Nested primer pair, sequencing primer pair, sequencing reagent, sequencing kit for sequencing of gene cds region and application thereof

By designing nested primer pairs and sequencing primer pairs, the problem of unstable fluorescence signals in first-generation sequencing was solved, enabling the complete acquisition of gene CDS region sequences, shortening the experimental cycle and reducing costs.

CN114908151BActive Publication Date: 2026-02-03SHANGHAI BIOGERM MEDICAL TECH CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202210474255.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-04-29
Publication Date
2026-02-03
Estimated Expiration
2042-04-29

AI Technical Summary

Technical Problem

Current first-generation sequencing technologies suffer from unstable fluorescence signals when reading gene CDS regions, making it impossible to obtain effective target gene CDS sequences. Furthermore, existing methods prolong the experimental cycle and increase experimental costs.

Method used

A nested primer pair, including forward and reverse nested primers, was designed. Combined with specific sequencing primer pairs, the read length was extended by using nested primer pairs to obtain the complete CDS sequence. The universal sequence and the target gene CDS sequence were distinguished by random base sequences.

Benefits of technology

This shortened the experimental cycle, reduced experimental costs, and ensured the integrity and accuracy of the gene CDS region sequence.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN114908151B_ABST
    Figure CN114908151B_ABST
Patent Text Reader

Abstract

The application relates to the technical field of gene detection, in particular to a nested primer pair for CDS region sequencing of a gene, a sequencing primer pair, sequencing reagents, a sequencing kit and application. A pair of universal nested primers connected in front of specific amplification primers is designed and developed, and a pair of sequencing primers is designed for the primers. The primers have two functional regions, the universal primer sequence region is used to prolong the first-generation sequencing reading length and obtain effective target gene CDS sequences; the random base sequence is used as a bridge sequence and is used to distinguish the universal primer sequence and the specific amplification target gene sequence, so that the CDS sequence of the target gene can be quickly identified in the amplification product. Finally, the sequencing primer is used as a universal sequencing primer for first-generation sequencing, which can reduce the complexity of the sequencing operation. In summary, the application can not only shorten the experimental period, but also reduce the experimental cost.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of gene detection, in particular to a nested primer pair for CDS region sequencing of a gene, a sequencing primer pair, a sequencing reagent, a sequencing kit and application. BACKGROUND

[0002] First-generation sequencing, also known as Sanger sequencing, has the main feature of long read length, which can read 600bps-1000bps of base at a time. It is still the gold standard of correctness, with an accuracy of 99.999%. However, due to the instability of the initial current and voltage of the sequencing instrument, the fluorescence signal is unstable when reading the base sequence about 50bps downstream of the 5' end, so that the effective CDS region sequence of the target gene cannot be obtained. In order to obtain the CDS region sequence of the target gene, the main method adopted at present is to design a primer at the base sequence about 100bps downstream of the 5' end for reverse sequencing, and then realize the splicing through two sequences. The limitation of this method is that it prolongs the experimental period and increases the experimental cost.

[0003] In view of this, the present application is proposed. SUMMARY

[0004] The purpose of the present application is to provide a nested primer pair for CDS region sequencing of a gene, which prolongs the read length of first-generation sequencing to obtain the complete CDS sequence of the target gene.

[0005] The second purpose of the present application is to provide a sequencing primer pair specifically combined with the above-mentioned nested primer pair, and a reagent and kit comprising the above-mentioned nested primer pair and sequencing primer pair, which is expected to obtain the complete and effective CDS sequence by amplifying the nested primer pair as a template through the sequencing primer pair.

[0006] In order to solve the above technical problems and achieve the above purposes, the present application provides the following technical solutions:

[0007] In the first aspect, the present application provides a nested primer pair for CDS region sequencing of a gene, which comprises a forward nested primer and a reverse nested primer. The nucleotide sequence of the forward nested primer comprises a first universal sequence and a random base sequence connected in order from 5' end to 3' end. The nucleotide sequence of the reverse nested primer comprises a second universal sequence and a random base sequence connected in order from 5' end to 3' end. The nucleotide length of the first universal sequence and the second universal sequence is 55-80bps, and the length of the random base sequence is 5-10bps.

[0008] In an optional embodiment, the first universal sequence and the second universal sequence have a nucleotide length of 60 bps, and the random base sequence has a length of 6 bps.

[0009] In an optional embodiment, the first universal sequence is shown in SEQ ID No. 1, and the second universal sequence is shown in SEQ ID No. 2.

[0010] In a second aspect, the present application provides an application of the nested primer pair in the preparation of a CDS region sequencing product of a gene.

[0011] In a third aspect, the present application provides a sequencing primer pair for the first-generation sequencing of a CDS region of a gene, wherein the sequencing primer pair comprises a forward sequencing primer and a reverse sequencing primer, each having a length of 18-30 bps, the nucleotide sequence of the forward sequencing primer is identical to or complementary to a nucleotide fragment at the 5' end of the first universal sequence according to any one of the preceding embodiments, and the nucleotide sequence of the reverse sequencing primer is identical to or complementary to a nucleotide fragment at the 5' end of the second universal sequence according to any one of the preceding embodiments.

