SNP markers associated with dietary domestication in largemouth bass and their application

Abstract

The present invention discloses a SNP marker associated with feeding habit acclimation in largemouth bass and its application. The SNP marker is shown in SEQ ID NO. 1, wherein R at position 448 is base A or base G. Primers, a kit, and a detection method for detecting the SNP marker are also provided. The molecular marker can serve as a reliable marker for feeding acclimation in largemouth bass, facilitating early selection, thereby increasing the success rate of feeding acclimation, improving breeding efficiency and accuracy, and being used for rapid screening of easily acclimated largemouth bass. This provides a theoretical basis for breeding new varieties of easily acclimated artificial feeds for largemouth bass.

Description

Technical Field

[0001] The invention belongs to the field of molecular biotechnology, and particularly relates to SNP markers related to feeding traits of largemouth bass and applications thereof. Background Art

[0002] Largemouth Bass ( Micropterus salmoides ) is a ferocious carnivorous fish native to North America. It has the advantages of no intramuscular spines, delicious meat, rapid growth, and a short breeding cycle. After breeding promotion, it has now become an important freshwater aquaculture economic fish in my country. According to the Fisheries Statistical Yearbook, the total output of largemouth black bass in my country in 2020 was 619,500 tons. With the cultivation of the new variety "Youyu No. 3" that is easy for largemouth black bass to eat compound feed and the gradual maturity of compound feed, largemouth black bass can now eat compound feed throughout the whole process. However, in the early stage of domestication (from biological baits such as copepods to artificial compound feed) of compound feed, some individuals refused to eat compound feed, resulting in a low domestication success rate. How to improve the success rate of largemouth black bass in the feeding process is a key issue that the industry urgently needs to solve.

[0003] With the rapid development of molecular biotechnology, molecular marker-assisted breeding (MAB) is expected to be an important approach to improving the success rate of feeding acclimation and cultivating high-quality largemouth bass. MAB uses molecular markers that are closely linked or co-segregated with the target gene to screen for the target gene, making it unaffected by environmental conditions, increasing the reliability of selection, and improving breeding efficiency. Single nucleotide polymorphism (SNP) markers refer to DNA sequence polymorphisms caused by changes in a single nucleotide at the genomic level. They are widely used due to their large number, high density, and high genetic stability. By associating these genetic markers with feeding traits, selective breeding can be carried out at the DNA level, effectively avoiding human influence and improving the accuracy of selective breeding. It can also identify individuals with superior traits at an early stage, screen for superior backup parents, and improve the success rate of feeding acclimation. Summary of the Invention

[0004] The purpose of the present invention is to provide a SNP marker related to the feeding trait of largemouth bass and its application. The molecular marker can be used as a reliable marker for the feeding trait of largemouth bass, facilitating early selection, thereby improving the success rate of feeding selection and improving breeding efficiency and accuracy.

[0005] The technical solution adopted by the present invention is:

[0006] In a first aspect of the present invention, a SNP marker related to the feeding habit acclimation of largemouth bass is provided. The SNP marker is shown in SEQ ID NO. 1, wherein the 448th R is base A or base G.

[0007] The second aspect of the present invention provides the use of the SNP marker described in the first aspect of the present invention in identifying or screening largemouth bass that are easily tamed.

[0008] The third aspect of the present invention provides a primer for detecting the SNP marker described in the first aspect of the present invention.

[0009] In some embodiments of the present invention, the primers include SEQ ID NO.2 sequence and SEQ ID NO.3 sequence.

[0010] A fourth aspect of the present invention provides a kit comprising a reagent for detecting the SNP marker described in the first aspect of the present invention.

[0011] In some embodiments of the present invention, the kit comprises the primers described in the third aspect of the present invention.

[0012] The fourth aspect of the present invention provides the use of the primers described in the third aspect of the present invention or the kit described in the fourth aspect of the present invention in identifying or screening largemouth bass that are easily tamed.

