is not very clear.

[0004] In in vitro studies, it has been found that curcumin can promote cell proliferation and migration. However, in in vivo experiments, how to verify that these drugs can indeed promote intestinal cell proliferation and migration in live fish requires the development and design of a method for in vivo labeling of fish intestinal cell migration. Summary of the Invention

[0005] The present invention is to solve the problem that it is currently impossible to verify that drugs can promote intestinal cell proliferation and migration in live fish, and provides a rapid labeling method for intestinal cell migration in fish that is safe, efficient, and accurate.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] A rapid labeling method for intestinal cell migration in fish of the present invention includes the following steps:

[0008] (1) Select a live fish that has ingested an exogenous substance, and inject a solution of 5-bromo-2'-deoxyuridine (BrdU) into the abdominal part of the fish at an injection dose of 50 mg / kg.

[0009] (2) Inject the fluorescent probe FITC-Keratin into the abdomen of the fish according to the required injection dose, and the nucleotide sequence of the fluorescent probe FITC-Keratin is shown in SEQ ID No. 1. The nucleotide sequence of the fluorescent probe FITC-Keratin is ATTCATGCCATGCTTTGACCTCCTCCTGGTTCTTC; in order to improve its targeting accuracy, the nucleotide sequence of the fluorescent probe FITC-Keratin is preferably treated with thiophosphorylation and locked nucleic acid modification, and the nucleotide sequence of the fluorescent probe FITC-Keratin after thiophosphorylation and locked nucleic acid modification is: / A+ / * / T+ / * / T+ / * / T+ / *C*A*T*G*C*C*A*T*G*C*T*T*T*G*A*C*C*T*C*C*T*C*C*T*G*G*T*T*C* / T+ / * / T+ / * / C+ / (* represents thiophosphorylation, / A+ / represents locked nucleic acid modification).

[0010] (3) 24 hours after injection, intestinal tissue was obtained from the living fish and fixed in a tissue fixative to obtain a fixed sample.

[0011] (4) Prepare frozen sections from fixed samples.

[0012] (5) Perform antigen retrieval on frozen sections.

[0013] (6) Circle blocking: After the slices obtained in step (5) are slightly shaken dry, a circle is drawn on the slide around the tissue using a histochemical pen, and a blocking solution is added to the circle and incubated at room temperature for 30 min; the blocking solution is 5% BSA.

[0014] (7) Add primary antibody: shake off the blocking solution, add primary antibody to the slice, and then place it flat in a humidified box and incubate overnight at 4°C.

[0015] (8) Adding secondary antibody: Place the slide in PBS buffer, shake and wash on a decolorizing shaker, shake the slices dry, then add secondary antibody of the same species as the primary antibody in the circle to cover the tissue and incubate at room temperature away from light.

[0016] (9) Autofluorescence quenching: Place the slide in PBS buffer, shake and wash on a decolorizing shaker, add autofluorescence quencher into the circle, and rinse with running water after quenching.

[0017] (10) DAPI counterstaining of cell nuclei: Place the slide in PBS buffer, shake and wash on a decolorizing shaker, spin dry the sections, and seal them with anti-fluorescence quenching sealing medium.

[0018] (11) Microscopic examination and photography: Observe the slices under a fluorescence microscope and collect images.

[0019] Preferably, in step (1), live fish that have been fed with exogenous substances for eight weeks are selected.

[0020] Preferably, in step (3), the tissue fixative is 4% PFA solution.

[0021] Preferably, in step (4), the frozen section is prepared by the following method:

[0022] (i) Dehydration: The intestinal tissue was removed from the fixative and placed in a 15% sucrose solution in a 4°C refrigerator for dehydration and sedimentation. The tissue was then transferred to a 30% sucrose solution in a 4°C refrigerator for dehydration and sedimentation.

[0023] (ii) OCT embedding: Take out the dehydrated intestinal tissue and slightly absorb the surface water with filter paper. Use a scalpel to flatten the tissue of the target area and place it on the sample holder with the cut surface facing up. Drop OCT embedding agent around the tissue and place the sample holder on the quick-freezing table of the freezing microtome for quick freezing and embedding. After the OCT turns white and hard, it can be sectioned.

[0024] (iii) Sectioning: Fix the sample holder on the slicer, make a rough cut to make the tissue surface smooth before starting sectioning. The thickness of the slice should be 8-10 μm. Place a clean glass slide flat on the cut tissue slice and then attach the tissue to the glass slide.