[0012] In an optional embodiment, the specific nucleotide sequence of the forward sequencing primer is shown in SEQ ID No. 3, and the specific nucleotide sequence of the reverse sequencing primer is shown in SEQ ID No. 4.

[0013] In a fourth aspect, the present application provides a universal sequencing reagent for the first-generation sequencing of a CDS region of a gene, wherein the sequencing reagent comprises the nested primer pair and the sequencing primer pair according to any one of the preceding embodiments.

[0014] In a fifth aspect, the present application provides a universal sequencing kit for the first-generation sequencing of a CDS region of a gene, wherein the kit comprises the universal sequencing reagent according to the preceding embodiments and optional consumables.

[0015] In a sixth aspect, the present application provides an application of the universal sequencing reagent or the universal sequencing kit according to the preceding embodiments in the sequencing of a CDS region of a target gene.

[0016] In an optional embodiment, the target gene comprises an HA gene, an NA gene, a PB1 gene, a PB2 gene, an NP gene, an MP gene, a PA gene, or an NS gene of an influenza virus.

[0017] This invention designs and develops a pair of universal nested primers connected to specific amplification primers, and simultaneously designs a pair of sequencing primers for these primers. First, the synthesized specific primers connected to these generalized primers do not affect the specific amplification of the gene. Second, these primers possess two functional regions: the universal primer sequence region extends the read length of first-generation sequencing, obtaining an effective target gene CDS sequence; the random base sequence acts as a bridging sequence, distinguishing the universal primer sequence from the specifically amplified target gene sequence, thus enabling rapid identification of the target gene's CDS sequence in the amplification product. Finally, the sequencing primers serve as universal sequencing primers for first-generation sequencing, reducing the complexity of the sequencing process. In summary, this invention not only shortens the experimental cycle but also reduces experimental costs. Attached Figure Description

[0018] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0019] Figure 1 The electrophoresis results of the HA gene amplification product of influenza B obtained in Example 1 of this invention;

[0020] Figure 2 The sequencing results of the forward sequence obtained in Example 1 of this invention;

[0021] Figure 3 The sequencing results of the reverse sequence obtained in Example 1 of this invention;

[0022] Figure 4 This is the blast result of the forward sequence obtained in Example 1 of the present invention;

[0023] Figure 5 The blast result of the reverse sequence obtained in Example 1 of this invention;

[0024] Figure 6 The alignment results are those of forward sequencing of Example 1, Comparative Example 1, and reference sequence of the present invention;

[0025] Figure 7 This is a comparison of the reverse sequencing results of Example 1, Comparative Example 1, and the reference sequence of the present invention. Detailed Implementation

[0026] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. The components of the embodiments of the present invention described and shown in the accompanying drawings can generally be arranged and designed in various different configurations.

[0027] Therefore, the following detailed description of the embodiments of the invention provided in the accompanying drawings is not intended to limit the scope of the claimed invention, but merely to illustrate selected embodiments of the invention. All other embodiments obtained by those skilled in the art based on the embodiments of the invention without inventive effort are within the scope of protection of the invention.

[0028] It should be noted that similar reference numerals and letters in the following figures indicate similar items; therefore, once an item is defined in one figure, it does not need to be further defined and explained in subsequent figures. Furthermore, the terms "first" and "second" are used only to distinguish descriptions and should not be construed as indicating or implying relative importance.

[0029] In a specific embodiment, in a first aspect, the present invention provides nested primer pairs for first-generation sequencing of gene CDS regions. The nested primer pairs include a forward nested primer and a reverse nested primer. The nucleotide sequence of the forward nested primer includes a first universal sequence sequentially connected from the 5' end to the 3' end and a random base sequence. The nucleotide sequence of the reverse nested primer includes a second universal sequence sequentially connected from the 5' end to the 3' end and a random base sequence. The nucleotide lengths of the first and second universal sequences are 55–80 bps, including but not limited to 55 bps, 60 bps, 65 bps, 70 bps, 75 bps, or 80 bps. The length of the random base sequence is 5–10 bps, including but not limited to 5 bps, 6 bps, 7 bps, 8 bps, 9 bps, or 10 bps.

[0030] It should be noted that, generally, the random base sequence refers to a sequence fragment in which the probability of each base appearing is 25%. This is reflected in the sequencing results, meaning that in the first-generation sequencing results corresponding to this sequence, all four bases are detected simultaneously, and their numbers tend to be equal. The function of this sequence is to distinguish between the universal sequence region and the target gene CDS sequence region. Therefore, for a specific target gene, any random base sequence whose length is sufficient to clearly distinguish between the universal sequence and the target gene CDS sequence region in the sequencing results can be used as the length of the random base sequence described in this invention. The random base sequence provided by this invention has a length of 5–10 bps, which, on the one hand, achieves sufficient distinguishability between the universal sequence and the target gene CDS sequence, and on the other hand, does not affect primer specificity binding.