[0013] The fifth aspect of the present invention provides a method for identifying or screening largemouth bass that are easily tamed, detecting the SNP marker described in the first aspect of the present invention, and selecting largemouth bass with an AA genotype at the 448th SNP site of the SEQ ID NO.1 sequence as an easily tamed largemouth bass.

[0014] In some embodiments of the present invention, largemouth bass DNA is extracted, and the largemouth bass DNA is amplified using primers of SEQ ID NO.2 and SEQ NO.3 to obtain PCR products. The PCR products are sequenced and analyzed, and largemouth bass with an AA genotype at the 448th SNP site of the SEQ ID NO.1 sequence are selected as easily tamed largemouth bass.

[0015] In some embodiments of the present invention, the obtained PCR product is further extended and amplified using an extension primer; the sequence of the extension primer is shown in SEQ ID NO.4.

[0016] The beneficial effects of the present invention are:

[0017] The present invention analyzes the RDH12 gene sequence obtained by sequencing, screens the SNP site of the gene, types the individuals of largemouth bass that are easy to tame and those that are difficult to tame, and performs association analysis with the tame traits of largemouth bass, thereby obtaining a SNP site related to the tame feeding habits of largemouth bass. The SNP marker is shown in SEQ ID NO.1, wherein the 448th R is base A or base G. Primers, a kit and a detection method for detecting the SNP marker are provided. The SNP marker can be used to quickly screen largemouth bass that are easy to tame, and provide a theoretical basis for breeding new varieties of artificial compound feeds that are easy to tame for largemouth bass. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is the genotype detection diagram of the chr15-A+8322808G marker. DETAILED DESCRIPTION

[0019] The following will clearly and completely describe the concept and technical effects of the present invention in conjunction with the embodiments to fully understand the purpose, features and effects of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0020] Example 1 Acquisition of SNP markers associated with diet domestication of largemouth bass

[0021] The present study found that the RDH12 gene sequence of largemouth bass is shown in SEQ ID NO: 1, wherein there is an A / G type SNP site at 448 bp, and there are three genotypes: AA, GG, and AG.

[0022]

[0023] Based on transcriptome sequencing data, an A / G SNP was identified at position 448 in the RDH12 gene. The caudal fins of 30 largemouth bass were clipped from a newly selected feeding population to verify the SNP.

[0024] 1. Cut the tail fin of the test fish to extract genomic DNA

[0025] Using alcohol-disinfected scissors, cut the caudal fins of largemouth bass (Black bass) approximately 0.5 × 0.5 cm in size and place in anhydrous ethanol for storage at room temperature. Fin ray genomic DNA was extracted using a marine animal tissue genomic DNA extraction kit (Tiangen). Genomic DNA quality was assessed by electrophoresis on a 1.0% agarose gel, and concentration was determined using an ultraviolet spectrophotometer (Eppendorf, AG2231). The DNA was stored at -20°C until use.

[0026] 2. The PCR amplification reaction system is:

[0027]

[0028] The PCR amplification reaction program was as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 30 s, for 35 cycles; and extension at 72°C for 10 min.

[0029] F1: ACTGTATTATCATCTAACCACAA(SEQ ID NO.2);

[0030] R1: GCAATTCAAGCGGTAATCA (SEQ ID NO. 3).

[0031] ACTGTATTATCATCTAACCACAA (SEQ ID NO. 2) and GCAATTCAAGCGGTAATCA (SEQ ID NO. 3) are the upstream and downstream primers for amplifying the SNP site.

[0032] 3. Results

[0033] The PCR products were detected by 1.0% agarose gel electrophoresis and then sent to Guangzhou Aiki Biotechnology Co., Ltd. for sequencing. The SNP sites and their peak graphs of the sequencing results were statistically analyzed. An A / G type SNP site was found in the sequencing sequence, and there were three genotypes: AA, GG, and AG.