[0025] Preferably, in step (5), the specific steps of antigen repair are: placing the tissue section in a repair box filled with EDTA antigen repair solution with a pH of 8.0 and performing antigen repair in a microwave oven, heating at medium heat for 10 minutes, stopping the heat for 10 minutes, and switching to medium-low heat for 7 minutes. After natural cooling, the slide is placed in PBS buffer with a pH of 7.4 and washed by shaking on a decolorizing shaker.

[0026] 5-Bromo-2'-deoxyuridine (BrdU) is an analogue of the DNA precursor thymidine and can selectively incorporate into the single-stranded DNA nucleotide sequence of cells in the S phase (i.e., the DNA synthesis phase) of the cell cycle. By introducing the tracable precursor substance BrdU for DNA synthesis in vivo, proliferating cells can competitively replace thymidine and incorporate it, becoming an important marker of cell proliferation. However, BrdU can incorporate into all cells in the cell DNA synthesis phase, and the resulting results will be mixed with the positive results of other cells. Keratin is a specific cytoskeletal protein present on the surface of epithelial cells and is a characteristic marker for the growth, differentiation, and maturation of epithelial cells. Therefore, in the present invention, an FITC-Keratin probe is designed to target intestinal epithelial cells, combined with BrdU in vivo labeling and fluorescence probe technology, and subsequent fluorescence immunization is performed through frozen sections to ensure that the cells after fluorescence immunization are intestinal epithelial cells rather than other cells in the intestine, so as to observe the proliferation and migration effects of exogenous substances on the intestinal epithelial cells of fish.

[0027] Preferably, in step (6), the blocking solution is 5% BSA blocking solution.

[0028] Preferably, in step (7), the primary antibody is rabbit-derived CK-18.

[0029] Preferably, in step (8), the secondary antibody is rabbit-derived CK-18.

[0030] Preferably, in step (9), the autofluorescence quencher is Servicebio G1221.

[0031] Preferably, in step (10), the anti-fluorescence quenching mounting medium is Servicebio G1401.

[0032] Therefore, the present invention has the following beneficial effects: It provides a safe, efficient, and accurate in vivo labeling method for fish, and creatively combines the BrdU in vivo labeling method with fluorescence probe technology and applies it to the research on the proliferation and migration of fish intestinal epithelial cells, providing a technical approach for studying the promoting effects of exogenous substances on the proliferation and migration of fish intestinal epithelial cells, which is of great significance for the efficient and healthy aquaculture of fish. Description of the Drawings

[0033] Figure 1 It is the color development result of the frozen section in Example 1.

[0034] Figure 2 It is the color development result of the frozen section in Example 2.

[0035] Figure 3This is the color development result of the frozen section in Example 3. DETAILED DESCRIPTION

[0036] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments.

[0037] Example 1

[0038] (1) Live fish (yellow croaker) that had been fed exogenous substances (curcumin) for eight weeks were selected, and BrdU solution was injected into the abdomen of the fish according to the required injection dose.

[0039] (2) The fluorescent probe FITC-Keratin was injected into the abdomen of the fish at an injection dose of 50 mg / kg. The nucleotide sequence of the fluorescent probe FITC-Keratin is shown in SEQ ID No. 1.

[0040] (3) 24 hours after injection, the intestinal tissue of the living fish was collected and fixed in a tissue fixative (4% PFA solution) to obtain a fixed sample.

[0041] (4) Preparing frozen sections from fixed samples; the frozen sections are prepared by the following method:

[0042] (i) Dehydration: The intestinal tissue was removed from the fixative and placed in a 15% sucrose solution in a 4°C refrigerator for dehydration and sedimentation. The tissue was then transferred to a 30% sucrose solution in a 4°C refrigerator for dehydration and sedimentation.

[0043] (ii) OCT embedding: Take out the dehydrated intestinal tissue and slightly absorb the surface water with filter paper. Use a scalpel to flatten the tissue of the target area and place it on the sample holder with the cut surface facing up. Drop OCT embedding agent around the tissue and place the sample holder on the quick-freezing table of the freezing microtome for quick freezing and embedding. After the OCT turns white and hard, it can be sectioned.

[0044] (iii) Sectioning: Fix the sample holder on the slicer, make a rough cut to make the tissue surface smooth before starting sectioning. The thickness of the slice should be 8-10 μm. Place a clean glass slide flat on the cut tissue slice and then attach the tissue to the glass slide.

[0045] (5) Perform antigen repair on frozen sections. The specific steps of antigen repair are as follows: place the tissue sections in a repair box filled with EDTA antigen repair solution (pH 8.0) in a microwave oven for antigen repair. Heat at medium heat for 10 minutes, then stop for 10 minutes and switch to medium-low heat for 7 minutes. After natural cooling, place the slides in PBS buffer (pH 7.4) and wash them by shaking on a decolorizing shaker.