[0031] In an optional embodiment, the first universal sequence and the second universal sequence have a nucleotide length of 60 bps, and the random base sequence has a length of 6 bps.

[0032] In an optional embodiment, the first universal sequence is shown as SEQ ID No. 1, and the second universal sequence is shown as SEQ ID No. 2.

[0033] Secondly, the present invention provides the application of the nested primer pairs described in any of the foregoing embodiments in the preparation of gene CDS region sequencing products.

[0034] It should be noted that, since the nested primer pairs provided by this invention do not have selectivity for the target gene being linked, they can be widely used to obtain the complete CDS region of various target genes, including eukaryotes, prokaryotes, and viruses.

[0035] Thirdly, the present invention provides sequencing primer pairs for first-generation sequencing of gene CDS regions, wherein the sequencing primer pairs include a forward sequencing primer and a reverse sequencing primer, each with a length of 18-30 bps, wherein the nucleotide sequence of the forward sequencing primer is the same as or complementary to the nucleotide fragment at the 5' end of the first universal sequence in any of the foregoing embodiments; and the nucleotide sequence of the reverse sequencing primer is the same as or complementary to the nucleotide fragment at the 5' end of the second universal sequence in any of the foregoing embodiments.

[0036] It should be noted that the sequencing primer pairs described above need to have low homology with the full sequence of the target gene to ensure that the sequencing primer pairs specifically target the nested primer pairs rather than bind to the target gene sequence. When the nested primer sequences and the source of the target gene are determined, those skilled in the art can optimize and adjust the sequencing primer pairs according to actual needs.

[0037] In an optional embodiment, the specific nucleotide sequence of the forward sequencing primer is shown in SEQ ID No. 3; and the specific nucleotide sequence of the reverse sequencing primer is shown in SEQ ID No. 4.

[0038] Fourthly, the present invention provides universal sequencing reagents for first-generation sequencing of gene CDS regions, the sequencing reagents comprising the nested primer pairs and sequencing primer pairs described in any of the foregoing embodiments.

[0039] Fifthly, the present invention provides a universal sequencing kit for first-generation sequencing of gene CDS regions, the kit comprising the universal sequencing reagents and optional consumables described in the foregoing embodiments.

[0040] It is understood that those skilled in the art can routinely select the optional consumables according to actual needs, such as reaction vessels, pipetting devices, multi-well plates, or reagent strips.

[0041] Sixthly, the present invention provides the application of the universal sequencing reagent or universal sequencing kit described in the foregoing embodiments in the sequencing of the CDS region of the target gene.

[0042] In an optional embodiment, the target gene includes the HA gene, NA gene, PB1 gene, PB2 gene, NP gene, MP gene, PA gene, or NS gene of influenza virus.

[0043] It is understood that the present invention achieves complete speed measurement of the CDS region of the target gene by using nested primer pairs. In addition to obtaining the complete and effective CDS region, in some embodiments, the non-coding region (UTR) sequence adjacent to the CDS region may also be detected simultaneously. Typically, the length of the detected UTR sequence is 0 to 60 bps.

[0044] The following detailed description of some embodiments of the present invention is provided in conjunction with the accompanying drawings. Unless otherwise specified, the following embodiments and features can be combined with each other.

[0045] Example 1

[0046] Taking the HA gene of influenza B as an example

[0047] Experimental steps:

[0048] Step 1: RNA Nucleic Acid Extraction

[0049] ①The influenza B virus standard was obtained from the China National Institutes for Food and Drug Control.

[0050] ②The nucleic acid extraction and purification kit of Berger Medical was used to extract and purify the β-flurRNA; the experimental steps were the same as those in the kit instructions.

[0051] Step 2 PCR: Targeted Enrichment

[0052] ① Take 5 μL of qualified nucleic acid sample (Ct≤30) and transfer it to a new 200 μL PCR tube; the standard is from the China National Institutes for Food and Drug Control.

[0053] ② Prepare the first round PCR Mix according to the following system (this step uses the standard RT-PCR system Vazyme). IIIOne-Step RT-PCR System with Taq High Fidelity):

[0054]

[0055] ③ Vortex to mix, briefly centrifuge, and run the PCR instrument as follows:

[0056]

[0057] After the reaction, the target product was subjected to electrophoretic quality inspection, and the size of the product bands was recorded. The results are as follows: Figure 1 As shown, T1 represents the amplification result of the forward nested primers, and T2 represents the amplification result of the reverse nested primers.

[0058] Step 3: Sequencing

[0059] Sequencing was performed using an ABI 3730XL sequencing platform in bidirectional sequencing mode. The nucleotide sequences of the forward and reverse sequencing primers are shown in SEQ ID No. 3 and SEQ ID No. 4, respectively. The forward sequencing results are shown in SEQ ID No. 5, and the reverse sequencing results are shown in SEQ ID No. 6.