[0034] Example 2 Association analysis between SNP markers and feeding traits of largemouth bass

[0035] 1. Primer sequence

[0036] According to the partial genomic sequence of the largemouth bass RDH12 gene shown in SEQ ID NO: 1, a SNaPshot extension primer was designed: 5'-CTGACTGACTTGATGTATTTTAATGCTGTAGG-3' (SEQ ID NO. 4).

[0037] 2. Cut the tail fin of the test fish to extract genomic DNA

[0038] Using alcohol-disinfected scissors, we excised a portion of the caudal fin of a largemouth bass (approximately 0.5 × 0.5 cm) and placed it in anhydrous ethanol for storage at room temperature. Fin ray genomic DNA was extracted using a marine animal tissue genomic DNA extraction kit (Tiangen). Genomic DNA quality was assessed by electrophoresis on a 1.0% agarose gel, and concentration was determined using an ultraviolet spectrophotometer (Eppendorf, AG2231). The DNA was then stored at -20°C until use.

[0039] 3. Multiplex PCR amplification

[0040] 1) Dissolve the synthesized primers in 1×TE to 10 pmol, add the primers from one group to the primers, mix well, and centrifuge.

[0041] The primary PCR system is as follows:

[0042]

[0043]

[0044] The ratio of F1 to R1 is 1:1.

[0045] The above-configured PCR master tubes were divided into 96-well PCR plates, centrifuged, and 2 μl of DNA sample was added to each well and centrifuged.

[0046] The PCR amplification reaction program was as follows: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 15 s, annealing at 58°C for 15 s, and extension at 72°C for 30 s, 35 cycles; and extension at 72°C for 3 min.

[0047] 2) PCR product purification

[0048] After PCR amplification, 3 μl of PCR product was purified using ExoI and FastAP. ExoI is mainly used to remove excess primers in the reaction product, and FastAP is mainly used to remove excess dNTPs in the reaction product. The system is as follows:

[0049]

[0050] The reaction conditions are: 37°C for 15 min, 80°C for 15 min. After purification, the extension reaction is carried out and the extension primers are pre-mixed.

[0051] 3) Extension reaction

[0052] The extension reaction system is as follows:

[0053]

[0054] The reaction conditions are:

[0055]

[0056] 4) Take 1 μl of extension primer, add 10 μl of loading sample, denature at 95°C for 3 min, immediately place in an ice-water bath, and load onto the sequencer.

[0057] On the sequencer, the size of the extension product and the color of the peak are detected ( Figure 1 ), determine that the SNP site at the 448th base of the genomic sequence SEQ ID NO: 1 of the RDH12 gene of the test sample is AA, GG or AG.

[0058] The allele and genotype frequencies of the SNP loci in 240 largemouth bass were detected, and the test results are shown in Table 1.

[0059] Table 1 Frequency distribution of SNPs in largemouth bass RDH12 in random populations

[0060]

[0061] SPSS 22.0 chi-square tests were used to analyze the association between different SNP genotypes and feeding traits of largemouth bass. Acclimation success was determined by the fry's acceptance of the formulated feed. Fry with full bellies half an hour after feeding were defined as readily acclimated (abdominal contents per body weight of 18% to 24%), while those with less acclimated bellies were considered less acclimated (abdominal contents per body weight of 8% to 12%). The results of the association analysis between this locus and feeding traits of largemouth bass are shown in Table 2.

[0062] Table 2 Association analysis between SNPs and feeding traits in RDH12 of largemouth bass

[0063]

[0064] The above data show that the SNP locus of the RDH12 gene of largemouth bass is significantly associated with feeding tameness. Among them, the AA genotype is the dominant genotype of largemouth bass that is easy to tame.

[0065] In summary, the AG-type SNP loci of the RDH12 gene are closely associated with the dietary domestication of largemouth bass.