[0046] (6) Circle blocking: After the slices obtained in step (5) are slightly shaken dry, a circle is drawn on the slide around the tissue using a histochemical pen, and a blocking solution is added to the circle and incubated at room temperature for 30 min; the blocking solution is 5% BSA blocking solution.

[0047] (7) Add primary antibody: shake off the blocking solution, add primary antibody to the slice, and then place it flat in a humidified box and incubate overnight at 4°C. The primary antibody is rabbit CK-18.

[0048] (8) Adding secondary antibody: Place the slide in PBS buffer, shake and wash on a decolorizing shaker, shake the slices dry, and then add a secondary antibody of the same species as the primary antibody to cover the tissue. Incubate at room temperature in the dark. The secondary antibody is goat anti-rabbit IgG H&L.

[0049] (9) Autofluorescence quenching: Place the slide in PBS buffer, shake and wash on a decolorizing shaker, add an autofluorescence quencher into the circle, and rinse with running water after quenching. The autofluorescence quencher is Servicebio G1221.

[0050] (10) DAPI counterstaining of cell nuclei: Place the slide in PBS buffer, shake and wash on a decolorizing shaker, spin dry the sections, and then seal them with an anti-fluorescence quenching sealant (Servicebio G1401).

[0051] (11) Microscopic examination and photography: The slices are placed under a fluorescence microscope for observation and the images are collected. Figure 1 shown.

[0052] Example 2

[0053] (1) Select live fish (yellow croaker) that have been fed exogenous substances (berberine) for eight weeks, and inject BrdU solution into the abdomen of the fish according to the required injection dose.

[0054] (2) The fluorescent probe FITC-Keratin was injected into the abdomen of the fish at an injection dose of 50 mg / kg. The nucleotide sequence of the fluorescent probe FITC-Keratin is shown in SEQ ID No. 1.

[0055] (3) 24 hours after injection, the intestinal tissue of the living fish was collected and fixed in a tissue fixative (4% PFA solution) to obtain a fixed sample.

[0056] (4) Preparing frozen sections from fixed samples; the frozen sections are prepared by the following method:

[0057] (i) Dehydration: The intestinal tissue was removed from the fixative and placed in a 15% sucrose solution in a 4°C refrigerator for dehydration and sedimentation. The tissue was then transferred to a 30% sucrose solution in a 4°C refrigerator for dehydration and sedimentation.

[0058] (ii) OCT embedding: Take out the dehydrated intestinal tissue and slightly absorb the surface water with filter paper. Use a scalpel to flatten the tissue of the target area and place it on the sample holder with the cut surface facing up. Drop OCT embedding agent around the tissue and place the sample holder on the quick-freezing table of the freezing microtome for quick freezing and embedding. After the OCT turns white and hard, it can be sectioned.

[0059] (iii) Sectioning: Fix the sample holder on the slicer, make a rough cut to make the tissue surface smooth before starting sectioning. The thickness of the slice should be 8-10 μm. Place a clean glass slide flat on the cut tissue slice and then attach the tissue to the glass slide.

[0060] (5) Perform antigen repair on frozen sections. The specific steps of antigen repair are as follows: place the tissue sections in a repair box filled with EDTA antigen repair solution (pH 8.0) in a microwave oven for antigen repair. Heat at medium heat for 10 minutes, then stop for 10 minutes and switch to medium-low heat for 7 minutes. After natural cooling, place the slides in PBS buffer (pH 7.4) and wash them by shaking on a decolorizing shaker.

[0061] (6) Circle blocking: After the slices obtained in step (5) are slightly shaken dry, a circle is drawn on the slide around the tissue using a histochemical pen, and a blocking solution is added to the circle and incubated at room temperature for 30 min; the blocking solution is 5% BSA blocking solution.

[0062] (7) Add primary antibody: shake off the blocking solution, add primary antibody to the slice, and then place it flat in a humidified box and incubate overnight at 4°C. The primary antibody is rabbit CK-18.

[0063] (8) Adding secondary antibody: Place the slide in PBS buffer, shake and wash on a decolorizing shaker, shake the slices dry, and then add a secondary antibody of the same species as the primary antibody to cover the tissue. Incubate at room temperature in the dark. The secondary antibody is goat anti-rabbit IgG H&L.

[0064] (9) Autofluorescence quenching: Place the slide in PBS buffer, shake and wash on a decolorizing shaker, add an autofluorescence quencher into the circle, and rinse with running water after quenching. The autofluorescence quencher is Servicebio G1221.