[0060] Data Analysis:

[0061] The ABI format data from the sequencing process was analyzed using Seqmen software to examine the peak patterns and sequencing quality. The analysis results for the ABI format data are as follows: Figure 2 and Figure 3 As shown.

[0062] A peak signal containing ATCG bases for 6 consecutive bp indicates a bridging sequence of nested primers; a peak signal preceding ATCG bases for 6 consecutive bp indicates a common sequence signal of nested primers; and a peak signal following ATCG bases for 6 consecutive bp indicates a specific target fragment sequence. Figure 1 and Figure 2 It can be seen that the 5' and 3' sequence peaks of the HA gene are free of miscellaneous peaks, indicating high sequencing quality.

[0063] The primer information for nested primer pairs and sequencing primer pairs, along with the sequencing results, are as follows:

[0064]

[0065]

[0066] Step 4: blast results

[0067] The target gene sequence for BLAST alignment was obtained by removing the non-target sequence containing nested primers using Seqmen software. The forward sequence after removal is shown in SEQ ID No. 7.

[0068] AGCAGAAGCGGAGCATTTTCTAATATCCACAAAATGAAGGCAATAATTGTACTACTCATGGTAGTAACATCCAATGCAGATCGAATCTGCACTGGGATAACATCGTCAAACTCACCACATGTCGTCAAAACTGCTACTCAAGGGGAGGTCAACGTGACCGGTGTAATACCACTGACAACAACACCCACCAAATCTCATTTTGCAAATCTCAAAGGAACAGAAACCAGGGGGAAACTATGCCCAAAATGCCTCAACTGCACAGATCTGGATGTAGCCTTGGGCAGACCAAAATGCACAGGGAAAATACCCTCTGCAAGGGTTTCAATACTCCATGAAGTCAGACCTGTTACATCTGGGTGCTTTCCTATAATGCACGATAGAACAAAAATTAGACAGCTGCCTAACCTTCTCCGAGGATACGAACATGTCAGGTTATCAACTCACAACGTTATCAATGCAGAAGATGCACCAGGAAGACCCTACGAAATTGGAACCTCAGGGTCTTGCCCTAACATTACCAATGGAAACGGATTCTTCGCAACAATGGCTTGGGCCGTCCCAAAAAACAAAACAGCAACAAATCCATTAACAATAGAAGTACCATACATTTGTACAGAAGGAGAAGACCAAATTACCGTTTGGGGGTTCCACTCTGACAACGAGACCCAAATGGCAAAGCTCTATGGGGACTCAAAGCCCCAGAAGTTCACCTCATCTGCCAACGGAGTGACCACACATTACGTTTCACAGATTGGTGGCTTCCCAAATCAAACAGAAGACGGAGGACTACCACAAAGTGGCAGATTGTTGTTGATTACATGGTGCAGAATCTGGAAAACAGGAACAATTACCTATCAAAGAGGTATTTTATTGCCTCAAAGGTGTGGTGCGCAAGTGGCAGGAGCAAGGT。

[0069] The reverse sequence is shown in SEQ ID No.8:

[0070] AGTAGTAACAAGAGCATTTTTCAATAACGTTTCTTTGTAATGACAACAAGCAAACAAGCACTACAATAAAGGAAAATACAGGGCTTAACTTTCCCTATAGACAAATAGAGCAAGAAACATTGTCTCTGGAGACCATATAAACAACAAAGATAGCTATCATCAGTGTTACAGCCAAACTGGAGGCAGCAGTTGAGTAGTAAAGCAGTATAGTATGATTGTCCAATCCGTCGTCATTTAAAGATGCAGCAGTAATATTCAGTGAATCAAAGGTGGGGAGAGAAAATTCTCCTGCATCAAAGGTACCAGCAGCTATTCTGTCGAGACAGGTCTGGTTGCACTTGTGTTTGGTTTCAAAGCATCCATTCCCTATCTCTACAGCAGAGGGGCCCAGCATTTTCTTCAGCTTTCTTTCAAGCGCCAAGAGATGTTCATCTTCACTGTTTATTATTCCTTCATTGGAAAGCAGGACTGCGAGTTCTATTTGTGAGCTTATTGTATCAGCTCTGAGATCATCCACTTTCTCATCTAGTTCTAGTATTTCGTTGTGGAGTTCATCCATGGCACCGCTTAGTCTTTGAAGATTCTTTACTTCCAGCTCACTCAAAGAGTTGAGATTTTTTGTTATCTTGTTTATGGCCTCTTGAGTGCTCTTAAGGTCAGCTGCCACCGCTACTCCATGTGCCCCATGGGATGTGTATCCGTGCCAACCTGCAATCATTCCTTCCCATCCTCCCTCTAAGAACCAGCAATGGCTCCGAAGAAACCTCTTTCCTTTAATAGTTTTGCAGGGGTCTATATTTGGTTCCATTGGCCAGTTTCAAGGGTGTTTTCACCCATATTGGGCAATTTCCTATGG。

[0071] The blast results of the forward sequence and the reverse sequence are shown respectively as Figure 4 and Figure 5 shown, and the blast result of the amplified product is the HA gene fragment of influenza B.