[0066] The above specific embodiments provide a detailed description of the present invention. However, the present invention is not limited to the above embodiments. Various modifications may be made within the scope of knowledge possessed by a person skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof may be combined with each other unless there is a conflict. SEQUENCE LISTING <110> Pearl River Fisheries Research Institute, Chinese Academy of Fishery Sciences <120> SNP markers associated with dietary domestication in largemouth bass and their application <130> <160> 4 <170> PatentIn version 3.5 <210> 1 <211> 1080 <212> DNA <213> Largemouth Bass <400> 1 cccctgcctt tgtagcccca cagggcagaa gtgaggagac agcaaagaga ctgtgggacg 60 tcagctgtga gcttcttggt attgagtggg actgattcaa cttttaacca ccatctatca 120 cttctccaag gagtccttat tctttccgtt gtcattcatt tcattatggt ttttgatgtt 180 ctgtacgttg aacgtttcct acctaataag cagtcaggta atactgtaag gggtactata 240 atgtgaagtt gctttttttc tgtaataatg cagtaattcc attatattaa cttgagtatt 300 ttggtgctct acaacagctc ctcaaaccaa aaccactcaa ctgtattatc atctaaccac 360 aaataactttttgactctat atttttgtga cacaatgtga atacagtgta ggcaaaaaag 420 caacttgatg tattttaatg ctgtaggrta ctgtgaaggg tcaagccagg gtaaatgacc 480 agcatcatta tcaaatattc tgttttttga tttctctaga atttgcagct agattgcttg 540 aattttgtgc cagcatttct aaacaattgc aggggttctt acggtgtttc caggttgata 600 aaaatgctag caaactatct actactagtc agtctgagcc atgattaccg cttgaattgc 660 ataaatgtat tttgtgataa ttgtagttga tatagattat aagaaggttt ttctatttta 720 accaaatcaa agaaagagtc atgtcattgc aatatttgca aagaattttc tttacatctg 780 cattaccaaa actgcacatt cctggaggaa ctgcagtttt gaatttatta ggatctccct 840 acttatgttt ccttctcagc attcacatgc aaggttgcca agagtttaca ttctgtgttt 900 tatacaagtg aaacatgcct tttactacac ttatattcat gttaagagtt gaatgtttac 960 atttgatgta aataaacaga aatattacta taaggatgga tgtttgtttc agtcctttga 1020 aattctagtt tgagatcatc aaaatgccat cagcaaagta cgaagtgggt tagtgcacaa 1080 <210> 2 <211> 23 <212> DNA <213> Artificial sequence <400> 2 actgtattat catctaacca caa 23 <210> 3 <211> 19 <212> DNA <213> Artificial sequence <400> 3 gcaattcaag cggtaatca 19 <210> 4 <211> 32 <212> DNA <213> Artificial sequence <400> 4 ctgactgact tgatgtattt taatgctgta gg 32

Claims

1. A SNP marker associated with the domestication of the diet of largemouth bass, characterized in that: The SNP marker is shown in SEQ ID NO. 1, wherein the 448th R is base A or base G.

2. Use of the SNP marker according to claim 1 in identifying or screening largemouth bass that are easily tamed.

3. A method for identifying or screening largemouth bass that are easily tamed, characterized in that: The SNP marker according to claim 1 is detected, and the largemouth bass having the genotype of the SNP site at position 448 of the SEQ ID NO.1 sequence as the easily tamed largemouth bass is selected.

4. The method according to claim 3, characterized in that Largemouth bass DNA was extracted and amplified using primers of SEQ ID NO.2 and SEQ ID NO.3 to obtain PCR products. The PCR products were sequenced and analyzed, and largemouth bass with an AA genotype at the 448th SNP site of SEQ ID NO.1 were selected as easily tamed largemouth bass.

5. The method according to claim 4, characterized in that The obtained PCR product is further extended and amplified using an extension primer; the sequence of the extension primer is shown in SEQ ID NO.4.

Images