[0065] (10) DAPI counterstaining of cell nuclei: Place the slide in PBS buffer, shake and wash on a decolorizing shaker, spin dry the sections, and then seal them with an anti-fluorescence quenching sealant (Servicebio G1401).

[0066] (11) Microscopic examination and photography: The slices are placed under a fluorescence microscope for observation and the images are collected. Figure 2 shown.

[0067] Example 3

[0068] (1) Live fish (yellow croaker) that had been fed exogenous substances (curcumin and berberine) for eight weeks were selected, and BrdU solution was injected into the abdomen of the fish according to the required injection dose.

[0069] (2) The fluorescent probe FITC-Keratin was injected into the abdomen of the fish at a dose of 50 mg / kg. The nucleotide sequence of the fluorescent probe FITC-Keratin is shown in SEQ ID No. 1.

[0070] (3) 24 hours after injection, the intestinal tissue of the living fish was collected and fixed in a tissue fixative (4% PFA solution) to obtain a fixed sample.

[0071] (4) Preparing frozen sections from fixed samples; the frozen sections are prepared by the following method:

[0072] (i) Dehydration: The intestinal tissue was removed from the fixative and placed in a 15% sucrose solution in a 4°C refrigerator for dehydration and sedimentation. The tissue was then transferred to a 30% sucrose solution in a 4°C refrigerator for dehydration and sedimentation.

[0073] (ii) OCT embedding: Take out the dehydrated intestinal tissue and slightly absorb the surface water with filter paper. Use a scalpel to flatten the tissue of the target area and place it on the sample holder with the cut surface facing up. Drop OCT embedding agent around the tissue and place the sample holder on the quick-freezing table of the freezing microtome for quick freezing and embedding. After the OCT turns white and hard, it can be sectioned.

[0074] (iii) Sectioning: Fix the sample holder on the slicer, make a rough cut to make the tissue surface smooth before starting sectioning. The thickness of the slice should be 8-10 μm. Place a clean glass slide flat on the cut tissue slice and then attach the tissue to the glass slide.

[0075] (5) Perform antigen repair on frozen sections. The specific steps of antigen repair are as follows: place the tissue sections in a repair box filled with EDTA antigen repair solution (pH 8.0) in a microwave oven for antigen repair. Heat at medium heat for 10 minutes, then stop for 10 minutes and switch to medium-low heat for 7 minutes. After natural cooling, place the slides in PBS buffer (pH 7.4) and wash them by shaking on a decolorizing shaker.

[0076] (6) Circle blocking: After the slices obtained in step (5) are slightly shaken dry, a circle is drawn on the slide around the tissue using a histochemical pen, and a blocking solution is added to the circle and incubated at room temperature for 30 min; the blocking solution is 5% BSA blocking solution.

[0077] (7) Add primary antibody: shake off the blocking solution, add primary antibody to the slice, and then place it flat in a humidified box and incubate overnight at 4°C. The primary antibody is rabbit CK-18.

[0078] (8) Adding secondary antibody: Place the slide in PBS buffer, wash it on a shaker, then gently shake off the excess liquid. Add the secondary antibody corresponding to the primary antibody in the circle to cover the tissue, and incubate at room temperature in the dark. The secondary antibody is goat anti-rabbit IgG H&L.

[0079] (9) Spontaneous fluorescence quenching: Place the slide in PBS buffer, wash it on a shaker, then add the spontaneous fluorescence quenching agent in the circle. After quenching, rinse with running water. The spontaneous fluorescence quenching agent is Servicebio G1221.

[0080] (10) DAPI counterstaining of cell nuclei: Place the slide in PBS buffer, wash it on a shaker, then shake off the excess liquid and mount the slide with an anti-fluorescence quenching mounting medium. The anti-fluorescence quenching mounting medium is Servicebio G1401.

[0081] (11) Microscopic examination and photography: Observe the section under a fluorescence microscope and collect images. The collected images are as Figure 3 shown.

[0082] From the color development results of the frozen sections in Examples 1 to 3, it can be seen that the color development results of the intestinal tissue are the color development results of BrdU and FITC-Keratin. The binding site is the epithelial cells, and the migration of epithelial cells can be clearly seen.