[0072] Comparative Example 1

[0073] Taking the HA gene of influenza B as an example

[0074] Experimental steps:

[0075] Step 1: RNA Nucleic Acid Extraction

[0076] The nucleic acid extraction method is the same as in Example 1.

[0077] Step 2 PCR: Targeted Enrichment

[0078] The enrichment method is the same as in Example 1, and the amplification primers are the specific amplification primers in Example 1 without the nested primers of this invention.

[0079] The specific amplification primer information is as follows:

[0080]

[0081]

[0082] Step 3: Sequencing

[0083] Same as Example 1.

[0084] Step 4: blast results

[0085] The target gene sequence for BLAST alignment was obtained by removing the low-quality sequence using Seqmen software. The forward sequence after removal is shown in SEQ ID No. 11.

[0086] ACATCCAATGCAGATCGAATCTGCACTGGGATAACATCGTCAAACTCACCACATGTCGTCAAAACTGCTACTCAAGGGGAGGTCAACGTGACCGGTGTAATACCACTGACAACAACACCCACCAAATCTCATTTTGCAAATCTCAAAGGAACAGAAACCAGGGGGAAACTATGCCCAAAATGCCTCAACTGCACAGATCTGGATGTAGCCTTGGGCAGACCAAAATGCACAGGGAAAATACCCTCTGCAAGGGTTTCAATACTCCATGAAGTCAGACCTGTTACATCTGGGTGCTTTCCTATAATGCACGATAGAACAAAAATTAGACAGCTGCCTAACCTTCTCCGAGGATACGAACATGTCAGGTTATCAACTCACAACGTTATCAATGCAGAAGATGCACCAGGAAGACCCTACGAAATTGGAACCTCAGGGTCTTGCCCTAACATTACCAATGGAAACGGATTCTTCGCAACAATGGCTTGGGCCGTCCCAAAAAACAAAACAGCAACAAATCCATTAACAATAGAAGTACCATACATTTGTACAGAAGGAGAAGACCAAATTACCGTTTGGGGGTTCCACTCTGACAACGAGACCCAAATGGCAAAGCTCTATGGGGACTCAAAGCCCCAGAAGTTCACCTCATCTGCCAACGGAGTGACCACACATTACGTTTCACAGATTGGTGGCTTCCCAAATCAAACAGAAGACGGAGGACTACCACAAAGTGGCAGATTGTTGTTGATTACATGGTGCAGAATCTGGAAAACAGGAACAATTACCTATCAAAGAGGTATTTTATTGCCTCAAAGGTGTGGTGCGCAAGTGGCAGGAGCAAGGT。

[0087] The reverse sequence after removing low-quality sequences is shown in SEQ ID No. 12:

[0088] CAATAAAGGAAAATACAGGGCTTAACTTTCCCTATAGACAAATAGAGCAAGAAACATTGTCTCTGGAGACCATATAAACAACAAAGATAGCTATCATCAGTGTTACAGCCAAACTGGAGGCAGCAGTTGAGTAGTAAAGCAGTATAGTATGATTGTCCAATCCGTCGTCATTTAAAGATGCAGCAGTAATATTCAGTGAATCAAAGGTGGGGAGAGAAAATTCTCCTGCATCAAAGGTACCAGCAGCTATTCTGTCGAGACAGGTCTGGTTGCACTTGTGTTTGGTTTCAAAGCATCCATTCCCTATCTCTACAGCAGAGGGGCCCAGCATTTTCTTCAGCTTTCTTTCAAGCGCCAAGAGATGTTCATCTTCACTGTTTATTATTCCTTCATTGGAAAGCAGGACTGCGAGTTCTATTTGTGAGCTTATTGTATCAGCTCTGAGATCATCCACTTTCTCATCTAGTTCTAGTATTTCGTTGTGGAGTTCATCCATGGCACCGCTTAGTCTTTGAAGATTCTTTACTTCCAGCTCACTCAAAGAGTTGAGATTTTTTGTTATCTTGTTTATGGCCTCTTGAGTGCTCTTAAGGTCAGCTGCCACCGCTACTCCATGTGCCCCATGGGATGTGTATCCGTGCCAACCTGCAATCATTCCTTCCCATCCTCCCTCTAAGAACCAGCAATGGCTCCGAAGAAACCTCTTTCCTTTAATAGTTTTGCAGGGGTCTATATTTGGTTCCATTGGCCAGTTTCAAGGGTGTTTTCACCCATATTGGGCAATTTCCTATGG。

[0089] Step 4: Comparison of the sequencing results between Example 1 and Comparative Example 1

[0090] The complete CDS nucleotide sequences of the influenza B virus HA gene were downloaded from the NCBI website (https: / / www.ncbi.nlm.nih.gov / ) as reference sequences (MT499494.1, MT466627.1, MT423263.1, MT423017.1, MT343731.1). The sequences from Example 1, Comparative Example 1, and the reference sequences were aligned using Mega7 software (MUSCLE). Figure 6 This is the result of forward sequencing sequence alignment. Figure 7 The results are reverse sequencing sequence alignment results (Note: HA_1 is the nucleotide sequence of the sequencing result of Example 1, and HA_2 is the nucleotide sequence of the sequencing result of Comparative Example 1).