[0083] The above-described embodiments are only a preferred solution of the present invention, and do not impose any form of limitation on the present invention. There are other variations and modifications without exceeding the technical solutions recorded in the claims. SEQUENCE LISTING <110> Zhejiang Ocean Fisheries Research Institute <120> A rapid labeling method for intestinal cell migration in fish <130> 2022 <160> 1 <170> PatentIn version 3.3 <210> 1 <211> 35 <212> DNA <213> Artificial sequence <400> 1 attcatgcca tgctttgacc tcctcctggt tcttc 35

Claims

1. A rapid labeling method for intestinal cell migration in fish, characterized in that, The following steps are involved: (1) Obtain intestinal tissue from live fish that have been injected with 5-bromo-2-deoxyuridine solution and fluorescent probe FITC-Keratin into the abdomen eight weeks after ingesting exogenous substances, and fix the intestinal tissue in a tissue fixative to obtain a fixed sample; Wherein, the intestinal tissue is taken 24 hours after injection; The 5-bromo-2-deoxyuridine solution is injected at an injection dose of 50 mg / kg; The fluorescent probe FITC-Keratin is injected at a dose of 50 mg / kg, and the nucleotide sequence of the fluorescent probe FITC-Keratin is shown in SEQ ID No. 1; The exogenous substance is curcumin and / or berberine; (2) Making frozen sections of fixed samples; (3) Perform antigen retrieval on frozen sections; (4) Circle sealing: After drying the slices obtained in step (3), use a tissue pen to draw a circle on the slide around the tissue, and add a drop of blocking solution in the circle and incubate at room temperature for 30 minutes; (5) Add primary antibody: shake off the blocking solution, add primary antibody to the slice, and then place it flat in a humidified box and incubate overnight at 4°C. (6) Adding secondary antibody: Place the slide in PBS buffer, shake and wash on a decolorizing shaker, spin dry the sections, add secondary antibody of the same species as the primary antibody in the circle to cover the tissue, and incubate at room temperature away from light; (7) Autofluorescence quenching: Place the slide in PBS buffer, shake and wash on a decolorizing shaker, add autofluorescence quencher into the circle, and rinse with running water after quenching; (8) DAPI counterstaining of cell nuclei: Place the slide in PBS buffer, shake and wash on a decolorizing shaker, spin dry the sections, and seal with an anti-fluorescence quenching sealant; (9) Microscopic examination and photography: Observe the slices under a fluorescence microscope and collect images.

2. A rapid labeling method for intestinal cell migration in fish body according to claim 1, characterized in that, In step (1), the tissue fixative is a 4% PFA solution.

3. A rapid labeling method for intestinal cell migration in fish body according to claim 1, characterized in that, In step (2), the frozen section is prepared by the following method: (i) Dehydration: The intestinal tissue was removed from the fixative and placed in a 15% sucrose solution in a 4°C refrigerator to dehydrate and sink to the bottom. Then, the tissue was transferred to a 30% sucrose solution in a 4°C refrigerator to dehydrate and sink to the bottom. (ii) OCT embedding: Take out the dehydrated intestinal tissue and dry the surface water with filter paper. Use a scalpel to trim the target tissue and place it on the sample holder with the cut surface facing up. Drop OCT embedding agent around the tissue and place the sample holder on the quick-freezing table of the freezing microtome for quick freezing and embedding. When the OCT turns white and hard, it can be sliced; (iii) Sectioning: Fix the sample holder on the slicer, make a rough cut to make the tissue surface smooth before starting sectioning. The thickness of the slice should be 8-10 μm. Place a clean glass slide flat on the cut tissue slice and then attach the tissue to the glass slide.

4. A rapid labeling method for intestinal cell migration in fish body according to claim 1, characterized in that In step (3), the specific steps of antigen repair are as follows: the tissue sections are placed in a repair box filled with EDTA antigen repair solution at pH 8.0 and subjected to antigen repair in a microwave oven, with medium heat for 10 minutes, then turned off for 10 minutes and switched to medium-low heat for 7 minutes. After natural cooling, the slides are placed in PBS buffer at pH 7.4 and washed by shaking on a decolorizing shaker.

5. A rapid labeling method for intestinal cell migration in fish bodies according to claim 1, characterized in that In step (4), the blocking solution is 5% BSA blocking solution.

6. A rapid labeling method for intestinal cell migration in fish bodies according to claim 1, characterized in that In step (5), the primary antibody is rabbit-derived CK-18.

7. A rapid labeling method for intestinal cell migration in fish body according to claim 1, characterized in that, In step (6), the secondary antibody is rabbit-derived CK-18.

8. A rapid labeling method for intestinal cell migration in fish body according to claim 1, characterized in that In step (7), the autofluorescence quencher is Servicebio G1221.

9. A rapid labeling method for intestinal cell migration in fish body according to claim 1, characterized in that, In step (8), the anti-fluorescence quenching mounting medium is Servicebio G1401.

Images