[0091] In summary, the sequencing results of this invention are the nucleotide sequence of the influenza B virus HA gene. According to the alignment results of the same comparison example 1, the sequencing results of this invention are the complete CDS nucleotide sequence of the influenza B virus HA gene.

[0092] Statistical table of genome coverage for gene sequence deletions and splicing results with and without nested primers:

[0093]

[0094] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention. SEQUENCE LISTING <110> Shanghai Berger Medical Technology Co., Ltd. <120> Nested primer pairs, sequencing primer pairs, sequencing reagents, and sequencing reagents for first-generation sequencing of gene CDS regions. Dosage box and application <160> 12 <170> PatentIn version 3.5 <210> 1 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> first universal sequence <400> 1 aactgactaa actaggtgcc acgtcgtgaa agtctgacaa gtcgtgaaag tctgacaacc 60 ggccct 66 <210> 2 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> Second General Sequence <400> 2 tagactcctg atcccttcat tgccctgcat ctgacacgca ccctgcatct gacacgcact 60 agctat 66 <210> 3 <211> twenty two <212> DNA <213> Artificial Sequence <220> <223> Forward sequencing primers <400> 3 ctgactaaac taggtgccac gt 22 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse sequencing primers <400> 4 tagactcctg atcccttcat 20 <210> 5 <211> 947 <212> DNA <213> HA gene of influenza B <220> <221> misc_feature <222> (32) (37) <223> n is a, c, g, or t <400> 5 ctgcaactcg tgttgtctag acaccggccc tnnnnnnagc agaagcggag cattttctaa 120. tatccacaaa atgaaggcaa tattgtact actcatggta gtaacatcca atgcagatcg 180. aatctgcact gggataacat cgtcaaactc accacatgtc gtcaaaactg ctactcaagg 240. ggaggtcaac gtgaccggtg taataccact gacacaaca cccaccaaat ctcattttgc aatctcaaa ggacagaa ccaggggga actatgccca aaatgcctca actgcacaga tctggatgta gccttgggca gaccaaaatg cacaggggaa ataccctctg caagggtttc aatactccat gaagtcagac ctgttacatc tgggtgcttt cctataatgc acgatagaac aaaaattaga cagctgccta accttctccg aggatacga catgtcaggt tatcaactca caacgttatc aatgcagaag atgcaccagg aagaccctac cctcagggtc ttgccctaac attackg gaaacggatt cttcgcaaca atggcttggg ccgtcccaaa aaacaaaaca gcaacaaatc cattaacaat agaagtacca tacatttgta cagaaggaga agccaaatt accgtttggg ggttccactc tgacaacgag acccaaatgg caaagctcta tggggactca aagccccaga agttcacctc atctgccaac ggagtgacca cacattacgt 780 ttcacagatt ggtggcttcc caaatcaaac agaagacgga ggactaccac aaagtggcag 840 attgttgttg attacatggt gcagaatctg gaaaacagga acaattacct atcaaagagg 900 tattttattg cctcaaaggt gtggtgcgca agtggcagga gcaaggt 947 <210> 6 <211> 897 <212> DNA <213> HA gene of influenza B <220> <221> misc_feature <222> (36)..(41) <223> n is a, c, g, or t <400> 6 tgaacggcac cctgcatctg acacgcacta gctatnnnnn nagtagtaac aagagcattt 60 ttcaataacg tttctttgta atgacaacaa gcaaacaagc actacaataa aggaaaatac 120 agggcttaac tttccctata gacaaataga gcaagaaaca ttgtctctgg agaccatata 18� aacaacaaag atagctatca tcagtgttac agccaaactg gaggcagcag ttgagtagta 240 aagcagtata gtatgattgt ccaatccgtc gtcatttaaa gatgcagcag taatattcag 300 tgaatcaaag gtggggagag aaaattctcc tgcatcaaag gtaccagcag ctattctgtc 360 gagacaggtc tggttgcact tgtgtttggt ttcaaagcat ccattcccta tctctacagc 420 agaggggccc agcattttct tcagctttct ttcaagcgcc aagagatgtt catcttcact 480 gtttattatt ccttcattgg aaagcaggac tgcgagttct atttgtgagc ttattgtatc 540 agctctgaga tcatccactt tctcatctag ttctagtatt tcgttgtgga gttcatccat 600 ggcaccgctt agtctttgaa gattctttac ttccagctca ctcaaagagt tgagattttt 660 tgttatcttg tttatggcct cttgagtgct cttaaggtca gctgccaccg ctactccatg 720 tgccccatgg gatgtgtatc cgtgccaacc tgcaatcatt ccttcccatc ctccctctaa 780 gaaccagcaa tggctccgaa gaaacctctt tcctttaata gttttgcagg ggtctatatt 840 tggttccatt ggccagtttc aagggtgttt tcacccatat tgggcaattt cctatgg 897 <210> 7 <211> 910 <21​​​​​​ gtagtaacat ccaatgcaga tcgaatctgc actgggataa catcgtcaaa ctcaccacat 120 gtcgtcaaaa ctgctactca aggggaggtc aacgtgaccg gtgtaatacc actgacaaca 180 acacccacca aatctcattt tgcaaatctc aaaggaacag aaaccagggg gaaactatgc 240 ccaaaatgcc tcaactgcac agatctggat gtagccttgg gcagaccaaa atgcacaggg 300 aaaataccct ctgcaagggt ttcaatactc catgaagtca gacctgttac atctgggtgc 360 tttcctataa tgcacgatag aacaaaaatt agacagctgc ctaaccttct ccgaggatac 420 gaacatgtca ggtatcaac tcacaacgtt atcaatgcag aagatgcacc aggaagacccc 480 tacgaaattg gaacctcagg gtcttgccct aacattacca atggaaacgg attcttcgca 540 acaatggctt gggccgtccc aaaaaacaaa acagcaacaa atccattaac atagaagta 600 ccatacattt gtacagaagg agaagaccaa attaccgttt gggggttcca ctctgacaac 660 gagacccaaa tggcaaagct ctatggggac tcaaagcccc agaagttcac ctcatctgcc 720 aacggagtga ccacacatta cgtttcacag attggtggct tcccaaatca aacagaagac 780 ggaggactac cacaaagtgg cagattgttg ttgattacat ggtgcagaat ctggaaaaca 840 ggaacaatta cctatcaaag aggtatttta ttgcctcaaa ggtgtggtgc gcaagtggca 900 ggagcaaggt 910 <210> 8 <211> 856 <212> DNA <213> HA gene of influenza B <400> 8 agtagtaaca agagcatttt tcaataacgt ttctttgtaa tgacaacaag caaacaagca 60 ctacaataaa ggaaaataca gggcttaact ttccctatag acaaatagag caagaaacat 120 tgtctctgga gaccatataa acaacaaaga tagctatcat cagtgttaca gccaaactgg 180 aggcagcagt tgagtagtaa agcagtatag tatgattgtc caatccgtcg tcatttaaag 240 atgcagcagt aatattcagt gaatcaaagg tggggagaga aaattctcct gcatcaaagg 300 taccagcagc tattctgtcg agacaggtct ggttgcactt gtgtttggtt tcaaagcatc 360 cattccctat ctctacagca gaggggccca gcattttctt cagctttctt tcaagcgcca 420 agagatgttc atcttcactg tttattattc cttcattgga aagcaggact gcgagttcta 480 tttgtgagct tattgtatca gctctgagat catccacttt ctcatctagt tctagtattt 540 cgttgtggag ttcatccatg gcaccgctta gtctttgaag attctttact tccagctcac 600 tcaaagagtt gagatttttt gttatcttgt ttatggcctc ttgagtgctc ttaaggtcag 660 ctgccaccgc tactccatgt gccccatggg atgtgtatcc gtgccaacct gcaatcattc 720 cttcccatcc tccctctaag aaccagcaat ggctccgaag aaacctcttt cctttaatag 780 ttttgcaggg gtctatattt ggttccattg gccagtttca agggtgtttt cacccatatt 840 gggcaatttc ctatgg 856 <210> 9 <211> 14 <212> DNA <213> Artificial Sequence <220> <223> Comparative Example 1 Forward Amplification Primers <400> 9 agcagaagcr kwgc 14 <210> 10 <211> twenty two <212> DNA <213> Artificial Sequence <220> <223> Comparative Example 1 Reverse Amplification Primers <400> 10 agtagtaaca agagcatttt tc 22 <210> 11 <211> 844 <212> DNA <213> HA gene of influenza B <400> 11 acatccaatg cagatcgaat ctgcactggg ataacatcgt caaactcacc acatgtcgtc 60 aaaactgcta ctcaagggga ggtcaacgtg accggtgtaa taccactgac aacaacaccc 120 accaaatctc attttgcaaa tctcaaagga acagaaacca gggggaaact atgcccaaaa 180 tgcctcaact gcacagatct ggatgtagcc ttgggcagac caaaatgcac agggaaaata 240 ccctctgcaa gggtttcaat actccatgaa gtcagacctg ttacatctgg gtgctttcct 300 ataatgcacg atagaacaaa aattagacag ctgcctaacc ttctccgagg atacgaacat 360 gtcaggttat caactcacaa cgttatcaat gcagaagatg caccaggaag accctacgaa 420 attggaacct cagggtcttg ccctaacatt accaatggaa acggattctt cgcaacaatg 480 gcttgggccg tcccaaaaaa caaaacagca acaaatccat taacaataga agtaccatac 540 atttgtacag aaggagaaga ccaaattacc gtttgggggt tccactctga caacgagacc 600 caaatggcaa agctctatgg ggactcaaag ccccagaagt tcacctcatc tgccaacgga 660 gtgaccacac attacgtttc acagattggt ggcttcccaa atcaaacaga acagacgagga 720 ctaccacaaa gtggcagatt gttgttgatt acatggtgca gaatctgga aacaggaaca attacctatc aaagaggtat tttattgcct caaaggtgtg gtgcgcaagt ggcaggagca 840 aggt 844 <210> 12 <211> 793 <212> DNA <213> Their snowflakes HA inside <400> 12 60. ctaaagga aaatacaggg cttaactttc cctatagaca aatagagcaaaacattgt ctctggagac catataaaca acaaagatag ctatcatcag tgttacagcc aaactggagg cagcagttga gtagtaaagc agtagtat gattgtccaa tccgtcgtca tttaaagatg cagcagtaat attcagtgaa tcaaaggtgg ggagagaaaa ttctcctgca tcaaaggtac cagcagctat tctgtcgaga caggtctggt tgcacttgtg tttggtttca aagcatccat tccctatctc tacagcagag gggcccagca ttttcttcag ttttctttca agcgccaga 360 gatgttcatc ttcactgttt attattcctt cattggaag caggactgcg agttctattt 420 gtgagcttat tgtatcagct ctgagatcat cactttctc atctagttct agtatttcgt 480 tgtggagttc atccatggca ccgcttagtc tttgaagatt cttacttcc agctcactca 540 aagagttgag atttttgtt atcttgttta tggcctcttg agtgctctta aggtcagctg 600 ccaccgctac tccatgtgcc ccatgggatg tgtatccgtg ccaacctgca atcattcctt 660 cccatcctcc ctctaagaac cagcaatggc tccgaagaaa cctctttcct ttaatagttt 720 tgcaggggtc tatatttggt tccattggcc agtttcaagg gtgttttcac ccatattggg 780 caatttccta tgg 793

Claims

1. Nested primer pairs for first-generation sequencing of gene CDS regions, characterized in that, The nested primer pair includes a forward nested primer and a reverse nested primer. The nucleotide sequence of the forward nested primer includes a first universal sequence and a random base sequence sequentially connected from the 5' end to the 3' end. The nucleotide sequence of the reverse nested primer includes a second universal sequence and a random base sequence sequentially connected from the 5' end to the 3' end. The nucleotide lengths of the first universal sequence and the second universal sequence are 55~80 bps, and the length of the random base sequence is 5~10 bps.

2. The nested primer pair according to claim 1, characterized in that, The first universal sequence and the second universal sequence have a nucleotide length of 60 bps, and the random base sequence has a length of 6 bps.

3. The nested primer pair according to claim 2, characterized in that, The first general sequence is shown in SEQ ID No. 1, and the second general sequence is shown in SEQ ID No.

2.

4. The use of the nested primer pairs according to any one of claims 1 to 3 in the preparation of gene CDS region sequencing products.

5. A sequencing primer pair for first-generation sequencing of gene CDS regions, characterized in that, The sequencing primer pair includes a forward sequencing primer and a reverse sequencing primer, both with a length of 18-30 bps. The nucleotide sequence of the forward sequencing primer is the same as or complementary to the nucleotide fragment at the 5' end of the first universal sequence of any one of claims 1-3. The nucleotide sequence of the reverse sequencing primer is the same as or complementary to the nucleotide fragment at the 5' end of the second universal sequence of any one of claims 1-3.

6. The sequencing primer pair according to claim 5, characterized in that, The specific nucleotide sequence of the forward sequencing primer is shown in SEQ ID No. 3; the specific nucleotide sequence of the reverse sequencing primer is shown in SEQ ID No.

4.

7. A universal sequencing reagent for first-generation sequencing of gene CDS regions, characterized in that, The sequencing reagent includes the nested primer pairs as described in any one of claims 1 to 3 and the sequencing primer pairs as described in claim 5 or 6.

8. A universal sequencing kit for first-generation sequencing of gene CDS regions, characterized in that, The kit includes the universal sequencing reagents and optional consumables as described in claim 7.

9. The application of the universal sequencing reagent of claim 7 or the universal sequencing kit of claim 8 in the sequencing of the CDS region of the target gene.

Citation Information

Patent Citations

  • Method for detecting trace fungi by utilizing single-cell sequencing

    CN109680050A

  • Nucleotide sequence, and method for constructing RNA target area sequencing library and application thereof

    WO2020191521A1